An N-terminal fragment of yeast ribosomal protein L3 inhibits the cytotoxicity of pokeweed antiviral protein in Saccharomyces cerevisiae.

PubMed

Di, Rong; Tumer, Nilgun E

2014-04-11

We have previously shown that ribosomal protein L3 is required for pokeweed antiviral protein (PAP), a type I ribosome inactivating protein, to bind to ribosomes and depurinate the α-sarcin/ricin loop (SRL) in yeast. Co-expression of the N-terminal 99 amino acids of yeast L3 (L3Δ99) with PAP in transgenic tobacco plants completely abolished the toxicity of PAP. In this study, we investigated the interaction between PAP and L3Δ99 in Saccharomyces cerevisiae. Yeast cells co-transformed with PAP and L3Δ99 showed markedly reduced growth inhibition and reduced rRNA depurination by PAP, compared to cells transformed with PAP alone. Co-transformation of yeast with PAP and L3Δ21 corresponding to the highly conserved N-terminal 21 amino acids of L3Δ99, reduced the cytotoxicity of PAP. PAP mRNA and protein levels were elevated and L3Δ99 or L3Δ21 mRNA and protein levels were reduced in yeast co-transformed with PAP and L3Δ99 or with PAP and L3Δ21, respectively. PAP interacted with L3Δ21 in yeast cells in vivo and by Biacore analysis in vitro, suggesting that the interaction between L3Δ21 and PAP may inhibit PAP-mediated depurination of the SRL, leading to a reduction in the cytotoxicity of PAP.

A ribosome-dependent GTPase from yeast distinct from elongation factor 2.

PubMed Central

Skogerson, L; Wakatama, E

1976-01-01

Three proteins required for poly(U)-directed polyphenylalanine synthesis have been separated from yeast. Two of the factors correspond to the elongation factors 1 and 2 described for other eukaryotic systems, according to the criteria of phenylalanyl-tRNA binding and diphtheria toxin-catalyzed ADP-ribosylation. The third protein, while absolutely required for polyphenylalanine synthesis, was a more active ribosome-dependent GTPase than elongation factor 2. PMID:174100

TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p.

PubMed

Bodem, J; Dobreva, G; Hoffmann-Rohrer, U; Iben, S; Zentgraf, H; Delius, H; Vingron, M; Grummt, I

2000-08-01

Cells carefully modulate the rate of rRNA transcription in order to prevent an overinvestment in ribosome synthesis under less favorable nutritional conditions. In mammals, growth-dependent regulation of RNA polymerase I (Pol I) transcription is mediated by TIF-IA, an essential initiation factor that is active in extracts from growing but not starved or cycloheximide-treated mammalian cells. Here we report the molecular cloning and functional characterization of recombinant TIF-IA, which turns out to be the mammalian homolog of the yeast factor Rrn3p. We demonstrate that TIF-IA interacts with Pol I in the absence of template DNA, augments Pol I transcription in vivo and rescues transcription in extracts from growth-arrested cells in vitro.

Analysis of ribosomal RNA stability in dead cells of wine yeast by quantitative PCR.

PubMed

Sunyer-Figueres, Merce; Wang, Chunxiao; Mas, Albert

2018-04-02

During wine production, some yeasts enter a Viable But Not Culturable (VBNC) state, which may influence the quality and stability of the final wine through remnant metabolic activity or by resuscitation. Culture-independent techniques are used for obtaining an accurate estimation of the number of live cells, and quantitative PCR could be the most accurate technique. As a marker of cell viability, rRNA was evaluated by analyzing its stability in dead cells. The species-specific stability of rRNA was tested in Saccharomyces cerevisiae, as well as in three species of non-Saccharomyces yeast (Hanseniaspora uvarum, Torulaspora delbrueckii and Starmerella bacillaris). High temperature and antimicrobial dimethyl dicarbonate (DMDC) treatments were efficient in lysing the yeast cells. rRNA gene and rRNA (as cDNA) were analyzed over 48 h after cell lysis by quantitative PCR. The results confirmed the stability of rRNA for 48 h after the cell lysis treatments. To sum up, rRNA may not be a good marker of cell viability in the wine yeasts that were tested. Copyright © 2018 Elsevier B.V. All rights reserved.

Replication and meiotic transmission of yeast ribosomal RNA genes.

PubMed

Brewer, B J; Zakian, V A; Fangman, W L

1980-11-01

The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

PubMed

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

2013-02-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing

PubMed Central

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.

2013-01-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

PubMed

Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

2013-02-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p

PubMed Central

Bodem, Jochen; Dobreva, Gergana; Hoffmann-Rohrer, Urs; Iben, Sebastian; Zentgraf, Hanswalter; Delius, Hajo; Vingron, Martin; Grummt, Ingrid

2000-01-01

Cells carefully modulate the rate of rRNA transcription in order to prevent an overinvestment in ribosome synthesis under less favorable nutritional conditions. In mammals, growth-dependent regulation of RNA polymerase I (Pol I) transcription is mediated by TIF-IA, an essential initiation factor that is active in extracts from growing but not starved or cycloheximide-treated mammalian cells. Here we report the molecular cloning and functional characterization of recombinant TIF-IA, which turns out to be the mammalian homolog of the yeast factor Rrn3p. We demonstrate that TIF-IA interacts with Pol I in the absence of template DNA, augments Pol I transcription in vivo and rescues transcription in extracts from growth-arrested cells in vitro. PMID:11265758

Heavy ion action on yeast cells: Inhibition of ribosomal-RNA synthesis, loss of colony forming ability and induction of mutants

NASA Astrophysics Data System (ADS)

Kiefer, J.; Rase, S.; Schöpfer, F.; Schneider, E.; Weber, K.; Kraft, G.

The action of heavy ions (Ar to U) accelerated to specific energies up to about 10 MeV/u (u=atomic mass unit) on different functions of yeast cells was studied. Ribosomal-RNA synthesis is inhibited according to a single-hit mechanism. Inactivation cross-sections were linearly related to the ratio of the squares of the effective charge Z* and the velocity of the ions. It is concluded from the analysis that the range of the most energetic δ-electrons is larger than previously assumed. There is no such dependence for survival and induction of mutants. In both cases cross-sections increase with the ion's specific-energy indicating an important contribution of long-range δ-electrons. The analysis shows that diploid yeast is not killed by a single-hit mechanism even by very heavy ions if the track width is too small. The relative importance of the penumbral region is even more pronounced with the more sensitive strains.

Comparison of preribosomal RNA processing pathways in yeast, plant and human cells - focus on coordinated action of endo- and exoribonucleases.

PubMed

Tomecki, Rafal; Sikorski, Pawel J; Zakrzewska-Placzek, Monika

2017-07-01

Proper regulation of ribosome biosynthesis is mandatory for cellular adaptation, growth and proliferation. Ribosome biogenesis is the most energetically demanding cellular process, which requires tight control. Abnormalities in ribosome production have severe consequences, including developmental defects in plants and genetic diseases (ribosomopathies) in humans. One of the processes occurring during eukaryotic ribosome biogenesis is processing of the ribosomal RNA precursor molecule (pre-rRNA), synthesized by RNA polymerase I, into mature rRNAs. It must not only be accurate but must also be precisely coordinated with other phenomena leading to the synthesis of functional ribosomes: RNA modification, RNA folding, assembly with ribosomal proteins and nucleocytoplasmic RNP export. A multitude of ribosome biogenesis factors ensure that these events take place in a correct temporal order. Among them are endo- and exoribonucleases involved in pre-rRNA processing. Here, we thoroughly present a wide spectrum of ribonucleases participating in rRNA maturation, focusing on their biochemical properties, regulatory mechanisms and substrate specificity. We also discuss cooperation between various ribonucleolytic activities in particular stages of pre-rRNA processing, delineating major similarities and differences between three representative groups of eukaryotes: yeast, plants and humans. © 2017 Federation of European Biochemical Societies.

Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells

PubMed Central

Carlile, Thomas M.; Rojas-Duran, Maria F.; Zinshteyn, Boris; Shin, Hakyung; Bartoli, Kristen M.; Gilbert, Wendy V.

2014-01-01

Post-transcriptional modification of RNA nucleosides occurs in all living organisms. Pseudouridine, the most abundant modified nucleoside in non-coding RNAs1, enhances the function of transfer RNA and ribosomal RNA by stabilizing RNA structure2–8. mRNAs were not known to contain pseudouridine, but artificial pseudouridylation dramatically affects mRNA function – it changes the genetic code by facilitating non-canonical base pairing in the ribosome decoding center9,10. However, without evidence of naturally occurring mRNA pseudouridylation, its physiological was unclear. Here we present a comprehensive analysis of pseudouridylation in yeast and human RNAs using Pseudo-seq, a genome-wide, single-nucleotide-resolution method for pseudouridine identification. Pseudo-seq accurately identifies known modification sites as well as 100 novel sites in non-coding RNAs, and reveals hundreds of pseudouridylated sites in mRNAs. Genetic analysis allowed us to assign most of the new modification sites to one of seven conserved pseudouridine synthases, Pus1–4, 6, 7 and 9. Notably, the majority of pseudouridines in mRNA are regulated in response to environmental signals, such as nutrient deprivation in yeast and serum starvation in human cells. These results suggest a mechanism for the rapid and regulated rewiring of the genetic code through inducible mRNA modifications. Our findings reveal unanticipated roles for pseudouridylation and provide a resource for identifying the targets of pseudouridine synthases implicated in human disease11–13. PMID:25192136

RNA processing: pocket guides to ribosomal RNA.

PubMed

Peculis, B

1997-08-01

The functional role of a recently identified class of small nucleolar (sno) RNAs has been elucidated: the 'box H/ACA' snoRNAs act as guide RNAs, specifying the position of evolutionarily conserved pseudouridines in ribosomal (r)RNA via an rRNA-snoRNA base-pairing interaction that forms a 'pseudouridine pocket'.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains

PubMed Central

Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.

2013-01-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192

[Intranuclear distribution of rat liver ribosomal RNA].

PubMed

Dabeva, M D; Todorov, B N; Khadzhiolova, A A

1976-03-01

A method is described for the isolation of pure liver nuclei with minimal cytoplasmic contaminants, loss of nuclear RNA and degradation of nuclear RNA. The RNA components are extracted in three distinct fractions by subsequent treatment with phenol at 4 degrees, 50 degrees and 85 degrees C. The total and 14C-orotate labelled RNA components in the three nuclear RNA fractions are characterized by nucleotide composition, poly(A)-RNA content and agar-gel electrophoresis. The results show that the RNA in three fractions correspond to the nucleosol, nucleolus and chromatin compartments of the nucleus. The nuclear HnRNA components are exclusively in the 85 degrees C RNA. Nuclear ribosomal RNA is extracted in the 4 degrees C and 50 degrees C RNA fractions. These two nuclear RNA fractions are distinct in constituent pre-rRNA species and the rate of labelling of their rRNA components. The amount of the pre-rRNA and rRNA species is determined. The results show that the nucleolus-nucleosol and nucleosol-cytoplasm transitions of ribosomal subparticles are markedly slower processes than the preceeding steps of ribosome biogenesis.

An mRNA-Derived Noncoding RNA Targets and Regulates the Ribosome

PubMed Central

Pircher, Andreas; Bakowska-Zywicka, Kamilla; Schneider, Lukas; Zywicki, Marek; Polacek, Norbert

2014-01-01

Summary The structural and functional repertoire of small non-protein-coding RNAs (ncRNAs) is central for establishing gene regulation networks in cells and organisms. Here, we show that an mRNA-derived 18-nucleotide-long ncRNA is capable of downregulating translation in Saccharomyces cerevisiae by targeting the ribosome. This 18-mer ncRNA binds to polysomes upon salt stress and is crucial for efficient growth under hyperosmotic conditions. Although the 18-mer RNA originates from the TRM10 locus, which encodes a tRNA methyltransferase, genetic analyses revealed the 18-mer RNA nucleotide sequence, rather than the mRNA-encoded enzyme, as the translation regulator. Our data reveal the ribosome as a target for a small regulatory ncRNA and demonstrate the existence of a yet unkown mechanism of translation regulation. Ribosome-targeted small ncRNAs are found in all domains of life and represent a prevalent but so far largely unexplored class of regulatory molecules. PMID:24685157

tRNA-derived short RNAs bind to Saccharomyces cerevisiae ribosomes in a stress-dependent manner and inhibit protein synthesis in vitro

PubMed Central

Kasprzyk, Marta; Twardowski, Tomasz

2016-01-01

Recently, a number of ribosome-associated non-coding RNAs (rancRNAs) have been discovered in all three domains of life. In our previous studies, we have described several types of rancRNAs in Saccharomyces cerevisiae, derived from many cellular RNAs, including mRNAs, rRNAs, tRNAs and snoRNAs. Here, we present the evidence that the tRNA fragments from simple eukaryotic organism S. cerevisiae directly bind to the ribosomes. Interestingly, rancRNA-tRFs in yeast are derived from both, 5′- and 3′-part of the tRNAs and both types of tRFs associate with the ribosomes in vitro. The location of tRFs within the ribosomes is distinct from classical A- and P-tRNA binding sites. Moreover, 3′-tRFs bind to the distinct site than 5′-tRFs. These interactions are stress dependent and as a consequence, provoke regulation of protein biosynthesis. We observe strong correlation between tRF binding to the ribosomes and inhibition of protein biosynthesis in particular environmental conditions. These results implicate the existence of an ancient and conserved mechanism of translation regulation with the involvement of ribosome-associating tRNA-derived fragments. PMID:27609601

Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

PubMed Central

Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

2016-01-01

ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae.

PubMed

Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine; Belyi, Yury

2016-01-01

The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5' untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62-K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62-K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62-K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62-K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62-K70 segment of Rps26 and the 5' untranslated region of mRNA. The data suggested a specific role of the Y62-K70 motif during translation initiation. Here, we report that single-site substitutions

Deletion of L4 domains reveals insights into the importance of ribosomal protein extensions in eukaryotic ribosome assembly.

PubMed

Gamalinda, Michael; Woolford, John L

2014-11-01

Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.

PubMed

Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte

2018-06-27

All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

EPA Science Inventory

This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

PubMed

Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

2010-07-15

The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

PubMed

Rodnina, Marina V; Wintermeyer, Wolfgang

2011-04-01

Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

Evaluation of ribosomal RNA removal protocols for Salmonella RNA-Seq projects

USDA-ARS?s Scientific Manuscript database

Next generation sequencing is a powerful technology and its application to sequencing entire RNA populations of food-borne pathogens will provide valuable insights. A problem unique to prokaryotic RNA-Seq is the massive abundance of ribosomal RNA. Unlike eukaryotic messenger RNA (mRNA), bacterial ...

The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu

2006-08-04

Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase,more » whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone.« less

Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans

PubMed Central

Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

2016-01-01

Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

Interaction of tetracycline with RNA: photoincorporation into ribosomal RNA of Escherichia coli.

PubMed Central

Oehler, R; Polacek, N; Steiner, G; Barta, A

1997-01-01

Photolysis of [3H]tetracycline in the presence of Escherichia coli ribosomes results in an approximately 1:1 ratio of labelling ribosomal proteins and RNAs. In this work we characterize crosslinks to both 16S and 23S RNAs. Previously, the main target of photoincorporation of [3H]tetracycline into ribosomal proteins was shown to be S7, which is also part of the one strong binding site of tetracycline on the 30S subunit. The crosslinks on 23S RNA map exclusively to the central loop of domain V (G2505, G2576 and G2608) which is part of the peptidyl transferase region. However, experiments performed with chimeric ribosomal subunits demonstrate that peptidyltransferase activity is not affected by tetracycline crosslinked solely to the 50S subunits. Three different positions are labelled on the 16S RNA, G693, G1300 and G1338. The positions of these crosslinked nucleotides correlate well with footprints on the 16S RNA produced either by tRNA or the protein S7. This suggests that the nucleotides are labelled by tetracycline bound to the strong binding site on the 30S subunit. In addition, our results demonstrate that the well known inhibition of tRNA binding to the A-site is solely due to tetracycline crosslinked to 30S subunits and furthermore suggest that interactions of the antibiotic with 16S RNA might be involved in its mode of action. PMID:9092632

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription

PubMed Central

Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-01-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.

PubMed

Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-03-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.

Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

PubMed

Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

2007-04-01

During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

Ribosomal proteins L7 and L8 function in concert with six A3 assembly factors to propagate assembly of domains I and II of 25S rRNA in yeast 60S ribosomal subunits

PubMed Central

Jakovljevic, Jelena; Ohmayer, Uli; Gamalinda, Michael; Talkish, Jason; Alexander, Lisa; Linnemann, Jan; Milkereit, Philipp; Woolford, John L.

2012-01-01

Ribosome biogenesis is a complex multistep process that involves alternating steps of folding and processing of pre-rRNAs in concert with assembly of ribosomal proteins. Recently, there has been increased interest in the roles of ribosomal proteins in eukaryotic ribosome biogenesis in vivo, focusing primarily on their function in pre-rRNA processing. However, much less is known about participation of ribosomal proteins in the formation and rearrangement of preribosomal particles as they mature to functional subunits. We have studied ribosomal proteins L7 and L8, which are required for the same early steps in pre-rRNA processing during assembly of 60S subunits but are located in different domains within ribosomes. Depletion of either leads to defects in processing of 27SA3 to 27SB pre-rRNA and turnover of pre-rRNAs destined for large ribosomal subunits. A specific subset of proteins is diminished from these residual assembly intermediates: six assembly factors required for processing of 27SA3 pre-rRNA and four ribosomal proteins bound to domain I of 25S and 5.8S rRNAs surrounding the polypeptide exit tunnel. In addition, specific sets of ribosomal proteins are affected in each mutant: In the absence of L7, proteins bound to domain II, L6, L14, L20, and L33 are greatly diminished, while proteins L13, L15, and L36 that bind to domain I are affected in the absence of L8. Thus, L7 and L8 might establish RNP structures within assembling ribosomes necessary for the stable association and function of the A3 assembly factors and for proper assembly of the neighborhoods containing domains I and II. PMID:22893726

Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.

PubMed Central

Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M

1982-01-01

A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727

Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

NASA Astrophysics Data System (ADS)

Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

1986-08-01

The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.

PubMed

Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M

2018-06-01

Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.

Ribosome A and P sites revealed by length analysis of ribosome profiling data

PubMed Central

Martens, Andrew T.; Taylor, James; Hilser, Vincent J.

2015-01-01

The high-throughput sequencing of nuclease-protected mRNA fragments bound to ribosomes, a technique known as ribosome profiling, quantifies the relative frequencies with which different regions of transcripts are translated. This technique has revealed novel translation initiation sites with unprecedented scope and has furthered investigations into the connections between codon biases and translation rates. Yet the location of the codon being decoded in ribosome footprints is still unknown, and has been complicated by the recent observation of footprints with non-canonical lengths. Here we show how taking into account the variations in ribosome footprint lengths can reveal the ribosome aminoacyl (A) and peptidyl (P) site locations. These location assignments are in agreement with the proposed mechanisms for various ribosome pauses and further enhance the resolution of the profiling data. We also show that GC-rich motifs at the 5′ ends of footprints are found in yeast, calling into question the anti-Shine-Dalgarno effect's role in ribosome pausing. PMID:25805170

RNA and ribosomal protein patterns during aerial spore germination in Streptomyces granaticolor.

PubMed

Mikulík, K; Janda, I; Weiser, J; Stastná, J; Jiránová, A

1984-12-03

Disruption of the external sheath of Streptomyces granaticolor aerial spores and subsequent cultivation in a rich medium result in a synchronous germination. This method was used to analyze RNA and protein patterns during the germination. The germination process took place through a sequence of time-ordered events. RNA and protein synthesis started during the first 5 min and net DNA synthesis at 60-70 min of germination. Within the first 10 min of germination, synthesis of RNA was not sensitive to the inhibitory effect of rifamycin. During this period rRNA and other species including 4-5-S RNA were synthesized. Dormant spores contained populations of ribosomes or ribosomal precursors that were structurally and functionally defective. The ribosomal particles bound a sporulation pigment(s) of the melanine type. The ribosomal proteins complexed to the pigments formed insoluble aggregates which were easily removed from the ribosomes by one wash with 1 M NH4Cl. During the first 10 min of germination, pigment(s) were liberated from the complexes with the ribosomes and protein extracts of the washed ribosomes had essentially the same pattern as the extracts of ribosomes of vegetative cells. These structural alterations were accompanied by enhancement of the ribosome activities in polypeptide synthesis in vivo and in vitro. When the spores were incubated with a 14C-labelled amino acid mixture in the presence of rifamycin, only three proteins (GS1, GL1 and GS9) were identified to be radiolabelled in the extracts from the washed ribosomes. These experiments indicate that liberation of the sporulation pigment(s) from the complexes with ribosomal proteins and assembly of de novo synthesized proteins and proteins from a preexisting pool in the spore are involved in the reactivation of the ribosomes of dormant spores of S. granaticolor.

Pea chloroplast DNA encodes homologues of Escherichia coli ribosomal subunit S2 and the beta'-subunit of RNA polymerase.

PubMed Central

Cozens, A L; Walker, J E

1986-01-01

The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249

The ribosome uses two active mechanisms to unwind messenger RNA during translation.

PubMed

Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

2011-07-06

The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

Cis-regulatory RNA elements that regulate specialized ribosome activity.

PubMed

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

[Ribosomal RNA Evolution

NASA Technical Reports Server (NTRS)

1997-01-01

It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

Superresolution Imaging of Ribosomes and RNA Polymerase in Live Escherichia coli Cells

PubMed Central

Bakshi, Somenath; Siryaporn, Albert; Goulian, Mark; Weisshaar, James C.

2012-01-01

Summary Quantitative spatial distributions of ribosomes (S2-YFP) and RNA polymerase (β′-yGFP) in live E. coli are measured by superresolution fluorescence microscopy. In moderate growth conditions, Nucleoid-ribosome segregation is strong, and RNAP localizes to the nucleoid lobes. The mean copy numbers per cell are 4600 RNAPs and 55,000 ribosomes. Only 10–15% of the ribosomes lie within the densest part of the nucleoid lobes, and at most 4% of the RNAPs lie in the two ribosome-rich endcaps. The predominant observed diffusion coefficient of ribosomes is Dribo = 0.04 μm2/s, attributed to free mRNA being translated by one or more 70S ribosomes. We find no clear evidence of sub-diffusion, as would arise from tethering of ribosomes. The degree of DNA-ribosome segregation strongly suggests that in E. coli most translation occurs on free mRNA transcripts that have diffused into the ribosome-rich regions. Both RNAP and ribosome radial distributions extend to the cytoplasmic membrane, consistent with the transertion hypothesis. However, few if any RNAP copies lie near the membrane of the endcaps. This suggests that if transertion occurs, it exerts a direct radially expanding force on the nucleoid, but not a direct axially expanding force. PMID:22624875

Transcriptional mapping of the ribosomal RNA region of mouse L-cell mitochondrial DNA.

PubMed Central

Nagley, P; Clayton, D A

1980-01-01

The map positions in mouse mitochondrial DNA of the two ribosomal RNA genes and adjacent genes coding several small transcripts have been determined precisely by application of a procedure in which DNA-RNA hybrids have been subjected to digestion by S1 nuclease under conditions of varying severity. Digestion of the DNA-RNA hybrids with S1 nuclease yielded a series of species which were shown to contain ribosomal RNA molecules together with adjacent transcripts hybridized conjointly to a continuous segment of mitochondrial DNA. There is one small transcript about 60 bases long whose gene adjoins the sequences coding the 5'-end of the small ribosomal RNA (950 bases) and which lies approximately 200 nucleotides from the D-loop origin of heavy strand mitochondrial DNA synthesis. An 80-base transcript lies between the small and large ribosomal RNA genes, and genes for two further short transcript (each about 80 bases in length) abut the sequences coding the 3'-end of the large ribosomal RNA (approximately 1500 bases). The ability to isolate a discrete DNA-RNA hybrid species approximately 2700 base pairs in length containing all these transcripts suggests that there can be few nucleotides in this region of mouse mitochondrial DNA which are not represented as stable RNA species. Images PMID:6253898

A mass spectrometry-based method for comprehensive quantitative determination of post-transcriptional RNA modifications: the complete chemical structure of Schizosaccharomyces pombe ribosomal RNAs

PubMed Central

Taoka, Masato; Nobe, Yuko; Hori, Masayuki; Takeuchi, Aiko; Masaki, Shunpei; Yamauchi, Yoshio; Nakayama, Hiroshi; Takahashi, Nobuhiro; Isobe, Toshiaki

2015-01-01

We present a liquid chromatography–mass spectrometry (LC-MS)-based method for comprehensive quantitative identification of post-transcriptional modifications (PTMs) of RNA. We incorporated an in vitro-transcribed, heavy isotope-labeled reference RNA into a sample RNA solution, digested the mixture with a number of RNases and detected the post-transcriptionally modified oligonucleotides quantitatively based on shifts in retention time and the MS signal in subsequent LC-MS. This allowed the determination and quantitation of all PTMs in Schizosaccharomyces pombe ribosomal (r)RNAs and generated the first complete PTM maps of eukaryotic rRNAs at single-nucleotide resolution. There were 122 modified sites, most of which appear to locate at the interface of ribosomal subunits where translation takes place. We also identified PTMs at specific locations in rRNAs that were altered in response to growth conditions of yeast cells, suggesting that the cells coordinately regulate the modification levels of RNA. PMID:26013808

RNA interactome capture in yeast.

PubMed

Beckmann, Benedikt M

2017-04-15

RNA-binding proteins (RBPs) are key players in post-transcriptional regulation of gene expression in eukaryotic cells. To be able to unbiasedly identify RBPs in Saccharomyces cerevisiae, we developed a yeast RNA interactome capture protocol which employs RNA labeling, covalent UV crosslinking of RNA and proteins at 365nm wavelength (photoactivatable-ribonucleoside-enhanced crosslinking, PAR-CL) and finally purification of the protein-bound mRNA. The method can be easily implemented in common workflows and takes about 3days to complete. Next to a comprehensive explanation of the method, we focus on our findings about the choice of crosslinking in yeast and discuss the rationale of individual steps in the protocol. Copyright © 2016. Published by Elsevier Inc.

Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.

DTIC Science & Technology

1987-04-16

the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r

Proteomic analysis of rodent ribosomes revealed heterogeneity including ribosomal proteins L10-like, L22-like 1, and L39-like.

PubMed

Sugihara, Yoshihiko; Honda, Hiroki; Iida, Tomoharu; Morinaga, Takuma; Hino, Shingo; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita

2010-03-05

Heterogeneity of ribosome structure, due to variations in ribosomal protein composition, has been shown to be of physiological significance in plants and yeast. Mammalian genomics have demonstrated numerous genes that are paralogous to genes encoding ribosomal proteins. Although the vast majority are considered to be pseudogenes, mRNA expression of a few paralogues, such as human ribosomal protein L39-like/L39-2, has been reported. In the present study, ribosomes from the liver, mammary gland, and testis of rodents were analyzed using a combination of two-dimensional gel electrophoresis under radical-free and highly reducing conditions, and mass spectrometry. This system allowed identification of 78 ribosomal proteins and Rack1 from a single gel. The degree of heterogeneity was far less than that reported for plant and yeast ribosomes, and was in accord with published biochemical and genetic data for mammalian ribosomes. Nevertheless, an uncharacterized paralogue of ribosomal protein L22, ribosomal protein L22-like 1, was identified as a minor ribosomal component. Ribosomal proteins L10-like and L39-like, paralogues of ribosomal proteins L10 and L39, respectively, were found in ribosomes only from the testis. Reverse transcription-polymerase chain reaction yielded supportive evidence for specific expression of L10-like and L39-like in the testis. Newly synthesized L39-like is likely to be transported to the nucleolus, where ribosome biosynthesis occurs, and then incorporated into translating ribosomes in the cytoplasm. Heterogeneity of mammalian testicular ribosomes is structurally non-negligible, and may offer valuable insights into the function of the customized ribosome.

Identification of novel proteins associated with yeast snR30 small nucleolar RNA

PubMed Central

Lemay, Vincent; Hossain, Ahmed; Osheim, Yvonne N.; Beyer, Ann L.; Dragon, François

2011-01-01

H/ACA small nucleolar RNPs (snoRNPs) that guide pseudouridylation reactions are comprised of one small nucleolar RNA (snoRNA) and four common proteins (Cbf5, Gar1, Nhp2 and Nop10). Unlike other H/ACA snoRNPs, snR30 is essential for the early processing reactions that lead to the production of 18S ribosomal RNA in the yeast Saccharomyces cerevisiae. To determine whether snR30 RNP contains specific proteins that contribute to its unique functional properties, we devised an affinity purification strategy using TAP-tagged Gar1 and an RNA aptamer inserted in snR30 snoRNA to selectively purify the RNP. Northern blotting and pCp labeling experiments showed that S1-tagged snR30 snoRNA can be selectively purified with streptavidin beads. Protein analysis revealed that aptamer-tagged snR30 RNA was associated with the four H/ACA proteins and a number of additional proteins: Nop6, ribosomal proteins S9 and S18 and histones H2B and H4. Using antibodies raised against Nop6 we show that endogenous Nop6 localizes to the nucleolus and that it cosediments with snR30 snoRNA in sucrose density gradients. We demonstrate through primer extension experiments that snR30 snoRNA is required for cleavages at site A0, A1 and A2, and that the absence of Nop6 decreases the efficiency of cleavage at site A2. Finally, electron microscopy analyses of chromatin spreads from cells depleted of snR30 snoRNA show that it is required for SSU processome assembly. PMID:21893585

Methylation of yeast ribosomal protein Rpl3 promotes translational elongation fidelity.

PubMed

Al-Hadid, Qais; Roy, Kevin; Chanfreau, Guillaume; Clarke, Steven G

2016-04-01

Rpl3, a highly conserved ribosomal protein, is methylated at histidine 243 by the Hpm1 methyltransferase in Saccharomyces cerevisiae. Histidine 243 lies close to the peptidyl transferase center in a functionally important region of Rpl3 designated as the basic thumb that coordinates the decoding, peptidyl transfer, and translocation steps of translation elongation. Hpm1 was recently implicated in ribosome biogenesis and translation. However, the biological role of methylation of its Rpl3 substrate has not been identified. Here we interrogate the role of Rpl3 methylation at H243 by investigating the functional impact of mutating this histidine residue to alanine (rpl3-H243A). Akin to Hpm1-deficient cells, rpl3-H243A cells accumulate 35S and 23S pre-rRNA precursors to a similar extent, confirming an important role for histidine methylation in pre-rRNA processing. In contrast, Hpm1-deficient cells but not rpl3-H243A mutants show perturbed levels of ribosomal subunits. We show that Hpm1 has multiple substrates in different subcellular fractions, suggesting that methylation of proteins other than Rpl3 may be important for controlling ribosomal subunit levels. Finally, translational fidelity assays demonstrate that like Hpm1-deficient cells, rpl3-H243A mutants have defects in translation elongation resulting in decreased translational accuracy. These data suggest that Rpl3 methylation at H243 is playing a significant role in translation elongation, likely via the basic thumb, but has little impact on ribosomal subunit levels. Hpm1 is therefore a multifunctional methyltransferase with independent roles in ribosome biogenesis and translation. © 2016 Al-Hadid et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

The ribosome-associated complex antagonizes prion formation in yeast.

PubMed

Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

2015-01-01

The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

PubMed

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

Interrelations between translation and general mRNA degradation in yeast.

PubMed

Huch, Susanne; Nissan, Tracy

2014-01-01

Messenger RNA (mRNA) degradation is an important element of gene expression that can be modulated by alterations in translation, such as reductions in initiation or elongation rates. Reducing translation initiation strongly affects mRNA degradation by driving mRNA toward the assembly of a decapping complex, leading to decapping. While mRNA stability decreases as a consequence of translational inhibition, in apparent contradiction several external stresses both inhibit translation initiation and stabilize mRNA. A key difference in these processes is that stresses induce multiple responses, one of which stabilizes mRNAs at the initial and rate-limiting step of general mRNA decay. Because this increase in mRNA stability is directly induced by stress, it is independent of the translational effects of stress, which provide the cell with an opportunity to assess its response to changing environmental conditions. After assessment, the cell can store mRNAs, reinitiate their translation or, alternatively, embark on a program of enhanced mRNA decay en masse. Finally, recent results suggest that mRNA decay is not limited to non-translating messages and can occur when ribosomes are not initiating but are still elongating on mRNA. This review will discuss the models for the mechanisms of these processes and recent developments in understanding the relationship between translation and general mRNA degradation, with a focus on yeast as a model system. © 2014 The Authors. WIREs RNA published by John Wiley & Sons, Ltd.

Cyclin-dependent Kinase 9 Links RNA Polymerase II Transcription to Processing of Ribosomal RNA*

PubMed Central

Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

2013-01-01

Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3′ extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3′ processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3′ rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing. PMID:23744076

Global Identification of New Substrates for the Yeast Endoribonuclease, RNase Mitochondrial RNA Processing (MRP)*

PubMed Central

Aulds, Jason; Wierzbicki, Sara; McNairn, Adrian; Schmitt, Mark E.

2012-01-01

RNase mitochondrial RNA processing (MRP) is an essential, evolutionarily conserved endoribonuclease composed of 10 different protein subunits and a single RNA. RNase MRP has established roles in multiple pathways including ribosome biogenesis, cell cycle regulation, and mitochondrial DNA replication. Although each of these functions is important to cell growth, additional functions may exist given the essential nature of the complex. To identify novel RNase MRP substrates, we utilized RNA immunoprecipitation and microarray chip analysis to identify RNA that physically associates with RNase MRP. We identified several new potential substrates for RNase MRP including a cell cycle-regulated transcript, CTS1; the yeast homolog of the mammalian p27Kip1, SIC1; and the U2 RNA component of the spliceosome. In addition, we found RNase MRP to be involved in the regulation of the Ty1 transposon RNA. These results reinforce and broaden the role of RNase MRP in cell cycle regulation and help to identify new roles of this endoribonuclease. PMID:22977255

Global identification of new substrates for the yeast endoribonuclease, RNase mitochondrial RNA processing (MRP).

PubMed

Aulds, Jason; Wierzbicki, Sara; McNairn, Adrian; Schmitt, Mark E

2012-10-26

RNase mitochondrial RNA processing (MRP) is an essential, evolutionarily conserved endoribonuclease composed of 10 different protein subunits and a single RNA. RNase MRP has established roles in multiple pathways including ribosome biogenesis, cell cycle regulation, and mitochondrial DNA replication. Although each of these functions is important to cell growth, additional functions may exist given the essential nature of the complex. To identify novel RNase MRP substrates, we utilized RNA immunoprecipitation and microarray chip analysis to identify RNA that physically associates with RNase MRP. We identified several new potential substrates for RNase MRP including a cell cycle-regulated transcript, CTS1; the yeast homolog of the mammalian p27(Kip1), SIC1; and the U2 RNA component of the spliceosome. In addition, we found RNase MRP to be involved in the regulation of the Ty1 transposon RNA. These results reinforce and broaden the role of RNase MRP in cell cycle regulation and help to identify new roles of this endoribonuclease.

Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome

PubMed Central

Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.

2014-01-01

SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919

Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis.

PubMed

Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M

2018-06-20

In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Oxidative stress damages rRNA inside the ribosome and differentially affects the catalytic center

PubMed Central

Willi, Jessica; Küpfer, Pascal; Evéquoz, Damien; Fernandez, Guillermo; Polacek, Norbert

2018-01-01

Abstract Intracellular levels of reactive oxygen species (ROS) increase as a consequence of oxidative stress and represent a major source of damage to biomolecules. Due to its high cellular abundance RNA is more frequently the target for oxidative damage than DNA. Nevertheless the functional consequences of damage on stable RNA are poorly understood. Using a genome-wide approach, based on 8-oxo-guanosine immunoprecipitation, we present evidence that the most abundant non-coding RNA in a cell, the ribosomal RNA (rRNA), is target for oxidative nucleobase damage by ROS. Subjecting ribosomes to oxidative stress, we demonstrate that oxidized 23S rRNA inhibits the ribosome during protein biosynthesis. Placing single oxidized nucleobases at specific position within the ribosome's catalytic center by atomic mutagenesis resulted in markedly different functional outcomes. While some active site nucleobases tolerated oxidative damage well, oxidation at others had detrimental effects on protein synthesis by inhibiting different sub-steps of the ribosomal elongation cycle. Our data provide molecular insight into the biological consequences of RNA oxidation in one of the most central cellular enzymes and reveal mechanistic insight on the role of individual active site nucleobases during translation. PMID:29309687

Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

NASA Technical Reports Server (NTRS)

Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

1987-01-01

A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

Steric interactions lead to collective tilting motion in the ribosome during mRNA-tRNA translocation

NASA Astrophysics Data System (ADS)

Nguyen, Kien; Whitford, Paul C.

2016-02-01

Translocation of mRNA and tRNA through the ribosome is associated with large-scale rearrangements of the head domain in the 30S ribosomal subunit. To elucidate the relationship between 30S head dynamics and mRNA-tRNA displacement, we apply molecular dynamics simulations using an all-atom structure-based model. Here we provide a statistical analysis of 250 spontaneous transitions between the A/P-P/E and P/P-E/E ensembles. Consistent with structural studies, the ribosome samples a chimeric ap/P-pe/E intermediate, where the 30S head is rotated ~18°. It then transiently populates a previously unreported intermediate ensemble, which is characterized by a ~10° tilt of the head. To identify the origins of head tilting, we analyse 781 additional simulations in which specific steric features are perturbed. These calculations show that head tilting may be attributed to specific steric interactions between tRNA and the 30S subunit (PE loop and protein S13). Taken together, this study demonstrates how molecular structure can give rise to large-scale collective rearrangements.

Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.

PubMed

Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R

2017-01-01

Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.

A model for the study of ligand binding to the ribosomal RNA helix h44

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dibrov, Sergey M.; Parsons, Jerod; Hermann, Thomas

2010-09-02

Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand-RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structuralmore » model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.« less

Ribosomal DNA stability is supported by many 'buffer genes'-introduction to the Yeast rDNA Stability Database.

PubMed

Kobayashi, Takehiko; Sasaki, Mariko

2017-01-01

The ribosomal RNA gene (rDNA) is the most abundant gene in yeast and other eukaryotic organisms. Due to its heavy transcription, repetitive structure and programmed replication fork pauses, the rDNA is one of the most unstable regions in the genome. Thus, the rDNA is the best region to study the mechanisms responsible for maintaining genome integrity. Recently, we screened a library of ∼4800 budding yeast gene knockout strains to identify mutants defective in the maintenance of rDNA stability. The results of this screen are summarized in the Yeast rDNA Stability (YRS) Database, in which the stability and copy number of rDNA in each mutant are presented. From this screen, we identified ∼700 genes that may contribute to the maintenance of rDNA stability. In addition, ∼50 mutants had abnormally high or low rDNA copy numbers. Moreover, some mutants with unstable rDNA displayed abnormalities in another chromosome. In this review, we introduce the YRS Database and discuss the roles of newly identified genes that contribute to rDNA maintenance and genome integrity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A GTPase reaction accompanying the rejection of Leu-tRNA2 by UUU-programmed ribosomes. Proofreading of the codon-anticodon interaction by ribosomes.

PubMed

Thompson, R C; Dix, D B; Gerson, R B; Karim, A M

1981-01-10

The characteristics of a GTPase reaction between poly(U)-programmed ribosomes, EFTu . GTP, and the near-cognate aminoacyl (aa)-tRNA, Leu-tRNA Leu 2, have been studied to assess the role of this reaction in proofreading of the codon-anticodon interaction. The reaction resembles the GTPase reaction with cognate aa-tRNAs and EFTu . GTP in its substrate requirements, in its involving EFTu . GTP . aa-tRNA ternary complexes, and in its requiring a free ribosomal A-site. The noncognate reaction differs from the cognate one in that aa-tRNA becomes stably bound to the ribosomes only 5% of the time; it therefore seems best characterized as an abortive enzymatic binding reaction. The rate of reaction is a significant fraction (4%) of that of the cognate aa-tRNA, indicating that recognition of ternary complexes by ribosomes involves a level of error greater than that of translation as a whole. The rejection of the noncognate aa-tRNA following GTP hydrolysis is therefore a vital step in the translation process and fulfills the criteria set for a proofreading reaction. Leu-tRNA Leu 2 which escapes rejection through proofreading, forms a stable complex with the ribosomal A-site, so it appears that the Leu-tRNA2 which was rejected never reached the A-site and that proofreading precedes full A-site binding.

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

Independent suppression of ribosomal +1 frameshifts by different tRNA anticodon loop modifications.

PubMed

Klassen, Roland; Bruch, Alexander; Schaffrath, Raffael

2017-09-02

Recently, a role for the anticodon wobble uridine modification 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U) has been revealed in the suppression of translational +1 frameshifts in Saccharomyces cerevisiae. Loss of either the mcm 5 U or s 2 U parts of the modification elevated +1 frameshift rates and results obtained with reporters involving a tRNA Lys UUU dependent frameshift site suggested these effects are caused by reduced ribosomal A-site binding of the hypomodified tRNA. Combined loss of mcm 5 U and s 2 U leads to increased ribosome pausing at tRNA Lys UUU dependent codons and synergistic growth defects but effects on +1 frameshift rates remained undefined to this end. We show in here that simultaneous removal of mcm 5 U and s 2 U results in synergistically increased +1 frameshift rates that are suppressible by extra copies of tRNA Lys UUU . Thus, two distinct chemical modifications of the same wobble base independently contribute to reading frame maintenance, loss of which may cause or contribute to observed growth defects. Since the thiolation pathway is sensitive to moderately elevated temperatures in yeast, we observe a heat-induced increase of +1 frameshift rates in wild type cells that depends on the sulfur transfer protein Urm1. Furthermore, we find that temperature-induced frameshifting is kept in check by the dehydration of N6-threonylcarbamoyladenosine (t 6 A) to its cyclic derivative (ct 6 A) at the anticodon adjacent position 37. Since loss of ct 6 A in elp3 or urm1 mutant cells is detrimental for temperature stress resistance we assume that conversion of t 6 A to ct 6 A serves to limit deleterious effects on translational fidelity caused by hypomodified states of wobble uridine bases.

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

PubMed

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

PubMed

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

Role of messenger RNA-ribosome complex in complementary DNA display.

PubMed

Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

2013-07-15

In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

PubMed Central

Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

2016-01-01

Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

Interrelations between translation and general mRNA degradation in yeast

PubMed Central

Huch, Susanne; Nissan, Tracy

2014-01-01

Messenger RNA (mRNA) degradation is an important element of gene expression that can be modulated by alterations in translation, such as reductions in initiation or elongation rates. Reducing translation initiation strongly affects mRNA degradation by driving mRNA toward the assembly of a decapping complex, leading to decapping. While mRNA stability decreases as a consequence of translational inhibition, in apparent contradiction several external stresses both inhibit translation initiation and stabilize mRNA. A key difference in these processes is that stresses induce multiple responses, one of which stabilizes mRNAs at the initial and rate-limiting step of general mRNA decay. Because this increase in mRNA stability is directly induced by stress, it is independent of the translational effects of stress, which provide the cell with an opportunity to assess its response to changing environmental conditions. After assessment, the cell can store mRNAs, reinitiate their translation or, alternatively, embark on a program of enhanced mRNA decay en masse. Finally, recent results suggest that mRNA decay is not limited to non-translating messages and can occur when ribosomes are not initiating but are still elongating on mRNA. This review will discuss the models for the mechanisms of these processes and recent developments in understanding the relationship between translation and general mRNA degradation, with a focus on yeast as a model system. How to cite this article: WIREs RNA 2014, 5:747–763. doi: 10.1002/wrna.1244 PMID:24944158

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

PubMed

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

PubMed Central

Xie, Ping

2015-01-01

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel. PMID:26473825

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

PubMed

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Rrp5p, Noc1p and Noc2p form a protein module which is part of early large ribosomal subunit precursors in S. cerevisiae

PubMed Central

Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert

2013-01-01

Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026

Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

NASA Astrophysics Data System (ADS)

Cho, Samuel

DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

Mechanisms for ribotoxin-induced ribosomal RNA cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren

The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA

Principles of mRNA transport in yeast.

PubMed

Heym, Roland Gerhard; Niessing, Dierk

2012-06-01

mRNA localization and localized translation is a common mechanism by which cellular asymmetry is achieved. In higher eukaryotes the mRNA transport machinery is required for such diverse processes as stem cell division and neuronal plasticity. Because mRNA localization in metazoans is highly complex, studies at the molecular level have proven to be cumbersome. However, active mRNA transport has also been reported in fungi including Saccharomyces cerevisiae, Ustilago maydis and Candida albicans, in which these events are less difficult to study. Amongst them, budding yeast S. cerevisiae has yielded mechanistic insights that exceed our understanding of other mRNA localization events to date. In contrast to most reviews, we refrain here from summarizing mRNA localization events from different organisms. Instead we give an in-depth account of ASH1 mRNA localization in budding yeast. This approach is particularly suited to providing a more holistic view of the interconnection between the individual steps of mRNA localization, from transcriptional events to cytoplasmic mRNA transport and localized translation. Because of our advanced mechanistic understanding of mRNA localization in yeast, the present review may also be informative for scientists working, for example, on mRNA localization in embryogenesis or in neurons.

The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

PubMed Central

Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

2018-01-01

Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches

Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

PubMed

Fraser, Christopher S

2015-07-01

The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. Copyright © 2015 Elsevier B.V. and Société française de biochimie et biologie Moléculaire (SFBBM). All rights reserved.

Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

PubMed

Nikolaitchik, Olga A; Hu, Wei-Shau

2014-04-01

A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

Deciphering the Role of the Gag-Pol Ribosomal Frameshift Signal in HIV-1 RNA Genome Packaging

PubMed Central

Nikolaitchik, Olga A.

2014-01-01

ABSTRACT A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5′ untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. IMPORTANCE To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5′ end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important

Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

PubMed

West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

2014-07-01

The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

PubMed Central

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

2013-01-01

SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

PubMed

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae.

PubMed

Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

2018-05-18

The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

ERIC Educational Resources Information Center

Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

2004-01-01

Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

The role of tRNA and ribosome competition in coupling the expression of different mRNAs in Saccharomyces cerevisiae

PubMed Central

Chu, Dominique; Barnes, David J.; von der Haar, Tobias

2011-01-01

Protein synthesis translates information from messenger RNAs into functional proteomes. Because of the finite nature of the resources required by the translational machinery, both the overall protein synthesis activity of a cell and activity on individual mRNAs are controlled by the allocation of limiting resources. Upon introduction of heterologous sequences into an organism—for example for the purposes of bioprocessing or synthetic biology—limiting resources may also become overstretched, thus negatively affecting both endogenous and heterologous gene expression. In this study, we present a mean-field model of translation in Saccharomyces cerevisiae for the investigation of two particular translational resources, namely ribosomes and aminoacylated tRNAs. We firstly use comparisons of experiments with heterologous sequences and simulations of the same conditions to calibrate our model, and then analyse the behaviour of the translational system in yeast upon introduction of different types of heterologous sequences. Our main findings are that: competition for ribosomes, rather than tRNAs, limits global translation in this organism; that tRNA aminoacylation levels exert, at most, weak control over translational activity; and that decoding speeds and codon adaptation exert strong control over local (mRNA specific) translation rates. PMID:21558172

Disseminated yeast (Order Saccharomycetales) infection in a Muscovy duckling (Cairina moschata)

PubMed Central

Ravi, Madhu; Hill, Janet E.; Fernando, Champika; Wobeser, Gary

2016-01-01

A Muscovy duckling was presented for necropsy due to ongoing mortalities on a farm. Microscopic examination revealed multisystemic inflammatory lesions with intralesional and intracytoplasmic yeast-like organisms. We identified these agents as yeast belonging to the Order Saccharomycetales based on sequence data obtained from the ribosomal RNA operon. PMID:27807382

Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish

USDA-ARS?s Scientific Manuscript database

RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...

Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

PubMed

Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

2009-01-01

Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits

PubMed Central

Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

2016-01-01

The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

NASA Astrophysics Data System (ADS)

Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

2015-06-01

The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

Beyond tRNA cleavage: novel essential function for yeast tRNA splicing endonuclease unrelated to tRNA processing

PubMed Central

Dhungel, Nripesh; Hopper, Anita K.

2012-01-01

Pre-tRNA splicing is an essential process in all eukaryotes. In yeast and vertebrates, the enzyme catalyzing intron removal from pre-tRNA is a heterotetrameric complex (splicing endonuclease [SEN] complex). Although the SEN complex is conserved, the subcellular location where pre-tRNA splicing occurs is not. In yeast, the SEN complex is located at the cytoplasmic surface of mitochondria, whereas in vertebrates, pre-tRNA splicing is nuclear. We engineered yeast to mimic the vertebrate cell biology and demonstrate that all three steps of pre-tRNA splicing, as well as tRNA nuclear export and aminoacylation, occur efficiently when the SEN complex is nuclear. However, nuclear pre-tRNA splicing fails to complement growth defects of cells with defective mitochondrial-located splicing, suggesting that the yeast SEN complex surprisingly serves a novel and essential function in the cytoplasm that is unrelated to tRNA splicing. The novel function requires all four SEN complex subunits and the catalytic core. A subset of pre-rRNAs accumulates when the SEN complex is restricted to the nucleus, indicating that the SEN complex moonlights in rRNA processing. Thus, findings suggest that selection for the subcellular distribution of the SEN complex may reside not in its canonical, but rather in a novel, activity. PMID:22391451

Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.

PubMed

Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V

2010-10-01

The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.

Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

PubMed Central

Lill, R; Robertson, J M; Wintermeyer, W

1989-01-01

A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome

PubMed Central

Melnikov, Sergey V.; Söll, Dieter; Steitz, Thomas A.

2016-01-01

Abstract Cisplatin is a widely prescribed anticancer drug, which triggers cell death by covalent binding to a broad range of biological molecules. Among cisplatin targets, cellular RNAs remain the most poorly characterized molecules. Although cisplatin was shown to inactivate essential RNAs, including ribosomal, spliceosomal and telomeric RNAs, cisplatin binding sites in most RNA molecules are unknown, and therefore it remains challenging to study how modifications of RNA by cisplatin contributes to its toxicity. Here we report a 2.6Å-resolution X-ray structure of cisplatin-modified 70S ribosome, which describes cisplatin binding to the ribosome and provides the first nearly atomic model of cisplatin–RNA complex. We observe nine cisplatin molecules bound to the ribosome and reveal consensus structural features of the cisplatin-binding sites. Two of the cisplatin molecules modify conserved functional centers of the ribosome—the mRNA-channel and the GTPase center. In the mRNA-channel, cisplatin intercalates between the ribosome and the messenger RNA, suggesting that the observed inhibition of protein synthesis by cisplatin is caused by impaired mRNA-translocation. Our structure provides an insight into RNA targeting and inhibition by cisplatin, which can help predict cisplatin-binding sites in other cellular RNAs and design studies to elucidate a link between RNA modifications by cisplatin and cisplatin toxicity. PMID:27079977

In vivo tmRNA protection by SmpB and pre-ribosome binding conformation in solution

PubMed Central

Ranaei-Siadat, Ehsan; Mérigoux, Cécile; Seijo, Bili; Ponchon, Luc; Saliou, Jean-Michel; Bernauer, Julie; Sanglier-Cianférani, Sarah; Dardel, Fréderic

2014-01-01

TmRNA is an abundant RNA in bacteria with tRNA and mRNA features. It is specialized in trans-translation, a translation rescuing system. We demonstrate that its partner protein SmpB binds the tRNA-like region (TLD) in vivo and chaperones the fold of the TLD-H2 region. We use an original approach combining the observation of tmRNA degradation pathways in a heterologous system, the analysis of the tmRNA digests by MS and NMR, and co-overproduction assays of tmRNA and SmpB. We study the conformation in solution of tmRNA alone or in complex with one SmpB before ribosome binding using SAXS. Our data show that Mg2+ drives compaction of the RNA structure and that, in the absence of Mg2+, SmpB has a similar effect albeit to a lesser extent. Our results show that tmRNA is intrinsically structured in solution with identical topology to that observed on complexes on ribosomes which should facilitate its subsequent recruitment by the 70S ribosome, free or preloaded with one SmpB molecule. PMID:25135523

Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

PubMed

Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

2004-01-01

Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.

PubMed

Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R

2010-09-02

Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae

PubMed Central

Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

2018-01-01

Abstract The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits. PMID:29788267

Piecemeal Buildup of the Genetic Code, Ribosomes, and Genomes from Primordial tRNA Building Blocks.

PubMed

Caetano-Anollés, Derek; Caetano-Anollés, Gustavo

2016-12-02

The origin of biomolecular machinery likely centered around an ancient and central molecule capable of interacting with emergent macromolecular complexity. tRNA is the oldest and most central nucleic acid molecule of the cell. Its co-evolutionary interactions with aminoacyl-tRNA synthetase protein enzymes define the specificities of the genetic code and those with the ribosome their accurate biosynthetic interpretation. Phylogenetic approaches that focus on molecular structure allow reconstruction of evolutionary timelines that describe the history of RNA and protein structural domains. Here we review phylogenomic analyses that reconstruct the early history of the synthetase enzymes and the ribosome, their interactions with RNA, and the inception of amino acid charging and codon specificities in tRNA that are responsible for the genetic code. We also trace the age of domains and tRNA onto ancient tRNA homologies that were recently identified in rRNA. Our findings reveal a timeline of recruitment of tRNA building blocks for the formation of a functional ribosome, which holds both the biocatalytic functions of protein biosynthesis and the ability to store genetic memory in primordial RNA genomic templates.

Piecemeal Buildup of the Genetic Code, Ribosomes, and Genomes from Primordial tRNA Building Blocks

PubMed Central

Caetano-Anollés, Derek; Caetano-Anollés, Gustavo

2016-01-01

The origin of biomolecular machinery likely centered around an ancient and central molecule capable of interacting with emergent macromolecular complexity. tRNA is the oldest and most central nucleic acid molecule of the cell. Its co-evolutionary interactions with aminoacyl-tRNA synthetase protein enzymes define the specificities of the genetic code and those with the ribosome their accurate biosynthetic interpretation. Phylogenetic approaches that focus on molecular structure allow reconstruction of evolutionary timelines that describe the history of RNA and protein structural domains. Here we review phylogenomic analyses that reconstruct the early history of the synthetase enzymes and the ribosome, their interactions with RNA, and the inception of amino acid charging and codon specificities in tRNA that are responsible for the genetic code. We also trace the age of domains and tRNA onto ancient tRNA homologies that were recently identified in rRNA. Our findings reveal a timeline of recruitment of tRNA building blocks for the formation of a functional ribosome, which holds both the biocatalytic functions of protein biosynthesis and the ability to store genetic memory in primordial RNA genomic templates. PMID:27918435

The universally conserved GTPase HflX is an RNA helicase that restores heat-damaged Escherichia coli ribosomes.

PubMed

Dey, Sandip; Biswas, Chiranjit; Sengupta, Jayati

2018-06-21

The ribosome-associated GTPase HflX acts as an antiassociation factor upon binding to the 50S ribosomal subunit during heat stress in Escherichia coli Although HflX is recognized as a guanosine triphosphatase, several studies have shown that the N-terminal domain 1 of HflX is capable of hydrolyzing adenosine triphosphate (ATP), but the functional role of its adenosine triphosphatase (ATPase) activity remains unknown. We demonstrate that E. coli HflX possesses ATP-dependent RNA helicase activity and is capable of unwinding large subunit ribosomal RNA. A cryo-electron microscopy structure of the 50S-HflX complex in the presence of nonhydrolyzable analogues of ATP and guanosine triphosphate hints at a mode of action for the RNA helicase and suggests the linker helical domain may have a determinant role in RNA unwinding. Heat stress results in inactivation of the ribosome, and we show that HflX can restore heat-damaged ribosomes and improve cell survival. © 2018 Dey et al.

In vivo tmRNA protection by SmpB and pre-ribosome binding conformation in solution.

PubMed

Ranaei-Siadat, Ehsan; Mérigoux, Cécile; Seijo, Bili; Ponchon, Luc; Saliou, Jean-Michel; Bernauer, Julie; Sanglier-Cianférani, Sarah; Dardel, Fréderic; Vachette, Patrice; Nonin-Lecomte, Sylvie

2014-10-01

TmRNA is an abundant RNA in bacteria with tRNA and mRNA features. It is specialized in trans-translation, a translation rescuing system. We demonstrate that its partner protein SmpB binds the tRNA-like region (TLD) in vivo and chaperones the fold of the TLD-H2 region. We use an original approach combining the observation of tmRNA degradation pathways in a heterologous system, the analysis of the tmRNA digests by MS and NMR, and co-overproduction assays of tmRNA and SmpB. We study the conformation in solution of tmRNA alone or in complex with one SmpB before ribosome binding using SAXS. Our data show that Mg(2+) drives compaction of the RNA structure and that, in the absence of Mg(2+), SmpB has a similar effect albeit to a lesser extent. Our results show that tmRNA is intrinsically structured in solution with identical topology to that observed on complexes on ribosomes which should facilitate its subsequent recruitment by the 70S ribosome, free or preloaded with one SmpB molecule. © 2014 Ranaei-Siadat et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Ribosomal proteins L5 and L11 co-operatively inactivate c-Myc via RNA-induced silencing complex.

PubMed

Liao, J-M; Zhou, X; Gatignol, A; Lu, H

2014-10-09

Oncogene MYC is highly expressed in many human cancers and functions as a global regulator of ribosome biogenesis. Previously, we reported that ribosomal protein (RP) L11 binds to c-Myc and inhibits its transcriptional activity in response to ribosomal stress. Here, we show that RPL5, co-operatively with RPL11, guides the RNA-induced silencing complex (RISC) to c-Myc mRNA and mediates the degradation of the mRNA, consequently leading to inhibition of c-Myc activity. Knocking down of RPL5 induced c-Myc expression at both mRNA and protein levels, whereas overexpression of RPL5 suppressed c-Myc expression and activity. Immunoprecipitation revealed that RPL5 binds to 3'UTR of c-Myc mRNA and two subunits of RISC, TRBP (HIV-1 TAR RNA-binding protein) and Ago2, mediating the targeting of c-Myc mRNA by miRNAs. Interestingly, RPL5 and RPL11 co-resided on c-Myc mRNA and suppressed c-Myc expression co-operatively. These findings uncover a mechanism by which these two RPs can co-operatively suppress c-Myc expression, allowing a tightly controlled ribosome biogenesis in cells.

Comparison of the structures of free and ribosome-bound tRNAPhe by using slow tritium exchange.

PubMed Central

Farber, N; Cantor, C R

1980-01-01

The rate of incorporation of tritium from the solvent into the C-8 position of purines in RNA is markedly sensitive to the microenvironment. This slow tritium exchange reaction has been used to study the structure and interactions of yeast tRNAPhe bound to poly(U)-programed tight-couple 70S ribosomes of Escherichia coli. The tritium incorporation into specific sites of the tRNA was determined by enzymatic digestion and measurement of the specific activity of each of the isolated radioactive fragments. Ribosome binding leads to marked suppression in the exchange rate of a number of fragments. This delineates extensive regions of tRNA-ribosome contact. No change in exchange rates is seen for fragments from the corner of the molecule, indicating that this region of bound tRNA is readily accessible to the solvent. Ribosome binding results in an enhanced exchange rate at the T loop. This appears to be the result of a conformational change that is most likely an unfolding of the T and D loops. Additional tritium exchange reactions suggest this conformational change is induced by ribosomes and not by messenger. PMID:7001473

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.

PubMed

Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

2016-09-19

The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan.

PubMed

Mittal, Nitish; Guimaraes, Joao C; Gross, Thomas; Schmidt, Alexander; Vina-Vilaseca, Arnau; Nedialkova, Danny D; Aeschimann, Florian; Leidel, Sebastian A; Spang, Anne; Zavolan, Mihaela

2017-09-06

In Saccharomyces cerevisiae, deletion of large ribosomal subunit protein-encoding genes increases the replicative lifespan in a Gcn4-dependent manner. However, how Gcn4, a key transcriptional activator of amino acid biosynthesis genes, increases lifespan, is unknown. Here we show that Gcn4 acts as a repressor of protein synthesis. By analyzing the messenger RNA and protein abundance, ribosome occupancy and protein synthesis rate in various yeast strains, we demonstrate that Gcn4 is sufficient to reduce protein synthesis and increase yeast lifespan. Chromatin immunoprecipitation reveals Gcn4 binding not only at genes that are activated, but also at genes, some encoding ribosomal proteins, that are repressed upon Gcn4 overexpression. The promoters of repressed genes contain Rap1 binding motifs. Our data suggest that Gcn4 is a central regulator of protein synthesis under multiple perturbations, including ribosomal protein gene deletions, calorie restriction, and rapamycin treatment, and provide an explanation for its role in longevity and stress response.The transcription factor Gcn4 is known to regulate yeast amino acid synthesis. Here, the authors show that Gcn4 also acts as a repressor of protein biosynthesis in a range of conditions that enhance yeast lifespan, such as ribosomal protein knockout, calorie restriction or mTOR inhibition.

A Novel In Vivo Assay Reveals Inhibition of Ribosomal Nuclear Export in Ran-Cycle and Nucleoporin Mutants

PubMed Central

Hurt, Ed; Hannus, Stefan; Schmelzl, Birgit; Lau, Denise; Tollervey, David; Simos, George

1999-01-01

To identify components involved in the nuclear export of ribosomes in yeast, we developed an in vivo assay exploiting a green fluorescent protein (GFP)-tagged version of ribosomal protein L25. After its import into the nucleolus, L25-GFP assembles with 60S ribosomal subunits that are subsequently exported into the cytoplasm. In wild-type cells, GFP-labeled ribosomes are only detected by fluorescence in the cytoplasm. However, thermosensitive rna1-1 (Ran-GAP), prp20-1 (Ran-GEF), and nucleoporin nup49 and nsp1 mutants are impaired in ribosomal export as revealed by nuclear accumulation of L25-GFP. Furthermore, overexpression of dominant-negative RanGTP (Gsp1-G21V) and the tRNA exportin Los1p inhibits ribosomal export. The pattern of subnuclear accumulation of L25-GFP observed in different mutants is not identical, suggesting that transport can be blocked at different steps. Thus, nuclear export of ribosomes requires the nuclear/cytoplasmic Ran-cycle and distinct nucleoporins. This assay can be used to identify soluble transport factors required for nuclear exit of ribosomes. PMID:9971735

High-throughput determination of RNA structure by proximity ligation.

PubMed

Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

2015-09-01

We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

5S ribosomal RNA database Y2K

PubMed Central

Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

5S ribosomal RNA database Y2K.

PubMed

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

Chaperoning 5S RNA assembly.

PubMed

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

Chaperoning 5S RNA assembly

PubMed Central

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-01-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

Cap- and initiator tRNA-dependent initiation of TYMV polyprotein synthesis by ribosomes: evaluation of the Trojan horse model for TYMV RNA translation.

PubMed

Matsuda, Daiki; Dreher, Theo W

2007-01-01

Turnip yellow mosaic virus (TYMV) RNA directs the translation of two overlapping open reading frames. Competing models have been previously published to explain ribosome access to the downstream polyprotein cistron. The Trojan horse model, based on cell-free experiments, proposes noncanonical cap-independent initiation in which the 3'-terminal tRNA-like structure (TLS) functionally replaces initiator tRNA, and the valine bound to the TLS becomes cis-incorporated into viral protein. The initiation coupling model, based on in vivo expression and ribosome toe-printing studies, proposes a variation of canonical leaky scanning. Here, we have re-examined the wheat germ extract experiments that led to the Trojan horse model, incorporating a variety of controls. We report that (1) translation in vitro from the polyprotein AUG of TYMV RNA is unchanged after removal of the 3' TLS but is stimulated by the presence of a 5'-cap; (2) the presence of free cap analog or edeine (which interferes with initiation at the ribosomal P site and its tRNA(i) (Met) involvement) inhibits translation from the polyprotein AUG; (3) the toe-prints of immediately post-initiation ribosomes on TYMV RNA are similar with and without an intact TLS; and (4) significant deacylation of valyl-TYMV RNA in wheat germ extract can complicate the detection of cis-incorporation. These results favor the initiation coupling model.

Contributions of mRNA abundance, ribosome loading, and post- or peri-translational effects to temporal repression of C. elegans heterochronic miRNA targets

PubMed Central

Stadler, Michael; Artiles, Karen; Pak, Julia; Fire, Andrew

2012-01-01

miRNAs are post-transcriptional regulators of gene activity that reduce protein accumulation from target mRNAs. Elucidating precise molecular effects that animal miRNAs have on target transcripts has proven complex, with varied evidence indicating that miRNA regulation may produce different molecular outcomes in different species, systems, and/or physiological conditions. Here we use high-throughput ribosome profiling to analyze detailed translational parameters for five well-studied targets of miRNAs that regulate C. elegans developmental timing. For two targets of the miRNA lin-4 (lin-14 and lin-28), functional down-regulation was associated with decreases in both overall mRNA abundance and ribosome loading; however, these changes were of substantially smaller magnitude than corresponding changes observed in protein abundance. For three functional targets of the let-7 miRNA family for which down-regulation is critical in temporal progression of the animal (daf-12, hbl-1, and lin-41), we observed only modest changes in mRNA abundance and ribosome loading. lin-41 provides a striking example in that populations of ribosome-protected fragments from this gene remained essentially unchanged during the L3–L4 time interval when lin-41 activity is substantially down-regulated by let-7. Spectra of ribosomal positions were also examined for the five lin-4 and let-7 target mRNAs as a function of developmental time, with no indication of miRNA-induced ribosomal drop-off or significant pauses in translation. These data are consistent with models in which physiological regulation by this set of C. elegans miRNAs derives from combinatorial effects including suppressed recruitment/activation of translational machinery, compromised stability of target messages, and post- or peri-translational effects on lifetimes of polypeptide products. PMID:22855835

Nonenzymatic microorganism identification based on ribosomal RNA

NASA Astrophysics Data System (ADS)

Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

1999-11-01

Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

Analysis of Ribosome Stalling and Translation Elongation Dynamics by Deep Learning.

PubMed

Zhang, Sai; Hu, Hailin; Zhou, Jingtian; He, Xuan; Jiang, Tao; Zeng, Jianyang

2017-09-27

Ribosome stalling is manifested by the local accumulation of ribosomes at specific codon positions of mRNAs. Here, we present ROSE, a deep learning framework to analyze high-throughput ribosome profiling data and estimate the probability of a ribosome stalling event occurring at each genomic location. Extensive validation tests on independent data demonstrated that ROSE possessed higher prediction accuracy than conventional prediction models, with an increase in the area under the receiver operating characteristic curve by up to 18.4%. In addition, genome-wide statistical analyses showed that ROSE predictions can be well correlated with diverse putative regulatory factors of ribosome stalling. Moreover, the genome-wide ribosome stalling landscapes of both human and yeast computed by ROSE recovered the functional interplays between ribosome stalling and cotranslational events in protein biogenesis, including protein targeting by the signal recognition particles and protein secondary structure formation. Overall, our study provides a novel method to complement the ribosome profiling techniques and further decipher the complex regulatory mechanisms underlying translation elongation dynamics encoded in the mRNA sequence. Copyright © 2017 Elsevier Inc. All rights reserved.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis

PubMed Central

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia

2017-01-01

Abstract Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an ‘all-or-none’ pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. PMID:28520982

How EF-Tu can contribute to efficient proofreading of aa-tRNA by the ribosome

PubMed Central

Noel, Jeffrey K.; Whitford, Paul C.

2016-01-01

It has long been recognized that the thermodynamics of mRNA–tRNA base pairing is insufficient to explain the high fidelity and efficiency of aminoacyl-tRNA (aa-tRNA) selection by the ribosome. To rationalize this apparent inconsistency, Hopfield proposed that the ribosome may improve accuracy by utilizing a multi-step kinetic proofreading mechanism. While biochemical, structural and single-molecule studies have provided a detailed characterization of aa-tRNA selection, there is a limited understanding of how the physical–chemical properties of the ribosome enable proofreading. To this end, we probe the role of EF-Tu during aa-tRNA accommodation (the proofreading step) through the use of energy landscape principles, molecular dynamics simulations and kinetic models. We find that the steric composition of EF-Tu can reduce the free-energy barrier associated with the first step of accommodation: elbow accommodation. We interpret this effect within an extended kinetic model of accommodation and show how EF-Tu can contribute to efficient and accurate proofreading. PMID:27796304

The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

PubMed

Lin, A; McNally, J; Wool, I G

1983-09-10

The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

PubMed Central

Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric

2015-01-01

The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame. PMID:26554019

Cap- and initiator tRNA-dependent initiation of TYMV polyprotein synthesis by ribosomes: Evaluation of the Trojan horse model for TYMV RNA translation

PubMed Central

Matsuda, Daiki; Dreher, Theo W.

2007-01-01

Turnip yellow mosaic virus (TYMV) RNA directs the translation of two overlapping open reading frames. Competing models have been previously published to explain ribosome access to the downstream polyprotein cistron. The Trojan horse model, based on cell-free experiments, proposes noncanonical cap-independent initiation in which the 3′-terminal tRNA-like structure (TLS) functionally replaces initiator tRNA, and the valine bound to the TLS becomes cis-incorporated into viral protein. The initiation coupling model, based on in vivo expression and ribosome toe-printing studies, proposes a variation of canonical leaky scanning. Here, we have re-examined the wheat germ extract experiments that led to the Trojan horse model, incorporating a variety of controls. We report that (1) translation in vitro from the polyprotein AUG of TYMV RNA is unchanged after removal of the 3′ TLS but is stimulated by the presence of a 5′-cap; (2) the presence of free cap analog or edeine (which interferes with initiation at the ribosomal P site and its tRNAi Met involvement) inhibits translation from the polyprotein AUG; (3) the toe-prints of immediately post-initiation ribosomes on TYMV RNA are similar with and without an intact TLS; and (4) significant deacylation of valyl-TYMV RNA in wheat germ extract can complicate the detection of cis-incorporation. These results favor the initiation coupling model. PMID:17095542

Positively Charged Residues Are the Major Determinants of Ribosomal Velocity

PubMed Central

Charneski, Catherine A.; Hurst, Laurence D.

2013-01-01

Both for understanding mechanisms of disease and for the design of transgenes, it is important to understand the determinants of ribosome velocity, as changes in the rate of translation are important for protein folding, error attenuation, and localization. While there is great variation in ribosomal occupancy along even a single transcript, what determines a ribosome's occupancy is unclear. We examine this issue using data from a ribosomal footprinting assay in yeast. While codon usage is classically considered a major determinant, we find no evidence for this. By contrast, we find that positively charged amino acids greatly retard ribosomes downstream from where they are encoded, consistent with the suggestion that positively charged residues interact with the negatively charged ribosomal exit tunnel. Such slowing is independent of and greater than the average effect owing to mRNA folding. The effect of charged amino acids is additive, with ribosomal occupancy well-predicted by a linear fit to the density of positively charged residues. We thus expect that a translated poly-A tail, encoding for positively charged lysines regardless of the reading frame, would act as a sandtrap for the ribosome, consistent with experimental data. PMID:23554576

Evidence for Context-Dependent Complementarity of Non-Shine-Dalgarno Ribosome Binding Sites to Escherichia coli rRNA

PubMed Central

Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.

2013-01-01

While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812

Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

PubMed Central

Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter

2015-01-01

Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308

RNA Mimicry by the Fap7 Adenylate Kinase in Ribosome Biogenesis

PubMed Central

Réty, Stéphane; Lebaron, Simon; Deschamps, Patrick; Bareille, Joseph; Jombart, Julie; Robert-Paganin, Julien; Delbos, Lila; Chardon, Florian; Zhang, Elodie; Charenton, Clément; Tollervey, David; Leulliot, Nicolas

2014-01-01

During biogenesis of the 40S and 60S ribosomal subunits, the pre-40S particles are exported to the cytoplasm prior to final cleavage of the 20S pre-rRNA to mature 18S rRNA. Amongst the factors involved in this maturation step, Fap7 is unusual, as it both interacts with ribosomal protein Rps14 and harbors adenylate kinase activity, a function not usually associated with ribonucleoprotein assembly. Human hFap7 also regulates Cajal body assembly and cell cycle progression via the p53–MDM2 pathway. This work presents the functional and structural characterization of the Fap7–Rps14 complex. We report that Fap7 association blocks the RNA binding surface of Rps14 and, conversely, Rps14 binding inhibits adenylate kinase activity of Fap7. In addition, the affinity of Fap7 for Rps14 is higher with bound ADP, whereas ATP hydrolysis dissociates the complex. These results suggest that Fap7 chaperones Rps14 assembly into pre-40S particles via RNA mimicry in an ATP-dependent manner. Incorporation of Rps14 by Fap7 leads to a structural rearrangement of the platform domain necessary for the pre-rRNA to acquire a cleavage competent conformation. PMID:24823650

Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

PubMed

Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

2015-10-01

Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

PubMed

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

2017-07-07

Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2

PubMed Central

Occhipinti, Laura; Chang, Yiming; Altvater, Martin; Menet, Anna M.; Kemmler, Stefan; Panse, Vikram G.

2013-01-01

Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a second surface that makes non-FG contacts with the nucleoporin Nup116. A basic patch mutant of Gle2 is able to function in mRNA export, but not pre-60S export. Thus, Gle2 provides a distinct interaction platform to transport pre-60S to the cytoplasm. Notably, Gle2’s interaction platforms become crucial for pre-60S export when FG-interacting receptors are either not recruited to pre-60S or are impaired. We propose that large complex cargos rely on non-FG as well as FG-interactions for their efficient translocation through the nuclear pore complex channel. PMID:23907389

Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

ERIC Educational Resources Information Center

Deutch, Charles E.; Marshall, Pamela A.

2008-01-01

In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

Sudestada1, a Drosophila ribosomal prolyl-hydroxylase required for mRNA translation, cell homeostasis, and organ growth

PubMed Central

Katz, Maximiliano J.; Acevedo, Julieta M.; Loenarz, Christoph; Galagovsky, Diego; Liu-Yi, Phebee; Pérez-Pepe, Marcelo; Thalhammer, Armin; Sekirnik, Rok; Ge, Wei; Melani, Mariana; Thomas, María G.; Simonetta, Sergio; Boccaccio, Graciela L.; Schofield, Christopher J.; Cockman, Matthew E.; Ratcliffe, Peter J.; Wappner, Pablo

2014-01-01

Genome sequences predict the presence of many 2-oxoglutarate (2OG)-dependent oxygenases of unknown biochemical and biological functions in Drosophila. Ribosomal protein hydroxylation is emerging as an important 2OG oxygenase catalyzed pathway, but its biological functions are unclear. We report investigations on the function of Sudestada1 (Sud1), a Drosophila ribosomal oxygenase. As with its human and yeast homologs, OGFOD1 and Tpa1p, respectively, we identified Sud1 to catalyze prolyl-hydroxylation of the small ribosomal subunit protein RPS23. Like OGFOD1, Sud1 catalyzes a single prolyl-hydroxylation of RPS23 in contrast to yeast Tpa1p, where Pro-64 dihydroxylation is observed. RNAi-mediated Sud1 knockdown hinders normal growth in different Drosophila tissues. Growth impairment originates from both reduction of cell size and diminution of the number of cells and correlates with impaired translation efficiency and activation of the unfolded protein response in the endoplasmic reticulum. This is accompanied by phosphorylation of eIF2α and concomitant formation of stress granules, as well as promotion of autophagy and apoptosis. These observations, together with those on enzyme homologs described in the companion articles, reveal conserved biochemical and biological roles for a widely distributed ribosomal oxygenase. PMID:24550463

Small, synthetic, GC-rich mRNA stem-loop modules 5' proximal to the AUG start-codon predictably tune gene expression in yeast.

PubMed

Lamping, Erwin; Niimi, Masakazu; Cannon, Richard D

2013-07-29

A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5' UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5' UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = -15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = -4.4 kcal/mol) inhibited

Selection of peptides targeting helix 31 of bacterial 16S ribosomal RNA by screening M13 phage-display libraries.

PubMed

Lamichhane, Tek N; Abeydeera, N Dinuka; Duc, Anne-Cécile E; Cunningham, Philip R; Chow, Christine S

2011-01-28

Ribosomal RNA is the catalytic portion of ribosomes, and undergoes a variety of conformational changes during translation. Structural changes in ribosomal RNA can be facilitated by the presence of modified nucleotides. Helix 31 of bacterial 16S ribosomal RNA harbors two modified nucleotides, m²G966 and m⁵C967, that are highly conserved among bacteria, though the degree and nature of the modifications in this region are different in eukaryotes. Contacts between helix 31 and the P-site tRNA, initiation factors, and ribosomal proteins highlight the importance of this region in translation. In this work, a heptapeptide M13 phage-display library was screened for ligands that target the wild-type, naturally modified bacterial helix 31. Several peptides, including TYLPWPA, CVRPFAL, TLWDLIP, FVRPFPL, ATPLWLK, and DIRTQRE, were found to be prevalent after several rounds of screening. Several of the peptides exhibited moderate affinity (in the high nM to low µM range) to modified helix 31 in biophysical assays, including surface plasmon resonance (SPR), and were also shown to bind 30S ribosomal subunits. These peptides also inhibited protein synthesis in cell-free translation assays.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Recent structural studies on Dom34/aPelota and Hbs1/aEF1α: important factors for solving general problems of ribosomal stall in translation

PubMed Central

Kobayashi, Kan; Ishitani, Ryuichiro; Nureki, Osamu

2013-01-01

In the translation process, translating ribosomes usually move on an mRNA until they reach the stop codon. However, when ribosomes translate an aberrant mRNA, they stall. Then, ribosomes are rescued from the aberrant mRNA, and the aberrant mRNA is subsequently degraded. In eukaryotes, Pelota (Dom34 in yeast) and Hbs1 are responsible for solving general problems of ribosomal stall in translation. In archaea, aPelota and aEF1α, homologous to Pelota and Hbs1, respectively, are considered to be involved in that process. In recent years, great progress has been made in determining structures of Dom34/aPelota and Hbs1/aEF1α. In this review, we focus on the functional roles of Dom34/aPelota and Hbs1/aEF1α in ribosome rescue, based on recent structural studies of them. We will also present questions to be answered by future work. PMID:27493551

The internal transcribed spacer of ribosomal RNA genes in plant trypanosomes (Phytomonas spp.) resolves 10 groups.

PubMed

Dollet, Michel; Sturm, Nancy R; Campbell, David A

2012-03-01

The distinction between plant trypanosomatids and opportunistic monoxenous insect trypanosomatids has not been demarcated clearly due to the mass placement of all trypanosomatids isolated from plants into the arbitrary genus Phytomonas spp. The advent of molecular markers has been useful in distinguishing plant trypanosomatids from the rest of the Trypanosomatidae family. Here we have examined the internal transcribed spacer (ITS) region of the ribosomal RNA (rRNA) locus for classification purposes. This region contains two distinct ITSs flanked by the small subunit and large subunit of ribosomal RNA genes and separated by the 5.8S ribosomal RNA gene. Sequences within the 5.8S ribosomal RNA gene and in the ITS sequences can serve as specific markers for several of the Phytomonas groups. Microsatellite sequences were identified in Phytomonas spp. in both ITS regions. Several classes of microsatellites were seen, with inter-isolate variation that has potential for future use. Maximum Likelihood analysis of the ITS sequences of 20 Phytomonas isolates representing the eight defined groups and a few unclassified isolates revealed a total of 10 distinct subgroups within our collection, of which two are new. The ITS region, which includes the 5.8S sequence, is a robust marker for the subdivisions within the genus Phytomonas spp. Copyright © 2011 Elsevier B.V. All rights reserved.

[Protein S3 fragments neighboring mRNA during elongation and translation termination on the human ribosome].

PubMed

Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G

2008-01-01

Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.

Nuclear export of the small ribosomal subunit requires the Ran–GTPase cycle and certain nucleoporins

PubMed Central

Moy, Terence I.; Silver, Pamela A.

1999-01-01

After their assembly in the nucleolus, ribosomal subunits are exported from the nucleus to the cytoplasm. After export, the 20S rRNA in the small ribosomal subunit is cleaved to yield 18S rRNA and the small 5′ ITS1 fragment. The 5′ ITS1 RNA is normally degraded by the cytoplasmic Xrn1 exonuclease, but in strains lacking XRN1, the 5′ ITS1 fragment accumulates in the cytoplasm. Using the cytoplasmic localization of the 5′ ITS1 fragment as an indicator for the export of the small ribosomal subunit, we have identified genes that are required for ribosome export. Ribosome export is dependent on the Ran–GTPase as mutations in Ran or its regulators caused 5′ ITS1 to accumulate in the nucleoplasm. Mutations in the genes encoding the nucleoporin Nup82 and in the NES exporter Xpo1/Crm1 also caused the nucleoplasmic accumulation of 5′ ITS1. Mutants in a subset of nucleoporins and in the nuclear transport factors Srp1, Kap95, Pse1, Cse1, and Mtr10 accumulate the 5′ ITS1 in the nucleolus and affect ribosome assembly. In contrast, we did not detect nuclear accumulation of 5′ ITS1 in 28 yeast strains that have mutations in other genes affecting nuclear trafficking. PMID:10465789

The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

PubMed

Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

2007-01-01

The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

Isolation of total RNA from yeast cell cultures.

PubMed

Ares, Manuel

2012-10-01

This article describes two procedures for isolating total RNA from yeast cell cultures. The first allows the convenient isolation of total RNA from early log-phase cultures (vegetative cells). RNA isolated in this way is intact and sufficiently pure for use in microarray experiments, primer extension, and RNase protection mapping. With additional treatment to remove contaminating genomic DNA, the preparation is suitable for reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), cDNA library construction, high-throughput sequencing of RNA, or other manipulations. However, compared to vegetative cells, the isolation of RNA from cells late in meiosis (asci and ascospores) requires additional effort. This is because a tough cell wall composed of heavily cross-linked polysaccharides and proteins is built around the four spores during meiosis and ascospore development. Therefore, an alternative protocol is presented for extracting RNA from cells late in meiosis. This alternative may also be preferable for cells from stationary cultures or from yeast strains and other fungal species isolated from the environment.

Small, synthetic, GC-rich mRNA stem-loop modules 5′ proximal to the AUG start-codon predictably tune gene expression in yeast

PubMed Central

2013-01-01

Background A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5′ UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Results Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5′ UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = −15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (�

Novel characteristics of the biological properties of the yeast Saccharomyces cerevisiae eukaryotic initiation factor 2A.

PubMed

Komar, Anton A; Gross, Stephane R; Barth-Baus, Diane; Strachan, Ryan; Hensold, Jack O; Goss Kinzy, Terri; Merrick, William C

2005-04-22

Eukaryotic initiation factor 2A (eIF2A) has been shown to direct binding of the initiator methionyl-tRNA (Met-tRNA(i)) to 40 S ribosomal subunits in a codon-dependent manner, in contrast to eIF2, which requires GTP but not the AUG codon to bind initiator tRNA to 40 S subunits. We show here that yeast eIF2A genetically interacts with initiation factor eIF4E, suggesting that both proteins function in the same pathway. The double eIF2A/eIF4E-ts mutant strain displays a severe slow growth phenotype, which correlated with the accumulation of 85% of the double mutant cells arrested at the G(2)/M border. These cells also exhibited a disorganized actin cytoskeleton and elevated actin levels, suggesting that eIF2A might be involved in controlling the expression of genes involved in morphogenic processes. Further insights into eIF2A function were gained from the studies of eIF2A distribution in ribosomal fractions obtained from either an eIF5BDelta (fun12Delta) strain or a eIF3b-ts (prt1-1) strain. It was found that the binding of eIF2A to 40 and 80 S ribosomes was not impaired in either strain. We also found that eIF2A functions as a suppressor of Ure2p internal ribosome entry site-mediated translation in yeast cells. The regulation of expression from the URE2 internal ribosome entry site appears to be through the levels of eIF2A protein, which has been found to be inherently unstable with a half-life of approximately 17 min. It was hypothesized that this instability allows for translational control through the level of eIF2A protein in yeast cells.

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

NASA Astrophysics Data System (ADS)

Mishra, Bhavya; Schütz, Gunter M.; Chowdhury, Debashish

2016-06-01

We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special “slippery” sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obtained from a mean-field analysis of the stochastic dynamics.

DMR1 (CCM1/YGR150C) of Saccharomyces cerevisiae encodes an RNA-binding protein from the pentatricopeptide repeat family required for the maintenance of the mitochondrial 15S ribosomal RNA.

PubMed

Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel

2010-04-01

Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.

[Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

PubMed

Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

2005-01-01

Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

PubMed Central

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

2016-01-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in-trans signaling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identified TCOF1-Treacle, a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle-dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in-trans in the presence of distant chromosome breaks. PMID:25064736

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage.

PubMed

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

2014-08-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in trans in the presence of distant chromosome breaks.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

PubMed

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

PubMed

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

PubMed

Spirin, Alexander S

2009-11-17

A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

Mitochondrial ribosome assembly in health and disease

PubMed Central

De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

2015-01-01

The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

The Budding Yeast Nucleus

PubMed Central

Taddei, Angela; Schober, Heiko; Gasser, Susan M.

2010-01-01

The budding yeast nucleus, like those of other eukaryotic species, is highly organized with respect to both chromosomal sequences and enzymatic activities. At the nuclear periphery interactions of nuclear pores with chromatin, mRNA, and transport factors promote efficient gene expression, whereas centromeres, telomeres, and silent chromatin are clustered and anchored away from pores. Internal nuclear organization appears to be function-dependent, reflecting localized sites for tRNA transcription, rDNA transcription, ribosome assembly, and DNA repair. Recent advances have identified new proteins involved in the positioning of chromatin and have allowed testing of the functional role of higher-order chromatin organization. The unequal distribution of silent information regulatory factors and histone modifying enzymes, which arises in part from the juxtaposition of telomeric repeats, has been shown to influence chromatin-mediated transcriptional repression. Other localization events suppress unwanted recombination. These findings highlight the contribution budding yeast genetics and cytology have made to dissecting the functional role of nuclear structure. PMID:20554704

A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

PubMed

Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

1990-09-01

Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

PubMed Central

Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

2007-01-01

The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

Characterization of a novel RNA-binding region of eIF4GI critical for ribosomal scanning

PubMed Central

Prévôt, Déborah; Décimo, Didier; Herbreteau, Cécile H.; Roux, Florence; Garin, Jérôme; Darlix, Jean-Luc; Ohlmann, Théophile

2003-01-01

The eukaryotic translation initiation factor eIF4GI binds several proteins and acts as a scaffold to promote preinitiation complex formation on the mRNA molecule (48S). Following mRNA attachment this complex scans along the messenger in a 5′ to 3′ direction until it locates and recognizes the initiation start codon. By using a combination of retroviral and picornaviral proteases (HIV-2 and L respectively) in the reticulocyte lysate system, we have characterized a 40 amino acid (aa) region of eIF4GI (aa 642–681) that exhibits general RNA-binding properties. Removal of this domain by proteolytic processing followed by translational assays showed virtually no inhibition of internal ribosome entry on the encephalomyocarditis virus, but resulted in drastic impairment of ribosome scanning as demonstrated by studying poliovirus and foot-and-mouth disease virus translation. Based on these findings, we propose that this 40 aa motif of eIF4GI is critical for ribosome scanning. PMID:12682023

Ribosome-inactivating proteins

PubMed Central

Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

2013-01-01

Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

Ribosomal protein RPS-14 modulates let-7 microRNA function in Caenorhabditis elegans

PubMed Central

Chan, Shih-Peng; Slack, Frank J.

2009-01-01

The let-7 microRNA (miRNA) regulates developmental timing at the larval-to-adult transition in Caenorhabditis elegans. Dysregulation of let-7 results in irregular hypodermal and vulval development. Disrupted let-7 function is also a feature of human lung cancer. However, little is known about the mechanism and co-factors of let-7. Here we demonstrate that ribosomal protein RPS-14 is able to modulate let-7 function in C. elegans. The RPS-14 protein co-immunoprecipitated with the nematode Argonaute homolog, ALG-1. Reduction of rps-14 gene expression by RNAi suppressed the aberrant vulva and hypodermis development phenotypes of let-7(n2853) mutant animals and the mis-regulation of a reporter bearing the lin-41 3′UTR, a well established let-7 target. Our results indicate an interactive relationship between let-7 miRNA function and ribosomal protein RPS-14 in regulation of terminal differentiation that may help in understanding the mechanism of translational control by miRNAs. PMID:19627982

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

PubMed Central

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-01

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

Transcription termination and RNA processing in the 3'-end spacer of mouse ribosomal RNA genes.

PubMed Central

Miwa, T; Kominami, R; Yoshikura, H; Sudo, K; Muramatsu, M

1987-01-01

The 3' termini of ribosomal RNA precursors from mouse FM3A cultured cells are mapped to eight sites within 625 bp downstream from the 3' terminus of 28 S rRNA. Three additional sites are mapped in liver RNA from C3H/He strain mice. Two of them, the sites at 570 bp and 625 bp are assumed to be termination sites in vivo, because they correspond to in vitro termination sites of RNA polymerase I, and 45 S RNAs having these 3' termini decay with kinetics distinct from others. The amount of 45 S RNA having the 3' terminus at other sites is variable among several mouse strains, despite their having the same DNA sequence in these regions. The ability to produce 3' termini in these sites seems to follow Mendel's law of inheritance. Therefore, we postulate that these nine sites are RNA processing sites which are controlled genetically. Images PMID:3031586

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

PubMed

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

An aminoacylation-dependent nuclear tRNA export pathway in yeast.

PubMed

Grosshans, H; Hurt, E; Simos, G

2000-04-01

Yeast Los1p, the homolog of human exportin-t, mediates nuclear export of tRNA. Using fluorescence in situ hybridization, we could show that the export of some intronless tRNA species is not detectably affected by the disruption of LOS1. To find other factors that facilitate tRNA export, we performed a suppressor screen of a synthetically lethal los1 mutant and identified the essential translation elongation factor eEF-1A. Mutations in eEF-1A impaired nuclear export of all tRNAs tested, which included both spliced and intronless species. An even stronger defect in nuclear exit of tRNA was observed under conditions that inhibited tRNA aminoacylation. In all cases, inhibition of tRNA export led to nucleolar accumulation of mature tRNAs. Our data show that tRNA aminoacylation and eEF-1A are required for efficient nuclear tRNA export in yeast and suggest coordination between the protein translation and the nuclear tRNA processing and transport machineries.

An aminoacylation-dependent nuclear tRNA export pathway in yeast

PubMed Central

Grosshans, Helge; Hurt, Ed; Simos, George

2000-01-01

Yeast Los1p, the homolog of human exportin-t, mediates nuclear export of tRNA. Using fluorescence in situ hybridization, we could show that the export of some intronless tRNA species is not detectably affected by the disruption of LOS1. To find other factors that facilitate tRNA export, we performed a suppressor screen of a synthetically lethal los1 mutant and identified the essential translation elongation factor eEF-1A. Mutations in eEF-1A impaired nuclear export of all tRNAs tested, which included both spliced and intronless species. An even stronger defect in nuclear exit of tRNA was observed under conditions that inhibited tRNA aminoacylation. In all cases, inhibition of tRNA export led to nucleolar accumulation of mature tRNAs. Our data show that tRNA aminoacylation and eEF-1A are required for efficient nuclear tRNA export in yeast and suggest coordination between the protein translation and the nuclear tRNA processing and transport machineries. PMID:10766739

Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

PubMed

Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

2010-08-01

Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

Connections Underlying Translation and mRNA Stability.

PubMed

Radhakrishnan, Aditya; Green, Rachel

2016-09-11

Gene expression and regulation in organisms minimally depends on transcription by RNA polymerase and on the stability of the RNA product (for both coding and non-coding RNAs). For coding RNAs, gene expression is further influenced by the amount of translation by the ribosome and by the stability of the protein product. The stabilities of these two classes of RNA, non-coding and coding, vary considerably: tRNAs and rRNAs tend to be long lived while mRNAs tend to be more short lived. Even among mRNAs, however, there is a considerable range in stability (ranging from seconds to hours in bacteria and up to days in metazoans), suggesting a significant role for stability in the regulation of gene expression. Here, we review recent experiments from bacteria, yeast and metazoans indicating that the stability of most mRNAs is broadly impacted by the actions of ribosomes that translate them. Ribosomal recognition of defective mRNAs triggers "mRNA surveillance" pathways that target the mRNA for degradation [Shoemaker and Green (2012) ]. More generally, even the stability of perfectly functional mRNAs appears to be dictated by overall rates of translation by the ribosome [Herrick et al. (1990), Presnyak et al. (2015) ]. Given that mRNAs are synthesized for the purpose of being translated into proteins, it is reassuring that such intimate connections between mRNA and the ribosome can drive biological regulation. In closing, we consider the likelihood that these connections between protein synthesis and mRNA stability are widespread or whether other modes of regulation dominate the mRNA stability landscape in higher organisms. Copyright © 2016. Published by Elsevier Ltd.

Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species.

PubMed

Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, Stéphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-Rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans

2014-06-01

Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin-Benson cycle enzymes. In mature leaves, soluble protein and Calvin-Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin-Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use.

Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species

PubMed Central

Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, StÉphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans

2014-01-01

Abstract Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin–Benson cycle enzymes. In mature leaves, soluble protein and Calvin–Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin–Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use. PMID:24895754

Three-dimensional tertiary structure of yeast phenylalanine transfer RNA

NASA Technical Reports Server (NTRS)

Kim, S. H.; Sussman, J. L.; Suddath, F. L.; Quigley, G. J.; Mcpherson, A.; Wang, A. H. J.; Seeman, N. C.; Rich, A.

1974-01-01

Results of an analysis and interpretation of a 3-A electron density map of yeast phenylalanine transfer RNA. Some earlier detailed assignments of nucleotide residues to electron density peaks are found to be in error, even though the overall tracing of the backbone conformation of yeast phenylalanine transfer RNA was generally correct. A new, more comprehensive interpretation is made which makes it possible to define the tertiary interactions in the molecule. The new interpretation makes it possible to visualize a number of tertiary interactions which not only explain the structural role of most of the bases which are constant in transfer RNAs, but also makes it possible to understand in a direct and simple fashion the chemical modification data on transfer RNA. In addition, this pattern of tertiary interactions provides a basis for understanding the general three-dimensional folding of all transfer RNA molecules.

The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes.

PubMed

Mérai, Zsuzsanna; Chumak, Nina; García-Aguilar, Marcelina; Hsieh, Tzung-Fu; Nishimura, Toshiro; Schoft, Vera K; Bindics, János; Slusarz, Lucyna; Arnoux, Stéphanie; Opravil, Susanne; Mechtler, Karl; Zilberman, Daniel; Fischer, Robert L; Tamaru, Hisashi

2014-11-11

Centromeres mediate chromosome segregation and are defined by the centromere-specific histone H3 variant (CenH3)/centromere protein A (CENP-A). Removal of CenH3 from centromeres is a general property of terminally differentiated cells, and the persistence of CenH3 increases the risk of diseases such as cancer. However, active mechanisms of centromere disassembly are unknown. Nondividing Arabidopsis pollen vegetative cells, which transport engulfed sperm by extended tip growth, undergo loss of CenH3; centromeric heterochromatin decondensation; and bulk activation of silent rRNA genes, accompanied by their translocation into the nucleolus. Here, we show that these processes are blocked by mutations in the evolutionarily conserved AAA-ATPase molecular chaperone, CDC48A, homologous to yeast Cdc48 and human p97 proteins, both of which are implicated in ubiquitin/small ubiquitin-like modifier (SUMO)-targeted protein degradation. We demonstrate that CDC48A physically associates with its heterodimeric cofactor UFD1-NPL4, known to bind ubiquitin and SUMO, as well as with SUMO1-modified CenH3 and mutations in NPL4 phenocopy cdc48a mutations. In WT vegetative cell nuclei, genetically unlinked ribosomal DNA (rDNA) loci are uniquely clustered together within the nucleolus and all major rRNA gene variants, including those rDNA variants silenced in leaves, are transcribed. In cdc48a mutant vegetative cell nuclei, however, these rDNA loci frequently colocalized with condensed centromeric heterochromatin at the external periphery of the nucleolus. Our results indicate that the CDC48A(NPL4) complex actively removes sumoylated CenH3 from centromeres and disrupts centromeric heterochromatin to release bulk rRNA genes into the nucleolus for ribosome production, which fuels single nucleus-driven pollen tube growth and is essential for plant reproduction.

The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes

PubMed Central

Mérai, Zsuzsanna; Chumak, Nina; García-Aguilar, Marcelina; Hsieh, Tzung-Fu; Nishimura, Toshiro; Schoft, Vera K.; Bindics, János; Ślusarz, Lucyna; Arnoux, Stéphanie; Opravil, Susanne; Mechtler, Karl; Zilberman, Daniel; Fischer, Robert L.; Tamaru, Hisashi

2014-01-01

Centromeres mediate chromosome segregation and are defined by the centromere-specific histone H3 variant (CenH3)/centromere protein A (CENP-A). Removal of CenH3 from centromeres is a general property of terminally differentiated cells, and the persistence of CenH3 increases the risk of diseases such as cancer. However, active mechanisms of centromere disassembly are unknown. Nondividing Arabidopsis pollen vegetative cells, which transport engulfed sperm by extended tip growth, undergo loss of CenH3; centromeric heterochromatin decondensation; and bulk activation of silent rRNA genes, accompanied by their translocation into the nucleolus. Here, we show that these processes are blocked by mutations in the evolutionarily conserved AAA-ATPase molecular chaperone, CDC48A, homologous to yeast Cdc48 and human p97 proteins, both of which are implicated in ubiquitin/small ubiquitin-like modifier (SUMO)-targeted protein degradation. We demonstrate that CDC48A physically associates with its heterodimeric cofactor UFD1-NPL4, known to bind ubiquitin and SUMO, as well as with SUMO1-modified CenH3 and mutations in NPL4 phenocopy cdc48a mutations. In WT vegetative cell nuclei, genetically unlinked ribosomal DNA (rDNA) loci are uniquely clustered together within the nucleolus and all major rRNA gene variants, including those rDNA variants silenced in leaves, are transcribed. In cdc48a mutant vegetative cell nuclei, however, these rDNA loci frequently colocalized with condensed centromeric heterochromatin at the external periphery of the nucleolus. Our results indicate that the CDC48ANPL4 complex actively removes sumoylated CenH3 from centromeres and disrupts centromeric heterochromatin to release bulk rRNA genes into the nucleolus for ribosome production, which fuels single nucleus-driven pollen tube growth and is essential for plant reproduction. PMID:25344531

Ribosome stalling and peptidyl-tRNA drop-off during translational delay at AGA codons

PubMed Central

Cruz-Vera, Luis Rogelio; Magos-Castro, Marco Antonio; Zamora-Romo, Efraín; Guarneros, Gabriel

2004-01-01

Minigenes encoding the peptide Met–Arg–Arg have been used to study the mechanism of toxicity of AGA codons proximal to the start codon or prior to the termination codon in bacteria. The codon sequences of the ‘mini-ORFs’ employed were initiator, combinations of AGA and CGA, and terminator. Both, AGA and CGA are low-usage Arg codons in ORFs of Escherichia coli but, whilst AGA is translated by the scarce tRNAArg4, CGA is recognized by the abundant tRNAArg2. Overexpression of minigenes harbouring AGA in the third position, next to a termination codon, was deleterious to the cell and led to the accumulation of peptidyl-tRNAArg4 and of the peptidyl-tRNA cognate to the preceding CGA or AGA Arg triplet. The minigenes carrying CGA in the third position were not toxic. Minigene-mediated toxicity and peptidyl-tRNA accumulation were suppressed by overproduction of tRNAArg4 but not by overproduction of peptidyl-tRNA hydrolase, an enzyme that is only active on substrates that have been released from the ribosome. Consistent with these findings, peptidyl-tRNAArg4 was identified to be mainly associated with ribosomes in a stand-by complex. These and previous results support the hypothesis that the primary mechanism of inhibition of protein synthesis by AGA triplets in pth+ cells involves sequestration of tRNAs as peptidyl-tRNA on the stalled ribosome. PMID:15317870

The Ribosome Shape Directs mRNA Translocation through Entrance and Exit Dynamics

USDA-ARS?s Scientific Manuscript database

The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs (transfer ribonucleic acids) and mRNA (messenger ribonucleic acid); here the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal struc...

Factors Affecting Nuclear Export of the 60S Ribosomal Subunit In Vivo

PubMed Central

Stage-Zimmermann, Tracy; Schmidt, Ute; Silver, Pamela A.

2000-01-01

In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ∼45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b–GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b–GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b–GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b–GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120. PMID:11071906

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

PubMed

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

Heat-induced ribosome pausing triggers mRNA co-translational decay in Arabidopsis thaliana

PubMed Central

Merret, Rémy; Nagarajan, Vinay K.; Carpentier, Marie-Christine; Park, Sunhee; Favory, Jean-Jacques; Descombin, Julie; Picart, Claire; Charng, Yee-yung; Green, Pamela J.; Deragon, Jean-Marc; Bousquet-Antonelli, Cécile

2015-01-01

The reprogramming of gene expression in heat stress is a key determinant to organism survival. Gene expression is downregulated through translation initiation inhibition and release of free mRNPs that are rapidly degraded or stored. In mammals, heat also triggers 5′-ribosome pausing preferentially on transcripts coding for HSC/HSP70 chaperone targets, but the impact of such phenomenon on mRNA fate remains unknown. Here, we provide evidence that, in Arabidopsis thaliana, heat provokes 5′-ribosome pausing leading to the XRN4-mediated 5′-directed decay of translating mRNAs. We also show that hindering HSC/HSP70 activity at 20°C recapitulates heat effects by inducing ribosome pausing and co-translational mRNA turnover. Strikingly, co-translational decay targets encode proteins with high HSC/HSP70 binding scores and hydrophobic N-termini, two characteristics that were previously observed for transcripts most prone to pausing in animals. This work suggests for the first time that stress-induced variation of translation elongation rate is an evolutionarily conserved process leading to the polysomal degradation of thousands of ‘non-aberrant’ mRNAs. PMID:25845591

Preparation of Total RNA from Fission Yeast.

PubMed

Bähler, Jürg; Wise, Jo Ann

2017-04-03

Treatment with hot phenol breaks open fission yeast cells and begins to strip away bound proteins from RNA. Deproteinization is completed by multiple extractions with chloroform/isoamyl alcohol and separation of the aqueous and organic phases using MaXtract gel, an inert material that acts as a physical barrier between the phases. The final step is concentration of the RNA by ethanol precipitation. The protocol can be used to prepare RNA from several cultures grown in parallel, but it is important not to process too many samples at once because delays can be detrimental to RNA quality. A reasonable number of samples to process at once would be three to four for microarray or RNA sequencing analyses and six for preliminary investigations of mutants implicated in RNA metabolism. © 2017 Cold Spring Harbor Laboratory Press.

The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs.

PubMed

Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum

2017-07-07

Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNA Lys (UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC.

Compilation of small ribosomal subunit RNA structures.

PubMed Central

Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

1993-01-01

The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].

PubMed

Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G

2007-01-01

The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.

Direct TFIIA-TFIID Protein Contacts Drive Budding Yeast Ribosomal Protein Gene Transcription*

PubMed Central

Layer, Justin H.; Weil, P. Anthony

2013-01-01

We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use

PubMed Central

Atkins, John F.; Loughran, Gary; Bhatt, Pramod R.; Firth, Andrew E.; Baranov, Pavel V.

2016-01-01

Genetic decoding is not ‘frozen’ as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational ‘correction’ of problem or ‘savior’ indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5′ or 3′ of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3′ from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. PMID:27436286

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

Review: transport of tRNA out of the nucleus-direct channeling to the ribosome?

PubMed

Grosshans, H; Simos, G; Hurt, E

2000-04-01

Although tRNA was the first substrate whose export from the nuclei of eukaryotic cells had been shown to be carrier-mediated and active, it has only been in the last 2 years that the first mechanistic details of this nucleocytoplasmic transport pathway have begun to emerge. A member of the importin/karyopherin beta superfamily, Los1p in yeast and Xpo-t in vertebrates, has been shown to export tRNA in cooperation with the small GTPase Ran (Gsp1p) from the nucleus into the cytoplasm, where tRNA becomes available for translation. However, Los1p is not essential for viability in yeast cells, suggesting that alternative tRNA export pathways exist. Recent results show that aminoacylation and a translation factor are also required for efficient nuclear tRNA export. Thus, protein translation and nuclear export of tRNA appear to be coupled processes. Copyright 2000 Academic Press.

An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations

PubMed Central

Kuhlmann, Micki M.; Chattopadhyay, Maitreyi; Stupina, Vera A.; Gao, Feng

2016-01-01

ABSTRACT Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3′ end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro. The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. IMPORTANCE Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to

mRNA Translation Gone Awry: Translation Fidelity and Neurological Disease.

PubMed

Kapur, Mridu; Ackerman, Susan L

2018-03-01

Errors during mRNA translation can lead to a reduction in the levels of functional proteins and an increase in deleterious molecules. Advances in next-generation sequencing have led to the discovery of rare genetic disorders, many caused by mutations in genes encoding the mRNA translation machinery, as well as to a better understanding of translational dynamics through ribosome profiling. We discuss here multiple neurological disorders that are linked to errors in tRNA aminoacylation and ribosome decoding. We draw on studies from genetic models, including yeast and mice, to enhance our understanding of the translational defects observed in these diseases. Finally, we emphasize the importance of tRNA, their associated enzymes, and the inextricable link between accuracy and efficiency in the maintenance of translational fidelity. Copyright © 2017 Elsevier Ltd. All rights reserved.

STUDIES ON THE ORIGIN OF RIBOSOMES IN AMOEBA PROTEUS

PubMed Central

Craig, Nessly; Goldstein, Lester

1969-01-01

The origin of cytoplasmic RNA and ribosomes was studied in Amoeba proteus by transplantation of a radioactive nucleus into an unlabeled cell followed by examination of the cytoplasm of the recipient for the presence of label. When a RNA-labeled nucleus was used, label appeared in the ribosomes, ribosomal RNA, and soluble RNA. Since the kinetics of appearance of labeled RNA indicates that the nucleus was not injured during the transfer, and since the transferred nuclear pool of labeled acid-soluble RNA precursors is inadequate to account for the amount of cytoplasmic RNA label, it is concluded that cytoplasmic ribosomal RNA is derived from acid-insoluble nuclear RNA and is probably transported as an intact molecule. Likewise, cytoplasmic soluble RNA probably originated in the nucleus, although labeling by terminal exchange in the cytoplasm is also possible. The results were completely different when a protein-labeled nucleus was grafted into an unlabeled host. In this case, label was found only in soluble proteins in the host cell cytoplasm, and there were no (or very few) radioactive ribosomes. This suggests that the nuclear pool of ribosomal protein and ribosomal protein precursors is relatively small and perhaps nonexistent (and, furthermore, shows that there was no cytoplasmic ribosomal contamination of the transferred nucleus). PMID:5765758

Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

NASA Technical Reports Server (NTRS)

Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

1999-01-01

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

Extrachromosomal Nucleolus-Like Compartmentalization by a Plasmid-Borne Ribosomal RNA Operon and Its Role in Nucleoid Compaction.

PubMed

Mata Martin, Carmen; Sun, Zhe; Zhou, Yan Ning; Jin, Ding Jun

2018-01-01

In the fast-growing Escherichia coli cells, RNA polymerase (RNAP) molecules are concentrated and form foci at clusters of ribosomal RNA (rRNA) operons resembling eukaryotic nucleolus. The bacterial nucleolus-like organization, spatially compartmentalized at the surface of the compact bacterial chromosome (nucleoid), serves as transcription factories for rRNA synthesis and ribosome biogenesis, which influences the organization of the nucleoid. Unlike wild type that has seven rRNA operons in the genome in a mutant that has six (Δ6 rrn ) rRNA operons deleted in the genome, there are no apparent transcription foci and the nucleoid becomes uncompacted, indicating that formation of RNAP foci requires multiple copies of rRNA operons clustered in space and is critical for nucleoid compaction. It has not been determined, however, whether a multicopy plasmid-borne rRNA operon (p rrnB ) could substitute the multiple chromosomal rRNA operons for the organization of the bacterial nucleolus-like structure in the mutants of Δ6 rrn and Δ7 rrn that has all seven rRNA operons deleted in the genome. We hypothesized that extrachromosomal nucleolus-like structures are similarly organized and functional in trans from p rrnB in these mutants. In this report, using multicolor images of three-dimensional superresolution Structured Illumination Microscopy (3D-SIM), we determined the distributions of both RNAP and NusB that are a transcription factor involved in rRNA synthesis and ribosome biogenesis, p rrnB clustering, and nucleoid structure in these two mutants in response to environmental cues. Our results found that the extrachromosomal nucleolus-like organization tends to be spatially located at the poles of the mutant cells. In addition, formation of RNAP foci at the extrachromosomal nucleolus-like structure condenses the nucleoid, supporting the idea that active transcription at the nucleolus-like organization is a driving force in nucleoid compaction.

Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

PubMed

Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

2018-04-21

Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

[Expression of the Drosophila melanogaster limk1 gene 3'-UTRs mRNA in Yeast Saccharomyces cerevisiae].

PubMed

Rumyantsev, A M; Zakharov, G A; Zhuravlev, A V; Padkina, M V; Savvateeva-Popova, E V; Sambuk, E V

2014-06-01

The stability of mRNA and its translation efficacy in higher eukaryotes are influenced by the interaction of 3'-untranscribed regions (3'-UTRs) with microRNAs and RNA-binding proteins. Since Saccharomyces cerevisiae lack microRNAs, it is possible to evaluate the contribution of only 3'-UTRs' and RNA-binding proteins' interaction in post-transcriptional regulation. For this, the post-transcriptional regulation of Drosophila limk1 gene encoding for the key enzyme of actin remodeling was studied in yeast. Analysis of limkl mRNA 3'-UTRs revealed the potential sites of yeast transcriptional termination. Computer remodeling demonstrated the possibility of secondary structure formation in limkl mRNA 3'-UTRs. For an evaluation of the functional activity of Drosophila 3'-UTRs in yeast, the reporter gene PHO5 encoding for yeast acid phosphatase (AP) fused to different variants of Drosophila limk1 mRNA 3'-UTRs (513, 1075, 1554 bp) was used. Assessments of AP activity and RT-PCR demonstrated that Drosophila limkl gene 3'-UTRs were functionally active and recognized in yeast. Therefore, yeast might be used as an appropriate model system for studies of 3'-UTR's role in post-transcriptional regulation.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Role of a ribosomal RNA phosphate oxygen during the EF-G–triggered GTP hydrolysis

PubMed Central

Koch, Miriam; Flür, Sara; Kreutz, Christoph; Ennifar, Eric; Micura, Ronald; Polacek, Norbert

2015-01-01

Elongation factor-catalyzed GTP hydrolysis is a key reaction during the ribosomal elongation cycle. Recent crystal structures of G proteins, such as elongation factor G (EF-G) bound to the ribosome, as well as many biochemical studies, provide evidence that the direct interaction of translational GTPases (trGTPases) with the sarcin-ricin loop (SRL) of ribosomal RNA (rRNA) is pivotal for hydrolysis. However, the precise mechanism remains elusive and is intensively debated. Based on the close proximity of the phosphate oxygen of A2662 of the SRL to the supposedly catalytic histidine of EF-G (His87), we probed this interaction by an atomic mutagenesis approach. We individually replaced either of the two nonbridging phosphate oxygens at A2662 with a methyl group by the introduction of a methylphosphonate instead of the natural phosphate in fully functional, reconstituted bacterial ribosomes. Our major finding was that only one of the two resulting diastereomers, the SP methylphosphonate, was compatible with efficient GTPase activation on EF-G. The same trend was observed for a second trGTPase, namely EF4 (LepA). In addition, we provide evidence that the negative charge of the A2662 phosphate group must be retained for uncompromised activity in GTP hydrolysis. In summary, our data strongly corroborate that the nonbridging proSP phosphate oxygen at the A2662 of the SRL is critically involved in the activation of GTP hydrolysis. A mechanistic scenario is supported in which positioning of the catalytically active, protonated His87 through electrostatic interactions with the A2662 phosphate group and H-bond networks are key features of ribosome-triggered activation of trGTPases. PMID:25941362

Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus

PubMed Central

Liu, Xiao-Dan; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang

2014-01-01

Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Sequence alignment revealed that AgRPL44 is one of the proteins of the large ribosomal subunit 60S. Expression of AgRPL44 was upregulated via treatment with salt, sorbitol, or heavy metals to demonstrate its response to osmotic stress. A homologous sequence from the model fungus Magnaporthe oryzae, MoRPL44, was cloned and compared with AgRPL44 in a yeast expression system. The results indicated that yeast cells with overexpressed AgRPL44 were more resistant to salt, drought, and heavy metals than were yeast cells expressing MoRPL44 at a similar level of stress. When AgRPL44 was introduced into M. oryzae, the transformants displayed obviously enhanced tolerance to salt and drought, indicating the potential value of AgRPL44 for genetic applications. To verify the value of its application in plants, tobacco was transformed with AgRPL44, and the results were similar. Taken together, we conclude that AgRPL44 supports abiotic stress resistance and may have value for genetic application. PMID:24814782

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

PubMed Central

Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

2012-01-01

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

PubMed

Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

2012-04-17

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster

PubMed Central

Dunn, Joshua G; Foo, Catherine K; Belletier, Nicolette G; Gavis, Elizabeth R; Weissman, Jonathan S

2013-01-01

Ribosomes can read through stop codons in a regulated manner, elongating rather than terminating the nascent peptide. Stop codon readthrough is essential to diverse viruses, and phylogenetically predicted to occur in a few hundred genes in Drosophila melanogaster, but the importance of regulated readthrough in eukaryotes remains largely unexplored. Here, we present a ribosome profiling assay (deep sequencing of ribosome-protected mRNA fragments) for Drosophila melanogaster, and provide the first genome-wide experimental analysis of readthrough. Readthrough is far more pervasive than expected: the vast majority of readthrough events evolved within D. melanogaster and were not predicted phylogenetically. The resulting C-terminal protein extensions show evidence of selection, contain functional subcellular localization signals, and their readthrough is regulated, arguing for their importance. We further demonstrate that readthrough occurs in yeast and humans. Readthrough thus provides general mechanisms both to regulate gene expression and function, and to add plasticity to the proteome during evolution. DOI: http://dx.doi.org/10.7554/eLife.01179.001 PMID:24302569

Factors beyond Enolase 2 and Mitochondrial Lysyl-tRNA Synthetase Precursor Are Required for tRNA Import into Yeast Mitochondria.

PubMed

Baleva, M V; Meyer, M; Entelis, N; Tarassov, I; Kamenski, P; Masquida, B

2017-11-01

In yeast, the import of tRNA Lys with CUU anticodon (tRK1) relies on a complex mechanism where interaction with enolase 2 (Eno2p) dictates a deep conformational change of the tRNA. This event is believed to mask the tRNA from the cytosolic translational machinery to re-direct it towards the mitochondria. Once near the mitochondrial outer membrane, the precursor of the mitochondrial lysyl-tRNA synthetase (preMsk1p) takes over enolase to carry the tRNA within the mitochondrial matrix, where it is supposed to participate in translation following correct refolding. Biochemical data presented in this report focus on the role of enolase. They show that despite the inability of Eno2p alone to form a complex with tRK1, mitochondrial import can be recapitulated in vitro using fractions of yeast extracts sharing either recombinant or endogenous yeast Eno2p as one of the main components. Taken together, our data suggest the existence of a protein complex containing Eno2p that is involved in RNA mitochondrial import.

In vitro transcription of a cloned mouse ribosomal RNA gene.

PubMed Central

Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M

1981-01-01

An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

PubMed

Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

2016-09-06

Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

NMR structure of the Aquifex aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation

PubMed Central

Nonin-Lecomte, Sylvie; Felden, Brice; Dardel, Frédéric

2006-01-01

The transfer-messenger RNA (tmRNA) pseudoknot PK1 is essential for bacterial trans-translation, a ribosomal rescue mechanism. We report the solution structure of PK1 from Aquifex aeolicus, which despite an unprecedented small number of nucleotides and thus an unprecented compact size, displays a very high thermal stability. Several unusual structural features account for these properties and indicate that PK1 belongs to the class of ribosomal frameshift pseudoknots. This suggests a similarity between the mechanism of programmed ribosomal frameshifting and trans-translation. PMID:16595798

NMR structure of the Aquifex aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation.

PubMed

Nonin-Lecomte, Sylvie; Felden, Brice; Dardel, Frédéric

2006-01-01

The transfer-messenger RNA (tmRNA) pseudoknot PK1 is essential for bacterial trans-translation, a ribosomal rescue mechanism. We report the solution structure of PK1 from Aquifex aeolicus, which despite an unprecedented small number of nucleotides and thus an unprecented compact size, displays a very high thermal stability. Several unusual structural features account for these properties and indicate that PK1 belongs to the class of ribosomal frameshift pseudoknots. This suggests a similarity between the mechanism of programmed ribosomal frameshifting and trans-translation.

Eigenvectors determination of the ribosome dynamics model during mRNA translation using the Kleene Star algorithm

NASA Astrophysics Data System (ADS)

Ernawati; Carnia, E.; Supriatna, A. K.

2018-03-01

Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.

Yeast Diversity and Persistence in Botrytis-Affected Wine Fermentations

PubMed Central

Mills, David A.; Johannsen, Eric A.; Cocolin, Luca

2002-01-01

Culture-dependent and -independent methods were used to examine the yeast diversity present in botrytis-affected (“botrytized”) wine fermentations carried out at high (∼30°C) and ambient (∼20°C) temperatures. Fermentations at both temperatures possessed similar populations of Saccharomyces, Hanseniaspora, Pichia, Metschnikowia, Kluyveromyces, and Candida species. However, higher populations of non-Saccharomyces yeasts persisted in ambient-temperature fermentations, with Candida and, to a lesser extent, Kluyveromyces species remaining long after the fermentation was dominated by Saccharomyces. In general, denaturing gradient gel electrophoresis profiles of yeast ribosomal DNA or rRNA amplified from the fermentation samples correlated well with the plating data. The direct molecular methods also revealed a Hanseniaspora osmophila population not identified in the plating analysis. rRNA analysis also indicated a large population (>106 cells per ml) of a nonculturable Candida strain in the high-temperature fermentation. Monoculture analysis of the Candida isolate indicated an extreme fructophilic phenotype and correlated with an increased glucose/fructose ratio in fermentations containing higher populations of Candida. Analysis of wine fermentation microbial ecology by using both culture-dependent and -independent methods reveals the complexity of yeast interactions enriched during spontaneous fermentations. PMID:12324335

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Dual Role of a SAS10/C1D Family Protein in Ribosomal RNA Gene Expression and Processing Is Essential for Reproduction in Arabidopsis thaliana

PubMed Central

Chen, Ying-Jiun C.; Wang, Huei-Jing

2016-01-01

In eukaryotic cells, ribosomal RNAs (rRNAs) are transcribed, processed, and assembled with ribosomal proteins in the nucleolus. Regulatory mechanisms of rRNA gene (rDNA) transcription and processing remain elusive in plants, especially their connection to nucleolar organization. We performed an in silico screen for essential genes of unknown function in Arabidopsis thaliana and identified Thallo (THAL) encoding a SAS10/C1D family protein. THAL disruption caused enlarged nucleoli in arrested embryos, aberrant processing of precursor rRNAs at the 5’ External Transcribed Spacer, and repression of the major rDNA variant (VAR1). THAL overexpression lines showed de-repression of VAR1 and overall reversed effects on rRNA processing sites. Strikingly, THAL overexpression also induced formation of multiple nucleoli per nucleus phenotypic of mutants of heterochromatin factors. THAL physically associated with histone chaperone Nucleolin 1 (NUC1), histone-binding NUC2, and histone demethylase Jumonji 14 (JMJ14) in bimolecular fluorescence complementation assay, suggesting that it participates in chromatin regulation. Furthermore, investigation of truncated THAL proteins revealed that the SAS10 C-terminal domain is likely important for its function in chromatin configuration. THAL also interacted with putative Small Subunit processome components, including previously unreported Arabidopsis homologue of yeast M Phase Phosphoprotein 10 (MPP10). Our results uncovering the dual role of THAL in transcription and processing events critical for proper rRNA biogenesis and nucleolar organization during reproduction are the first to define the function of SAS10/C1D family members in plants. PMID:27792779

A Specific Hepatic Transfer RNA for Phosphoserine*

PubMed Central

Mäenpää, Pekka H.; Bernfield, Merton R.

1970-01-01

Radioactive O-phosphoryl-L-serine was detected after alkaline deacylation of rat and rooster liver [3H]seryl-tRNA acylated in vitro with homologous synthetases. Ribonuclease treatment of this tRNA yielded a compound with the properties of phosphoseryl-adenosine. Benzoylated DEAE-cellulose chromatography of seryl-tRNA yielded four distinct peaks, only one of which contained phosphoserine. A unique fraction for phosphoserine was also found on chromatography of nonacylated tRNA. In ribosome binding studies, this fraction responded very slightly with poly(U,C), but not with any of the known serine trinucleotide codons. Substantial incorporation of [3H]-serine into protein from this tRNA species was observed in an aminoacyl-tRNA dependent polysomal system derived from chick oviducts. No phosphoserine was found in Escherichia coli or yeast seryl-tRNA acylated with homologous enzymes, nor in E. coli seryl-tRNA acylated with liver synthetase. In the absence of tRNA, free phosphoserine was not formed in reaction mixtures, which suggests that phosphoseryl-tRNA arises by phosphorylation of the unique seryl-tRNA species. These results demonstrate a discrete tRNASer species in rat and rooster liver containing phosphoserine and suggest that this tRNA is involved in ribosomal polypeptide synthesis. PMID:4943179

Yeast RNA viruses as indicators of exosome activity: human exosome hCsl4p participates in RNA degradation in Saccharomyces cerevisiae'.

PubMed

Ramírez-Garrastacho, Manuel; Esteban, Rosa

2011-12-01

The exosome is an evolutionarily conserved 10-mer complex involved in RNA metabolism, located in both the nucleus and the cytoplasm. The cytoplasmic exosome plays an important role in mRNA turnover through its 3'→5' exonucleolytic activity. The superkiller (SKI) phenotype of yeast was originally identified as an increase of killer toxin production due to elevated levels of the L-A double-stranded RNA (dsRNA) Totivirus and its satellite toxin-encoding M dsRNA. Most SKI genes were later shown to be either components of the exosome or modulators of its activity. Variations in the amount of Totivirus are, thus, good indicators of yeast exosome activity, and can be used to analyse its components. Furthermore, if exosome proteins of higher eukaryotes were functional in S. cerevisiae, these viruses would provide a simple tool to analyse their function. In this work, we have found that hCSL4, the human orthologue of SKI4 in the yeast exosome, rescues the null phenotype of the deletion mutant. hCsl4p shares with Ski4p conserved S1 RNA-binding domains, but lacks the N-terminal third of Ski4p. Nevertheless, it interacts with the Dis3p exonuclease of yeast exosome, and partially complements the superkiller phenotype of ski4-1 mutation. The elimination of the N-terminal third of Ski4p does not affect its activity, indicating that it is dispensable for RNA degradation. We have also identified the point mutation G152E in hCSL4, equivalent to the ski4-1 mutation G253E, which impairs the activity of the protein, thus validating our approach of using yeast RNA virus to analyse the exosome of higher eukaryotes. Copyright © 2011 John Wiley & Sons, Ltd.

Entrapping ribosomes for viral translation: tRNA mimicry as a molecular Trojan horse.

PubMed

Barends, Sharief; Bink, Hugo H J; van den Worm, Sjoerd H E; Pleij, Cornelis W A; Kraal, Barend

2003-01-10

Turnip yellow mosaic virus (TYMV) has a genomic plus-strand RNA with a 5' cap followed by overlapping and different reading frames for the movement protein and polyprotein, while the distal coat protein cistron is translated from a subgenomic RNA. The 3'-untranslated region harbors a tRNA-like structure (TLS) to which a valine moiety can be added and it is indispensable for virus viability. Here, we report about a surprising interaction between TYMV-RNA-programmed ribosomes and 3'-valylated TLS that yields polyprotein with the valine N terminally incorporated by a translation mechanism resistant to regular initiation inhibitors. Disruption of the TLS exclusively abolishes polyprotein synthesis, which can be restored by adding excess TLS in trans. Our observations imply a novel eukaryotic mechanism for internal initiation of mRNA translation.

Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans

PubMed Central

Mitrovich, Quinn M.; Anderson, Philip

2000-01-01

Messenger RNA surveillance, the selective and rapid degradation of mRNAs containing premature stop codons, occurs in all eukaryotes tested. The biological role of this decay pathway, however, is not well understood. To identify natural substrates of mRNA surveillance, we used a cDNA-based representational difference analysis to identify mRNAs whose abundance increases in Caenorhabditis elegans smg(−) mutants, which are deficient for mRNA surveillance. Alternatively spliced mRNAs of genes encoding ribosomal proteins L3, L7a, L10a, and L12 are abundant natural targets of mRNA surveillance. Each of these genes expresses two distinct mRNAs. A productively spliced mRNA, whose abundance does not change in smg(−) mutants, encodes a normal, full-length, ribosomal protein. An unproductively spliced mRNA, whose abundance increases dramatically in smg(−) mutants, contains premature stop codons because of incomplete removal of an alternatively spliced intron. In transgenic animals expressing elevated quantities of RPL-12, a greater proportion of endogenous rpl-12 transcript is spliced unproductively. Thus, RPL-12 appears to autoregulate its own splicing, with unproductively spliced mRNAs being degraded by mRNA surveillance. We demonstrate further that alternative splicing of rpl introns is conserved among widely diverged nematodes. Our results suggest that one important role of mRNA surveillance is to eliminate unproductive by-products of gene regulation. PMID:10970881

Reengineering ribosome export.

PubMed

Lo, Kai-Yin; Johnson, Arlen W

2009-03-01

Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.

Reengineering Ribosome Export

PubMed Central

Lo, Kai-Yin

2009-01-01

Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820

The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

PubMed Central

Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

2015-01-01

Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

RNA regulators responding to ribosomal protein S15 are frequent in sequence space

PubMed Central

Slinger, Betty L.; Meyer, Michelle M.

2016-01-01

There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

Structural insights into the role of diphthamide on elongation factor 2 in messenger RNA reading frame maintenance.

PubMed

Pellegrino, Simone; Demeshkina, Natalia; Mancera-Martinez, Eder; Melnikov, Sergey; Simonetti, Angelita; Myasnikov, Alexander; Yusupov, Marat; Yusupova, Gulnara; Hashem, Yaser

2018-06-07

One of the most critical steps of protein biosynthesis is the coupled movement of messenger RNA (mRNA), that encodes genetic information, with transfer RNAs (tRNAs) on the ribosome. In eukaryotes this process is catalyzed by a conserved G-protein, the elongation factor 2 (eEF2), which carries a unique post-translational modification, called diphthamide, found in all eukaryotic species. Here we present near-atomic resolution cryo-EM structures of yeast 80S ribosome complexes containing mRNA, tRNA and eEF2 trapped in different GTP-hydrolysis states which provide further structural insights on the role of diphthamide in the mechanism of translation fidelity in eukaryotes. Copyright © 2018. Published by Elsevier Ltd.

Unexpected expansion of tRNA substrate recognition by the yeast m1G9 methyltransferase Trm10.

PubMed

Swinehart, William E; Henderson, Jeremy C; Jackman, Jane E

2013-08-01

N-1 Methylation of the nearly invariant purine residue found at position 9 of tRNA is a nucleotide modification found in multiple tRNA species throughout Eukarya and Archaea. First discovered in Saccharomyces cerevisiae, the tRNA methyltransferase Trm10 is a highly conserved protein both necessary and sufficient to catalyze all known instances of m1G9 modification in yeast. Although there are 19 unique tRNA species that contain a G at position 9 in yeast, and whose fully modified sequence is known, only 9 of these tRNA species are modified with m1G9 in wild-type cells. The elements that allow Trm10 to distinguish between structurally similar tRNA species are not known, and sequences that are shared between all substrate or all nonsubstrate tRNAs have not been identified. Here, we demonstrate that the in vitro methylation activity of yeast Trm10 is not sufficient to explain the observed pattern of modification in vivo, as additional tRNA species are substrates for Trm10 m1G9 methyltransferase activity. Similarly, overexpression of Trm10 in yeast yields m1G9 containing tRNA species that are ordinarily unmodified in vivo. Thus, yeast Trm10 has a significantly broader tRNA substrate specificity than is suggested by the observed pattern of modification in wild-type yeast. These results may shed light onto the suggested involvement of Trm10 in other pathways in other organisms, particularly in higher eukaryotes that contain up to three different genes with sequence similarity to the single TRM10 gene in yeast, and where these other enzymes have been implicated in pathways beyond tRNA processing.

Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

NASA Astrophysics Data System (ADS)

Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

2017-01-01

Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

NASA Technical Reports Server (NTRS)

Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

1985-01-01

The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

Occurrence of 20S RNA and 23S RNA replicons in industrial yeast strains and their variation under nutritional stress conditions.

PubMed

López, Victoria; Gil, Rosario; Vicente Carbonell, José; Navarro, Alfonso

2002-04-01

We have characterized industrial yeast strains used in the brewing, baking, and winemaking industries for the presence or absence of cytoplasmic single-stranded 20S and 23S RNAs. Furthermore, the variation of intracellular concentrations of these replicons in brewing and laboratory strains under nutritional stress conditions was determined. Our results show a correlation between the relative abundance of these replicons and exposure of yeast to nutritionally stressful conditions, indicating that these RNAs could be employed as molecular probes to evaluate the exposure of 20S(+) and/or 23S(+) yeast strains to stress situations during industrial manipulation. During this study, several 20S(-)23S(+) Saccharomyces cerevisiae strains were isolated and identified. This is the first time that a yeast strain containing only 23S RNA has been reported, demonstrating that 20S RNA is not required for 23S RNA replication. Copyright 2002 John Wiley & Sons, Ltd.

[C-terminal fragment of ribosomal protein S15 is located at the decoding site of the human ribosome].

PubMed

Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'iaminova, A G; Karpova, G G

2008-01-01

Protein S15 is a characteristic component of the mammalian 80S ribosome that neighbors mRNA codon at the decoding site and the downstream triplets. In this study we determined S15 protein fragments located close to mRNA positions +4 to +12 with respect to the first nucleotide of the P site codon on the human ribosome. For cross-linking to ribosomal protein S15, a set of mRNA was used that contained triplet UUU/UUC at the 5'-termini and a perfluorophenyl azide-modified uridine in position 3' of this triplet. The locations of mRNA analogues on the ribosome were governed by tRNAPhe cognate to the UUU/UUC triplet targeted to the P site. Cross-linked S15 protein was isolated from the irradiated with mild UV light complexes of 80S ribosomes with tRNAPhe and mRNA analogues with subsequent cleavage with CNBr that splits polypeptide chain after methionines. Analysis of modified oligopeptides resulted from the cleavage revealed that in all cases cross-linking site was located in C-terminal fragment 111-145 of protein S15 indicating that this fragment is involved in formation of decoding site of the eukaryotic ribosome.

mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.

PubMed

Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G

2006-07-01

Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.

The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA.

PubMed

Kapranov, Philipp; St Laurent, Georges; Raz, Tal; Ozsolak, Fatih; Reynolds, C Patrick; Sorensen, Poul H B; Reaman, Gregory; Milos, Patrice; Arceci, Robert J; Thompson, John F; Triche, Timothy J

2010-12-21

Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs) regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs), as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA), can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb) in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long, intergenic transcribed regions that could be involved in

The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs

PubMed Central

Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum

2017-01-01

Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNALys(UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC. PMID:28685749

Stiffened yeast telomerase RNA supports RNP function in vitro and in vivo

PubMed Central

Lebo, Kevin J.; Zappulla, David C.

2012-01-01

The 1157-nt Saccharomyces cerevisiae telomerase RNA, TLC1, in addition to providing a 16-nt template region for reverse transcription, has been proposed to act as a scaffold for protein subunits. Although accessory subunits of the telomerase ribonucleoprotein (RNP) complex function even when their binding sites are relocated on the yeast telomerase RNA, the physical nature of the RNA scaffold has not been directly analyzed. Here we explore the structure–function organization of the yeast telomerase RNP by extensively stiffening the three long arms of TLC1, which connect essential and important accessory protein subunits Ku, Est1, and Sm7, to its central catalytic hub. This 956-nt triple-stiff-arm TLC1 (TSA-T) reconstitutes active telomerase with TERT (Est2) in vitro. Furthermore, TSA-T functions in vivo, even maintaining longer telomeres than TLC1 on a per RNA basis. We also tested functional contributions of each stiffened arm within TSA-T and found that the stiffened Est1 and Ku arms contribute to telomere lengthening, while stiffening the terminal arm reduces telomere length and telomerase RNA abundance. The fact that yeast telomerase tolerates significant stiffening of its RNA subunit in vivo advances our understanding of the architectural and functional organization of this RNP and, more broadly, our conception of the world of lncRNPs. PMID:22850424

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

DNA replication stress restricts ribosomal DNA copy number

PubMed Central

Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

2017-01-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

DNA replication stress restricts ribosomal DNA copy number.

PubMed

Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

2017-09-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction

PubMed Central

Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard

2017-01-01

Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666

Expression of Functional Influenza Virus RNA Polymerase in the Methylotrophic Yeast Pichia pastoris

PubMed Central

Hwang, Jung-Shan; Yamada, Kazunori; Honda, Ayae; Nakade, Kohji; Ishihama, Akira

2000-01-01

Influenza virus RNA polymerase with the subunit composition PB1-PB2-PA is a multifunctional enzyme with the activities of both synthesis and cleavage of RNA and is involved in both transcription and replication of the viral genome. In order to produce large amounts of the functional viral RNA polymerase sufficient for analysis of its structure-function relationships, the cDNAs for RNA segments 1, 2, and 3 of influenza virus A/PR/8, each under independent control of the alcohol oxidase gene promoter, were integrated into the chromosome of the methylotrophic yeast Pichia pastoris. Simultaneous expression of all three P proteins in the yeast P. pastoris was achieved by the addition of methanol. To purify the P protein complexes, a sequence coding for a histidine tag was added to the PB2 protein gene at its N terminus. Starting from the induced P. pastoris cell lysate, we partially purified a 3P complex by Ni2+-agarose affinity column chromatography. The 3P complex showed influenza virus model RNA-directed and ApG-primed RNA synthesis in vitro but was virtually inactive without addition of template or primer. The kinetic properties of model template-directed RNA synthesis and the requirements for template sequence were analyzed using the 3P complex. Furthermore, the 3P complex showed capped RNA-primed RNA synthesis. Thus, we conclude that functional influenza virus RNA polymerase with the catalytic properties of a transcriptase is formed in the methylotrophic yeast P. pastoris. PMID:10756019

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Thermodynamics of the pseudo-knot in helix 18 of 16S ribosomal RNA.

PubMed

Wojciechowska, Monika; Dudek, Marta; Trylska, Joanna

2018-04-01

A fragment of E. coli 16S rRNA formed by nucleotides 500 to 545 is termed helix 18. Nucleotides 505-507 and 524-526 form a pseudo-knot and its distortion affects ribosome function. Helix 18 isolated from the ribosome context is thus an interesting fragment to investigate the structural properties and folding of RNA with pseudo-knots. With all-atom molecular dynamics simulations, spectroscopic and gel electrophoresis experiments, we investigated thermodynamics of helix 18, with a focus on its pseudo-knot. In solution studies at ambient conditions we observed dimerization of helix 18. We proposed that the loop, containing nucleotides forming the pseudo-knot, interacts with another monomer of helix 18. The native dimer is difficult to break but introducing mutations in the pseudo-knot indeed assured a monomeric form of helix 18. Molecular dynamics simulations at 310 K confirmed the stability of the pseudo-knot but at elevated temperatures this pseudo-knot was the first part of helix 18 to lose the hydrogen bond pattern. To further determine helix 18 stability, we analyzed the interactions of helix 18 with short oligomers complementary to a nucleotide stretch containing the pseudo-knot. The formation of higher-order structures by helix 18 impacts hybridization efficiency of peptide nucleic acid and 2'-O methyl RNA oligomers. © 2018 Wiley Periodicals, Inc.

TIF-IA-dependent regulation of ribosome synthesis in drosophila muscle is required to maintain systemic insulin signaling and larval growth.

PubMed

Ghosh, Abhishek; Rideout, Elizabeth J; Grewal, Savraj S

2014-10-01

The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs) from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.

TIF-IA-Dependent Regulation of Ribosome Synthesis in Drosophila Muscle Is Required to Maintain Systemic Insulin Signaling and Larval Growth

PubMed Central

Ghosh, Abhishek; Rideout, Elizabeth J.; Grewal, Savraj S.

2014-01-01

The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis—a limiting step in ribosome biogenesis—via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs) from the brain and increased expression of Imp-L2—a secreted factor that binds and inhibits dILP activity—from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis. PMID:25356674

Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria.

PubMed

Yoshihisa, Tohru; Yunoki-Esaki, Kaori; Ohshima, Chie; Tanaka, Nobuyuki; Endo, Toshiya

2003-08-01

Pre-tRNA splicing has been believed to occur in the nucleus. In yeast, the tRNA splicing endonuclease that cleaves the exon-intron junctions of pre-tRNAs consists of Sen54p, Sen2p, Sen34p, and Sen15p and was thought to be an integral membrane protein of the inner nuclear envelope. Here we show that the majority of Sen2p, Sen54p, and the endonuclease activity are not localized in the nucleus, but on the mitochondrial surface. The endonuclease is peripherally associated with the cytosolic surface of the outer mitochondrial membrane. A Sen54p derivative artificially fixed on the mitochondria as an integral membrane protein can functionally replace the authentic Sen54p, whereas mutant proteins defective in mitochondrial localization are not fully active. sen2 mutant cells accumulate unspliced pre-tRNAs in the cytosol under the restrictive conditions, and this export of the pre-tRNAs partly depends on Los1p, yeast exportin-t. It is difficult to explain these results from the view of tRNA splicing in the nucleus. We rather propose a new possibility that tRNA splicing occurs on the mitochondrial surface in yeast.

Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jun; McCann, Kathleen L.; Qiu, Chen

Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C’-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease,more » Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins.« less

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

PubMed Central

Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

1971-01-01

Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

High-resolution structure of the Escherichia coli ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.

Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

High-resolution structure of the Escherichia coli ribosome

DOE PAGES

Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; ...

2015-03-16

Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation.

PubMed

Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude

2004-05-01

The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.

Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe

PubMed Central

Duhig, Trevor; Nam, Miyoung; Palmer, Georgia; Han, Sangjo; Jeffery, Linda; Baek, Seung-Tae; Lee, Hyemi; Shim, Young Sam; Lee, Minho; Kim, Lila; Heo, Kyung-Sun; Noh, Eun Joo; Lee, Ah-Reum; Jang, Young-Joo; Chung, Kyung-Sook; Choi, Shin-Jung; Park, Jo-Young; Park, Youngwoo; Kim, Hwan Mook; Park, Song-Kyu; Park, Hae-Joon; Kang, Eun-Jung; Kim, Hyong Bai; Kang, Hyun-Sam; Park, Hee-Moon; Kim, Kyunghoon; Song, Kiwon; Song, Kyung Bin; Nurse, Paul; Hoe, Kwang-Lae

2014-01-01

SUMMARY We report the construction and analysis of 4,836 heterozygous diploid deletion mutants covering 98.4% of the fission yeast genome. This resource provides a powerful tool for biotechnological and eukaryotic cell biology research. Comprehensive gene dispensability comparisons with budding yeast, the first time such studies have been possible between two eukaryotes, revealed that 83% of single copy orthologues in the two yeasts had conserved dispensability. Gene dispensability differed for certain pathways between the two yeasts, including mitochondrial translation and cell cycle checkpoint control. We show that fission yeast has more essential genes than budding yeast and that essential genes are more likely than non-essential genes to be single copy, broadly conserved and to contain introns. Growth fitness analyses determined sets of haploinsufficient and haploproficient genes for fission yeast, and comparisons with budding yeast identified specific ribosomal proteins and RNA polymerase subunits, which may act more generally to regulate eukaryotic cell growth. PMID:20473289

Akt activation enhances ribosomal RNA synthesis through casein kinase II and TIF-IA.

PubMed

Nguyen, Le Xuan Truong; Mitchell, Beverly S

2013-12-17

Transcription initiation factor I (TIF-IA) plays an essential role in regulating ribosomal RNA (rRNA) synthesis by tethering RNA polymerase I (Pol I) to the rDNA promoter. We have found that activated Akt enhances rRNA synthesis through the phosphorylation of casein kinase IIα (CK2α) on a threonine residue near its N terminus. CK2 in turn phosphorylates TIF-IA, thereby increasing rDNA transcription. Activated Akt also stabilizes TIF-IA, induces its translocation to the nucleolus, and enhances its interaction with Pol I. Treatment with AZD8055, an inhibitor of both Akt and mammalian target of rapamycin phosphorylation, but not with rapamycin, disrupts Akt-mediated TIF-IA stability, translocation, and activity. These data support a model in which activated Akt enhances rRNA synthesis both by preventing TIF-IA degradation and phosphorylating CK2α, which in turn phosphorylates TIF-IA. This model provides an explanation for the ability of activated Akt to promote cell proliferation and, potentially, transformation.

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

PubMed

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

Spatial organization and dynamics of RNase E and ribosomes in Caulobacter crescentus.

PubMed

Bayas, Camille A; Wang, Jiarui; Lee, Marissa K; Schrader, Jared M; Shapiro, Lucy; Moerner, W E

2018-04-17

We report the dynamic spatial organization of Caulobacter crescentus RNase E (RNA degradosome) and ribosomal protein L1 (ribosome) using 3D single-particle tracking and superresolution microscopy. RNase E formed clusters along the central axis of the cell, while weak clusters of ribosomal protein L1 were deployed throughout the cytoplasm. These results contrast with RNase E and ribosome distribution in Escherichia coli , where RNase E colocalizes with the cytoplasmic membrane and ribosomes accumulate in polar nucleoid-free zones. For both RNase E and ribosomes in Caulobacter , we observed a decrease in confinement and clustering upon transcription inhibition and subsequent depletion of nascent RNA, suggesting that RNA substrate availability for processing, degradation, and translation facilitates confinement and clustering. Importantly, RNase E cluster positions correlated with the subcellular location of chromosomal loci of two highly transcribed rRNA genes, suggesting that RNase E's function in rRNA processing occurs at the site of rRNA synthesis. Thus, components of the RNA degradosome and ribosome assembly are spatiotemporally organized in Caulobacter , with chromosomal readout serving as the template for this organization.

Heat Shock Response in Yeast Involves Changes in Both Transcription Rates and mRNA Stabilities

PubMed Central

Castells-Roca, Laia; García-Martínez, José; Moreno, Joaquín; Herrero, Enrique; Bellí, Gemma; Pérez-Ortín, José E.

2011-01-01

We have analyzed the heat stress response in the yeast Saccharomyces cerevisiae by determining mRNA levels and transcription rates for the whole transcriptome after a shift from 25°C to 37°C. Using an established mathematical algorithm, theoretical mRNA decay rates have also been calculated from the experimental data. We have verified the mathematical predictions for selected genes by determining their mRNA decay rates at different times during heat stress response using the regulatable tetO promoter. This study indicates that the yeast response to heat shock is not only due to changes in transcription rates, but also to changes in the mRNA stabilities. mRNA stability is affected in 62% of the yeast genes and it is particularly important in shaping the mRNA profile of the genes belonging to the environmental stress response. In most cases, changes in transcription rates and mRNA stabilities are homodirectional for both parameters, although some interesting cases of antagonist behavior are found. The statistical analysis of gene targets and sequence motifs within the clusters of genes with similar behaviors shows that both transcriptional and post-transcriptional regulons apparently contribute to the general heat stress response by means of transcriptional factors and RNA binding proteins. PMID:21364882

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Antibody-ribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites.

PubMed Central

He, M; Taussig, M J

1997-01-01

We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries. PMID:9396828

Antibody-ribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites.

PubMed

He, M; Taussig, M J

1997-12-15

We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

PubMed

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

PubMed Central

2016-01-01

The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

PubMed

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

RNA Export through the NPC in Eukaryotes.

PubMed

Okamura, Masumi; Inose, Haruko; Masuda, Seiji

2015-03-20

In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.

Single Molecule Force Measurement for Protein Synthesis on the Ribosome

NASA Astrophysics Data System (ADS)

Uemura, Sotaro

2008-04-01

The ribosome is a molecular machine that translates the genetic code described on the messenger RNA (mRNA) into an amino acid sequence through repetitive cycles of transfer RNA (tRNA) selection, peptide bond formation and translocation. Although the detailed interactions between the translation components have been revealed by extensive structural and biochemical studies, it is not known how the precise regulation of macromolecular movements required at each stage of translation is achieved. Here we demonstrate an optical tweezer assay to measure the rupture force between a single ribosome complex and mRNA. The rupture force was compared between ribosome complexes assembled on an mRNA with and without a strong Shine-Dalgarno (SD) sequence. The removal of the SD sequence significantly reduced the rupture force, indicating that the SD interactions contribute significantly to the stability of the ribosomal complex on the mRNA in a pre-peptidyl transfer state. In contrast, the post-peptidyl transfer state weakened the rupture force as compared to the complex in a pre-peptidyl transfer state and it was the same for both the SD-containing and SD-deficient mRNAs. The results suggest that formation of the first peptide bond destabilizes the SD interaction, resulting in the weakening of the force with which the ribosome grips an mRNA. This might be an important requirement to facilitate movement of the ribosome along mRNA during the first translocation step. In this article, we discuss about the above new results including the introduction of the ribosome translation mechanism and the optical tweezer method.

The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

PubMed Central

De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

1992-01-01

The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

PubMed

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

Escherichia coli Ribosomal Protein S1 Unfolds Structured mRNAs Onto the Ribosome for Active Translation Initiation

PubMed Central

Duval, Mélodie; Korepanov, Alexey; Fuchsbauer, Olivier; Fechter, Pierre; Haller, Andrea; Fabbretti, Attilio; Choulier, Laurence; Micura, Ronald; Klaholz, Bruno P.; Romby, Pascale; Springer, Mathias; Marzi, Stefano

2013-01-01

Regulation of translation initiation is well appropriate to adapt cell growth in response to stress and environmental changes. Many bacterial mRNAs adopt structures in their 5′ untranslated regions that modulate the accessibility of the 30S ribosomal subunit. Structured mRNAs interact with the 30S in a two-step process where the docking of a folded mRNA precedes an accommodation step. Here, we used a combination of experimental approaches in vitro (kinetic of mRNA unfolding and binding experiments to analyze mRNA–protein or mRNA–ribosome complexes, toeprinting assays to follow the formation of ribosomal initiation complexes) and in vivo (genetic) to monitor the action of ribosomal protein S1 on the initiation of structured and regulated mRNAs. We demonstrate that r-protein S1 endows the 30S with an RNA chaperone activity that is essential for the docking and the unfolding of structured mRNAs, and for the correct positioning of the initiation codon inside the decoding channel. The first three OB-fold domains of S1 retain all its activities (mRNA and 30S binding, RNA melting activity) on the 30S subunit. S1 is not required for all mRNAs and acts differently on mRNAs according to the signals present at their 5′ ends. This work shows that S1 confers to the ribosome dynamic properties to initiate translation of a large set of mRNAs with diverse structural features. PMID:24339747

Cryo-EM structure of the spinach chloroplast ribosome reveals the location of plastid-specific ribosomal proteins and extensions

PubMed Central

Graf, Michael; Arenz, Stefan; Huter, Paul; Dönhöfer, Alexandra; Nováček, Jiří

2017-01-01

Abstract Ribosomes are the protein synthesizing machines of the cell. Recent advances in cryo-EM have led to the determination of structures from a variety of species, including bacterial 70S and eukaryotic 80S ribosomes as well as mitoribosomes from eukaryotic mitochondria, however, to date high resolution structures of plastid 70S ribosomes have been lacking. Here we present a cryo-EM structure of the spinach chloroplast 70S ribosome, with an average resolution of 5.4 Å for the small 30S subunit and 3.6 Å for the large 50S ribosomal subunit. The structure reveals the location of the plastid-specific ribosomal proteins (RPs) PSRP1, PSRP4, PSRP5 and PSRP6 as well as the numerous plastid-specific extensions of the RPs. We discover many features by which the plastid-specific extensions stabilize the ribosome via establishing additional interactions with surrounding ribosomal RNA and RPs. Moreover, we identify a large conglomerate of plastid-specific protein mass adjacent to the tunnel exit site that could facilitate interaction of the chloroplast ribosome with the thylakoid membrane and the protein-targeting machinery. Comparing the Escherichia coli 70S ribosome with that of the spinach chloroplast ribosome provides detailed insight into the co-evolution of RP and rRNA. PMID:27986857

The H/ACA RNP assembly factor SHQ1 functions as an RNA mimic.

PubMed

Walbott, Hélène; Machado-Pinilla, Rosario; Liger, Dominique; Blaud, Magali; Réty, Stéphane; Grozdanov, Petar N; Godin, Kate; van Tilbeurgh, Herman; Varani, Gabriele; Meier, U Thomas; Leulliot, Nicolas

2011-11-15

SHQ1 is an essential assembly factor for H/ACA ribonucleoproteins (RNPs) required for ribosome biogenesis, pre-mRNA splicing, and telomere maintenance. SHQ1 binds dyskerin/NAP57, the catalytic subunit of human H/ACA RNPs, and this interaction is modulated by mutations causing X-linked dyskeratosis congenita. We report the crystal structure of the C-terminal domain of yeast SHQ1, Shq1p, and its complex with yeast dyskerin/NAP57, Cbf5p, lacking its catalytic domain. The C-terminal domain of Shq1p interacts with the RNA-binding domain of Cbf5p and, through structural mimicry, uses the RNA-protein-binding sites to achieve a specific protein-protein interface. We propose that Shq1p operates as a Cbf5p chaperone during RNP assembly by acting as an RNA placeholder, thereby preventing Cbf5p from nonspecific RNA binding before association with an H/ACA RNA and the other core RNP proteins.

Translational Control of Hemoglobin Synthesis by an Initiation Factor Required for Recycling of Ribosomes and for their Binding to Messenger RNA

PubMed Central

Kaempfer, Raymond; Kaufman, Jennifer

1972-01-01

The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325

Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation

PubMed Central

Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude

2015-01-01

Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974

Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

PubMed

Alejo, Jose L; Blanchard, Scott C

2017-10-10

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

Miscoding-induced stalling of substrate translocation on the bacterial ribosome

PubMed Central

Alejo, Jose L.; Blanchard, Scott C.

2017-01-01

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G–catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors. PMID:28973849

Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

DOE PAGES

Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; ...

2016-04-29

Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.

Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

Role of large thermal fluctuations and magnesium ions in t-RNA selectivity of the ribosome

PubMed Central

Guo, Zuojun; Gibson, Meghan; Sitha, Sanyasi; Chu, Steven; Mohanty, Udayan

2011-01-01

The fidelity of translation selection begins with the base pairing of codon-anticodon complex between the m-RNA and tRNAs. Binding of cognate and near-cognate tRNAs induces 30S subunit of the ribosome to wrap around the ternary complex, EF-Tu(GTP)aa-tRNA. We have proposed that large thermal fluctuations play a crucial role in the selection process. To test this conjecture, we have developed a theoretical technique to determine the probability that the ternary complex, as a result of large thermal fluctuations, forms contacts leading to stabilization of the GTPase activated state. We argue that the configurational searches for such processes are in the tail end of the probability distribution and show that the probability for this event is localized around the most likely configuration. Small variations in the repositioning of cognate relative to near-cognate complexes lead to rate enhancement of the cognate complex. The binding energies of over a dozen unique site-bound magnesium structural motifs are investigated and provide insights into the nature of interaction of divalent metal ions with the ribosome. PMID:21368154

Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio

2008-08-15

The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, onlymore » mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library.« less

In vitro degradation of ribosomes.

PubMed

Mora, G; Rivas, A

1976-12-01

The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

The H/ACA RNP assembly factor SHQ1 functions as an RNA mimic

PubMed Central

Walbott, Hélène; Machado-Pinilla, Rosario; Liger, Dominique; Blaud, Magali; Réty, Stéphane; Grozdanov, Petar N.; Godin, Kate; van Tilbeurgh, Herman; Varani, Gabriele; Meier, U. Thomas; Leulliot, Nicolas

2011-01-01

SHQ1 is an essential assembly factor for H/ACA ribonucleoproteins (RNPs) required for ribosome biogenesis, pre-mRNA splicing, and telomere maintenance. SHQ1 binds dyskerin/NAP57, the catalytic subunit of human H/ACA RNPs, and this interaction is modulated by mutations causing X-linked dyskeratosis congenita. We report the crystal structure of the C-terminal domain of yeast SHQ1, Shq1p, and its complex with yeast dyskerin/NAP57, Cbf5p, lacking its catalytic domain. The C-terminal domain of Shq1p interacts with the RNA-binding domain of Cbf5p and, through structural mimicry, uses the RNA–protein-binding sites to achieve a specific protein–protein interface. We propose that Shq1p operates as a Cbf5p chaperone during RNP assembly by acting as an RNA placeholder, thereby preventing Cbf5p from nonspecific RNA binding before association with an H/ACA RNA and the other core RNP proteins. PMID:22085966

A model for competition for ribosomes in the cell

PubMed Central

Raveh, Alon; Margaliot, Michael; Sontag, Eduardo D.; Tuller, Tamir

2016-01-01

A single mammalian cell includes an order of 104–105 mRNA molecules and as many as 105–106 ribosomes. Large-scale simultaneous mRNA translation induces correlations between the mRNA molecules, as they all compete for the finite pool of available ribosomes. This has important implications for the cell's functioning and evolution. Developing a better understanding of the intricate correlations between these simultaneous processes, rather than focusing on the translation of a single isolated transcript, should help in gaining a better understanding of mRNA translation regulation and the way elongation rates affect organismal fitness. A model of simultaneous translation is specifically important when dealing with highly expressed genes, as these consume more resources. In addition, such a model can lead to more accurate predictions that are needed in the interconnection of translational modules in synthetic biology. We develop and analyse a general dynamical model for large-scale simultaneous mRNA translation and competition for ribosomes. This is based on combining several ribosome flow models (RFMs) interconnected via a pool of free ribosomes. We use this model to explore the interactions between the various mRNA molecules and ribosomes at steady state. We show that the compound system always converges to a steady state and that it always entrains or phase locks to periodically time-varying transition rates in any of the mRNA molecules. We then study the effect of changing the transition rates in one mRNA molecule on the steady-state translation rates of the other mRNAs that results from the competition for ribosomes. We show that increasing any of the codon translation rates in a specific mRNA molecule yields a local effect, an increase in the translation rate of this mRNA, and also a global effect, the translation rates in the other mRNA molecules all increase or all decrease. These results suggest that the effect of codon decoding rates of endogenous and

The Primary open-angle glaucoma gene WDR36 functions in ribosomal RNA processing and interacts with the p53 stress–response pathway

PubMed Central

Skarie, Jonathan M.; Link, Brian A.

2008-01-01

Primary open-angle glaucoma (POAG) is a genetically complex neuropathy that affects retinal ganglion cells and is a leading cause of blindness worldwide. WDR36, a gene of unknown function, was recently identified as causative for POAG at locus GLC1G. Subsequent studies found disease-associated variants in control populations, leaving the role of WDR36 in this disease unclear. To address this issue, we determined the function of WDR36. We studied Wdr36 in zebrafish and found it is the functional homolog of yeast Utp21. Utp21 is cell essential and functions in the nucleolar processing of 18S rRNA, which is required for ribosome biogenesis. Evidence for functional homology comes from sequence alignment, ubiquitous expression, sub-cellular localization to the nucleolus and loss-of-function phenotypes that include defects in 18S rRNA processing and abnormal nucleolar morphology. Additionally, we show that loss of Wdr36 function leads to an activation of the p53 stress–response pathway, suggesting that co-inheritance of defects in p53 pathway genes may influence the impact of WDR36 variants on POAG. Although these results overall do not provide evidence for or against a role of WDR36 in POAG, they do provide important baseline information for future studies. PMID:18469340

RISSC: a novel database for ribosomal 16S–23S RNA genes spacer regions

PubMed Central

García-Martínez, Jesús; Bescós, Ignacio; Rodríguez-Sala, Jesús Javier; Rodríguez-Valera, Francisco

2001-01-01

A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S–23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documen­tation tool for studies on evolution, identification, typing and strain characterization, among others. PMID:11125084

Ribosome-inactivating proteins: potent poisons and molecular tools.

PubMed

Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

2013-11-15

Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms.

Transfer RNA Post-Transcriptional Processing, Turnover, and Subcellular Dynamics in the Yeast Saccharomyces cerevisiae

PubMed Central

Hopper, Anita K.

2013-01-01

Transfer RNAs (tRNAs) are essential for protein synthesis. In eukaryotes, tRNA biosynthesis employs a specialized RNA polymerase that generates initial transcripts that must be subsequently altered via a multitude of post-transcriptional steps before the tRNAs beome mature molecules that function in protein synthesis. Genetic, genomic, biochemical, and cell biological approaches possible in the powerful Saccharomyces cerevisiae system have led to exciting advances in our understandings of tRNA post-transcriptional processing as well as to novel insights into tRNA turnover and tRNA subcellular dynamics. tRNA processing steps include removal of transcribed leader and trailer sequences, addition of CCA to the 3′ mature sequence and, for tRNAHis, addition of a 5′ G. About 20% of yeast tRNAs are encoded by intron-containing genes. The three-step splicing process to remove the introns surprisingly occurs in the cytoplasm in yeast and each of the splicing enzymes appears to moonlight in functions in addition to tRNA splicing. There are 25 different nucleoside modifications that are added post-transcriptionally, creating tRNAs in which ∼15% of the residues are nucleosides other than A, G, U, or C. These modified nucleosides serve numerous important functions including tRNA discrimination, translation fidelity, and tRNA quality control. Mature tRNAs are very stable, but nevertheless yeast cells possess multiple pathways to degrade inappropriately processed or folded tRNAs. Mature tRNAs are also dynamic in cells, moving from the cytoplasm to the nucleus and back again to the cytoplasm; the mechanism and function of this retrograde process is poorly understood. Here, the state of knowledge for tRNA post-transcriptional processing, turnover, and subcellular dynamics is addressed, highlighting the questions that remain. PMID:23633143

Strategies for investigating nuclear-cytoplasmic tRNA dynamics in yeast and mammalian cells.

PubMed

Pierce, Jacqueline B; Chafe, Shawn C; Eswara, Manoja B K; van der Merwe, George; Mangroo, Dev

2014-01-01

Nuclear-cytoplasmic tRNA transport involves multiple pathways that are segregated by the involvement of distinct proteins. The tRNA export process begins in the nucleolus, where the functionality of newly produced tRNAs are tested by aminoacylation, and ends with the delivery of the exported aminoacyl tRNAs to the eukaryotic elongation factor eEF-1A for utilization in protein synthesis in the cytoplasm. Recent studies have identified a number of proteins that participate in nuclear tRNA export in both yeast and mammals. However, genetic and biochemical evidence suggest that additional components, which have yet to be identified, also participate in nuclear-cytoplasmic tRNA trafficking. Here we review key strategies that have led to the identification and characterization of proteins that are involved in the nuclear tRNA export process in yeasts and mammals. The approaches described will greatly facilitate the identification and delineation of the roles of new proteins involved in nuclear export of tRNAs to the cytoplasm. Copyright © 2014 Elsevier Inc. All rights reserved.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

PubMed

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Transcriptome-wide studies uncover the diversity of modes of mRNA recruitment to eukaryotic ribosomes.

PubMed

Shatsky, Ivan N; Dmitriev, Sergey E; Andreev, Dmitri E; Terenin, Ilya M

2014-01-01

The conventional paradigm of translation initiation in eukaryotes states that the cap-binding protein complex eIF4F (consisting of eIF4E, eIF4G and eIF4A) plays a central role in the recruitment of capped mRNAs to ribosomes. However, a growing body of evidence indicates that this paradigm should be revised. This review summarizes the data which have been mostly accumulated in a post-genomic era owing to revolutionary techniques of transcriptome-wide analysis. Unexpectedly, these techniques have uncovered remarkable diversity in the recruitment of cellular mRNAs to eukaryotic ribosomes. These data enable a preliminary classification of mRNAs into several groups based on their requirement for particular components of eIF4F. They challenge the widely accepted concept which relates eIF4E-dependence to the extent of secondary structure in the 5' untranslated regions of mRNAs. Moreover, some mRNA species presumably recruit ribosomes to their 5' ends without the involvement of either the 5' m(7)G-cap or eIF4F but instead utilize eIF4G or eIF4G-like auxiliary factors. The long-standing concept of internal ribosome entry site (IRES)-elements in cellular mRNAs is also discussed.

Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jetzt, Amanda E.

Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarlymore » to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.« less

Ty3 Retrotransposon Hijacks Mating Yeast RNA Processing Bodies to Infect New Genomes

PubMed Central

Kaake, Robyn; Dawson, Anthony R.; Matheos, Dina; Nagashima, Kunio; Sitlani, Parth; Patterson, Kurt; Chang, Ivan; Huang, Lan; Sandmeyer, Suzanne

2015-01-01

Retrotransposition of the budding yeast long terminal repeat retrotransposon Ty3 is activated during mating. In this study, proteins that associate with Ty3 Gag3 capsid protein during virus-like particle (VLP) assembly were identified by mass spectrometry and screened for roles in mating-stimulated retrotransposition. Components of RNA processing bodies including DEAD box helicases Dhh1/DDX6 and Ded1/DDX3, Sm-like protein Lsm1, decapping protein Dcp2, and 5’ to 3’ exonuclease Xrn1 were among the proteins identified. These proteins associated with Ty3 proteins and RNA, and were required for formation of Ty3 VLP retrosome assembly factories and for retrotransposition. Specifically, Dhh1/DDX6 was required for normal levels of Ty3 genomic RNA, and Lsm1 and Xrn1 were required for association of Ty3 protein and RNA into retrosomes. This role for components of RNA processing bodies in promoting VLP assembly and retrotransposition during mating in a yeast that lacks RNA interference, contrasts with roles proposed for orthologous components in animal germ cell ribonucleoprotein granules in turnover and epigenetic suppression of retrotransposon RNAs. PMID:26421679

NOP132 is required for proper nucleolus localization of DEAD-box RNA helicase DDX47

PubMed Central

Sekiguchi, Takeshi; Hayano, Toshiya; Yanagida, Mitsuaki; Takahashi, Nobuhiro; Nishimoto, Takeharu

2006-01-01

Previously, we described a novel nucleolar protein, NOP132, which interacts with the small GTP binding protein RRAG A. To elucidate the function of NOP132 in the nucleolus, we identified proteins that interact with NOP132 using mass spectrometric methods. NOP132 associated mainly with proteins involved in ribosome biogenesis and RNA metabolism, including the DEAD-box RNA helicase protein, DDX47, whose yeast homolog is Rrp3, which has roles in pre-rRNA processing. Immunoprecipitation of FLAG-tagged DDX47 co-precipitated rRNA precursors, as well as a number of proteins that are probably involved in ribosome biogenesis, implying that DDX47 plays a role in pre-rRNA processing. Introduction of NOP132 small interfering RNAs induced a ring-like localization of DDX47 in the nucleolus, suggesting that NOP132 is required for the appropriate localization of DDX47 within the nucleolus. We propose that NOP132 functions in the recruitment of pre-rRNA processing proteins, including DDX47, to the region where rRNA is transcribed within the nucleolus. PMID:16963496

The Carboxy-Terminal Domain of Erb1 Is a Seven-Bladed ß-Propeller that Binds RNA

PubMed Central

Marcin, Wegrecki; Neira, Jose Luis; Bravo, Jeronimo

2015-01-01

Erb1 (Eukaryotic Ribosome Biogenesis 1) protein is essential for the maturation of the ribosomal 60S subunit. Functional studies in yeast and mammalian cells showed that altogether with Nop7 and Ytm1 it forms a stable subcomplex called PeBoW that is crucial for a correct rRNA processing. The exact function of the protein within the process remains unknown. The N-terminal region of the protein includes a well conserved region shown to be involved in PeBoW complex formation whereas the carboxy-terminal half was predicted to contain seven WD40 repeats. This first structural report on Erb1 from yeast describes the architecture of a seven-bladed β-propeller domain that revealed a characteristic extra motif formed by two α-helices and a β-strand that insert within the second WD repeat. We performed analysis of molecular surface and crystal packing, together with multiple sequence alignment and comparison of the structure with other β-propellers, in order to identify areas that are more likely to mediate protein-protein interactions. The abundance of many positively charged residues on the surface of the domain led us to investigate whether the propeller of Erb1 might be involved in RNA binding. Three independent assays confirmed that the protein interacted in vitro with polyuridilic acid (polyU), thus suggesting a possible role of the domain in rRNA rearrangement during ribosome biogenesis. PMID:25880847

Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

PubMed Central

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

2013-01-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

PubMed

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

2013-10-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

RNA Export through the NPC in Eukaryotes

PubMed Central

Okamura, Masumi; Inose, Haruko; Masuda, Seiji

2015-01-01

In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC. PMID:25802992

Structure of ratcheted ribosomes with tRNAs in hybrid states

PubMed Central

Julián, Patricia; Konevega, Andrey L.; Scheres, Sjors H. W.; Lázaro, Melisa; Gil, David; Wintermeyer, Wolfgang; Rodnina, Marina V.; Valle, Mikel

2008-01-01

During protein synthesis, tRNAs and mRNA move through the ribosome between aminoacyl (A), peptidyl (P), and exit (E) sites of the ribosome in a process called translocation. Translocation is accompanied by the displacement of the tRNAs on the large ribosomal subunit toward the hybrid A/P and P/E states and by a rotational movement (ratchet) of the ribosomal subunits relative to one another. So far, the structure of the ratcheted state has been observed only when translation factors were bound to the ribosome. Using cryo-electron microscopy and classification, we show here that ribosomes can spontaneously adopt a ratcheted conformation with tRNAs in their hybrid states. The peptidyl-tRNA molecule in the A/P state, which is visualized here, is not distorted compared with the A/A state except for slight adjustments of its acceptor end, suggesting that the displacement of the A-site tRNA on the 50S subunit is passive and is induced by the 30S subunit rotation. Simultaneous subunit ratchet and formation of the tRNA hybrid states precede and may promote the subsequent rapid and coordinated tRNA translocation on the 30S subunit catalyzed by elongation factor G. PMID:18971332

Temporal programming of chloroplast and cytoplasmic ribosomal RNA transcription in the synchronous cell cycle of Chlamydomonas reinhardtii

PubMed Central

1977-01-01

Approximately 90% of the Chlamydomonas reinhardtii chloroplast and cytoplasmic rRNAs was transcribed in the nuclear G1 phase, which occurred during the light period under an alternating light-dark synchronization regime of 12 h each. The remaining 10% of chloroplast and cytoplasmic rRNAs was transcribed from its respective DNAs in the dark period, in the midst of an apparent turnover of a transcription appeared to be prokaryotic in sophistication. The transcription was not interrupted during chloroplast DNA synthesis which occurred during the light period. However, transcription of the nuclear DNA was repressed severely during the nuclear S phase in the dark period. The patterns of incorporation of 32P into chloroplast and cytoplasmic rRNA species in the cell cycle were similar to those of the actual rRNA synthesis as measured optically. However, the quantity of 32P incorporation per unit amount of rRNA synthesized varied considerably during the cell cycle, increasing in all rRNA's during the dark period. 32P incorporation data obtained from continuous and pulse 32P-labeling experiments also revealed a turnover of a small amount of both cytoplasmic and chloroplast rRNAs at the end of the S phase. The 32P incorporation into cytoplasmic and chloroplast rRNAs was well matched temporally with the 32P incorporation into their corresponding ribosomes, indicating that the newly synthesized rRNA molecules are utilized without delay throughout the cell cycle in the assembly of ribosomes. PMID:833204

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

PubMed Central

Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

2015-01-01

Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

PubMed

Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

1995-01-01

Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

An Improved, Bias-Reduced Probabilistic Functional Gene Network of Baker's Yeast, Saccharomyces cerevisiae

PubMed Central

Lee, Insuk; Li, Zhihua; Marcotte, Edward M.

2007-01-01

Background Probabilistic functional gene networks are powerful theoretical frameworks for integrating heterogeneous functional genomics and proteomics data into objective models of cellular systems. Such networks provide syntheses of millions of discrete experimental observations, spanning DNA microarray experiments, physical protein interactions, genetic interactions, and comparative genomics; the resulting networks can then be easily applied to generate testable hypotheses regarding specific gene functions and associations. Methodology/Principal Findings We report a significantly improved version (v. 2) of a probabilistic functional gene network [1] of the baker's yeast, Saccharomyces cerevisiae. We describe our optimization methods and illustrate their effects in three major areas: the reduction of functional bias in network training reference sets, the application of a probabilistic model for calculating confidences in pair-wise protein physical or genetic interactions, and the introduction of simple thresholds that eliminate many false positive mRNA co-expression relationships. Using the network, we predict and experimentally verify the function of the yeast RNA binding protein Puf6 in 60S ribosomal subunit biogenesis. Conclusions/Significance YeastNet v. 2, constructed using these optimizations together with additional data, shows significant reduction in bias and improvements in precision and recall, in total covering 102,803 linkages among 5,483 yeast proteins (95% of the validated proteome). YeastNet is available from http://www.yeastnet.org. PMID:17912365

Ribosome rearrangements at the onset of translational bypassing

PubMed Central

Agirrezabala, Xabier; Samatova, Ekaterina; Klimova, Mariia; Zamora, Miguel; Gil-Carton, David; Rodnina, Marina V.; Valle, Mikel

2017-01-01

Bypassing is a recoding event that leads to the translation of two distal open reading frames into a single polypeptide chain. We present the structure of a translating ribosome stalled at the bypassing take-off site of gene 60 of bacteriophage T4. The nascent peptide in the exit tunnel anchors the P-site peptidyl-tRNAGly to the ribosome and locks an inactive conformation of the peptidyl transferase center (PTC). The mRNA forms a short dynamic hairpin in the decoding site. The ribosomal subunits adopt a rolling conformation in which the rotation of the small subunit around its long axis causes the opening of the A-site region. Together, PTC conformation and mRNA structure safeguard against premature termination and read-through of the stop codon and reconfigure the ribosome to a state poised for take-off and sliding along the noncoding mRNA gap. PMID:28630923

Focal accumulation of preribosomes outside the nucleolus during metaphase-anaphase in budding yeast.

PubMed

Moriggi, Giulia; Gaspar, Sonia G; Nieto, Blanca; Bustelo, Xosé R; Dosil, Mercedes

2017-09-01

Saccharomyces cerevisiae contains one nucleolus that remains intact in the mother-cell side of the nucleus throughout most of mitosis. Based on this, it is assumed that the bulk of ribosome production during cell division occurs in the mother cell. Here, we show that the ribosome synthesis machinery localizes not only in the nucleolus but also at a center that is present in the bud side of the nucleus after the initiation of mitosis. This center can be visualized by live microscopy as a punctate body located in close proximity to the nuclear envelope and opposite to the nucleolus. It contains ribosomal DNA (rDNA) and precursors of both 40S and 60S ribosomal subunits. Proteins that actively participate in ribosome synthesis, but not functionally defective variants, accumulate in that site. The formation of this body occurs in the metaphase-to-anaphase transition when discrete regions of rDNA occasionally exit the nucleolus and move into the bud. Collectively, our data unveil the existence of a previously unknown mechanism for preribosome accumulation at the nuclear periphery in budding yeast. We propose that this might be a strategy to expedite the delivery of ribosomes to the growing bud. © 2017 Moriggi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

The association of TIF-IA and polymerase I mediates promoter recruitment and regulation of ribosomal RNA transcription in Acanthamoeba castellanii.

PubMed

Gogain, Joseph C; Paule, Marvin R

2005-01-01

Large amounts of energy are expended for the construction of the ribosome during both transcription and processing, so it is of utmost importance for the cell to efficiently regulate ribosome production. Understanding how this regulation occurs will provide important insights into cellular growth control and into the coordination of gene expression mediated by all three transcription systems. Ribosomal RNA (rRNA) transcription rates closely parallel the need for protein synthesis; as a cell approaches stationary phase or encounters conditions that negatively affect either growth rate or protein synthesis, rRNA transcription is decreased. In eukaryotes, the interaction of RNA polymerase I (pol I) with the essential transcription initiation factor IA (TIF-IA) has been implicated in this downregulation of transcription. In agreement with the first observation that rRNA transcription is regulated by altering recruitment of pol I to the promoter in Acanthamoeba castellanii, we show here that pol I and an 80-kDa homologue of TIF-IA are found tightly associated in pol I fractions competent for specific transcription. Disruption of the pol I-TIF-IA complex is mediated by a specific dephosphorylation of either pol I or TIF-IA. Phosphatase treatment of TIF-IA-containing A. castellanii pol I fractions results in a downregulation of both transcriptional activity and promoter binding, reminiscent of the inactive pol I fractions purified from encysted cells. The fraction of pol I competent for promoter recruitment is enriched in TIF-IA relative to that not bound by immobilized promoter DNA. This downregulation coincides with an altered electrophoretic mobility of TIF-IA, suggesting at least it is phosphorylated.

Potential key bases of ribosomal RNA to kingdom-specific spectra of antibiotic susceptibility and the possible archaeal origin of eukaryotes.

PubMed

Xie, Qiang; Wang, Yanhui; Lin, Jinzhong; Qin, Yan; Wang, Ying; Bu, Wenjun

2012-01-01

In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC) of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.

Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

PubMed Central

Umaer, Khan; Ciganda, Martin

2014-01-01

Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

PubMed

Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

2016-01-01

Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana

PubMed Central

Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L.; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

2016-01-01

ABSTRACT Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast. PMID:26980300

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

NASA Astrophysics Data System (ADS)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

2011-07-01

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

Chemical and structural characterization of a model Post-Termination Complex (PoTC) for the ribosome recycling reaction: Evidence for the release of the mRNA by RRF and EF-G

PubMed Central

Iwakura, Nobuhiro; Yokoyama, Takeshi; Quaglia, Fabio; Mitsuoka, Kaoru; Mio, Kazuhiro; Shigematsu, Hideki; Shirouzu, Mikako; Kaji, Akira; Kaji, Hideko

2017-01-01

A model Post-Termination Complex (PoTC) used for the discovery of Ribosome Recycling Factor (RRF) was purified and characterized by cryo-electron microscopic analysis and biochemical methods. We established that the model PoTC has mostly one tRNA, at the P/E or P/P position, together with one mRNA. The structural studies were supported by the biochemical measurement of bound tRNA and mRNA. Using this substrate, we establish that the release of tRNA, release of mRNA and splitting of ribosomal subunits occur during the recycling reaction. Order of these events is tRNA release first followed by mRNA release and splitting almost simultaneously. Moreover, we demonstrate that IF3 is not involved in any of the recycling reactions but simply prevents the re-association of split ribosomal subunits. Our finding demonstrates that the important function of RRF includes the release of mRNA, which is often missed by the use of a short ORF with the Shine-Dalgarno sequence near the termination site. PMID:28542628

Indole-3-Acetic Acid-Producing Yeasts in the Phyllosphere of the Carnivorous Plant Drosera indica L

PubMed Central

Shin, Li-Ying; Wei, Jyuan-Yu; Fu, Shih-Feng; Chou, Jui-Yu

2014-01-01

Yeasts are widely distributed in nature and exist in association with other microorganisms as normal inhabitants of soil, vegetation, and aqueous environments. In this study, 12 yeast strains were enriched and isolated from leaf samples of the carnivorous plant Drosera indica L., which is currently threatened because of restricted habitats and use in herbal industries. According to similarities in large subunit and small subunit ribosomal RNA gene sequences, we identified 2 yeast species in 2 genera of the phylum Ascomycota, and 5 yeast species in 5 genera of the phylum Basidiomycota. All of the isolated yeasts produced indole-3-acetic acid (IAA) when cultivated in YPD broth supplemented with 0.1% L-tryptophan. Growth conditions, such as the pH and temperature of the medium, influenced yeast IAA production. Our results also suggested the existence of a tryptophan-independent IAA biosynthetic pathway. We evaluated the effects of various concentrations of exogenous IAA on yeast growth and observed that IAA produced by wild yeasts modifies auxin-inducible gene expression in Arabidopsis. Our data suggest that yeasts can promote plant growth and support ongoing prospecting of yeast strains for inclusion into biofertilizer for sustainable agriculture. PMID:25464336

Ribosomes are optimized for autocatalytic production

NASA Astrophysics Data System (ADS)

Reuveni, Shlomi; Ehrenberg, Måns; Paulsson, Johan

2017-07-01

Many fine-scale features of ribosomes have been explained in terms of function, revealing a molecular machine that is optimized for error-correction, speed and control. Here we demonstrate mathematically that many less well understood, larger-scale features of ribosomes—such as why a few ribosomal RNA molecules dominate the mass and why the ribosomal protein content is divided into 55-80 small, similarly sized segments—speed up their autocatalytic production.

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain

PubMed Central

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan

2017-01-01

Abstract The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson–Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. PMID:28369621

Schizosaccharomyces pombe Noc3 Is Essential for Ribosome Biogenesis and Cell Division but Not DNA Replication▿

PubMed Central

Houchens, Christopher R.; Perreault, Audrey; Bachand, François; Kelly, Thomas J.

2008-01-01

The initiation of eukaryotic DNA replication is preceded by the assembly of prereplication complexes (pre-RCs) at chromosomal origins of DNA replication. Pre-RC assembly requires the essential DNA replication proteins ORC, Cdc6, and Cdt1 to load the MCM DNA helicase onto chromatin. Saccharomyces cerevisiae Noc3 (ScNoc3), an evolutionarily conserved protein originally implicated in 60S ribosomal subunit trafficking, has been proposed to be an essential regulator of DNA replication that plays a direct role during pre-RC formation in budding yeast. We have cloned Schizosaccharomyces pombe noc3+ (Spnoc3+), the S. pombe homolog of the budding yeast ScNOC3 gene, and functionally characterized the requirement for the SpNoc3 protein during ribosome biogenesis, cell cycle progression, and DNA replication in fission yeast. We showed that fission yeast SpNoc3 is a functional homolog of budding yeast ScNoc3 that is essential for cell viability and ribosome biogenesis. We also showed that SpNoc3 is required for the normal completion of cell division in fission yeast. However, in contrast to the proposal that ScNoc3 plays an essential role during DNA replication in budding yeast, we demonstrated that fission yeast cells do enter and complete S phase in the absence of SpNoc3, suggesting that SpNoc3 is not essential for DNA replication in fission yeast. PMID:18606828

Structural domains within the HIV-1 mRNA and the ribosomal protein S25 influence cap-independent translation initiation

PubMed Central

Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth A.; Contreras, Nataly; Hertz, Marla I.; Olivares, Eduardo; Cáceres, C. Joaquín; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R.; López-Lastra, Marcelo

2016-01-01

The 5′leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work we examine the internal ribosome entry site (IRES) located in the 5′leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5′leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. PMID:27191820

The roles of SSU processome components and surveillance factors in the initial processing of human ribosomal RNA

PubMed Central

Sloan, Katherine E.; Bohnsack, Markus T.; Schneider, Claudia; Watkins, Nicholas J.

2014-01-01

During eukaryotic ribosome biogenesis, three of the mature ribosomal (r)RNAs are released from a single precursor transcript (pre-rRNA) by an ordered series of endonucleolytic cleavages and exonucleolytic processing steps. Production of the 18S rRNA requires the removal of the 5′ external transcribed spacer (5′ETS) by endonucleolytic cleavages at sites A0 and A1/site 1. In metazoans, an additional cleavage in the 5′ETS, at site A′, upstream of A0, has also been reported. Here, we have investigated how A′ processing is coordinated with assembly of the early preribosomal complex. We find that only the tUTP (UTP-A) complex is critical for A′ cleavage, while components of the bUTP (UTP-B) and U3 snoRNP are important, but not essential, for efficient processing at this site. All other factors involved in the early stages of 18S rRNA processing that were tested here function downstream from this processing step. Interestingly, we show that the RNA surveillance factors XRN2 and MTR4 are also involved in A′ cleavage in humans. A′ cleavage is largely bypassed when XRN2 is depleted, and we also discover that A′ cleavage is not always the initial processing event in all cell types. Together, our data suggest that A′ cleavage is not a prerequisite for downstream pre-rRNA processing steps and may, in fact, represent a quality control step for initial pre-rRNA transcripts. Furthermore, we show that components of the RNA surveillance machinery, including the exosome and TRAMP complexes, also play key roles in the recycling of excised spacer fragments and degradation of aberrant pre-rRNAs in human cells. PMID:24550520

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed Central

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

PubMed

Tzagoloff, A; Shtanko, A

1995-06-01

Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

Influence of the stringent control system on the transcription of ribosomal ribonucleic acid and ribosomal protein genes in Escherichia coli.

PubMed Central

Dennis, P P

1977-01-01

The fraction of the total ribonucleic acid (RNA) synthesis rate that is messenger RNA (mRNA) for ribosomal protein (r-protein) and ribosomal RNA (rRNA) has been estimated in valS(Ts) rel+ stringent and valS(Ts) relA1 relaxed strains of Escherichia coli during a partial inhibition of valyl-transfer RNA aminoacylation. The partial inhibition was accomplished by shifting the strains from the permissive growth temperature of 29.5 degrees C to the semipermissive temperature of 35.5 degrees C. The RNA synthesized at the elevated temperature was pulse labeled with [3H]uracil. The fraction of the total incorpoarted 3H radioactivity in r-protein mRNA or in rRNA was estimated by specific hybridization to the transducing phages gammaspc1, which carries about 15 r-protein genes and lambdailv5, which carries an rRNA transcription unit. The results clearly demonstrate that the rel gene influences the fraction of the total RNA synthesis rate that is r protein mRNA and rRNA; in the rel+ strain they are significantly increased relative to control cultures. This indicates that the expression of the genes coding for the RNA and protein component of the ribosome are most likely regulated at the level of transcription. Furthermore, it appears that the distribution of functioning RNA polymerase between rRNA genes, r-protein genes, and other types of genes is influenced by the rel gene control system; presumably this influence is mediated through the unusual nucleotide guanosine tetraphosphate. PMID:320185

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing

PubMed Central

Goldfarb, Katherine C.; Cech, Thomas R.

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR–Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor—analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing—implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. PMID:28115465

Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

PubMed Central

Ishida, Hisashi; Matsumoto, Atsushi

2014-01-01

To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

PubMed

Ishida, Hisashi; Matsumoto, Atsushi

2014-01-01

To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.