Tewari, Rita; Rathore, Dharmendar; Crisanti, Andrea
2005-05-01
Avian and rodent malaria sporozoites selectively invade different vertebrate cell types, namely macrophages and hepatocytes, and develop in distantly related vector species. To investigate the role of the circumsporozoite (CS) protein in determining parasite survival in different vector species and vertebrate host cell types, we replaced the endogenous CS protein gene of the rodent malaria parasite Plasmodium berghei with that of the avian parasite P. gallinaceum and control rodent parasite P. yoelii. In anopheline mosquitoes, P. berghei parasites carrying P. gallinaceum and rodent parasite P. yoelii CS protein gene developed into oocysts and sporozoites. Plasmodium gallinaceum CS expressing transgenic sporozoites, although motile, failed to invade mosquito salivary glands and to infect mice, which suggests that motility alone is not sufficient for invasion. Notably, a percentage of infected Anopheles stephensi mosquitoes showed melanotic encapsulation of late stage oocysts. This was not observed in control infections or in A. gambiae infections. These findings shed new light on the role of the CS protein in the interaction of the parasite with both the mosquito vector and the rodent host.
Franke, Eileen D.; Sette, Alessandro; Sacci, John; Southwood, Scott; Corradin, Giampietro; Hoffman, Stephen L.
2000-01-01
Previous studies indicated that the Plasmodium yoelii circumsporozoite protein (PyCSP) 57–70 region elicits T cells capable of eliminating infected hepatocytes in vitro. Herein, we report that the PyCSP58–67 sequence contains an H-2d binding motif, which binds purified Kd molecules in vitro with low affinity (3,267 nM) and encodes an H-2d-restricted cytotoxic T lymphocyte (CTL) epitope. Immunization of BALB/c mice with three doses of a multiple antigen peptide (MAP) construct containing four branches of amino acids 57 to 70 linked to a lysine-glycine core [MAP4(PyCSP57–70)] and Lipofectin as the adjuvant induced both T-cell proliferation and a peptide-specific CTL response that was PyCSP59–67 specific, H-2d restricted, and CD8+ T cell dependent. Immunization with either DNA encoding the PyCSP or irradiated sporozoites demonstrated that this CTL epitope is subdominant since it is not recognized in the context of whole CSP immunization. The biological relevance of this CTL response was underlined by the demonstration that it could mediate genetically restricted, CD8+- and nitric-oxide-dependent elimination of infected hepatocytes in vitro, as well as partial protection of BALB/c mice against sporozoite challenge. These findings indicate that subdominant epitopes with low major histocompatibility complex affinity can be used to engineer epitope-based vaccines and have implications for the selection of epitopes for subunit-based vaccines. PMID:10816491
Kim, Seon-Hee; Bae, Young-An; Seoh, Ju-Young; Yang, Hyun-Jong
2017-06-01
Malaria is an infectious disease affecting humans, which is transmitted by the bite of Anopheles mosquitoes harboring sporozoites of parasitic protozoans belonging to the genus Plasmodium . Despite past achievements to control the protozoan disease, malaria still remains a significant health threat up to now. In this study, we cloned and characterized the full-unit Plasmodium yoelii genes encoding merozoite surface protein 1 (MSP1), circumsporozoite protein (CSP), and Duffy-binding protein (DBP), each of which can be applied for investigations to obtain potent protective vaccines in the rodent malaria model, due to their specific expression patterns during the parasite life cycle. Recombinant fragments corresponding to the middle and C-terminal regions of PyMSP1 and PyCSP, respectively, displayed strong reactivity against P. yoelii -infected mice sera. Specific native antigens invoking strong humoral immune response during the primary and secondary infections of P. yoelii were also abundantly detected in experimental ICR mice. The low or negligible parasitemia observed in the secondary infected mice was likely to result from the neutralizing action of the protective antibodies. Identification of these antigenic proteins might provide the necessary information and means to characterize additional vaccine candidate antigens, selected solely on their ability to produce the protective antibodies.
Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W.; Garcia, Valentino; Kappe, Stefan H. I.; Krzych, Urszula; Duffy, Patrick E.
2016-01-01
Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP. PMID:27434123
Speake, Cate; Pichugin, Alexander; Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W; Garcia, Valentino; Kappe, Stefan H I; Krzych, Urszula; Duffy, Patrick E
2016-01-01
Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP.
Stoyanov, Cristina T; Boscardin, Silvia B; Deroubaix, Stephanie; Barba-Spaeth, Giovanna; Franco, David; Nussenzweig, Ruth S; Nussenzweig, Michel; Rice, Charles M
2010-06-23
The live-attenuated yellow fever vaccine (YF17D) is one of the safest and most effective vaccines available today. Here, YF17D was genetically altered to express the circumsporozoite protein (CSP) from the murine malarial parasite Plasmodium yoelii. Reconstituted recombinant virus was viable and exhibited robust CSP expression. Immunization of naïve mice resulted in extensive proliferation of adoptively transferred CSP-specific transgenic CD8(+) T-cells. A single immunization of naïve mice with recombinant YF17D resulted in robust production of IFN-gamma by CD8(+) T-cells and IFN-gamma and IL-2 by CD4(+) T-cells. A prime-boost regimen consisting of recombinant virus followed by a low-dose of irradiated sporozoites conferred protection against challenge with P. yoelii. Taken together, these results show that recombinant YF17D can efficiently express CSP in culture, and prime a protective immune response in vivo. (c) 2010 Elsevier Ltd. All rights reserved.
Plasmodium yoelii yoelii 17XNL constitutively expressing GFP throughout the life cycle.
Ono, Takeshi; Tadakuma, Takushi; Rodriguez, Ana
2007-03-01
Plasmodium yoelii is a rodent parasite commonly used as a model to study malaria infection. It is the preferred model parasite for liver-stage immunological studies and is also widely used to study hepatocyte, erythrocyte and mosquito infection. We have generated a P. yoelii yoelii 17XNL line that is stably transfected with the green fluorescent protein (gfp) gene. This parasite line constitutively expresses high levels of GFP during the complete parasite life cycle including liver, blood and mosquito stages. These fluorescent parasites can be used in combination with fluorescence activated cell sorting or live microscopy for a wide range of experimental applications.
Becker, Sylvia I.; Wang, Ruobing; Hedstrom, Richard C.; Aguiar, Joao C.; Jones, Trevor R.; Hoffman, Stephen L.; Gardner, Malcolm J.
1998-01-01
Immunization of mice with DNA vaccines encoding the full-length form and C and N termini of Plasmodium yoelii merozoite surface protein 1 provided partial protection against sporozoite challenge and resulted in boosting of antibody titers after challenge. In C57BL/6 mice, two DNA vaccines provided protection comparable to that of recombinant protein consisting of the C terminus in Freund’s adjuvant. PMID:9632624
Parra, Marcela; Liu, Xia; Derrick, Steven C; Yang, Amy; Molina-Cruz, Alvaro; Barillas-Mury, Carolina; Zheng, Hong; Thao Pham, Phuong; Sedegah, Martha; Belmonte, Arnel; Litilit, Dianne D; Waldmann, Thomas A; Kumar, Sanjai; Morris, Sheldon L; Perera, Liyanage P
2015-01-01
Malaria remains a major global public health problem with an estimated 200 million cases detected in 2012. Although the most advanced candidate malaria vaccine (RTS,S) has shown promise in clinical trials, its modest efficacy and durability have created uncertainty about the impact of RTS,S immunization (when used alone) on global malaria transmission. Here we describe the development and characterization of a novel modified vaccinia virus Ankara (MVA)-based malaria vaccine which co-expresses the Plasmodium yoelii circumsporozoite protein (CSP) and IL-15. Vaccination/challenge studies showed that C57BL/6 mice immunized with the MVA-CSP/IL15 vaccine were protected significantly better against a P. yoelii 17XNL sporozoite challenge than either mice immunized with an MVA vaccine expressing only CSP or naïve controls. Importantly, the levels of total anti-CSP IgG were elevated about 100-fold for the MVA-CSP/IL15 immunized group compared to mice immunized with the MVA-CSP construct that does not express IL-15. Among the IgG subtypes, the IL-15 expressing MVA-CSP vaccine induced levels of IgG1 (8 fold) and IgG2b (80 fold) higher than the MVA-CSP construct. The significantly enhanced humoral responses and protection detected after immunization with the MVA-CSP/IL15 vaccine suggest that this IL-15 expressing MVA construct could be considered in the development of future malaria immunization strategies.
Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Oliveira-Ferreira, Joseli; Lima-Junior, Josué da Costa; Calvo-Calle, J Mauricio; Moreno, Alberto
2015-09-01
Plasmodium vivax is the most widespread species of Plasmodium, causing up to 50% of the malaria cases occurring outside sub-Saharan Africa. An effective vaccine is essential for successful control and potential eradication. A well-characterized vaccine candidate is the circumsporozoite protein (CSP). Preclinical and clinical trials have shown that both antibodies and cellular immune responses have been correlated with protection induced by immunization with CSP. On the basis of our reported approach of developing chimeric Plasmodium yoelii proteins to enhance protective efficacy, we designed PvRMC-CSP, a recombinant chimeric protein based on the P. vivax CSP (PvCSP). In this engineered protein, regions of the PvCSP predicted to contain human T cell epitopes were genetically fused to an immunodominant B cell epitope derived from the N-terminal region I and to repeat sequences representing the two types of PvCSP repeats. The chimeric protein was expressed in soluble form with high yield. As the immune response to PvCSP has been reported to be genetically restricted in the murine model, we tested the immunogenicity of PvRMC-CSP in groups of six inbred strains of mice. PvRMC-CSP was able to induce robust antibody responses in all the mouse strains tested. Synthetic peptides representing the allelic forms of the P. vivax CSP were also recognized to a similar extent regardless of the mouse strain. Furthermore, the immunization regimen induced high frequencies of multifunctional CD4(+) and CD8(+) PvRMC-CSP-specific T cells. The depth and breadth of the immune responses elicited suggest that immunization with PvRMC-CSP can circumvent the genetic restriction of the immune response to P. vivax CSP. Interestingly, PvRMC-CSP was also recognized by naturally acquired antibodies from individuals living in areas where malaria is endemic. These features make PvRMC-CSP a promising vaccine candidate for further development. Copyright © 2015, American Society for Microbiology. All
Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Oliveira-Ferreira, Joseli; Lima-Junior, Josué da Costa; Calvo-Calle, J. Mauricio
2015-01-01
Plasmodium vivax is the most widespread species of Plasmodium, causing up to 50% of the malaria cases occurring outside sub-Saharan Africa. An effective vaccine is essential for successful control and potential eradication. A well-characterized vaccine candidate is the circumsporozoite protein (CSP). Preclinical and clinical trials have shown that both antibodies and cellular immune responses have been correlated with protection induced by immunization with CSP. On the basis of our reported approach of developing chimeric Plasmodium yoelii proteins to enhance protective efficacy, we designed PvRMC-CSP, a recombinant chimeric protein based on the P. vivax CSP (PvCSP). In this engineered protein, regions of the PvCSP predicted to contain human T cell epitopes were genetically fused to an immunodominant B cell epitope derived from the N-terminal region I and to repeat sequences representing the two types of PvCSP repeats. The chimeric protein was expressed in soluble form with high yield. As the immune response to PvCSP has been reported to be genetically restricted in the murine model, we tested the immunogenicity of PvRMC-CSP in groups of six inbred strains of mice. PvRMC-CSP was able to induce robust antibody responses in all the mouse strains tested. Synthetic peptides representing the allelic forms of the P. vivax CSP were also recognized to a similar extent regardless of the mouse strain. Furthermore, the immunization regimen induced high frequencies of multifunctional CD4+ and CD8+ PvRMC-CSP-specific T cells. The depth and breadth of the immune responses elicited suggest that immunization with PvRMC-CSP can circumvent the genetic restriction of the immune response to P. vivax CSP. Interestingly, PvRMC-CSP was also recognized by naturally acquired antibodies from individuals living in areas where malaria is endemic. These features make PvRMC-CSP a promising vaccine candidate for further development. PMID:26169267
NASA Astrophysics Data System (ADS)
Young, James F.; Hockmeyer, Wayne T.; Gross, Mitchell; Ripley Ballou, W.; Wirtz, Robert A.; Trosper, James H.; Beaudoin, Richard L.; Hollingdale, Michael R.; Miller, Louis H.; Diggs, Carter L.; Rosenberg, Martin
1985-05-01
The circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum may be the most promising target for the development of a malaria vaccine. In this study, proteins composed of 16, 32, or 48 tandem copies of a tetrapeptide repeating sequence found in the CS protein were efficiently expressed in the bacterium Escherichia coli. When injected into mice, these recombinant products resulted in the production of high titers of antibodies that reacted with the authentic CS protein on live sporozoites and blocked sporozoite invasion of human hepatoma cells in vitro. These CS protein derivatives are therefore candidates for a human malaria vaccine.
A Cas9 transgenic Plasmodium yoelii parasite for efficient gene editing.
Qian, Pengge; Wang, Xu; Yang, Zhenke; Li, Zhenkui; Gao, Han; Su, Xin-Zhuan; Cui, Huiting; Yuan, Jing
2018-06-01
The RNA-guided endonuclease Cas9 has applied as an efficient gene-editing method in malaria parasite Plasmodium. However, the size (4.2 kb) of the commonly used Cas9 from Streptococcus pyogenes (SpCas9) limits its utility for genome editing in the parasites only introduced with cas9 plasmid. To establish the endogenous and constitutive expression of Cas9 protein in the rodent malaria parasite P. yoelii, we replaced the coding region of an endogenous gene sera1 with the intact SpCas9 coding sequence using the CRISPR/Cas9-mediated genome editing method, generating the cas9-knockin parasite (PyCas9ki) of the rodent malaria parasite P. yoelii. The resulted PyCas9ki parasite displays normal progression during the whole life cycle and possesses the Cas9 protein expression in asexual blood stage. By introducing the plasmid (pYCs) containing only sgRNA and homologous template elements, we successfully achieved both deletion and tagging modifications for different endogenous genes in the genome of PyCas9ki parasite. This cas9-knockin PyCas9ki parasite provides a new platform facilitating gene functions study in the rodent malaria parasite P. yoelii. Copyright © 2018 Elsevier B.V. All rights reserved.
Wang, Jiuling; Zhang, Yue; Zhao, Yang O.; Li, Michelle W. M.; Zhang, Lili; Dragovic, Srdjan; Abraham, Nabil M.; Fikrig, Erol
2013-01-01
Malaria, a mosquito-borne disease caused by Plasmodium species, causes substantial morbidity and mortality throughout the world. Plasmodium sporozoites mature in oocysts formed in the mosquito gut wall and then invade the salivary glands, where they remain until transmitted to the vertebrate host during a mosquito bite. The Plasmodium circumsporozoite protein (CSP) binds to salivary glands and plays a role in the invasion of this organ by sporozoites. We identified an Anopheles salivary gland protein, named CSP-binding protein (CSPBP), that interacts with CSP. Downregulation of CSPBP in mosquito salivary glands inhibited invasion by Plasmodium organisms. In vivo bioassays showed that mosquitoes that were fed blood with CSPBP antibody displayed a 25% and 90% reduction in the parasite load in infected salivary glands 14 and 18 days after the blood meal, respectively. These results suggest that CSPBP is important for the infection of the mosquito salivary gland by Plasmodium organisms and that blocking CSPBP can interfere with the Plasmodium life cycle. PMID:23801601
Unexpected fold in the circumsporozoite protein target of malaria vaccines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doud, Michael B.; Koksal, Adem C.; Mi, Li-Zhi
Circumsporozoite (CS) protein is the major surface component of Plasmodium falciparum sporozoites and is essential for host cell invasion. A vaccine containing tandem repeats, region III, and thrombospondin type-I repeat (TSR) of CS is efficacious in phase III trials but gives only a 35% reduction in severe malaria in the first year postimmunization. We solved crystal structures showing that region III and TSR fold into a single unit, an '{alpha}TSR' domain. The {alpha}TSR domain possesses a hydrophobic pocket and core, missing in TSR domains. CS binds heparin, but {alpha}TSR does not. Interestingly, polymorphic T-cell epitopes map to specialized {alpha}TSR regions.more » The N and C termini are unexpectedly close, providing clues for sporozoite sheath organization. Elucidation of a unique structure of a domain within CS enables rational design of next-generation subunit vaccines and functional and medicinal chemical investigation of the conserved hydrophobic pocket.« less
Structure of the circumsporozoite protein gene in 18 strains of Plasmodium falciparum.
Weber, J L; Hockmeyer, W T
1985-06-01
Using the cloned circumsporozoite (CS) protein gene of a Brazilian strain of Plasmodium falciparum as probe, we have analyzed the structure of the CS protein gene from 17 other Asian, African, Central and South American parasite strains by nucleic acid hybridization. Each strain appears to have one CS protein gene which hybridizes readily to the Brazilian strain probe. The 5' and 3' thirds of the genes are invariant in size in all 18 strains whereas the central third containing the 12 base pair tandem repeats varies in size over a range of about 100 base pairs. Several differences were found in the locations of Sau3A sites in the genes. The Sau3A sites are significant because each of the minority Asn-Val-Asp-Pro repeats in the cloned gene has a Sau3A site. DNA melting of hybrids revealed a high degree of homology between the sequences of the cloned gene and genes from an Asian strain and an African strain. A 14 base oligodeoxynucleotide with a sequence from the central repeat region hybridized to all strains tested. We conclude that the CS protein gene is highly conserved among strains of P. falciparum and that malaria vaccine development with the CS protein is unlikely to be complicated by strain variation.
Palma, Christopher; Overstreet, Michael G.; Guedon, Jean-Marc; Hoiczyk, Egbert; Ward, Cameron; Karen, Kasey A.; Zavala, Fidel; Ketner, Gary
2011-01-01
Adenovirus particles can be engineered to display exogenous peptides on their surfaces by modification of viral capsid proteins, and particles that display pathogen-derived peptides can induce protective immunity. We constructed viable recombinant adenoviruses that display B-cell epitopes from the Plasmodium falciparum circumsporozoite protein (PfCSP) in the major adenovirus capsid protein, hexon. Recombinants induced high-titer antibodies against CSP when injected intraperitoneally into mice. Serum obtained from immunized mice recognized both recombinant PfCSP protein and P. falciparum sporozoites, and neutralized P. falciparum sporozoites in vitro. Replicating adenovirus vaccines have provided economical protection against adenovirus disease for over three decades. The recombinants described here may provide a path to an affordable malaria vaccine in the developing world. PMID:21199707
Wang, Qian; Fujioka, Hisashi; Nussenzweig, Victor
2005-01-01
Plasmodium sporozoites develop within oocysts residing in the mosquito midgut. Mature sporozoites exit the oocysts, enter the hemolymph, and invade the salivary glands. The circumsporozoite (CS) protein is the major surface protein of salivary gland and oocyst sporozoites. It is also found on the oocyst plasma membrane and on the inner surface of the oocyst capsule. CS protein contains a conserved motif of positively charged amino acids: region II-plus, which has been implicated in the initial stages of sporozoite invasion of hepatocytes. We investigated the function of region II-plus by generating mutant parasites in which the region had been substituted with alanines. Mutant parasites produced normal numbers of sporozoites in the oocysts, but the sporozoites were unable to exit the oocysts. In in vitro as well, there was a profound delay, upon trypsin treatment, in the release of mutant sporozoites from oocysts. We conclude that the exit of sporozoites from oocysts is an active process that involves the region II-plus of CS protein. In addition, the mutant sporozoites were not infective to young rats. These findings provide a new target for developing reagents that interfere with the transmission of malaria. PMID:16201021
NASA Astrophysics Data System (ADS)
Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.
1984-08-01
A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.
Gonzalez-Ceron, L; Rodriguez, M H; Wirtz, R A; Sina, B J; Palomeque, O L; Nettel, J A; Tsutsumi, V
1998-11-01
The major surface circumsporozoite (CS) proteins are known to play a role in malaria sporozoite development and invasion of invertebrate and vertebrate host cells. Plasmodium vivax CS protein processing during mosquito midgut oocyst and salivary gland sporozoite development was studied using monoclonal antibodies which recognize different CS protein epitopes. Monoclonal antibodies which react with the CS amino acid repeat sequences by ELISA recognized a 50-kDa precursor protein in immature oocyst and additional 47- and 42-kDa proteins in older oocysts. A 42-kDa CS protein was detected after initial sporozoite invasion of mosquito salivary glands and an additional 50-kDa precursor CS protein observed later in infected salivary glands. These data confirm previous results with other Plasmodium species, in which more CS protein precursors were detected in oocysts than in salivary gland sporozoites. A monoclonal antibody (PvPCS) was characterized which reacts with an epitope found only in the 50-kDa precursor CS protein. PvPCS reacted with all P. vivax sporozoite strains tested by indirect immunofluorescent assay, homogeneously staining the sporozoite periphery with much lower intensity than that produced by anti-CS repeat antibodies. Immunoelectron microscopy using PvPCS showed that the CS protein precursor was associated with peripheral cytoplasmic vacuoles and membranes of sporoblast and budding sporozoites in development oocysts. In salivary gland sporozoites, the CS protein precursor was primarily associated with micronemes and sporozoite membranes. Our results suggest that the 50-kDa CS protein precursor is synthesized intracellularly and secreted on the membrane surface, where it is proteolytically processed to form the 42-kDa mature CS protein. These data indicate that differences in CS protein processing in oocyst and salivary gland sporozoites development may occur. Copyright 1998 Academic Press.
Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878
Cherif, Mahamoud Sama; Shuaibu, Mohammed Nasir; Kodama, Yukinobu; Kurosaki, Tomoaki; Helegbe, Gideon Kofi; Kikuchi, Mihoko; Ichinose, Akitoyo; Yanagi, Tetsuo; Sasaki, Hitoshi; Yui, Katsuyuki; Tien, Nguyen Huy; Karbwang, Juntra; Hirayama, Kenji
2014-04-07
We have previously reported the new formulation of polyethylimine (PEI) with gamma polyglutamic acid (γ-PGA) nanoparticle (NP) to have provided Plasmodium yoelii merozoite surface protein-1 (PyMSP-1) plasmid DNA vaccine with enhanced protective cellular and humoral immunity in the lethal mouse malaria model. PyGPI8p-transamidase-related protein (PyTAM) was selected as a possible candidate vaccine antigen by using DNA vaccination screening from 29 GPI anchor and signal sequence motif positive genes picked up using web-based bioinformatics tools; though the observed protection was not complete. Here, we observed augmented protective effect of PyTAM DNA vaccine by using PEI and γ-PGA complex as delivery system. NP-coated PyTAM plasmid DNA immunized mice showed a significant survival rate from lethal P. yoelii challenge infection compared with naked PyTAM plasmid or with NP-coated empty plasmid DNA group. Antigen-specific IgG1 and IgG2b subclass antibody levels, proportion of CD4 and CD8T cells producing IFN-γ in the splenocytes and IL-4, IFN-γ, IL-12 and TNF-α levels in the sera and in the supernatants from ex vivo splenocytes culture were all enhanced by the NP-coated PyTAM DNA vaccine. These data indicates that NP augments PyTAM protective immune response, and this enhancement was associated with increased DC activation and concomitant IL-12 production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Teixeira, Lais H.; Tararam, Cibele A.; Lasaro, Marcio O.; Camacho, Ariane G. A.; Ersching, Jonatan; Leal, Monica T.; Herrera, Sócrates; Bruna-Romero, Oscar; Soares, Irene S.; Nussenzweig, Ruth S.; Ertl, Hildegund C. J.; Nussenzweig, Victor
2014-01-01
Plasmodium vivax is the most widespread and the second most prevalent malaria-causing species in the world. Current measures used to control the transmission of this disease would benefit from the development of an efficacious vaccine. In the case of the deadly parasite P. falciparum, the recombinant RTS,S vaccine containing the circumsporozoite antigen (CSP) consistently protects 30 to 50% of human volunteers against infection and is undergoing phase III clinical trials in Africa with similar efficacy. These findings encouraged us to develop a P. vivax vaccine containing the three circulating allelic forms of P. vivax CSP. Toward this goal, we generated three recombinant bacterial proteins representing the CSP alleles, as well as a hybrid polypeptide called PvCSP-All-CSP-epitopes. This hybrid contains the conserved N and C termini of P. vivax CSP and the three variant repeat domains in tandem. We also generated simian and human recombinant replication-defective adenovirus vectors expressing PvCSP-All-CSP-epitopes. Mice immunized with the mixture of recombinant proteins in a formulation containing the adjuvant poly(I·C) developed high and long-lasting serum IgG titers comparable to those elicited by proteins emulsified in complete Freund's adjuvant. Antibody titers were similar in mice immunized with homologous (protein-protein) and heterologous (adenovirus-protein) vaccine regimens. The antibodies recognized the three allelic forms of CSP, reacted to the repeated and nonrepeated regions of CSP, and recognized sporozoites expressing the alleles VK210 and VK247. The vaccine formulations described in this work should be useful for the further development of an anti-P. vivax vaccine. PMID:24478093
Immunogenicity and Protective Efficacy of a Plasmodium yoelii Hsp60 DNA Vaccine in BALB/c Mice
Sanchez, Gloria I.; Sedegah, Martha; Rogers, William O.; Jones, Trevor R.; Sacci, John; Witney, Adam; Carucci, Daniel J.; Kumar, Nirbhay; Hoffman, Stephen L.
2001-01-01
The gene encoding the 60-kDa heat shock protein of Plasmodium yoelii (PyHsp60) was cloned into the VR1012 and VR1020 mammalian expression vectors. Groups of 10 BALB/c mice were immunized intramuscularly at 0, 3, and 9 weeks with 100 μg of PyHsp60 DNA vaccine alone or in combination with 30 μg of pmurGMCSF. Sera from immunized mice but not from vector control groups recognized P. yoelii sporozoites, liver stages, and infected erythrocytes in an indirect fluorescent antibody test. Two weeks after the last immunization, mice were challenged with 50 P. yoelii sporozoites. In one experiment the vaccine pPyHsp60-VR1012 used in combination with pmurGMCSF gave 40% protection (Fisher's exact test; P = 0.03, vaccinated versus control groups). In a second experiment this vaccine did not protect any of the immunized mice but induced a delay in the onset of parasitemia. In neither experiment was there any evidence of a protective effect against the asexual erythrocytic stage of the life cycle. In a third experiment mice were primed with PyHsp60 DNA, were boosted 2 weeks later with 2 × 103 irradiated P. yoelii sporozoites, and were challenged several weeks later. The presence of PyHsp60 in the immunization regimen did not lead to reduced blood-stage infection or development of parasites in hepatocytes. PyHsp60 DNA vaccines were immunogenic in BALB/c mice but did not consistently, completely protect against sporozoite challenge. The observation that in some of the PyHsp60 DNA vaccine-immunized mice there was protection against infection or a delay in the onset of parasitemia after sporozoite challenge deserves further evaluation. PMID:11349057
Arévalo-Herrera, Myriam; Vera, Omaira; Castellanos, Angélica; Céspedes, Nora; Soto, Liliana; Corradin, Giampietro; Herrera, Sócrates
2011-01-01
Plasmodium vivax circumsporozoite (CS) protein is a leading malaria vaccine candidate previously assessed in animals and humans. Here, combinations of three synthetic polypeptides corresponding to amino (N), central repeat (R), and carboxyl (C) regions of the CS protein formulated in Montanide ISA 720 or Montanide ISA 51 adjuvants were assessed for immunogenicity in rodents and primates. BALB/c mice and Aotus monkeys were divided into test and control groups and were immunized three times with doses of 50 and 100 μg of vaccine or placebo. Antigen-specific antimalarial antibodies were determined by enzyme-linked immunosorbent assay, immunofluorescent antibody test, and IFN-γ responses by enzyme-linked immunosorbent spot (ELIspot). Both vaccine formulations were highly immunogenic in both species. Mice developed better antibody responses against C and R polypeptides, whereas the N polypeptide was more immunogenic in monkeys. Anti-peptide antibodies remained detectable for several months and recognized native proteins on sporozoites. Differences between Montanide ISA 720 and Montanide ISA 51 formulations were not significant. PMID:21292874
Zhang, Cui; Li, Zhenkui; Cui, Huiting; Jiang, Yuanyuan; Yang, Zhenke; Wang, Xu; Gao, Han; Liu, Cong; Zhang, Shujia
2017-01-01
ABSTRACT Malaria parasites have a complex life cycle with multiple developmental stages in mosquito and vertebrate hosts, and different developmental stages express unique sets of genes. Unexpectedly, many transcription factors (TFs) commonly found in eukaryotic organisms are absent in malaria parasites; instead, a family of genes encoding proteins similar to the plant Apetala2 (ApiAP2) transcription factors is expanded in the parasites. Several malaria ApiAP2 genes have been shown to play a critical role in parasite development; however, the functions of the majority of the ApiAP2 genes remain to be elucidated. In particular, no study on the Plasmodium yoelii ApiAP2 (PyApiAP2) gene family has been reported so far. This study systematically investigated the functional roles of PyApiAP2 genes in parasite development. Twenty-four of the 26 PyApiAP2 genes were selected for disruption, and 12 were successfully knocked out using the clustered regularly interspaced short palindromic repeat–CRISPR-associated protein 9 (CRISPR-Cas9) method. The effects of gene knockout (KO) on parasite development in mouse and mosquito stages were evaluated. Ten of 12 successfully disrupted genes, including two genes that have not been functionally characterized in any Plasmodium species previously, were shown to be critical for P. yoelii development of sexual and mosquito stages. Additionally, seven of the genes were labeled for protein expression analysis, revealing important information supporting their functions. This study represents the first systematic functional characterization of the P. yoelii ApiAP2 gene family and discovers important insights on the roles of the ApiAP2 genes in parasite development. PMID:29233900
Leal, Monica Teixeira Andrade; Camacho, Ariane Guglielmi Ariza; Teixeira, Laís Helena; Bargieri, Daniel Youssef; Soares, Irene Silva; Tararam, Cibele Aparecida
2013-01-01
A Plasmodium falciparum circumsporozoite protein (CSP)-based recombinant fusion vaccine is the first malaria vaccine to reach phase III clinical trials. Resistance to infection correlated with the production of antibodies to the immunodominant central repeat region of the CSP. In contrast to P. falciparum, vaccine development against the CSP of Plasmodium vivax malaria is far behind. Based on this gap in our knowledge, we generated a recombinant chimeric protein containing the immunodominant central repeat regions of the P. vivax CSP fused to Salmonella enterica serovar Typhimurium-derived flagellin (FliC) to activate the innate immune system. The recombinant proteins that were generated contained repeat regions derived from each of the 3 different allelic variants of the P. vivax CSP or a fusion of regions derived from each of the 3 allelic forms. Mice were subcutaneously immunized with the fusion proteins alone or in combination with the Toll-like receptor 3 (TLR-3) agonist poly(I·C), and the anti-CSP serum IgG response was measured. Immunization with a mixture of the 3 recombinant proteins, each containing immunodominant epitopes derived from a single allelic variant, rather than a single recombinant protein carrying a fusion of regions derived from each of 3 allelic forms elicited a stronger immune response. This response was independent of TLR-4 but required TLR-5/MyD88 activation. Antibody titers significantly increased when poly(I·C) was used as an adjuvant with a mixture of the 3 recombinant proteins. These recombinant fusion proteins are novel candidates for the development of an effective malaria vaccine against P. vivax. PMID:23863502
Gonzalez-Ceron, L; Rodriguez, M H; Santillan, F V; Hernandez, J E; Wirtz, R A
2000-05-01
The susceptibility to two coindigenous Plasmodium vivax Grassi & Feletti phenotypes VK210 and VK247 of three colonized Anopheles albimanus Wiedemann strains (white-striped, green and brown) from southern Mexico was investigated. Mosquitoes of the three strains were simultaneously fed with P. vivax-infected patient blood and examined 1 wk later for the presence of oocysts. The circumsporozoite protein phenotype type (VK210 and VK247) was determined by immunoflorescence of salivary gland sporozoites using monoclonal antibodies. The proportions of specimens infected and the number of oocyst per mosquito indicated that all mosquito strains were more susceptible to the phenotype VK210 than to VK247, but the white-striped strain was more susceptible to both parasite phenotypes than the other two strains.
MacKellar, Drew C; Vaughan, Ashley M; Aly, Ahmed S I; DeLeon, Sasha; Kappe, Stefan H I
2011-11-01
The early transcribed membrane proteins (ETRAMPs) are a family of small, highly charged transmembrane proteins unique to malaria parasites. Some members of the ETRAMP family have been localized to the parasitophorous vacuole membrane that separates the intracellular parasite from the host cell and thus presumably have a role in host-parasite interactions. Although it was previously shown that two ETRAMPs are critical for rodent malaria parasite liver-stage development, the importance of most ETRAMPs during the parasite life cycle remains unknown. Here, we comprehensively identify nine new etramps in the genome of the rodent malaria parasite Plasmodium yoelii, and elucidate their conservation in other malaria parasites. etramp expression profiles are diverse throughout the parasite life cycle as measured by RT-PCR. Epitope tagging of two ETRAMPs demonstrates protein expression in blood and liver stages, and reveals differences in both their timing of expression and their subcellular localization. Gene targeting studies of each of the nine uncharacterized etramps show that two are refractory to deletion and thus likely essential for blood-stage replication. Seven etramps are not essential for any life cycle stage. Systematic characterization of the members of the ETRAMP family reveals the diversity in importance of each family member at the interface between host and parasite throughout the developmental cycle of the malaria parasite. © 2011 Blackwell Publishing Ltd.
Apoptosis of non-parasitised red blood cells in Plasmodium yoelii malaria
Totino, Paulo Renato Rivas; Pinna, Raquel Alves; De-Oliveira, Ana Cecilia Amado Xavier; Banic, Dalma Maria; Daniel-Ribeiro, Cláudio Tadeu; Ferreira-da-Cruz, Maria de Fátima
2013-01-01
Recently, while studying erythrocytic apoptosis during Plasmodium yoelii infection, we observed an increase in the levels of non-parasitised red blood cell (nRBC) apoptosis, which could be related to malarial anaemia. Therefore, in the present study, we attempted to investigate whether nRBC apoptosis is associated with the peripheral RBC count, parasite load or immune response. To this end, BALB/c mice were infected with P. yoelii 17XL and nRBC apoptosis, number of peripheral RBCs, parasitaemia and plasmatic levels of cytokines, nitric oxide and anti-RBC antibodies were evaluated at the early and late stages of anaemia. The apoptosis of nRBCs increased at the late stage and was associated with parasitaemia, but not with the intensity of the immune response. The increased percentage of nRBC apoptosis that was observed when anaemia was accentuated was not related to a reduction in peripheral RBCs. We conclude that nRBC apoptosis in P. yoelii malaria appears to be induced in response to a high parasite load. Further studies on malaria models in which acute anaemia develops during low parasitaemia are needed to identify the potential pathogenic role of nRBC apoptosis. PMID:24037189
Patil, Aarti; Orjuela-Sánchez, Pamela; da Silva-Nunes, Mônica; Ferreira, Marcelo U.
2010-01-01
The circumsporozoite protein (CSP) of Plasmodium vivax, a major target for malaria vaccine development, has immunodominant B-cell epitopes mapped to central nonapeptide repeat arrays. To determine whether rearrangements of repeat motifs during mitotic DNA replication of parasites create significant CSP diversity under conditions of low effective meiotic recombination rates, we examined csp alleles from sympatric P. vivax isolates systematically sampled from an area of low malaria endemicity in Brazil over a period of 14 months. Nine unique csp types, comprising six different nonapeptide repeats, were observed in 45 isolates analyzed. Identical or nearly identical repeats predominated in most arrays, consistent with their recent expansion. We found strong linkage disequilibrium at sites across the chromosome 8 segment flanking the csp locus, consistent with rare meiotic recombination in this region. We conclude that CSP repeat diversity may not be severely constrained by rare meiotic recombination in areas of low malaria endemicity. New repeat variants may be readily created by nonhomologous recombination even when meiotic recombination is rare, with potential implications for CSP-based vaccine development. PMID:20097310
Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.
2004-01-01
We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966
Nair, Sethu C; Pattaradilokrat, Sittiporn; Zilversmit, Martine M; Dommer, Jennifer; Nagarajan, Vijayaraj; Stephens, Melissa T; Xiao, Wenming; Tan, John C; Su, Xin-Zhuan
2014-01-01
The rodent malaria parasite Plasmodium yoelii is an important model for studying malaria immunity and pathogenesis. One approach for studying malaria disease phenotypes is genetic mapping, which requires typing a large number of genetic markers from multiple parasite strains and/or progeny from genetic crosses. Hundreds of microsatellite (MS) markers have been developed to genotype the P. yoelii genome; however, typing a large number of MS markers can be labor intensive, time consuming, and expensive. Thus, development of high-throughput genotyping tools such as DNA microarrays that enable rapid and accurate large-scale genotyping of the malaria parasite will be highly desirable. In this study, we sequenced the genomes of two P. yoelii strains (33X and N67) and obtained a large number of single nucleotide polymorphisms (SNPs). Based on the SNPs obtained, we designed sets of oligonucleotide probes to develop a microarray that could interrogate ∼11,000 SNPs across the 14 chromosomes of the parasite in a single hybridization. Results from hybridizations of DNA samples of five P. yoelii strains or cloned lines (17XNL, YM, 33X, N67 and N67C) and two progeny from a genetic cross (N67×17XNL) to the microarray showed that the array had a high call rate (∼97%) and accuracy (99.9%) in calling SNPs, providing a simple and reliable tool for typing the P. yoelii genome. Our data show that the P. yoelii genome is highly polymorphic, although isogenic pairs of parasites were also detected. Additionally, our results indicate that the 33X parasite is a progeny of 17XNL (or YM) and an unknown parasite. The highly accurate and reliable microarray developed in this study will greatly facilitate our ability to study the genetic basis of important traits and the disease it causes. Published by Elsevier B.V.
Arévalo-Herrera, Myriam; Soto, Liliana; Perlaza, Blanca Liliana; Céspedes, Nora; Vera, Omaira; Lenis, Ana Milena; Bonelo, Anilza; Corradin, Giampietro; Herrera, Sócrates
2011-01-01
Plasmodium vivax circumsporozoite (CS) protein is a leading malaria vaccine candidate. We describe the characterization of specific immune responses induced in 21 malaria-naive volunteers vaccinated with long synthetic peptides derived from the CS protein formulated in Montanide ISA 720. Both antibody- and cell-mediated immune responses were analyzed. Antibodies were predominantly of IgG1 and IgG3 isotypes, recognized parasite proteins on the immunofluorescent antibody test, and partially blocked sporozoite invasion of hepatoma cell lines in vitro. Peripheral blood mononuclear cells from most volunteers (94%) showed IFN-γ production in vitro upon stimulation with both long signal peptide and short peptides containing CD8+ T-cell epitopes. The relatively limited sample size did not allow conclusions about HLA associations with the immune responses observed. In summary, the inherent safety and tolerability together with strong antibody responses, invasion blocking activity, and the IFN-γ production induced by these vaccine candidates warrants further testing in a phase II clinical trial. PMID:21292876
Oyen, David; Torres, Jonathan L.; Wille-Reece, Ulrike; Ockenhouse, Christian F.; Emerling, Daniel; Glanville, Jacob; Volkmuth, Wayne; Flores-Garcia, Yevel; Zavala, Fidel; Ward, Andrew B.; King, C. Richter; Wilson, Ian A.
2017-01-01
Acquired resistance against antimalarial drugs has further increased the need for an effective malaria vaccine. The current leading candidate, RTS,S, is a recombinant circumsporozoite protein (CSP)-based vaccine against Plasmodium falciparum that contains 19 NANP repeats followed by a thrombospondin repeat domain. Although RTS,S has undergone extensive clinical testing and has progressed through phase III clinical trials, continued efforts are underway to enhance its efficacy and duration of protection. Here, we determined that two monoclonal antibodies (mAbs 311 and 317), isolated from a recent controlled human malaria infection trial exploring a delayed fractional dose, inhibit parasite development in vivo by at least 97%. Crystal structures of antibody fragments (Fabs) 311 and 317 with an (NPNA)3 peptide illustrate their different binding modes. Notwithstanding, one and three of the three NPNA repeats adopt similar well-defined type I β-turns with Fab311 and Fab317, respectively. Furthermore, to explore antibody binding in the context of P. falciparum CSP, we used negative-stain electron microscopy on a recombinant shortened CSP (rsCSP) construct saturated with Fabs. Both complexes display a compact rsCSP with multiple Fabs bound, with the rsCSP–Fab311 complex forming a highly organized helical structure. Together, these structural insights may aid in the design of a next-generation malaria vaccine. PMID:29138320
Oyen, David; Torres, Jonathan L.; Wille-Reece, Ulrike; ...
2017-11-14
Acquired resistance against antimalarial drugs has further increased the need for an effective malaria vaccine. The current leading candidate, RTS,S, is a recombinant circumsporozoite protein (CSP)-based vaccine against Plasmodium falciparum that contains 19 NANP repeats followed by a thrombospondin repeat domain. Although RTS,S has undergone extensive clinical testing and has progressed through phase III clinical trials, continued efforts are underway to enhance its efficacy and duration of protection. Here in this paper, we determined that two monoclonal antibodies (mAbs 311 and 317), isolated from a recent controlled human malaria infection trial exploring a delayed fractional dose, inhibit parasite development inmore » vivo by at least 97%. Crystal structures of antibody fragments (Fabs) 311 and 317 with an (NPNA) 3 peptide illustrate their different binding modes. Notwithstanding, one and three of the three NPNA repeats adopt similar well-defined type I β-turns with Fab311 and Fab317, respectively. Furthermore, to explore antibody binding in the context of P. falciparum CSP, we used negative-stain electron microscopy on a recombinant shortened CSP (rsCSP) construct saturated with Fabs. Both complexes display a compact rsCSP with multiple Fabs bound, with the rsCSP–Fab311 complex forming a highly organized helical structure. Lastly, together, these structural insights may aid in the design of a next-generation malaria vaccine.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oyen, David; Torres, Jonathan L.; Wille-Reece, Ulrike
Acquired resistance against antimalarial drugs has further increased the need for an effective malaria vaccine. The current leading candidate, RTS,S, is a recombinant circumsporozoite protein (CSP)-based vaccine against Plasmodium falciparum that contains 19 NANP repeats followed by a thrombospondin repeat domain. Although RTS,S has undergone extensive clinical testing and has progressed through phase III clinical trials, continued efforts are underway to enhance its efficacy and duration of protection. Here in this paper, we determined that two monoclonal antibodies (mAbs 311 and 317), isolated from a recent controlled human malaria infection trial exploring a delayed fractional dose, inhibit parasite development inmore » vivo by at least 97%. Crystal structures of antibody fragments (Fabs) 311 and 317 with an (NPNA) 3 peptide illustrate their different binding modes. Notwithstanding, one and three of the three NPNA repeats adopt similar well-defined type I β-turns with Fab311 and Fab317, respectively. Furthermore, to explore antibody binding in the context of P. falciparum CSP, we used negative-stain electron microscopy on a recombinant shortened CSP (rsCSP) construct saturated with Fabs. Both complexes display a compact rsCSP with multiple Fabs bound, with the rsCSP–Fab311 complex forming a highly organized helical structure. Lastly, together, these structural insights may aid in the design of a next-generation malaria vaccine.« less
Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.
1999-01-01
Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206
Tan, Joshua; Sack, Brandon K; Oyen, David; Zenklusen, Isabelle; Piccoli, Luca; Barbieri, Sonia; Foglierini, Mathilde; Fregni, Chiara Silacci; Marcandalli, Jessica; Jongo, Said; Abdulla, Salim; Perez, Laurent; Corradin, Giampietro; Varani, Luca; Sallusto, Federica; Sim, Betty Kim Lee; Hoffman, Stephen L; Kappe, Stefan H I; Daubenberger, Claudia; Wilson, Ian A; Lanzavecchia, Antonio
2018-05-01
Immunization with attenuated Plasmodium falciparum sporozoites (PfSPZs) has been shown to be protective against malaria, but the features of the antibody response induced by this treatment remain unclear. To investigate this response in detail, we isolated IgM and IgG monoclonal antibodies from Tanzanian volunteers who were immunized with repeated injection of Sanaria PfSPZ Vaccine and who were found to be protected from controlled human malaria infection with infectious homologous PfSPZs. All isolated IgG monoclonal antibodies bound to P. falciparum circumsporozoite protein (PfCSP) and recognized distinct epitopes in its N terminus, NANP-repeat region, and C terminus. Strikingly, the most effective antibodies, as determined in a humanized mouse model, bound not only to the repeat region, but also to a minimal peptide at the PfCSP N-terminal junction that is not in the RTS,S vaccine. These dual-specific antibodies were isolated from different donors and were encoded by VH3-30 or VH3-33 alleles that encode tryptophan or arginine at position 52. Using structural and mutational data, we describe the elements required for germline recognition and affinity maturation. Our study provides potent neutralizing antibodies and relevant information for lineage-targeted vaccine design and immunization strategies.
Zhang, Cui; Gao, Han; Yang, Zhenke; Jiang, Yuanyuan; Li, Zhenkui; Wang, Xu; Xiao, Bo; Su, Xin-Zhuan; Cui, Huiting; Yuan, Jing
2017-03-01
CRISPR/Cas9 has been successfully adapted for gene editing in malaria parasites including Plasmodium falciparum and Plasmodium yoelii. However, the reported methods were limited to editing one gene at a time. In practice, it is often desired to modify multiple genetic loci in a parasite genome. Here we describe a CRISPR/Cas9 mediated genome editing method that allows successive modification of more than one gene in the genome of P. yoelii using an improved single-vector system (pYCm) we developed previously. Drug resistant genes encoding human dihydrofolate reductase (hDHFR) and a yeast bifunctional protein (yFCU), with cytosine deaminase (CD) and uridyl phosphoribosyl transferase (UPRT) activities in the plasmid, allowed sequential positive (pyrimethamine, Pyr) and negative (5-fluorocytosine, 5FC) selections and generation of transgenic parasites free of the episomal plasmid after genetic modification. Using this system, we were able to efficiently tag a gene of interest (Pyp28) and subsequently disrupted two genes (Pyctrp and Pycdpk3) that are individually critical for ookinete motility. Disruption of the genes either eliminated (Pyctrp) or greatly reduced (Pycdpk3) ookinete forward motility in matrigel in vitro and completely blocked oocyst development in mosquito midgut. The method will greatly facilitate studies of parasite gene function, development, and disease pathogenesis. Copyright © 2016 Elsevier B.V. All rights reserved.
Deng, Xu-Feng; Zhou, Dong; Liu, Quan-Xing; Zheng, Hong; Ding, Yan; Xu, Wen-Yue; Min, Jia-Xin; Dai, Ji-Gang
2018-05-01
Blocking the activation of nuclear factor κB (NF-κB) is a promising strategy for the treatment of non-small cell lung cancer. The circumsporozoite protein (CSP), a key component of the sporozoite stage of the malaria parasite, was previously reported to block NF-κB activation in hepatocytes. Therefore, in the present study, the effect of CSP on the growth of the human lung cancer cell line, A549, was investigated. It was demonstrated that transfection with a recombinant plasmid expressing CSP was able to inhibit the proliferation of A549 cells in a dose-dependent manner and induce the apoptosis of A549 cells. A NF-κB gene reporter assay indicated that CSP and its nuclear localization signal (NLS) motif were able to equally suppress the activation of NF-κB following stimulation with human recombinant tumor necrosis factor (TNF)-α in A549 cells. Furthermore, western blot analysis indicated that NLS did not affect the phosphorylation and degradation of IκB, but was able to markedly inhibit the nuclear translocation of NF-κB in TNF-α stimulated A549 cells. Therefore, the data suggest that CSP may be investigated as a potential novel NF-κB inhibitor for the treatment of lung cancer.
A Plasmodium yoelii HECT-like E3 ubiquitin ligase regulates parasite growth and virulence.
Nair, Sethu C; Xu, Ruixue; Pattaradilokrat, Sittiporn; Wu, Jian; Qi, Yanwei; Zilversmit, Martine; Ganesan, Sundar; Nagarajan, Vijayaraj; Eastman, Richard T; Orandle, Marlene S; Tan, John C; Myers, Timothy G; Liu, Shengfa; Long, Carole A; Li, Jian; Su, Xin-Zhuan
2017-08-09
Infection of mice with strains of Plasmodium yoelii parasites can result in different pathology, but molecular mechanisms to explain this variation are unclear. Here we show that a P. yoelii gene encoding a HECT-like E3 ubiquitin ligase (Pyheul) influences parasitemia and host mortality. We genetically cross two lethal parasites with distinct disease phenotypes, and identify 43 genetically diverse progeny by typing with microsatellites and 9230 single-nucleotide polymorphisms. A genome-wide quantitative trait loci scan links parasite growth and host mortality to two major loci on chromosomes 1 and 7 with LOD (logarithm of the odds) scores = 6.1 and 8.1, respectively. Allelic exchange of partial sequences of Pyheul in the chromosome 7 locus and modification of the gene expression alter parasite growth and host mortality. This study identifies a gene that may have a function in parasite growth, virulence, and host-parasite interaction, and therefore could be a target for drug or vaccine development.Many strains of Plasmodium differ in virulence, but factors that control these distinctions are not known. Here the authors comparatively map virulence loci using the offspring from a P. yoelii YM and N67 genetic cross, and identify a putative HECT E3 ubiquitin ligase that may explain the variance.
Patra, Aditya Prasad; Sharma, Shobhona; Ainavarapu, Sri Rama Koti
2017-02-10
The most effective vaccine candidate of malaria is based on the Plasmodium falciparum circumsporozoite protein (CSP), a major surface protein implicated in the structural strength, motility, and immune evasion properties of the infective sporozoites. It is suspected that reversible conformational changes of CSP are required for infection of the mammalian host, but the detailed structure and dynamic properties of CSP remain incompletely understood, limiting our understanding of its function in the infection. Here, we report the structural and mechanical properties of the CSP studied using single-molecule force spectroscopy on several constructs, one including the central region of CSP, which is rich in NANP amino acid repeats (CSP rep ), and a second consisting of a near full-length sequence without the signal and anchor hydrophobic domains (CSP ΔHP ). Our results show that the CSP rep is heterogeneous, with 40% of molecules requiring virtually no mechanical force to unfold (<10 piconewtons (pN)), suggesting that these molecules are mechanically compliant and perhaps act as entropic springs, whereas the remaining 60% are partially structured with low mechanical resistance (∼70 pN). CSP ΔHP having multiple force peaks suggests specifically folded domains, with two major populations possibly indicating the open and collapsed forms. Our findings suggest that the overall low mechanical resistance of the repeat region, exposed on the outer surface of the sporozoites, combined with the flexible full-length conformations of CSP, may provide the sporozoites not only with immune evasion properties, but also with lubricating capacity required during its navigation through the mosquito and vertebrate host tissues. We anticipate that these findings would further assist in the design and development of future malarial vaccines. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.
Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan
2015-03-10
One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the
Mutungi, Joe Kimanthi; Yahata, Kazuhide; Sakaguchi, Miako; Kaneko, Osamu
2015-11-01
Malaria symptoms and pathogenesis are caused by blood stage parasite burdens of Plasmodium spp., for which invasion of red blood cells (RBCs) by merozoites is essential. Successful targeting by either drugs or vaccines directed against the whole merozoite or its antigens during its transient extracellular status would contribute to malaria control by impeding RBC invasion. To understand merozoite invasion biology and mechanisms, it is desired to obtain merozoites that retain their invasion activity in vitro. Accordingly, methods have been developed to isolate invasive Plasmodium knowlesi and Plasmodium falciparum merozoites. Rodent malaria parasite models offer ease in laboratory maintenance and experimental genetic modifications; however, no methods have been reported regarding isolation of high numbers of invasive rodent malaria merozoites. In this study, Plasmodium yoelii-infected RBCs were obtained from infected mice, and mature schizont-infected RBCs enriched via Histodenz™ density gradients. Merozoites retaining invasion activity were then isolated by passing the preparations through a filter membrane. RBC-invaded parasites developed to mature stages in vitro in a synchronous manner. Isolated merozoites were evaluated for retention of invasion activity following storage at different temperatures prior to incubation with uninfected mouse RBCs. Isolated merozoites retained their invasion activity 4h after isolation at 10 or 15 °C, whereas their invasion activity reduced to 0-10% within 30 min when incubated on ice or at 37 °C prior to RBC invasion assay. Images of merozoites at successive steps during RBC invasion were captured by light and transmission electron microscopy. Synthetic peptides derived from the amino acid sequence of the P. yoelii invasion protein RON2 efficiently inhibited RBC invasion. The developed method to isolate and keep invasive P. yoelii merozoites for up to 4h is a powerful tool to study the RBC invasion biology of this parasite
Rodríguez, Dolores; González-Aseguinolaza, Gloria; Rodríguez, Juan R; Vijayan, Aneesh; Gherardi, Magdalena; Rueda, Paloma; Casal, J Ignacio; Esteban, Mariano
2012-01-01
With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs) carrying the CD8(+) T cell epitope (SYVPSAEQI) of the circumsporozoite (CS) protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS), and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8(+) T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV) vectors from the Western Reserve (WR) and modified virus Ankara (MVA) strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria.
Phares, Timothy W; May, Anthony D; Genito, Christopher J; Hoyt, Nathan A; Khan, Farhat A; Porter, Michael D; DeBot, Margot; Waters, Norman C; Saudan, Philippe; Dutta, Sheetij
2017-03-13
Non-human primates, such as the rhesus macaques, are the preferred model for down-selecting human malaria vaccine formulations, but the rhesus model is expensive and does not allow for direct efficacy testing of human malaria vaccines. Transgenic rodent parasites expressing genes of human Plasmodium are now routinely used for efficacy studies of human malaria vaccines. Mice have however rarely predicted success in human malaria trials and there is scepticism whether mouse studies alone are sufficient to move a vaccine candidate into the clinic. A comparison of immunogenicity, fine-specificity and functional activity of two Alum-adjuvanted Plasmodium falciparum circumsporozoite protein (CSP)-based vaccines was conducted in mouse and rhesus models. One vaccine was a soluble recombinant protein (CSP) and the other was the same CSP covalently conjugated to the Qβ phage particle (Qβ-CSP). Mice showed different kinetics of antibody responses and different sensitivity to the NANP-repeat and N-terminal epitopes as compared to rhesus. While mice failed to discern differences between the protective efficacy of CSP versus Qβ-CSP vaccine following direct challenge with transgenic Plasmodium berghei parasites, rhesus serum from the Qβ-CSP-vaccinated animals induced higher in vivo sporozoite neutralization activity. Despite some immunologic parallels between models, these data demonstrate that differences between the immune responses induced in the two models risk conflicting decisions regarding potential vaccine utility in humans. In combination with historical observations, the data presented here suggest that although murine models may be useful for some purposes, non-human primate models may be more likely to predict the human response to investigational vaccines.
Espinosa, Diego A; Yadava, Anjali; Angov, Evelina; Maurizio, Paul L; Ockenhouse, Christian F; Zavala, Fidel
2013-08-01
The development of vaccine candidates against Plasmodium vivax-the most geographically widespread human malaria species-is challenged by technical difficulties, such as the lack of in vitro culture systems and availability of animal models. Chimeric rodent Plasmodium parasites are safe and useful tools for the preclinical evaluation of new vaccine formulations. We report the successful development and characterization of chimeric Plasmodium berghei parasites bearing the type I repeat region of P. vivax circumsporozoite protein (CSP). The P. berghei-P. vivax chimeric strain develops normally in mosquitoes and produces highly infectious sporozoites that produce patent infection in mice that are exposed to the bites of as few as 3 P. berghei-P. vivax-infected mosquitoes. Using this transgenic parasite, we demonstrate that monoclonal and polyclonal antibodies against P. vivax CSP strongly inhibit parasite infection and thus support the notion that these antibodies play an important role in protective immunity. The chimeric parasites we developed represent a robust model for evaluating protective immune responses against P. vivax vaccines based on CSP.
Rodríguez, Dolores; González-Aseguinolaza, Gloria; Rodríguez, Juan R.; Vijayan, Aneesh; Gherardi, Magdalena; Rueda, Paloma; Casal, J. Ignacio; Esteban, Mariano
2012-01-01
With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs) carrying the CD8+ T cell epitope (SYVPSAEQI) of the circumsporozoite (CS) protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS), and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8+ T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV) vectors from the Western Reserve (WR) and modified virus Ankara (MVA) strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria. PMID:22529915
Porter, Michael D.; Nicki, Jennifer; Pool, Christopher D.; DeBot, Margot; Illam, Ratish M.; Brando, Clara; Bozick, Brooke; De La Vega, Patricia; Angra, Divya; Spaccapelo, Roberta; Crisanti, Andrea; Murphy, Jittawadee R.; Bennett, Jason W.; Schwenk, Robert J.; Ockenhouse, Christian F.
2013-01-01
Circumsporozoite protein (CSP) of Plasmodium falciparum is a protective human malaria vaccine candidate. There is an urgent need for models that can rapidly down-select novel CSP-based vaccine candidates. In the present study, the mouse-mosquito transmission cycle of a transgenic Plasmodium berghei malaria parasite stably expressing a functional full-length P. falciparum CSP was optimized to consistently produce infective sporozoites for protection studies. A minimal sporozoite challenge dose was established, and protection was defined as the absence of blood-stage parasites 14 days after intravenous challenge. The specificity of protection was confirmed by vaccinating mice with multiple CSP constructs of differing lengths and compositions. Constructs that induced high NANP repeat-specific antibody titers in enzyme-linked immunosorbent assays were protective, and the degree of protection was dependent on the antigen dose. There was a positive correlation between antibody avidity and protection. The antibodies in the protected mice recognized the native CSP on the parasites and showed sporozoite invasion inhibitory activity. Passive transfer of anti-CSP antibodies into naive mice also induced protection. Thus, we have demonstrated the utility of a mouse efficacy model to down-select human CSP-based vaccine formulations. PMID:23536694
Cheng, Qianqian; Zhang, Qingfeng; Xu, Xindong; Yin, Lan; Sun, Lin; Lin, Xin; Dong, Chen; Pan, Weiqing
2014-04-15
Cell-mediated immunity plays a crucial role in the development of host resistance to asexual blood-stage malaria infection. However, little is known of the regulatory factors involved in this process. In this study, we investigated the impact of MAPK phosphotase 5 (MKP5) on protective immunity against a lethal Plasmodium yoelii 17XL blood-stage infection using MKP5 knockout C57BL/6 mice. Compared with wild-type control mice, MKP5 knockout mice developed significantly lower parasite burdens with prolonged survival times. We found that this phenomenon correlated with a rapid and strong IFN-γ-dependent cellular immune response during the acute phase of infection. Inactivation of IFN-γ by the administration of a neutralizing Ab significantly reduced the protective effects in MKP5 knockout mice. By analyzing IFN-γ production in innate and adaptive lymphocyte subsets, we observed that MKP5 deficiency specifically enhanced the IFN-γ response mediated by CD4+ T cells, which was attributable to the increased stimulatory capacity of splenic CD11c+ dendritic cells. Furthermore, following vaccination with whole blood-stage soluble plasmodial Ag, MKP5 knockout mice acquired strongly enhanced Ag-specific immune responses and a higher level of protection against subsequent P. yoelii 17XL challenge. Finally, we found the enhanced response mediated by MKP5 deficiency resulted in a lethal consequence in mice when infected with nonlethal P. yoelii 17XNL. Thus, our data indicate that MKP5 is a potential regulator of immune resistance against Plasmodium infection in mice, and that an understanding of the role of MKP5 in manipulating anti-malaria immunity may provide valuable information on the development of better control strategies for human malaria.
Plasmodium yoelii: induction of attenuated mutants by irradiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Waki, S.; Yonome, I.; Suzuki, M.
When erythrocytic forms of Plasmodium yoelii nigeriensis, which is invariably fatal in mice, were exposed to X rays, the dose to reduce surviving parasites to one millionth was 100 gray (10 Krad). A suspension of 5 X 10(6) per ml of parasitized erythrocyte was irradiated at 100 gray, and 0.2 ml aliquots were inoculated into 22 mice. Eleven mice showed patent parasitemia, and in these the growth curves were less steep than that found in nonirradiated parasites. The infections of 8 mice of the 11 were self-resolving, and the attenuated feature of the parasites maintained following a limited number ofmore » blood passages. The parasites were slowly growing even in nude mice and cause self-resolving infections in intact mice. BALB/c mice immunized with the attenuated parasites were protected against subsequent challenge infections with the original virulent erythrocytic and sporogonic forms. These findings indicate that attenuated mutants of malaria parasites can be readily induced by this method.« less
1988-01-01
William R. Majarian, 2 ,5 Frank A. Robey, 3 Walter Weiss, 1 and Stephen L. Hoffman 1 lInfectious Diseases Department, Naval Medical Research Institute...autoradiography. Recombinant viruses which were positive in this assay were subject to 3 rounds of plaque purification. Finally, plaque purified virus was...mechanisms in the protective immunity elicited by inmunization with irradiated sporozoites (3,7,8,9). In an attempt to induce a protective cellular immune
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
2012-01-01
Background Several pre-erythrocytic malaria vaccines based on the circumsporozoite protein (CSP) antigen of Plasmodium falciparum are in clinical development. Vaccine immunogenicity is commonly evaluated by the determination of anti-CSP antibody levels using IgG-based assays, but no standard assay is available to allow comparison of the different vaccines. Methods The validation of an anti-CSP repeat region enzyme-linked immunosorbent assay (ELISA) is described. This assay is based on the binding of serum antibodies to R32LR, a recombinant protein composed of the repeat region of P. falciparum CSP. In addition to the original recombinant R32LR, an easy to purify recombinant His-tagged R32LR protein has been constructed to be used as solid phase antigen in the assay. Also, hybridoma cell lines have been generated producing human anti-R32LR monoclonal antibodies to be used as a potential inexhaustible source of anti-CSP repeats standard, instead of a reference serum. Results The anti-CSP repeats ELISA was shown to be robust, specific and linear within the analytical range, and adequately fulfilled all validation criteria as defined in the ICH guidelines. Furthermore, the coefficient of variation for repeatability and intermediate precision did not exceed 23%. Non-interference was demonstrated for R32LR-binding sera, and the assay was shown to be stable over time. Conclusions This ELISA, specific for antibodies directed against the CSP repeat region, can be used as a standard assay for the determination of humoral immunogenicity in the development of any CSP-based P. falciparum malaria vaccine. PMID:23173602
Genito, Christopher J; Beck, Zoltan; Phares, Timothy W; Kalle, Fanta; Limbach, Keith J; Stefaniak, Maureen E; Patterson, Noelle B; Bergmann-Leitner, Elke S; Waters, Norman C; Matyas, Gary R; Alving, Carl R; Dutta, Sheetij
2017-07-05
Malaria caused by Plasmodium falciparum continues to threaten millions of people living in the tropical parts of the world. A vaccine that confers sterile and life-long protection remains elusive despite more than 30years of effort and resources invested in solving this problem. Antibodies to a malaria vaccine candidate circumsporozoite protein (CSP) can block invasion and can protect humans against malaria. We have manufactured the Falciparum Malaria Protein-013 (FMP013) vaccine based on the nearly full-length P. falciparum CSP 3D7 strain sequence. We report here immunogenicity and challenge data on FMP013 antigen in C57BL/6 mice formulated with two novel adjuvants of the Army Liposome Formulation (ALF) series and a commercially available adjuvant Montanide ISA 720 (Montanide) as a control. ALF is a liposomal adjuvant containing a synthetic monophosphoryl lipid A (3D-PHAD®). In our study, FMP013 was adjuvanted with ALF alone, ALF containing aluminum hydroxide (ALFA) or ALF containing QS-21 (ALFQ). Adjuvants ALF and ALFA induced similar antibody titers and protection against transgenic parasite challenge that were comparable to Montanide. ALFQ was superior to the other three adjuvants as it induced higher antibody titers with improved boosting after the third immunization, higher serum IgG2c titers, and enhanced protection. FMP013+ALFQ also augmented the numbers of splenic germinal center-derived activated B-cells and antibody secreting cells compared to Montanide. Further, FMP013+ALFQ induced antigen-specific IFN-γ ELISPOT activity, CD4 + T-cells and a T H 1-biased cytokine profile. These results demonstrate that soluble CSP can induce a potent and sterile protective immune response when formulated with the QS-21 containing adjuvant ALFQ. Comparative mouse immunogenicity data presented here were used as the progression criteria for an ongoing non-human primate study and a regulatory toxicology study in preparation for a controlled human malaria infection (CHMI
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Ribeiro, Bruno de Paulo; Cassiano, Gustavo Capatti; de Souza, Rodrigo Medeiros; Cysne, Dalila Nunes; Grisotto, Marcos Augusto Grigolin; de Azevedo dos Santos, Ana Paula Silva; Marinho, Cláudio Romero Farias; Machado, Ricardo Luiz Dantas; Nascimento, Flávia Raquel Fernandes
2016-01-01
Mechanisms involved in severe P. vivax malaria remain unclear. Parasite polymorphisms, parasite load and host cytokine profile may influence the course of infection. In this study, we investigated the influence of circumsporozoite protein (CSP) polymorphisms on parasite load and cytokine profile in patients with vivax malaria. A cross-sectional study was carried out in three cities: São Luís, Cedral and Buriticupu, Maranhão state, Brazil, areas of high prevalence of P. vivax. Interleukin (IL)-2, IL-4, IL-10, IL-6, IL-17, tumor necrosis factor alpha (TNF-α, interferon gamma (IFN-γ and transforming growth factor beta (TGF-β were quantified in blood plasma of patients and in supernatants from peripheral blood mononuclear cell (PBMC) cultures. Furthermore, the levels of cytokines and parasite load were correlated with VK210, VK247 and P. vivax-like CSP variants. Patients infected with P. vivax showed increased IL-10 and IL-6 levels, which correlated with the parasite load, however, in multiple comparisons, only IL-10 kept this association. A regulatory cytokine profile prevailed in plasma, while an inflammatory profile prevailed in PBMC culture supernatants and these patterns were related to CSP polymorphisms. VK247 infected patients showed higher parasitaemia and IL-6 concentrations, which were not associated to IL-10 anti-inflammatory effect. By contrast, in VK210 patients, these two cytokines showed a strong positive correlation and the parasite load was lower. Patients with the VK210 variant showed a regulatory cytokine profile in plasma, while those infected with the VK247 variant have a predominantly inflammatory cytokine profile and higher parasite loads, which altogether may result in more complications in infection. In conclusion, we propose that CSP polymorphisms is associated to the increase of non-regulated inflammatory immune responses, which in turn may be associated with the outcome of infection. PMID:26943639
Li, Xiangming; Huang, Jing; Kawamura, Akira; Funakoshi, Ryota; Porcelli, Steven A; Tsuji, Moriya
2017-05-31
A CD1d-binding, invariant (i) natural killer T (NKT)-cell stimulatory glycolipid, α-Galactosylceramide (αGalCer), has been shown to act as an adjuvant. We previously identified a fluorinated phenyl ring-modified αGalCer analog, 7DW8-5, displaying a higher binding affinity for CD1d molecule and more potent adjuvant activity than αGalCer. In the present study, 7DW8-5 co-administered intramuscularly (i.m.) with a recombinant adenovirus expressing a Plasmodium yoelii circumsporozoite protein (PyCSP), AdPyCS, has led to a co-localization of 7DW8-5 and a PyCSP in draining lymph nodes (dLNs), particularly in dendritic cells (DCs). This occurrence initiates a cascade of events, such as the recruitment of DCs to dLNs and their activation and maturation, and the enhancement of the ability of DCs to prime CD8+ T cells induced by AdPyCS and ultimately leading to a potent adjuvant effect and protection against malaria. Copyright © 2017 Elsevier Ltd. All rights reserved.
Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.
2013-01-01
Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242
Pereira, Virginia Araujo; Sánchez-Arcila, Juan Camilo; Vasconcelos, Mariana Pinheiro Alves; Ferreira, Amanda Ribeiro; de Souza Videira, Lorene; Teva, Antonio; Perce-da-Silva, Daiana; Marques, Maria Teresa Queiroz; de Carvalho, Luzia Helena; Banic, Dalma Maria; Pôrto, Luiz Cristóvão Sobrino; Oliveira-Ferreira, Joseli
2018-05-14
Brazil has seen a great decline in malaria and the country is moving towards elimination. However, for eventual elimination, the control program needs efficient tools in order to monitor malaria exposure and transmission. In this study, we aimed to evaluate whether seroprevalence to the circumsporozoite protein (CSP) is a good tool for monitoring the exposure to and/or evaluating the burden and distribution of Plasmodium species in the Brazilian Amazon. Cross-sectional surveys were conducted in a rural area of Porto Velho, Rondônia state. Parasite infection was detected by microscopy and polymerase chain reaction. Antibodies to the sporozoite CSP repeats of Plasmodium vivax, P. falciparum, and P. malariae (PvCS, PfCS, and PmCS) were detected using the enzyme-linked immunosorbent assay technique. Human leukocyte antigen (HLA)-DRB1 and DQB1 genes were typed using Luminex® xMAP® technology. The prevalence of immunoglobulin G against P. vivax CSP peptide (62%) was higher than P. falciparum (49%) and P. malariae (46%) CSP peptide. Most of the studied individuals had antibodies to at least one of the three peptides (72%), 34% had antibodies to all three peptides and 28% were non-responders. Although the majority of the population was not infected at the time of the survey, 74.3% of parasite-negative individuals had antibodies to at least one of the CSPs. Importantly, among individuals carrying the haplotypes DRB1*04~DQB1*03, there was a significantly higher frequency of PfCS responders, and DRB1*16~DQB1*03 haplotype for PvCS and PfCS responders. In contrast, HLA-DRB1*01 and HLA-DQB1*05 allelic groups were associated with a lack of antibodies to P. vivax and P. falciparum CSP repeats, and the haplotype DRB1*01~DQB1*05 was also associated with non-responders, including non-responders to P. malariae. Our results show that in low transmission settings, naturally acquired antibody responses against the CSP repeats of P. vivax, P. falciparum, and P. malariae in a single
Hodgson, Susanne H; Ewer, Katie J; Bliss, Carly M; Edwards, Nick J; Rampling, Thomas; Anagnostou, Nicholas A; de Barra, Eoghan; Havelock, Tom; Bowyer, Georgina; Poulton, Ian D; de Cassan, Simone; Longley, Rhea; Illingworth, Joseph J; Douglas, Alexander D; Mange, Pooja B; Collins, Katharine A; Roberts, Rachel; Gerry, Stephen; Berrie, Eleanor; Moyle, Sarah; Colloca, Stefano; Cortese, Riccardo; Sinden, Robert E; Gilbert, Sarah C; Bejon, Philip; Lawrie, Alison M; Nicosia, Alfredo; Faust, Saul N; Hill, Adrian V S
2015-04-01
Circumsporozoite protein (CS) is the antigenic target for RTS,S, the most advanced malaria vaccine to date. Heterologous prime-boost with the viral vectors simian adenovirus 63 (ChAd63)-modified vaccinia virus Ankara (MVA) is the most potent inducer of T-cells in humans, demonstrating significant efficacy when expressing the preerythrocytic antigen insert multiple epitope-thrombospondin-related adhesion protein (ME-TRAP). We hypothesized that ChAd63-MVA containing CS may result in a significant clinical protective efficacy. We conducted an open-label, 2-site, partially randomized Plasmodium falciparum sporozoite controlled human malaria infection (CHMI) study to compare the clinical efficacy of ChAd63-MVA CS with ChAd63-MVA ME-TRAP. One of 15 vaccinees (7%) receiving ChAd63-MVA CS and 2 of 15 (13%) receiving ChAd63-MVA ME-TRAP achieved sterile protection after CHMI. Three of 15 vaccinees (20%) receiving ChAd63-MVA CS and 5 of 15 (33%) receiving ChAd63-MVA ME-TRAP demonstrated a delay in time to treatment, compared with unvaccinated controls. In quantitative polymerase chain reaction analyses, ChAd63-MVA CS was estimated to reduce the liver parasite burden by 69%-79%, compared with 79%-84% for ChAd63-MVA ME-TRAP. ChAd63-MVA CS does reduce the liver parasite burden, but ChAd63-MVA ME-TRAP remains the most promising antigenic insert for a vectored liver-stage vaccine. Detailed analyses of parasite kinetics may allow detection of smaller but biologically important differences in vaccine efficacy that can influence future vaccine development. NCT01623557. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.
Brett, S J; Cox, F E
1982-08-01
In mice infected with the intestinal flagellates Giardia muris or Spironucleus muris, together with the blood parasites Babesia microti or Plasmodium yoelii, there is a temporary decrease of flagellate cyst output coincident with the peak of the blood parasite infections, followed by a rapid return to normal levels. This decrease in cyst output is correlated with decreased numbers of trophozoites in the small intestine. The effect on S. muris is more marked than that on G. muris. Neither blood parasites has any effect on the total duration of the flagellate infection and the flagellates do not affect the blood parasites. In mice infected with G. muris or S. muris and P. berghei there is also a decrease in cyst output but this is less apparent than in infections with B. microti or P. yoelii because of the fatal nature of the P. berghei infection. It is suggested that the decrease in cyst output is probably due to changes in the contents of the small intestine or to non-specific immunological factors rather than to specific immunological changes.
Gomes, Margarete do Socorro Mendonça; Vieira, José Luiz Fernandes; Cassiano, Gustavo Capatti; Musset, Lise; Legrand, Eric; Nacher, Mathieu; Couto, Vanja Suely Calvosa D'Almeida; Machado, Ricardo Luiz Dantas; Couto, Álvaro Augusto Ribeiro D'Almeida
2016-09-22
Malaria is a major health problem for people who live on the border between Brazil and French Guiana. Here we discuss Plasmodium vivax distribution pattern in the town of Oiapoque, Amapá State using the circumsporozoite (CS) gene as a marker. Ninety-one peripheral blood samples from P. vivax patients have been studied. Of these, 64 individuals were from the municipality of Oiapoque (Amapá State, Brazil) and 27 patients from French Guiana (August to December 2011). DNA extraction was performed, and a fragment of the P. vivax CS gene was subsequently analyzed using PCR/RFLP. The VK210 genotype was the most common in both countries (48.36% in Brazil and 14.28% in French Guiana), followed by the P. vivax-like (1.10% in both Brazil and French Guiana) and VK247 (1.10% only in Brazil) in single infections. We were able to detect all three CS genotypes simultaneously in mixed infections. There were no statistically significant differences either regarding infection site or parasitaemia among individuals with different genotypes. These results suggest that the same genotypes circulating in French Guiana are found in the municipality of Oiapoque in Brazil. These findings suggest that there may be a dispersion of parasitic populations occurring between the two countries. Most likely, this distribution is associated with prolonged and/or more complex transmission patterns of these genotypes in Brazil, bordering French Guiana.
Release of Hepatic Plasmodium yoelii Merozoites into the Pulmonary Microvasculature
Baer, Kerstin; Klotz, Christian; Kappe, Stefan H. I; Schnieder, Thomas; Frevert, Ute
2007-01-01
Plasmodium undergoes one round of multiplication in the liver prior to invading erythrocytes and initiating the symptomatic blood phase of the malaria infection. Productive hepatocyte infection by sporozoites leads to the generation of thousands of merozoites capable of erythrocyte invasion. Merozoites are released from infected hepatocytes as merosomes, packets of hundreds of parasites surrounded by host cell membrane. Intravital microscopy of green fluorescent protein–expressing P. yoelii parasites showed that the majority of merosomes exit the liver intact, adapt a relatively uniform size of 12–18 μm, and contain 100–200 merozoites. Merosomes survived the subsequent passage through the right heart undamaged and accumulated in the lungs. Merosomes were absent from blood harvested from the left ventricle and from tail vein blood, indicating that the lungs effectively cleared the blood from all large parasite aggregates. Accordingly, merosomes were not detectable in major organs such as brain, kidney, and spleen. The failure of annexin V to label merosomes collected from hepatic effluent indicates that phosphatidylserine is not exposed on the surface of the merosome membrane suggesting the infected hepatocyte did not undergo apoptosis prior to merosome release. Merosomal merozoites continued to express green fluorescent protein and did not incorporate propidium iodide or YO-PRO-1 indicating parasite viability and an intact merosome membrane. Evidence of merosomal merozoite infectivity was provided by hepatic effluent containing merosomes being significantly more infective than blood with an identical low-level parasitemia. Ex vivo analysis showed that merosomes eventually disintegrate inside pulmonary capillaries, thus liberating merozoites into the bloodstream. We conclude that merosome packaging protects hepatic merozoites from phagocytic attack by sinusoidal Kupffer cells, and that release into the lung microvasculature enhances the chance of successful
Expression of the Major Surface Antigen of Plasmodium knowlesi Sporozoites in Yeast
NASA Astrophysics Data System (ADS)
Sharma, Shobhona; Godson, G. Nigel
1985-05-01
The circumsporozoite protein, a surface antigen of the sporozoite stage of the monkey malarial parasite Plasmodium knowlesi, was expressed in the yeast Saccharomyces cerevisiae by using an expression vector containing the 5' regulatory region of the yeast alcohol dehydrogenase I gene. It was necessary to eliminate the entire 5' upstream region of the parasite DNA to obtain the expression of this protein. Only the circumsporozoite precursor protein was produced by the yeast transformants, as detected by immunoblotting. About 55 and 20 percent of the circumsporozoite protein produced in yeast was associated with the 25,000g and 150,000g particulate fractions, respectively. The protein could be solubilized in Triton X-100 and was stable in solubilized extracts.
Sedegah, Martha; Brice, Gary T.; Rogers, William O.; Doolan, Denise L.; Charoenvit, Yupin; Jones, Trevor R.; Majam, Victoria F.; Belmonte, Arnel; Lu, Minh; Belmonte, Maria; Carucci, Daniel J.; Hoffman, Stephen L.
2002-01-01
The persistence of immunity to malaria induced in mice by a heterologous DNA priming and poxvirus boosting regimen was characterized. Mice were immunized by priming with DNA vaccine plasmids encoding the Plasmodium yoelii circumsporozoite protein (PyCSP) and murine granulocyte-macrophage colony-stimulating factor and boosting with recombinant vaccinia encoding PyCSP. BALB/c mice immunized with either high-dose (100 μg of p PyCSP plus 30 μg of pGM-CSF) or low-dose (1 μg of p PyCSP plus 1 μg of pGM-CSF DNA) priming were protected against challenge with 50 P. yoelii sporozoites. Protection 2 weeks after immunization was 70 to 100%, persisted at this level for at least 20 weeks, and declined to 30 to 40% by 28 weeks. Eight of eight mice protected at 20 weeks were still protected when rechallenged at 40 weeks. The antigen (Ag)-specific effector CD8+-T-cell population present 2 weeks after boosting had ex vivo Ag-specific cytolytic activity, expressed both gamma interferon (IFN-γ) and tumor necrosis factor alpha, and constituted 12 to 20% of splenic CD8+ T cells. In contrast, the memory CD8+-Ag-specific-cell population at 28 weeks lacked cytolytic activity and constituted only 6% of splenic CD8+ T cells, but at the single-cell level it produced significantly higher levels of IFN-γ than the effectors. High levels of Ag- or parasite-specific antibodies present 2 weeks after boosting had declined three- to sevenfold by 28 weeks. Low-dose priming was similarly immunogenic and as protective as high-dose priming against a 50-, but not a 250-, sporozoite challenge. These results demonstrate that a heterologous priming and boosting vaccination can provide lasting protection against malaria in this model system. PMID:12065488
Cravo, Pedro; Machado, Renato B; Leite, Juliana A; Leda, Taizy; Suwanarusk, Rossarin; Bittencourt, Najara; Albrecht, Letusa; Judice, Carla; Lopes, Stefanie C P; Lacerda, Marcus V G; Ferreira, Marcelo U; Soares, Irene S; Goh, Yun Shan; Bargieri, Daniel Y; Nosten, François; Russell, Bruce; Rénia, Laurent; Costa, Fabio T M
2018-01-10
Technical limitations for culturing the human malaria parasite Plasmodium vivax have impaired the discovery of vaccine candidates, challenging the malaria eradication agenda. The immunogenicity of the M2 domain of the Merozoite Adhesive Erythrocytic Binding Protein (MAEBL) antigen cloned from the Plasmodium yoelii murine parasite, has been previously demonstrated. Detailed epitope mapping of MAEBL through immunoinformatics identified several MHCI, MHCII and B cell epitopes throughout the peptide, with several of these lying in the M2 domain and being conserved between P. vivax, P. yoelii and Plasmodium falciparum, hinting that the M2-MAEBL is pan-reactive. This hypothesis was tested through functional assays, showing that P. yoelii M2-MAEBL antisera are able to recognize and inhibit erythrocyte invasion from both P. falciparum and P. vivax parasites isolated from Thai patients, in ex vivo assays. Moreover, the sequence of the M2-MAEBL is shown to be highly conserved between P. vivax isolates from the Amazon and Thailand, indicating that the MAEBL antigen may constitute a vaccine candidate outwitting strain-specific immunity. The MAEBL antigen is promising candidate towards the development of a malaria vaccine.
2010-01-01
Background Plasmodium vivax circumsporozoite variants have been identified in several geographical areas. The real implication of the genetic variation in this region of the P. vivax genome has been questioned for a long time. Although previous studies have observed significant association between VK210 and the Duffy blood group, we present here that evidences of this variation are limited to the CSP central portion. Methods The phylogenetic analyses were accomplished starting from the amplification of conserved domains of 18 SSU RNAr and Cyt B. The antibodies responses against the CSP peptides, MSP-1, AMA-1 and DBP were detected by ELISA, in plasma samples of individuals infected with two P. vivax CS genotypes: VK210 and P. vivax-like. Results These analyses of the two markers demonstrate high similarity among the P. vivax CS genotypes and surprisingly showed diversity equal to zero between VK210 and P. vivax-like, positioning these CS genotypes in the same clade. A high frequency IgG antibody against the N- and C-terminal regions of the P. vivax CSP was found as compared to the immune response to the R- and V- repetitive regions (p = 0.0005, Fisher's Exact test). This difference was more pronounced when the P. vivax-like variant was present in the infection (p = 0.003, Fisher's Exact test). A high frequency of antibody response against MSP-1 and AMA-1 peptides was observed for all P. vivax CS genotypes in comparison to the same frequency for DBP. Conclusions This results target that the differences among the P. vivax CS variants are restrict to the central repeated region of the protein, mostly nucleotide variation with important serological consequences. PMID:20573199
2011-01-01
Background The entomological inoculation rate (EIR) is an important indicator in estimating malaria transmission and the impact of vector control. To assess the EIR, the enzyme-linked immunosorbent assay (ELISA) to detect the circumsporozoite protein (CSP) is increasingly used. However, several studies have reported false positive results in this ELISA. The false positive results could lead to an overestimation of the EIR. The aim of present study was to estimate the level of false positivity among different anopheline species in Cambodia and Vietnam and to check for the presence of other parasites that might interact with the anti-CSP monoclonal antibodies. Methods Mosquitoes collected in Cambodia and Vietnam were identified and tested for the presence of sporozoites in head and thorax by using CSP-ELISA. ELISA positive samples were confirmed by a Plasmodium specific PCR. False positive mosquitoes were checked by PCR for the presence of parasites belonging to the Haemosporidia, Trypanosomatidae, Piroplasmida, and Haemogregarines. The heat-stability and the presence of the cross-reacting antigen in the abdomen of the mosquitoes were also checked. Results Specimens (N = 16,160) of seven anopheline species were tested by CSP-ELISA for Plasmodium falciparum and Plasmodium vivax (Pv210 and Pv247). Two new vector species were identified for the region: Anopheles pampanai (P. vivax) and Anopheles barbirostris (Plasmodium malariae). In 88% (155/176) of the mosquitoes found positive with the P. falciparum CSP-ELISA, the presence of Plasmodium sporozoites could not be confirmed by PCR. This percentage was much lower (28% or 5/18) for P. vivax CSP-ELISAs. False positive CSP-ELISA results were associated with zoophilic mosquito species. None of the targeted parasites could be detected in these CSP-ELISA false positive mosquitoes. The ELISA reacting antigen of P. falciparum was heat-stable in CSP-ELISA true positive specimens, but not in the false positives. The heat
Zheng, Li; Pang, Wei; Qi, Zanmei; Luo, Enjie; Cui, Liwang; Cao, Yaming
2016-08-08
Transmission-blocking vaccine (TBV) is a promising strategy for interrupting the malaria transmission cycle. Current TBV candidates include both pre- and post-fertilization antigens expressed during sexual development of the malaria parasites. We tested whether a TBV design combining two sexual-stage antigens has better transmission-blocking activity. Using the rodent malaria model Plasmodium yoelii, we pursued a DNA vaccination strategy with genes encoding the gametocyte antigen Pys48/45 and the major ookinete surface protein Pys25. Immunization of mice with DNA constructs expression either Pys48/45 or Pys25 elicited strong antibody responses, which specifically recognized a ~45 and ~25 kDa protein from gametocyte and ookinete lysates, respectively. Immune sera from mice immunized with DNA constructs expressing Pys48/45 and Pys25 individually and in combination displayed evident transmission-blocking activity in in vitro ookinete culture and direct mosquito feeding experiments. With both assays, the Pys25 sera had higher transmission-blocking activity than the Pys48/45 sera. Intriguingly, compared with the immunization with the individual DNA vaccines, immunization with both DNA constructs produced lower antibody responses against individual antigens. The resultant immune sera from the composite vaccination had significantly lower transmission-blocking activity than those from Pys25 DNA immunization group, albeit the activity was substantially higher than that from the Pys48 DNA vaccination group. This result suggested that vaccination with the two DNA constructs did not achieve a synergistic effect, but rather caused interference in inducing antigen-specific antibody responses. This result has important implications for future design of composite vaccines targeting different sexual antigens.
Ajua, Anthony; Lell, Bertrand; Agnandji, Selidji Todagbe; Asante, Kwaku Poku; Owusu-Agyei, Seth; Mwangoka, Grace; Mpina, Maxmilliam; Salim, Nahya; Tanner, Marcel; Abdulla, Salim; Vekemans, Johan; Jongert, Erik; Lievens, Marc; Cambron, Pierre; Ockenhouse, Chris F; Kremsner, Peter G; Mordmüller, Benjamin
2015-02-13
The malaria vaccine RTS,S induces antibodies against the Plasmodium falciparum circumsporozoite protein (CSP) and the concentration of Immunoglobulin G (IgG) against the repeat region of CSP following vaccination is associated with protection from P. falciparum malaria. So far, only the quantity of anti-CSP IgG has been measured and used to predict vaccination success, although quality (measured as avidity) of the antigen-antibody interaction shall be important since only a few sporozoites circulate for a short time after an infectious mosquito bite, likely requiring fast and strong binding. Quantity and avidity of anti-CSP IgG in African infants who received RTS,S/AS01E in a 0-1-2-month or a 0-1-7-month schedule in a phase 2 clinical trial were measured by enzyme-linked immunosorbent assay. Antibody avidity was defined as the proportion of IgG able to bind in the presence of a chaotropic agent (avidity index). The effect of CSP-specific IgG concentration and avidity on protective efficacy was modelled using Cox proportional hazards. After the third dose, quantity and avidity were similar between the two vaccination schedules. IgG avidity after the last vaccine injection was not associated with protection, whereas the change in avidity following second and third RTS,S/AS01E injection was associated with a 54% risk reduction of getting malaria (hazard ratio: 0.46; 95% confidence interval (CI): 0.22-0.99) in those participants with a change in avidity above the median. The change in anti-CSP IgG concentration following second and third injection was associated with a 77% risk reduction of getting malaria (hazard ratio: 0.23, 95% CI: 0.11-0.51). Change in IgG response between vaccine doses merits further evaluation as a surrogate marker for RTS,S efficacy. ClinicalTrials.gov Identifier NCT00436007 .
Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto
2016-01-01
An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299
Miura, Toyokazu; Takeo, Satoru; Ntege, Edward H; Otsuki, Hitoshi; Sawasaki, Tatsuya; Ishino, Tomoko; Takashima, Eizo; Tsuboi, Takafumi
2018-06-02
Malaria merozoite apical organelles; microneme and rhoptry secreted proteins play functional roles during and following invasion of host erythrocytes. Among numerous proteins, the rhoptries discharge high molecular weight proteins known as RhopH complex. Recent reports suggest that the RhopH complex is essential for growth and survival of the malaria parasite within erythrocytes. However, an in-depth understanding of the host-parasite molecular interactions is indispensable. Here we utilized a comprehensive mouse erythrocyte protein library consisting of 443 proteins produced by a wheat germ cell-free system, combined with AlphaScreen technology to identify mouse erythrocyte calmyrin as an interacting molecule of the rodent malaria parasite Plasmodium yoelii RhopH complex (PyRhopH). The PyRhopH interaction was dependent on the calmyrin N-terminus and divalent cation capacity. The finding unveils a recommendable and invaluable usefulness of our comprehensive mouse erythrocyte protein library together with the AlphaScreen technology in investigating a wide-range of host-parasite molecular interactions. Copyright © 2018 Elsevier Inc. All rights reserved.
Fonseca, Jairo Andres; Cabrera-Mora, Monica; Kashentseva, Elena A; Villegas, John Paul; Fernandez, Alejandra; Van Pelt, Amelia; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto
2016-01-01
A malaria vaccine is a public health priority. In order to produce an effective vaccine, a multistage approach targeting both the blood and the liver stage infection is desirable. The vaccine candidates also need to induce balanced immune responses including antibodies, CD4+ and CD8+ T cells. Protein-based subunit vaccines like RTS,S are able to induce strong antibody response but poor cellular reactivity. Adenoviral vectors have been effective inducing protective CD8+ T cell responses in several models including malaria; nonetheless this vaccine platform exhibits a limited induction of humoral immune responses. Two approaches have been used to improve the humoral immunogenicity of recombinant adenovirus vectors, the use of heterologous prime-boost regimens with recombinant proteins or the genetic modification of the hypervariable regions (HVR) of the capsid protein hexon to express B cell epitopes of interest. In this study, we describe the development of capsid modified Ad5 vectors that express a promiscuous Plasmodium yoelii T helper epitope denominated PyT53 within the hexon HVR2 region. Several regimens were tested in mice to determine the relevance of the hexon modification in enhancing protective immune responses induced by the previously described protein-based multi-stage experimental vaccine PyCMP. A heterologous prime-boost immunization regime that combines a hexon modified vector with transgenic expression of PyCMP followed by protein immunizations resulted in the induction of robust antibody and cellular immune responses in comparison to a similar regimen that includes a vector with unmodified hexon. These differences in immunogenicity translated into a better protective efficacy against both the hepatic and red blood cell stages of P. yoelii. To our knowledge, this is the first time that a hexon modification is used to deliver a promiscuous T cell epitope. Our data support the use of such modification to enhance the immunogenicity and protective
Silveira, Henrique; Ramos, Susana; Abrantes, Patrícia; Lopes, Luís Filipe; do Rosario, Virgílio E; Abrahamsen, Mitchell S
2007-01-01
Background The anti-malarial chloroquine can modulate the outcome of infection during the Plasmodium sporogonic development, interfering with Plasmodium gene expression and subsequently, with transmission. The present study sets to identify Plasmodium genes that might be regulated by chloroquine in the mosquito vector. Methods Differential display RT-PCR (DDRT-PCR) was used to identify genes expressed during the sporogonic cycle that are regulated by exposure to chloroquine. Anopheles stephensi mosquitoes were fed on Plasmodium yoelii nigeriensis-infected mice. Three days post-infection, mosquitoes were fed a non-infectious blood meal from mice treated orally with 50 mg/kg chloroquine. Two differentially expressed Plasmodium transcripts (Pyn_chl091 and Pyn_chl055) were further characterized by DNA sequencing and real-time PCR analysis. Results Both transcripts were represented in Plasmodium EST databases, but displayed no homology with any known genes. Pyn_chl091 was upregulated by day 18 post infection when the mosquito had a second blood meal. However, when the effect of chloroquine on that transcript was investigated during the erythrocytic cycle, no significant differences were observed. Although slightly upregulated by chloroquine exposure the expression of Pyn_chl055 was more affected by development, increasing towards the end of the sporogonic cycle. Transcript abundance of Pyn_chl055 was reduced when erythrocytic stages were treated with chloroquine. Conclusion Chloroquine increased parasite load in mosquito salivary glands and interferes with the expression of at least two Plasmodium genes. The transcripts identified contain putative signal peptides and transmembrane domains suggesting that these proteins, due to their location, are targets of chloroquine (not as an antimalarial) probably through cell trafficking and recycling. PMID:17605769
Raja, Amber I.; Cai, Yeping; Reiman, Jennifer M.; Groves, Penny; Chakravarty, Sumana; McPhun, Virginia; Doolan, Denise L.; Cockburn, Ian; Hoffman, Stephen L.; Stanisic, Danielle I.
2016-01-01
The development of a vaccine is essential for the elimination of malaria. However, despite many years of effort, a successful vaccine has not been achieved. Most subunit vaccine candidates tested in clinical trials have provided limited efficacy, and thus attenuated whole-parasite vaccines are now receiving close scrutiny. Here, we test chemically attenuated Plasmodium yoelii 17X and demonstrate significant protection following homologous and heterologous blood-stage challenge. Protection against blood-stage infection persisted for at least 9 months. Activation of both CD4+ and CD8+ T cells was shown after vaccination; however, in vivo studies demonstrated a pivotal role for both CD4+ T cells and B cells since the absence of either cell type led to loss of vaccine-induced protection. In spite of significant activation of circulating CD8+ T cells, liver-stage immunity was not evident. Neither did vaccine-induced CD8+ T cells contribute to blood-stage protection; rather, these cells contributed to pathogenesis, since all vaccinated mice depleted of both CD4+ and CD8+ T cells survived a challenge infection. This study provides critical insight into whole-parasite vaccine-induced immunity and strong support for testing whole-parasite vaccines in humans. PMID:27245410
Guo, Qin; Dasgupta, Debleena; Doll, Tais A.P.F.; Burkhard, Peter; Lanar, David E.
2013-01-01
There are many ways to present antigens to the immune system. We have used a repetitive antigen display technology that relies on the self-assembly of 60 protein chains into a spherical self-assembling protein nanoparticle (SAPN) to develop a vaccine against Plasmodium falciparum malaria. The protein sequence contains selected B- and T-cell epitopes of the circumsporozoite protein of P. falciparum (PfCSP) and, when assembled into a nanoparticle induces strong, long-lived and protective immune responses against the PfCSP. Here we describe the conditions needed for promoting self-assembly of a P. falciparum vaccine nanoparticle, PfCSP-KMY-SAPN, and note pitfalls that may occur when determining conditions for other SAPN vaccines. Attention was paid to selecting processes that were amenable to scale up and cGMP manufacturing. PMID:23548672
Kariuki, Simon K; Njunge, James; Muia, Ann; Muluvi, Geofrey; Gatei, Wangeci; Ter Kuile, Feiko; Terlouw, Dianne J; Hawley, William A; Phillips-Howard, Penelope A; Nahlen, Bernard L; Lindblade, Kim A; Hamel, Mary J; Slutsker, Laurence; Shi, Ya Ping
2013-08-27
Although several studies have investigated the impact of reduced malaria transmission due to insecticide-treated bed nets (ITNs) on the patterns of morbidity and mortality, there is limited information on their effect on parasite diversity. Sequencing was used to investigate the effect of ITNs on polymorphisms in two genes encoding leading Plasmodium falciparum vaccine candidate antigens, the 19 kilodalton blood stage merozoite surface protein-1 (MSP-1(19kDa)) and the Th2R and Th3R T-cell epitopes of the pre-erythrocytic stage circumsporozoite protein (CSP) in a large community-based ITN trial site in western Kenya. The number and frequency of haplotypes as well as nucleotide and haplotype diversity were compared among parasites obtained from children <5 years old prior to the introduction of ITNs (1996) and after 5 years of high coverage ITN use (2001). A total of 12 MSP-1(19kDa) haplotypes were detected in 1996 and 2001. The Q-KSNG-L and E-KSNG-L haplotypes corresponding to the FVO and FUP strains of P. falciparum were the most prevalent (range 32-37%), with an overall haplotype diversity of > 0.7. No MSP-1(19kDa) 3D7 sequence-types were detected in 1996 and the frequency was less than 4% in 2001. The CSP Th2R and Th3R domains were highly polymorphic with a total of 26 and 14 haplotypes, respectively detected in 1996 and 34 and 13 haplotypes in 2001, with an overall haplotype diversity of > 0.9 and 0.75 respectively. The frequency of the most predominant Th2R and Th3R haplotypes was 14 and 36%, respectively. The frequency of Th2R and Th3R haplotypes corresponding to the 3D7 parasite strain was less than 4% at both time points. There was no significant difference in nucleotide and haplotype diversity in parasite isolates collected at both time points. High diversity in these two genes has been maintained overtime despite marked reductions in malaria transmission due to ITNs use. The frequency of 3D7 sequence-types was very low in this area. These findings provide
Ability of TEP1 in intestinal flora to modulate natural resistance of Anopheles dirus.
Wang, Yanyan; Wang, Ying; Zhang, Jingru; Xu, Wenyue; Zhang, Jian; Huang, Fu Sheng
2013-08-01
Blocking transmission of malaria is a reliable way to control and eliminate infection. However, in-depth knowledge of the interaction between Plasmodium and mosquito is needed. Studies suggest that innate immunity is the main mechanism inhibiting development of malaria parasites in the mosquito. Recent studies have found that use of antibiotics that inhibit the mosquito gut flora can reduce the immune response of Anopheles gambiae, thereby contributing to the development of malaria parasites. In our study, we used the non susceptible model of Anopheles dirus-Plasmodium yoelii to explore the effect of Anopheles intestinal flora on the natural resistance of A. dirus to P. yoelii. We found that in mosquitoes infected with Plasmodium, the intestinal flora can regulate expression of thioester-containing protein (TEP1) via an RNAi gene-silencing approach. Our results suggest that in the absence of TEP1, the natural microbiota cannot suppress the development of P. yoelii in A. dirus. This suggests that AdTEP1 plays an important role in the resistance of A. dirus to P. yoelii. The intestinal flora may modulate the development of P. yoelii in A. dirus by regulating TEP1 expression. Copyright © 2013 Elsevier Inc. All rights reserved.
Martin-Jaular, Lorena; Ferrer, Mireia; Calvo, Maria; Rosanas-Urgell, Anna; Kalko, Susana; Graewe, Stefanie; Soria, Guadalupe; Cortadellas, Núria; Ordi, Jaume; Planas, Anna; Burns, James; Heussler, Volker; del Portillo, Hernando A
2011-01-01
Knowledge of the dynamic features of the processes driven by malaria parasites in the spleen is lacking. To gain insight into the function and structure of the spleen in malaria, we have implemented intravital microscopy and magnetic resonance imaging of the mouse spleen in experimental infections with non-lethal (17X) and lethal (17XL) Plasmodium yoelii strains. Noticeably, there was higher parasite accumulation, reduced motility, loss of directionality, increased residence time and altered magnetic resonance only in the spleens of mice infected with 17X. Moreover, these differences were associated with the formation of a strain-specific induced spleen tissue barrier of fibroblastic origin, with red pulp macrophage-clearance evasion and with adherence of infected red blood cells to this barrier. Our data suggest that in this reticulocyte-prone non-lethal rodent malaria model, passage through the spleen is different from what is known in other Plasmodium species and open new avenues for functional/structural studies of this lymphoid organ in malaria. PMID:20923452
Terkawi, Mohamad Alaa; Nishimura, Maki; Furuoka, Hidefumi
2016-01-01
In the current study, we examined the effects of depletion of phagocytes on the progression of Plasmodium yoelii 17XNL infection in mice. Strikingly, the depletion of phagocytic cells, including macrophages, with clodronate in the acute phase of infection significantly reduced peripheral parasitemia but increased mortality. Moribund mice displayed severe pathological damage, including coagulative necrosis in liver and thrombi in the glomeruli, fibrin deposition, and tubular necrosis in kidney. The severity of infection was coincident with the increased sequestration of parasitized erythrocytes, the systematic upregulation of inflammation and coagulation, and the disruption of endothelial integrity in the liver and kidney. Aspirin was administered to the mice to minimize the risk of excessive activation of the coagulation response and fibrin deposition in the renal tissue. Interestingly, treatment with aspirin reduced the parasite burden and pathological lesions in the renal tissue and improved survival of phagocyte-depleted mice. Our data imply that the depletion of phagocytic cells, including macrophages, in the acute phase of infection increases the severity of malarial infection, typified by multiorgan failure and high mortality. PMID:26755155
Kaushansky, Alexis; Austin, Laura S.; Mikolajczak, Sebastian A.; Lo, Fang Y.; Miller, Jessica L.; Douglass, Alyse N.; Arang, Nadia; Vaughan, Ashley M.; Gardner, Malcolm J.
2014-01-01
After transmission by Anopheles mosquitoes, Plasmodium sporozoites travel to the liver, infect hepatocytes, and rapidly develop as intrahepatocytic liver stages (LS). Rodent models of malaria exhibit large differences in the magnitude of liver infection, both between parasite species and between strains of mice. This has been mainly attributed to differences in innate immune responses and parasite infectivity. Here, we report that BALB/cByJ mice are more susceptible to Plasmodium yoelii preerythrocytic infection than BALB/cJ mice. This difference occurs at the level of early hepatocyte infection, but expression levels of reported host factors that are involved in infection do not correlate with susceptibility. Interestingly, BALB/cByJ hepatocytes are more frequently polyploid; thus, their susceptibility converges on the previously observed preference of sporozoites to infect polyploid hepatocytes. Gene expression analysis demonstrates hepatocyte-specific differences in mRNA abundance for numerous genes between BALB/cByJ and BALB/cJ mice, some of which encode hepatocyte surface molecules. These data suggest that a yet-unknown receptor for sporozoite infection, present at elevated levels on BALB/cByJ hepatocytes and also polyploid hepatocytes, might facilitate Plasmodium liver infection. PMID:25312960
Durand, Pierre M; Oelofse, Andries J; Coetzer, Theresa L
2006-11-04
The completed genome sequences of the malaria parasites P. falciparum, P. y. yoelii and P. vivax have revealed some unusual features. P. falciparum contains the most AT rich genome sequenced so far--over 90% in some regions. In comparison, P. y. yoelii is approximately 77% and P. vivax is approximately 55% AT rich. The evolutionary reasons for these findings are unknown. Mobile genetic elements have a considerable impact on genome evolution but a thorough investigation of these elements in Plasmodium has not been undertaken. We therefore performed a comprehensive genome analysis of these elements and their derivatives in the three Plasmodium species. Whole genome analysis was performed using bioinformatic methods. Forty potential protein encoding sequences with features of transposable elements were identified in P. vivax, eight in P. y. yoelii and only six in P. falciparum. Further investigation of the six open reading frames in P. falciparum revealed that only one is potentially an active mobile genetic element. Most of the open reading frames identified in all three species are hypothetical proteins. Some represent annotated host proteins such as the putative telomerase reverse transcriptase genes in P. y. yoelii and P. falciparum. One of the P. vivax open reading frames identified in this study demonstrates similarity to telomerase reverse transcriptase and we conclude it to be the orthologue of this gene. There is a divergence in the frequencies of mobile genetic elements in the three Plasmodium species investigated. Despite the limitations of whole genome analytical methods, it is tempting to speculate that mobile genetic elements might have been a driving force behind the compositional bias of the P. falciparum genome.
Wu, Xianzhu; Gowda, Nagaraj M; Kawasawa, Yuka I; Gowda, D Channe
2018-04-17
Dendritic cells (DC) and cytokines produced by DC play crucial roles in inducing and regulating pro-/anti-inflammatory and Th1/Th2 responses. DC are known to produce Th1-promoting cytokine, IL-12, in response to malaria and other pathogenic infections, but it is thought that DC do not produce Th2-promoting cytokine, IL-4. Here, we show that a protein factor of malaria parasites induces IL-4 responses by CD11c hi MHCII hi CD3ε - CD49b - CD19 - FcεRI - DC via PI3K-Akt-NF-κB signaling independent of TLR-MyD88/TRIF. Malaria parasite-activated DC induced IL-4 responses by T cells both in vitro and in vivo , favoring Th2, and il-4 deficient DC were unable to induce IL-4 expression by T cell. Interestingly, lethal parasites, Plasmodium falciparum and P. berghei ANKA, induced IL-4 response primarily by CD8a - DC, whereas nonlethal P. yoelii induced IL-4 by both CD8α + and CD8α - DC. In both P. berghei ANKA- and P. yoelii -infected mice, IL-4-expressing CD8α - DC did not express IL-12, but a distinct CD8α - DC subset expressed IL-12. In P. berghei ANKA infection, CD8α + DC expressed IL-12 but not IL-4, whereas in P. yoelii infection CD8α + DC expressed IL-4 but not IL-12. This differential IL-4 and IL-12 responses by DC subsets may contribute to different Th1/Th2 development and clinical outcomes in lethal and nonlethal malaria. Our results for the first time demonstrate that a malaria protein factor induces IL-4 production by DC via PI3K-Akt-NF-κB signaling, revealing signaling and molecular mechanisms that initiate and promote Th2 development. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Kaushansky, Alexis; Austin, Laura S; Mikolajczak, Sebastian A; Lo, Fang Y; Miller, Jessica L; Douglass, Alyse N; Arang, Nadia; Vaughan, Ashley M; Gardner, Malcolm J; Kappe, Stefan H I
2015-01-01
After transmission by Anopheles mosquitoes, Plasmodium sporozoites travel to the liver, infect hepatocytes, and rapidly develop as intrahepatocytic liver stages (LS). Rodent models of malaria exhibit large differences in the magnitude of liver infection, both between parasite species and between strains of mice. This has been mainly attributed to differences in innate immune responses and parasite infectivity. Here, we report that BALB/cByJ mice are more susceptible to Plasmodium yoelii preerythrocytic infection than BALB/cJ mice. This difference occurs at the level of early hepatocyte infection, but expression levels of reported host factors that are involved in infection do not correlate with susceptibility. Interestingly, BALB/cByJ hepatocytes are more frequently polyploid; thus, their susceptibility converges on the previously observed preference of sporozoites to infect polyploid hepatocytes. Gene expression analysis demonstrates hepatocyte-specific differences in mRNA abundance for numerous genes between BALB/cByJ and BALB/cJ mice, some of which encode hepatocyte surface molecules. These data suggest that a yet-unknown receptor for sporozoite infection, present at elevated levels on BALB/cByJ hepatocytes and also polyploid hepatocytes, might facilitate Plasmodium liver infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Zhang, Yanjun; Zhu, Xiaotong; Feng, Yonghui; Pang, Wei; Qi, Zanmei; Cui, Liwang; Cao, Yaming
2016-11-01
The mechanisms regulating the induction of protective immunity against blood-stage malaria remain unclear. Resistant DBA/2 mouse develops a higher Th1 response compared with a susceptible BALB/c strain during Plasmodium yoelii (Py) infection. It is known that the T helper cell response is initiated and polarized by dendritic cells (DCs) of the innate immune system, during which TLR4 and TLR9 are important receptors for the innate recognition of the malaria parasite and its products. We hypothesized that TLR4/9 may play critical roles in the induction of protective immunity against Py infection. We used TLR4/9 antagonists and agonists to study their effects on mouse resistance to Py infection. We found that the administration of an antagonist prior to infection aggravated disease outcomes, impaired DC functions and suppressed the pro-inflammatory response to Py infection in resistant DBA/2 mice. Treatment with the TLR4 agonist lipopolysaccharide (LPS) but not TLR9 agonist significantly improved the survival rate of susceptible Py-infected BALB/c mice. LPS administration promoted the activation and expansion of DCs and drove a Th1-biased response. Our data demonstrate the important roles of TLR4/9 signals in inducing resistance to malaria parasites and provide evidence for the rational use of TLR agonists to potentiate protective immunity against Plasmodium infection. Copyright © 2016 Elsevier Inc. All rights reserved.
2013-01-01
Background The origins and dispersal of Plasmodium vivax to its current worldwide distribution remains controversial. Although progress on P. vivax genetics and genomics has been achieved worldwide, information concerning New World parasites remains fragmented and largely incomplete. More information on the genetic diversity in Latin America (LA) is needed to better explain current patterns of parasite dispersion and evolution. Methods Plasmodium vivax circumsporozoite protein gene polymorphism was investigated using polymerase chain reaction amplification and restriction fragment length polymorphism (PCR-RFLP), and Sanger sequencing in isolates from the Pacific Ocean coast of Mexico, Nicaragua, and Peru. In conjunction with worldwide sequences retrieved from the Genbank, mismatch distribution analysis of central repeat region (CRR), frequency estimation of unique repeat types and phylogenetic analysis of the 3′ terminal region, were performed to obtain an integrative view of the genetic relationships between regional and worldwide isolates. Results Four RFLP subtypes, vk210a, b, c and d were identified in Southern Mexico and three subtypes vk210a, e and f in Nicaragua. The nucleotide sequences showed that Mexican vk210a and all Nicaraguan isolates were similar to other American parasites. In contrast, vk210b, c and d were less frequent, had a domain ANKKAEDA in their carboxyl end and clustered with Asian isolates. All vk247 isolates from Mexico and Peru had identical RFLP pattern. Their nucleotide sequences showed two copies of GGQAAGGNAANKKAGDAGA at the carboxyl end. Differences in mismatch distribution parameters of the CRR separate vk247 from most vk210 isolates. While vk247 isolates display a homogeneous pattern with no geographical clustering, vk210 isolates display a heterogeneous geographically clustered pattern which clearly separates LA from non-American isolates, except vk210b, c and d from Southern Mexico. Conclusions The presence of vk210a in Mexico
Limbach, Keith; Stefaniak, Maureen; Chen, Ping; Patterson, Noelle B; Liao, Grant; Weng, Shaojie; Krepkiy, Svetlana; Ekberg, Greg; Torano, Holly; Ettyreddy, Damodar; Gowda, Kalpana; Sonawane, Sharvari; Belmonte, Arnel; Abot, Esteban; Sedegah, Martha; Hollingdale, Michael R; Moormann, Ann; Vulule, John; Villasante, Eileen; Richie, Thomas L; Brough, Douglas E; Bruder, Joseph T
2017-07-03
A DNA-human Ad5 (HuAd5) prime-boost malaria vaccine has been shown to protect volunteers against a controlled human malaria infection. The potency of this vaccine, however, appeared to be affected by the presence of pre-existing immunity against the HuAd5 vector. Since HuAd5 seroprevalence is very high in malaria-endemic areas of the world, HuAd5 may not be the most appropriate malaria vaccine vector. This report describes the evaluation of the seroprevalence, immunogenicity and efficacy of three newly identified gorilla adenoviruses, GC44, GC45 and GC46, as potential malaria vaccine vectors. The seroprevalence of GC44, GC45 and GC46 is very low, and the three vectors are not efficiently neutralized by human sera from Kenya and Ghana, two countries where malaria is endemic. In mice, a single administration of GC44, GC45 and GC46 vectors expressing a murine malaria gene, Plasmodium yoelii circumsporozoite protein (PyCSP), induced robust PyCSP-specific T cell and antibody responses that were at least as high as a comparable HuAd5-PyCSP vector. Efficacy studies in a murine malaria model indicated that a prime-boost regimen with DNA-PyCSP and GC-PyCSP vectors can protect mice against a malaria challenge. Moreover, these studies indicated that a DNA-GC46-PyCSP vaccine regimen was significantly more efficacious than a DNA-HuAd5-PyCSP regimen. These data suggest that these gorilla-based adenovectors have key performance characteristics for an effective malaria vaccine. The superior performance of GC46 over HuAd5 highlights its potential for clinical development.
2013-01-01
Background Mosquito fitness is determined largely by body size and nutritional reserves. Plasmodium infections in the mosquito and resultant transmission of malaria parasites might be compromised by the vector’s nutritional status. We studied the effects of nutritional stress and malaria parasite infections on transmission fitness of Anopheles mosquitoes. Methods Larvae of Anopheles gambiae sensu stricto and An. stephensi were reared at constant density but with nutritionally low and high diets. Fitness of adult mosquitoes resulting from each dietary class was assessed by measuring body size and lipid, protein and glycogen content. The size of the first blood meal was estimated by protein analysis. Mosquitoes of each dietary class were fed upon a Plasmodium yoelii nigeriensis-infected mouse, and parasite infections were determined 5 d after the infectious blood meal by dissection of the midguts and by counting oocysts. The impact of Plasmodium infections on gonotrophic development was established by dissection. Results Mosquitoes raised under low and high diets emerged as adults of different size classes comparable between An. gambiae and An. stephensi. In both species low-diet females contained less protein, lipid and glycogen upon emergence than high-diet mosquitoes. The quantity of larval diet impacted strongly upon adult blood feeding and reproductive success. The prevalence and intensity of P. yoelii nigeriensis infections were reduced in low-diet mosquitoes of both species, but P. yoelii nigeriensis impacted negatively only on low-diet, small-sized An. gambiae considering survival and egg maturation. There was no measurable fitness effect of P. yoelii nigeriensis on An. stephensi. Conclusions Under the experimental conditions, small-sized An. gambiae expressed high mortality, possibly caused by Plasmodium infections, the species showing distinct physiological concessions when nutrionally challenged in contrast to well-fed, larger siblings. Conversely, An
Secreted HSP Vaccine for Malaria Prophylaxis
2014-10-01
AWARD NUMBER: W81XWH-13-2-0098 TITLE: Secreted HSP Vaccine for Malaria Prophylaxis PRINCIPAL INVESTIGATOR: Dr. Eckhard R. Podack...model. 15. SUBJECT TERMS Malaria , Plasmodium Falciparum, circumsporozoite protein, apical membrane antigen-1, vaccine , heat shock proteins, gp96...approach to stimulate cytotoxic T cells against malaria antigens and investigate the optimal vaccination route to target these T cells to the liver. To
Wanji, Samuel; Kengne-Ouafo, Arnaud J; Eyong, Ebanga E Joan; Kimbi, Helen K; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L; Nana-Djeunga, Hugues C; Bourguinat, Catherine; Sofeu-Feugaing, David D; Charvet, Claude L
2012-05-01
The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein-enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction-based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms.
Miyata, Takeshi; Harakuni, Tetsuya; Tsuboi, Takafumi; Sattabongkot, Jetsumon; Ikehara, Ayumu; Tachibana, Mayumi; Torii, Motomi; Matsuzaki, Goro; Arakawa, Takeshi
2011-01-01
The creation of subunit vaccines to prevent malaria infection has been hampered by the intrinsically weak immunogenicity of the recombinant antigens. We have developed a novel strategy to increase immune responses by creating genetic fusion proteins to target specific antigen-presenting cells (APCs). The fusion complex was composed of three physically linked molecular entities: (i) a vaccine antigen, (ii) a multimeric α-helical coiled-coil core, and (iii) an APC-targeting ligand linked to the core via a flexible linker. The vaccine efficacy of the tricomponent complex was evaluated using an ookinete surface protein of Plasmodium vivax, Pvs25, and merozoite surface protein-1 of Plasmodium yoelii. Immunization of mice with the tricomponent complex induced a robust antibody response and conferred substantial levels of P. vivax transmission blockade as evaluated by a membrane feed assay, as well as protection from lethal P. yoelii infection. The observed effect was strongly dependent on the presence of all three components physically integrated as a fusion complex. This system, designated the tricomponent immunopotentiating system (TIPS), onto which any recombinant protein antigens or nonproteinaceous substances could be loaded, may be a promising strategy for devising subunit vaccines or adjuvants against various infectious diseases, including malaria. PMID:21807905
Fooksman, David; Moore, Jamie M.; Saidi, Alex; Feintuch, Catherine M.; Reizis, Boris; Chorro, Laurent; Daily, Johanna; Lauvau, Grégoire
2016-01-01
Malaria remains a global health burden causing significant morbidity, yet the mechanisms underlying disease outcomes and protection are poorly understood. Herein, we analyzed the peripheral blood of a unique cohort of Malawian children with severe malaria, and performed a comprehensive overview of blood leukocytes and inflammatory mediators present in these patients. We reveal robust immune cell activation, notably of CD14+ inflammatory monocytes, NK cells and plasmacytoid dendritic cells (pDCs) that is associated with very high inflammation. Using the Plasmodium yoelii 17X YM surrogate mouse model of lethal malaria, we report a comparable pattern of immune cell activation and inflammation and found that type I IFN represents a key checkpoint for disease outcomes. Compared to wild type mice, mice lacking the type I interferon (IFN) receptor exhibited a significant decrease in immune cell activation and inflammatory response, ultimately surviving the infection. We demonstrate that pDCs were the major producers of systemic type I IFN in the bone marrow and the blood of infected mice, via TLR7/MyD88-mediated recognition of Plasmodium parasites. This robust type I IFN production required priming of pDCs by CD169+ macrophages undergoing activation upon STING-mediated sensing of parasites in the bone marrow. pDCs and macrophages displayed prolonged interactions in this compartment in infected mice as visualized by intravital microscopy. Altogether our findings describe a novel mechanism of pDC activation in vivo and precise stepwise cell/cell interactions taking place during severe malaria that contribute to immune cell activation and inflammation, and subsequent disease outcomes. PMID:27792766
Creech, C Buddy; Dekker, Cornelia L; Ho, Dora; Phillips, Shanda; Mackey, Sally; Murray-Krezan, Cristina; Grazia Pau, Maria; Hendriks, Jenny; Brown, Valerie; Dally, Leonard G; Versteege, Isabella; Edwards, Kathryn M
2013-12-01
Malaria results in over 650,000 deaths each year; thus, there is an urgent need for an effective vaccine. Pre-clinical studies and recently reported human trials suggest that pre-erythrocytic stage vaccines can provide protection against infection. A Phase 1, randomized, placebo-controlled, dose-escalation study was conducted with a vaccine composed of a replication-deficient adenovirus-35 backbone with P. falciparum circumsporozoite (CS) surface antigen (Ad35.CS.01). Healthy adult subjects received three doses of 10 (8), 10 (9), 10 (10), or 10 (11) vp/mL Ad35.CS.01 vaccine or saline placebo intramuscularly at 0, 1, and 6-mo intervals. Adverse events were assessed and anti-CS antibody responses were determined by ELISA. Seventy-two individuals were enrolled, with age, gender, and ethnicity similar across each study arm. While the vaccine was generally well tolerated, adverse events were more frequent in the highest dose groups (10 (10) and 10 (11) vp/mL). More robust humoral responses were also noted at the highest doses, with 73% developing a positive ELISA response after the three dose series of 10 (11) vp/mL. The Ad35.CS.01 vaccine was most immunogenic at the highest dosages (10 (10) and 10 (11) vp/mL). Reactogenicity findings were more common after the 10 (11) vp/mL dose, although most were mild or moderate in nature and resolved without therapy.
Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris
2016-01-01
INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667
Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris
2016-12-01
Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association
Entomologic Inoculation Rates of Anopheles arabiensis in Southwestern Ethiopia
Massebo, Fekadu; Balkew, Meshesha; Gebre-Michael, Teshome; Lindtjørn, Bernt
2013-01-01
We collected anophelines every second week for one year from randomly selected houses in southwestern Ethiopia by using Centers for Disease Control (CDC) light traps, pyrethrum spray catches, and artificial pit shelter constructions to detect circumsporozoite proteins and estimate entomologic inoculation rates (EIRs). Of 3,678 Anopheles arabiensis tested for circumsporozoite proteins, 11 were positive for Plasmodium falciparum and three for P. vivax. The estimated annual P. falciparum EIR of An. arabiensis was 17.1 infectious bites per person per year (95% confidence interval = 7.03–34.6) based on CDC light traps and 0.1 infectious bites per person per year based on pyrethrum spray catches. The P. falciparum EIRs from CDC light traps varied from 0 infectious bites per person per year (in 60% of houses) to 73.2 infectious bites per person per year in the house nearest the breeding sites. Risk of exposure to infectious bites was higher in wet months than dry months, with a peak in April (9.6 infectious bites per person per month), the period of highest mosquito density. PMID:23878184
Entomologic inoculation rates of Anopheles arabiensis in southwestern Ethiopia.
Massebo, Fekadu; Balkew, Meshesha; Gebre-Michael, Teshome; Lindtjørn, Bernt
2013-09-01
We collected anophelines every second week for one year from randomly selected houses in southwestern Ethiopia by using Centers for Disease Control (CDC) light traps, pyrethrum spray catches, and artificial pit shelter constructions to detect circumsporozoite proteins and estimate entomologic inoculation rates (EIRs). Of 3,678 Anopheles arabiensis tested for circumsporozoite proteins, 11 were positive for Plasmodium falciparum and three for P. vivax. The estimated annual P. falciparum EIR of An. arabiensis was 17.1 infectious bites per person per year (95% confidence interval = 7.03-34.6) based on CDC light traps and 0.1 infectious bites per person per year based on pyrethrum spray catches. The P. falciparum EIRs from CDC light traps varied from 0 infectious bites per person per year (in 60% of houses) to 73.2 infectious bites per person per year in the house nearest the breeding sites. Risk of exposure to infectious bites was higher in wet months than dry months, with a peak in April (9.6 infectious bites per person per month), the period of highest mosquito density.
Gonzalez-Ceron, L; Rodriguez, M H; Santillan, F; Chavez, B; Nettel, J A; Hernandez-Avila, J E; Kain, K C
2001-07-01
Anopheles albimanus and An. pseudopunctipennis differ in their susceptibilities to Plasmodium vivax circumsporozoite phenotypes. An. pseudopunctipennis is susceptible to phenotype VK247 but almost refractory to VK210. In contrast, An. albimanus is almost refractory to VK247 but susceptible to VK210. To investigate the site in the mosquito and the parasite stage at which resistance mechanisms affect VK247 development in An. albimanus, parasite development was followed in a series of experiments in which both mosquitoes species were simultaneously infected with blood from patients. Parasite phenotype was determined in mature oocysts and salivary gland sporozoites by use of immunofluorescence and Western blot assays and/or gene identification. Ookinete maturation and their densities within the bloodmeal bolus were similar in both mosquito species. Ookinete densities on the internal midgut surface of An. albimanus were 4.7 times higher than those in An. pseudopunctipennis; however, the densities of developing oocysts on the external midgut surface were 6.12 times higher in the latter species. Electron microscopy observation of ookinetes in An. albimanus midgut epithelium indicated severe parasite damage. These results indicate that P. vivax VK247 parasites are destroyed at different parasite stages during migration in An. albimanus midguts. A portion, accumulated on the internal midgut surface, is probably destroyed by the mosquito's digestive enzymes and another portion is most likely destroyed by mosquito defense molecules within the midgut epithelium. A third group, reaching the external midgut surface, initiates oocyst development, but over 90% of them interrupt their development and die. The identification of mechanisms that participate in parasite destruction could provide new elements to construct transgenic mosquitoes resistant to malaria parasites. Copyright 2001 Academic Press.
Zhu, Xiaotong; Pan, Yanyan; Zheng, Li; Cui, Liwang; Cao, Yaming
2012-02-20
Clinical immunity to malaria in human populations is developed after repeated exposure to malaria. Regulation and balance of host immune responses may lead to optimal immunity against malaria parasite infection. Polysaccharides (ABPS) derived from the Chinese herb ox knee Achyranthes bidentata possess immuno-modulatory functions. The aim of this study is to use the rodent malaria model Plasmodium yoelii 17XL (P. y17XL) to examine whether pretreatment with ABPS will modulate host immunity against malaria infection and improve the outcome of the disease. To determine whether ABPS could modulate immunity against malaria, mice were pretreated with ABPS prior to blood-stage infection by P. y17XL. Host survival and parasitaemia were monitored daily. The effect of pretreatment on host immune responses was studied through the quantitation of cytokines, dendritic cell populations, and natural regulatory T cells (Treg). Pretreatment with ABPS prior to infection significantly extended the survival time of mice after P. y17XL infection. At three and five days post-infection, ABPS pretreated mice developed stronger Th1 immune responses against malaria infection with the number of F4/80+CD36+ macrophages and levels of IFN-γ, TNF-α and nitric oxide being significantly higher than in the control group. More importantly, ABPS-treated mice developed more myeloid (CD11c+CD11b+) and plasmacytoid dendritic cells (CD11c+CD45R+/B220+) than control mice. ABPS pretreatment also resulted in modulated expression of MHC-II, CD86, and especially Toll-like receptor 9 by CD11c+ dendritic cells. In comparison, pretreatment with ABPS did not alter the number of natural Treg or the production of the anti-inflammatory cytokine IL-10. Pretreatment with the immuno-modulatory ABPS selectively enhanced Th1 immune responses to control the proliferation of malaria parasites, and prolonged the survival of mice during subsequent malaria infection.
Wanji, Samuel; Kengne-Ouafo, Arnaud J.; Joan Eyong, Ebanga E.; Kimbi, Helen K.; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L.; Nana-Djeunga, Hugues C.; Bourguinat, Catherine; Sofeu-Feugaing, David D.; Charvet, Claude L.
2012-01-01
The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein–enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction–based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms. PMID:22556072
Gonzalez-Ceron, L; Rodriguez, M H; Nettel, J C; Villarreal, C; Kain, K C; Hernandez, J E
1999-01-01
The susceptibilities to coindigenous Plasmodium vivax of colonized Anopheles albimanus and Anopheles pseudopunctipennis from southern Mexico were investigated by simultaneous feeding with infected blood obtained from patients. The genes encoding circumsporozoite protein variant types (VK210 and VK247) in blood samples were determined by PCR and oligonucleotide probe hybridization. A. albimanus was more susceptible to VK210, and A. pseudopunctipennis was more susceptible to VK247.
Gonzalez-Ceron, Lilia; Rodriguez, Mario H.; Nettel, Jose C.; Villarreal, Cuauhtemoc; Kain, Kevin C.; Hernandez, Juan E.
1999-01-01
The susceptibilities to coindigenous Plasmodium vivax of colonized Anopheles albimanus and Anopheles pseudopunctipennis from southern Mexico were investigated by simultaneous feeding with infected blood obtained from patients. The genes encoding circumsporozoite protein variant types (VK210 and VK247) in blood samples were determined by PCR and oligonucleotide probe hybridization. A. albimanus was more susceptible to VK210, and A. pseudopunctipennis was more susceptible to VK247. PMID:9864243
Nyagwange, James; Nene, Vishvanath; Mwalimu, Stephen; Henson, Sonal; Steinaa, Lucilla; Nzau, Benjamin; Tijhaar, Edwin; Pelle, Roger
2018-05-01
East Coast fever (ECF) caused by Theileria parva kills cattle in East, Central and Southern Africa leading to significant economic losses. Vaccination is used as a control strategy against ECF and is presently dependent on deliberate infection with live sporozoites and simultaneous treatment with a long-acting oxytetracycline. Although effective, this method has serious limitations; the immunity is parasite strain specific and immunized cattle can become life-long asymptomatic carriers of the parasite, posing risk for the spread of the disease. In efforts to develop a subunit vaccine, the role of antibodies in the neutralization of T. parva sporozoites infection of host cells has been investigated and a circumsporozoite protein, p67, is able to induce such neutralizing antibodies. However, the p67 protein only protects a proportion of immunized cattle against T. parva challenge and such protection might be improved by inclusion of additional parasite antigens that neutralize sporozoite infection. In an attempt to identify such antigens, we searched the re-annotated T. parva genome for genes predicted to contain GPI anchor signals, since they are likely to be located on the cell surface, and expressed fragments of six of the selected genes in E. coli. The recombinant proteins were used to raise antisera in mice. Antisera to two proteins, TpMuguga_01g00876 and TpMuguga_01g00939, neutralized sporozoite infectivity to a high degree, while antisera to two additional proteins, TpMuguga_01g00095 and TpMuguga_04g00437, exhibited moderate neutralizing capacity. We conclude that these four antigens are potential vaccine candidates, which should be evaluated further in cattle. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Medical Surveillance Monthly Report (MSMR). Volume 21, Number 01, January 2014
2014-01-01
31. Foley DH, Klein TA, Lee IY, et al. Mosquito species composition and Plasmodium vivax infection rates from Baengnyeong-do (Island), Republic of...and the circumsporozoite proteins in the saliva of Anopheles stephensi mosquitoes. Parasitol Res. 1992; 78:563-569. 33. Lee WJ, Klein TA, Kim HC, et...distribution of dengue includes Latin America, the Carib- bean , Africa, Asia, and the Pacifi c Islands. Dengue rarely occurs in the continental U.S., but
Chenet, Stella M; Pacheco, M Andreína; Bacon, David J; Collins, William E; Barnwell, John W; Escalante, Ananias A
2013-12-01
The merozoite surface protein-9 (MSP-9) has been considered a target for an anti-malarial vaccine since it is one of many proteins involved in the erythrocyte invasion, a critical step in the parasite life cycle. Orthologs encoding this antigen have been found in all known species of Plasmodium parasitic to primates. In order to characterize and investigate the extent and maintenance of MSP-9 genetic diversity, we analyzed DNA sequences of the following malaria parasite species: Plasmodium falciparum, Plasmodium reichenowi, Plasmodium chabaudi, Plasmodium yoelii, Plasmodium berghei, Plasmodium coatneyi, Plasmodium gonderi, Plasmodium knowlesi, Plasmodium inui, Plasmodium simiovale, Plasmodium fieldi, Plasmodium cynomolgi and Plasmodium vivax and evaluated the signature of natural selection in all MSP-9 orthologs. Our findings suggest that the gene encoding MSP-9 is under purifying selection in P. vivax and closely related species. We further explored how selection affected different regions of MSP-9 by comparing the polymorphisms in P. vivax and P. falciparum, and found contrasting patterns between these two species that suggest differences in functional constraints. This observation implies that the MSP-9 orthologs in human parasites may interact differently with the host immune response. Thus, studies carried out in one species cannot be directly translated into the other. Copyright © 2013 Elsevier B.V. All rights reserved.
1987-01-01
STRUCTURE OF THE GENE ENCODING THE CIRCUMSPOROZOITE PROTEIN OF PLASWODIUm YOELIJ. A RODENT MCDFL FOP EIAMINING ANTIMALARIAL SPOBOZOITE VACCINES. JOURNAL OF...BICLOGICAL CHEMISTRY 1987 MAR 5;262(7):2937-40 INFECTIOUS DISEASES 3M162770A870.AF.312-1 (DA301614) REPORT NO.E ANTIGENS, SURFACE PLAS!CDIU? AD A188...SURFACE CLONING, MOLECULAR PLASMCDIUM dERGHEI AD A185 330 NI!PI 87-C036 ROTd ?L CHUANG DM MULTIPLE EECHANIS!15 CF SEROTONERGIC SIGNAL TRANSDUCTION. LIFE
Ghosh, Moumita; Solanki, Ashish K; Roy, Koushik; Dhoke, Reema R; Ashish; Roy, Syamal
2013-09-23
We investigated how the processing of a given antigen by antigen presenting cells (APC) is dictated by the conformation of the antigen and how this governs the immunodominance hierarchy. To address the question, a known immunodominant sequence of bacteriophage lambda repressor N-terminal sequence 12-26 [λR(12-26)] was engineered at the N and C termini of a heterologous leishmanial protein, Kinetoplastid membrane protein-11 (KMP-11); the resulting proteins were defined as N-KMP-11 and C-KMP-11 respectively. The presence of λR(12-26) in N-KMP-11 and C-KMP-11 was established by western blot analysis with antibody to λR(12-26) peptide. N-KMP-11 but not C-KMP-11 could stimulate the anti λR(12-26) T-cell clonal population very efficiently in the presence of APCs. Priming of BALB/c mice with N-KMP-11 or C-KMP-11 generated similar levels of anti-KMP-11 IgG, but anti-λR(12-26) specific IgG was observed only upon priming with N-KMP-11. Interestingly, uptake of both N-KMP-11 and C-KMP-11 by APCs was similar but catabolism of N-KMP-11 but not C-KMP-11 was biphasic and fast at the initial time point. Kratky plots of small angle X-ray scattering showed that while N-KMP-11 adopts flexible Gaussian type of topology, C-KMP-11 prefers Globular nature. To show that KMP-11 is not unique as a carrier protein, an epitope (SPITBTNLBTMBK) of Plasmodium yoelii (PY) apical membrane protein 1[AMA-1 (136-148)], is placed at the C and N terminals of a dominant T-cell epitope of ovalbumin protein OVA(323-339) and the resulting peptides are defined as PY-OVA and OVA-PY respectively. Interestingly, only OVA-PY could stimulate anti-OVA T-cells and produce IgG response upon priming of BALB/c mice with it. Thus for rational design of peptide vaccine it is important to place the dominant epitope appropriately in the context of the carrier protein. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kaba, Stephen A; Karch, Christopher P; Seth, Labdhi; Ferlez, Karen M B; Storme, Casey K; Pesavento, Danielle M; Laughlin, Paige Y; Bergmann-Leitner, Elke S; Burkhard, Peter; Lanar, David E
2018-02-01
To eliminate the problems associated with the use of extraneous adjuvants we have designed a Self-Assembling Protein Nanoparticle (SAPN) containing epitopes from the Plasmodium falciparum circumsporozoite protein (PfCSP) (designated FMP014) and portions of the TLR5 agonist flagellin (designated FMP014 D0D1 ) as an intrinsic adjuvant. By combining different molar ratios of FMP014 to FMP014 D0D1 monomers before self-assembly, we generated multiple nanoparticles and investigated their biophysical characteristics, immunogenicity and protective efficacy. Immunization with the construct formulated with the ratio 58:2 of FMP014 to FMP014 D0D1 had the highest protective efficacy against a challenge with a transgenic P. berghei sporozoite expressing PfCSP. Increasing the proportion of flagellin per particle resulted in an inverse relationship with levels of both antibody titers and protection. The cytokine profiles of the various immunization groups were evaluated and quantitative amounts of the cytokines IL-2, IFN-γ, IL-12/p70 (Th1); IL4, IL5 (Th2); TNF-α, IL1β, IL-6, KC/GRO (pro-inflammatory), and IL-10 (immunomodulatory) were measured. The relationship of the cytokines to each other revealed a strong immunomodulatory effect depending on the proportion of flagellin in the construct. Our results demonstrate that SAPNs with flagellin may be a promising strategy for the development and delivery of a safe vaccine for infectious diseases. Published by Elsevier Ltd.
Srivastava, Kumkum; Agarwal, Pooja; Soni, Awakash; Puri, S K
2017-07-01
Present efforts have been made to establish a correlation between in vitro and in vivo antimalarial activity using MIC, IC 50 and IC 90 values against CQ-sensitive (3D7) and CQ-resistant (K1) strains of Plasmodium falciparum and in vivo activity against Plasmodium yoelii. The method of discriminant function analysis (DFA) was applied to analyze the data. It was observed that in vitro IC 90 values against both 3D7 and K1 strains (p < 0.001) have strong correlation with in vivo curative activity. The respective IC 50 and IC 90 values of compounds, which cured mice (i.e., animals did not show recrudescence of parasitemia even after 60 days posttreatment), ranged between 3 and 14 nM and 14 and 186 nM against 3D7 and between 9 and 65 nM and 24 and 359 nM against the K1 strain of P. falciparum. Whereas the IC 50 and IC 90 values of compounds which exhibited in vivo suppressive activity in mice ranged between 10 and 307 nm and 61 and >965 nM, respectively, against 3D7 and 75 and >806 nm and 241 and >1232 nM against the K1 strain of P. falciparum. The findings suggest that IC 90 values against both 3D7 and K1 strains (p < 0.02) are the main contributors for the prediction of in vivo curative activity of a new molecule. Apart from this, a reasonable correlation between MIC and IC 50 values of compounds has also been established.
Das, Sudipta; Basu, Himanish; Korde, Reshma; Tewari, Rita; Sharma, Shobhona
2012-01-01
Malaria parasites reside inside erythrocytes and the disease manifestations are linked to the growth inside infected erythrocytes (IE). The growth of the parasite is mostly confined to the trophozoite stage during which nuclear division occurs followed by the formation of cell bodies (schizogony). The mechanism and regulation of schizogony are poorly understood. Here we show a novel role for a Plasmodium falciparum 60S stalk ribosomal acidic protein P2 (PfP2) (PFC0400w), which gets exported to the IE surface for 6–8 hrs during early schizogony, starting around 26–28 hrs post-merozoite invasion. The surface exposure is demonstrated using multiple PfP2-specific monoclonal antibodies, and is confirmed through transfection using PfP2-GFP. The IE surface-exposed PfP2-protein occurs mainly as SDS-resistant P2-homo-tetramers. Treatment with anti-PfP2 monoclonals causes arrest of IEs at the first nuclear division. Upon removal of the antibodies, about 80–85% of synchronized parasites can be released even after 24 hrs of antibody treatment. It has been reported that a tubovesicular network (TVN) is set up in early trophozoites which is used for nutrient import. Anti-P2 monoclonal antibodies cause a complete fragmentation of TVN by 36 hrs, and impairs lipid import in IEs. These may be downstream causes for the cell-cycle arrest. Upon antibody removal, the TVN is reconstituted, and the cell division progresses. Each of the above properties is observed in the rodent malaria parasite species P. yoelii and P. berghei. The translocation of the P2 protein to the IE surface is therefore likely to be of fundamental importance in Plasmodium cell division. PMID:22912579
Systems analysis of protective immune responses to RTS,S malaria vaccination in humans
Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali
2017-01-01
RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898
Shabani, Samaneh H; Zakeri, Sedigheh; Salmanian, Ali H; Amani, Jafar; Mehrizi, Akram A; Snounou, Georges; Nosten, François; Andolina, Chiara; Mourtazavi, Yousef; Djadid, Navid D
2017-10-01
The circumsporozoite protein (CSP) of the malaria parasite Plasmodium vivax is a major pre-erythrocyte vaccine candidate. The protein has a central repeat region that belongs to one of repeat families (VK210, VK247, and the P. vivax-like). In the present study, computer modelling was employed to select chimeric proteins, comprising the conserved regions and different arrangements of the repeat elements (VK210 and VK247), whose structure is similar to that of the native counterparts. DNA encoding the selected chimeras (named CS127 and CS712) were synthetically constructed based on E. coli codons, then cloned and expressed. Mouse monoclonal antibodies (mAbs; anti-Pv-210-CDC and -Pv-247-CDC), recognized the chimeric antigens in ELISA, indicating correct conformation and accessibility of the B-cell epitopes. ELISA using IgG from plasma samples collected from 221 Iranian patients with acute P. vivax showed that only 49.32% of the samples reacted to both CS127 and CS712 proteins. The dominant subclass for the two chimeras was IgG1 (48% of the positive responders, OD 492 =0.777±0.420 for CS127; 48.41% of the positive responders, OD 492 =0.862±0.423 for CS712, with no statistically significant difference P>0.05; Wilcoxon signed ranks test). Binding assays showed that both chimeric proteins bound to immobilized heparan sulphate and HepG2 hepatocyte cells in a concentration-dependent manner, saturable at 80μg/mL. Additionally, anti-CS127 and -CS712 antibodies raised in mice recognized the native protein on the surface of P. vivax sporozoite with high intensity, confirming the presence of common epitopes between the recombinant forms and the native proteins. In summary, despite structural differences at the molecular level, the expression levels of both chimeras were satisfactory, and their conformational structure retained biological function, thus supporting their potential for use in the development of vivax-based vaccine. Copyright © 2017 Elsevier Ltd. All rights
Surface expression of an immunodominant malaria protein B cell epitope by yellow fever virus.
Bonaldo, Myrna C; Garratt, Richard C; Caufour, Philippe S; Freire, Marcos S; Rodrigues, Mauricio M; Nussenzweig, Ruth S; Galler, Ricardo
2002-01-25
The yellow fever 17D virus (YF17D) has several characteristics that are desirable for the development of new, live attenuated vaccines. We approached its development as a vector for heterologous antigens by studying the expression of a humoral epitope at the surface of the E protein based on the results of modelling its three-dimensional structure. This model indicated that the most promising insertion site is between beta-strands f and g, a site that is exposed at the external surface of the virus. The large deletion of six residues from the fg loop of the E protein from yellow fever virus, compared to tick-born encephalitis virus, leaves space at the dimer interface for a large insertion without creating steric hindrance. We have tested this hypothesis by inserting a model humoral epitope from the circumsporozoite protein of Plasmodium falciparum consisting of triple NANP repeats. Recombinant virus (17D/8) expressing this insertion flanked by two glycine residues at each end, is specifically neutralized by a monoclonal antibody to the model epitope. Furthermore, mouse antibodies raised to the recombinant virus recognize the parasite protein in an ELISA assay. Serial passage analysis confirmed the genetic stability of the insertion made in the viral genome and the resulting 17D/8 virus is significantly more attenuated in mouse neurovirulence tests than the 17DD vaccine. The fg loop belongs to the dimerization domain of the E protein and lies at the interface between monomers. This domain undergoes a low pH transition, which is related to the fusion of the viral envelope to the endosome membrane. It is conceivable that a slower rate of fusion, resulting from the insertion close to the dimer interface, may delay the onset of virus production and thereby lead to a milder infection of the host. This would account for the more attenuated phenotype of the recombinant virus in the mouse model and lower extent of replication in cultured cells. The vectorial capacity of
Plasmodium knowlesi Sporozoite Antigen: Expression by Infectious Recombinant Vaccinia Virus
NASA Astrophysics Data System (ADS)
Smith, Geoffrey L.; Godson, G. Nigel; Nussenzweig, Victor; Nussenzweig, Ruth S.; Barnwell, John; Moss, Bernard
1984-04-01
The gene coding for the circumsporozoite antigen of the malaria parasite Plasmodium knowlesi was inserted into the vaccinia virus genome under the control of a defined vaccinia virus promoter. Cells infected with the recombinant virus synthesized polypeptides of 53,000 to 56,000 daltons that reacted with monoclonal antibody against the repeating epitope of the malaria protein. Furthermore, rabbits vaccinated with the recombinant virus produced antibodies that bound specifically to sporozoites. These data provide evidence for expression of a cloned malaria gene in mammalian cells and illustrate the potential of vaccinia virus recombinants as live malaria vaccines.
Herrera, Sócrates; Fernández, Olga Lucía; Vera, Omaira; Cárdenas, William; Ramírez, Oscar; Palacios, Ricardo; Chen-Mok, Mario; Corradin, Giampietro; Arévalo-Herrera, Myriam
2011-01-01
We assessed the safety, tolerability, and immunogenicity of a mixture of three synthetic peptides derived from the Plasmodium vivax circumsporozoite protein formulated in Montanide ISA 720 or Montanide ISA 51. Forty healthy malaria-naive volunteers were allocated to five experimental groups (A–E): four groups (A–D) were immunized intramuscularly with 50 and 100 μg/dose injections of a mixture of N, R, and C peptides formulated in the two different adjuvants at 0, 2, and 4 months and one group was administered placebo. Vaccines were immunogenic, safe, well tolerated, and no serious adverse events related to the vaccine occurred. Seroconversion occurred in > 90% of the vaccines and antibodies recognized the sporozoite protein on immunofluorescent antibody test. Vaccines in Montanide ISA 51 showed a higher sporozoite protein recognition and interferon production. Results encourage further testing of the vaccine protective efficacy. PMID:21292873
Roberts, D W; Rank, R G; Weidanz, W P; Finerty, J F
1977-01-01
Nude mice died when infected with the normally avirulent malarial parasite Plasmodium berghei yoelii. Furthermore, malaria recrudesced in Nu/Nu mice after the termination of acute disease by treatment with clindamycin. Recrudescence was not observed in Nu/Nu mice that had been grafted with thymic tissue or treated with hyperimmune serum. Mice mad B cell deficient by treatment with anti-mu-chain serum also died when infected with P. berghei yoelii. The data suggest that a crucial role of the thymus in preventing recrudescent malaria in this model system is to provide a helper function in the production of protective antibody. PMID:330396
Rapid identification of genes controlling virulence and immunity in malaria parasites
Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab
2017-01-01
Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525
Liu, Xuewu; Wang, Yuanyuan; Liang, Jiao; Wang, Luojun; Qin, Na; Zhao, Ya; Zhao, Gang
2018-05-02
Plasmodium falciparum is the most virulent malaria parasite capable of parasitizing human erythrocytes. The identification of genes related to this capability can enhance our understanding of the molecular mechanisms underlying human malaria and lead to the development of new therapeutic strategies for malaria control. With the availability of several malaria parasite genome sequences, performing computational analysis is now a practical strategy to identify genes contributing to this disease. Here, we developed and used a virtual genome method to assign 33,314 genes from three human malaria parasites, namely, P. falciparum, P. knowlesi and P. vivax, and three rodent malaria parasites, namely, P. berghei, P. chabaudi and P. yoelii, to 4605 clusters. Each cluster consisted of genes whose protein sequences were significantly similar and was considered as a virtual gene. Comparing the enriched values of all clusters in human malaria parasites with those in rodent malaria parasites revealed 115 P. falciparum genes putatively responsible for parasitizing human erythrocytes. These genes are mainly located in the chromosome internal regions and participate in many biological processes, including membrane protein trafficking and thiamine biosynthesis. Meanwhile, 289 P. berghei genes were included in the rodent parasite-enriched clusters. Most are located in subtelomeric regions and encode erythrocyte surface proteins. Comparing cluster values in P. falciparum with those in P. vivax and P. knowlesi revealed 493 candidate genes linked to virulence. Some of them encode proteins present on the erythrocyte surface and participate in cytoadhesion, virulence factor trafficking, or erythrocyte invasion, but many genes with unknown function were also identified. Cerebral malaria is characterized by accumulation of infected erythrocytes at trophozoite stage in brain microvascular. To discover cerebral malaria-related genes, fast Fourier transformation (FFT) was introduced to extract
Conteh, Solomon; Anderson, Charles; Lambert, Lynn; Orr-Gonzalez, Sachy; Herrod, Jessica; Robbins, Yvette L; Carter, Dariyen; Karhemere, Stomy Bin Shamamba; Pyana, Pati; Büscher, Philippe; Duffy, Patrick E
2017-04-01
AbstractInbred mice are commonly used to test candidate malaria vaccines, but have been unreliable for predicting efficacy in humans. To establish a more rigorous animal model, we acquired African woodland thicket rats of the genus Grammomys , the natural hosts for Plasmodium berghei . Thicket rats were acquired and identified as Grammomys surdaster by skull and teeth measurements and mitochondrial DNA genotyping. Herein, we demonstrate that thicket rats are highly susceptible to infection by P. berghei , and moderately susceptible to Plasmodium yoelii and Plasmodium chabaudi : 1-2 infected mosquito bites or 25-100 sporozoites administered by intravenous injection consistently resulted in patent parasitemia with P. berghei , and resulted in patent parasitemia with P. yoelii and P. chabaudi strains for at least 50% of animals. We then assessed efficacy of whole-organism vaccines to induce sterile immunity, and compared the thicket rat model to conventional mouse models. Using P. berghei ANKA radiation-attenuated sporozoites, and P. berghei ANKA and P. yoelii chemoprophylaxis vaccination approaches, we found that standard doses of vaccine sufficient to protect laboratory mice for a long duration against malaria challenge, are insufficient to protect thicket rats, which require higher doses of vaccine to achieve even short-term sterile immunity. Thicket rats may offer a more stringent and pertinent model for evaluating whole-organism vaccines.
Mooney, Jason P; Lokken, Kristen L; Byndloss, Mariana X; George, Michael D; Velazquez, Eric M; Faber, Franziska; Butler, Brian P; Walker, Gregory T; Ali, Mohamed M; Potts, Rashaun; Tiffany, Caitlin; Ahmer, Brian M M; Luckhart, Shirley; Tsolis, Renée M
2015-10-05
Childhood malaria is a risk factor for disseminated infections with non-typhoidal Salmonella (NTS) in sub-Saharan Africa. While hemolytic anemia and an altered cytokine environment have been implicated in increased susceptibility to NTS, it is not known whether malaria affects resistance to intestinal colonization with NTS. To address this question, we utilized a murine model of co-infection. Infection of mice with Plasmodium yoelii elicited infiltration of inflammatory macrophages and T cells into the intestinal mucosa and increased expression of inflammatory cytokines. These mucosal responses were also observed in germ-free mice, showing that they are independent of the resident microbiota. Remarkably, P. yoelii infection reduced colonization resistance of mice against S. enterica serotype Typhimurium. Further, 16S rRNA sequence analysis of the intestinal microbiota revealed marked changes in the community structure. Shifts in the microbiota increased susceptibility to intestinal colonization by S. Typhimurium, as demonstrated by microbiota reconstitution of germ-free mice. These results show that P. yoelii infection, via alterations to the microbial community in the intestine, decreases resistance to intestinal colonization with NTS. Further they raise the possibility that decreased colonization resistance may synergize with effects of malaria on systemic immunity to increase susceptibility to disseminated NTS infections.
Mooney, Jason P.; Lokken, Kristen L.; Byndloss, Mariana X.; George, Michael D.; Velazquez, Eric M.; Faber, Franziska; Butler, Brian P.; Walker, Gregory T.; Ali, Mohamed M.; Potts, Rashaun; Tiffany, Caitlin; Ahmer, Brian M. M.; Luckhart, Shirley; Tsolis, Renée M.
2015-01-01
Childhood malaria is a risk factor for disseminated infections with non-typhoidal Salmonella (NTS) in sub-Saharan Africa. While hemolytic anemia and an altered cytokine environment have been implicated in increased susceptibility to NTS, it is not known whether malaria affects resistance to intestinal colonization with NTS. To address this question, we utilized a murine model of co-infection. Infection of mice with Plasmodium yoelii elicited infiltration of inflammatory macrophages and T cells into the intestinal mucosa and increased expression of inflammatory cytokines. These mucosal responses were also observed in germ-free mice, showing that they are independent of the resident microbiota. Remarkably, P. yoelii infection reduced colonization resistance of mice against S. enterica serotype Typhimurium. Further, 16S rRNA sequence analysis of the intestinal microbiota revealed marked changes in the community structure. Shifts in the microbiota increased susceptibility to intestinal colonization by S. Typhimurium, as demonstrated by microbiota reconstitution of germ-free mice. These results show that P. yoelii infection, via alterations to the microbial community in the intestine, decreases resistance to intestinal colonization with NTS. Further they raise the possibility that decreased colonization resistance may synergize with effects of malaria on systemic immunity to increase susceptibility to disseminated NTS infections. PMID:26434367
Gammaherpesvirus Co-infection with Malaria Suppresses Anti-parasitic Humoral Immunity
Matar, Caline G.; Anthony, Neil R.; O’Flaherty, Brigid M.; Jacobs, Nathan T.; Priyamvada, Lalita; Engwerda, Christian R.; Speck, Samuel H.; Lamb, Tracey J.
2015-01-01
Immunity to non-cerebral severe malaria is estimated to occur within 1-2 infections in areas of endemic transmission for Plasmodium falciparum. Yet, nearly 20% of infected children die annually as a result of severe malaria. Multiple risk factors are postulated to exacerbate malarial disease, one being co-infections with other pathogens. Children living in Sub-Saharan Africa are seropositive for Epstein Barr Virus (EBV) by the age of 6 months. This timing overlaps with the waning of protective maternal antibodies and susceptibility to primary Plasmodium infection. However, the impact of acute EBV infection on the generation of anti-malarial immunity is unknown. Using well established mouse models of infection, we show here that acute, but not latent murine gammaherpesvirus 68 (MHV68) infection suppresses the anti-malarial humoral response to a secondary malaria infection. Importantly, this resulted in the transformation of a non-lethal P. yoelii XNL infection into a lethal one; an outcome that is correlated with a defect in the maintenance of germinal center B cells and T follicular helper (Tfh) cells in the spleen. Furthermore, we have identified the MHV68 M2 protein as an important virus encoded protein that can: (i) suppress anti-MHV68 humoral responses during acute MHV68 infection; and (ii) plays a critical role in the observed suppression of anti-malarial humoral responses in the setting of co-infection. Notably, co-infection with an M2-null mutant MHV68 eliminates lethality of P. yoelii XNL. Collectively, our data demonstrates that an acute gammaherpesvirus infection can negatively impact the development of an anti-malarial immune response. This suggests that acute infection with EBV should be investigated as a risk factor for non-cerebral severe malaria in young children living in areas endemic for Plasmodium transmission. PMID:25996913
Alaro, James R.; Partridge, Andrea; Miura, Kazutoyo; Diouf, Ababacar; Lopez, Ana M.; Angov, Evelina; Long, Carole A.
2013-01-01
The C-terminal 19-kDa domain of Plasmodium falciparum merozoite surface protein 1 (PfMSP119) is an established target of protective antibodies. However, clinical trials of PfMSP142, a leading blood-stage vaccine candidate which contains the protective epitopes of PfMSP119, revealed suboptimal immunogenicity and efficacy. Based on proof-of-concept studies in the Plasmodium yoelii murine model, we produced a chimeric vaccine antigen containing recombinant PfMSP119 (rPfMSP119) fused to the N terminus of P. falciparum merozoite surface protein 8 that lacked its low-complexity Asn/Asp-rich domain, rPfMSP8 (ΔAsn/Asp). Immunization of mice with the chimeric rPfMSP1/8 vaccine elicited strong T cell responses to conserved epitopes associated with the rPfMSP8 (ΔAsn/Asp) fusion partner. While specific for PfMSP8, this T cell response was adequate to provide help for the production of high titers of antibodies to both PfMSP119 and rPfMSP8 (ΔAsn/Asp) components. This occurred with formulations adjuvanted with either Quil A or with Montanide ISA 720 plus CpG oligodeoxynucleotide (ODN) and was observed in both inbred and outbred strains of mice. PfMSP1/8-induced antibodies were highly reactive with two major alleles of PfMSP119 (FVO and 3D7). Of particular interest, immunization with PfMSP1/8 elicited higher titers of PfMSP119-specific antibodies than a combined formulation of rPfMSP142 and rPfMSP8 (ΔAsn/Asp). As a measure of functionality, PfMSP1/8-specific rabbit IgG was shown to potently inhibit the in vitro growth of blood-stage parasites of the FVO and 3D7 strains of P. falciparum. These data support the further testing and evaluation of this chimeric PfMSP1/8 antigen as a component of a multivalent vaccine for P. falciparum malaria. PMID:23897613
Neuroimmunological Blood Brain Barrier Opening in Experimental Cerebral Malaria
Baer, Kerstin; Mikolajczak, Sebastian A.; Kappe, Stefan H. I.; Frevert, Ute
2012-01-01
Plasmodium falciparum malaria is responsible for nearly one million annual deaths worldwide. Because of the difficulty in monitoring the pathogenesis of cerebral malaria in humans, we conducted a study in various mouse models to better understand disease progression in experimental cerebral malaria (ECM). We compared the effect on the integrity of the blood brain barrier (BBB) and the histopathology of the brain of P. berghei ANKA, a known ECM model, P. berghei NK65, generally thought not to induce ECM, P. yoelii 17XL, originally reported to induce human cerebral malaria-like histopathology, and P. yoelii YM. As expected, P. berghei ANKA infection caused neurological signs, cerebral hemorrhages, and BBB dysfunction in CBA/CaJ and Swiss Webster mice, while Balb/c and A/J mice were resistant. Surprisingly, PbNK induced ECM in CBA/CaJ mice, while all other mice were resistant. P. yoelii 17XL and P. yoelii YM caused lethal hyperparasitemia in all mouse strains; histopathological alterations, BBB dysfunction, or neurological signs were not observed. Intravital imaging revealed that infected erythrocytes containing mature parasites passed slowly through capillaries making intimate contact with the endothelium, but did not arrest. Except for relatively rare microhemorrhages, mice with ECM presented no obvious histopathological alterations that would explain the widespread disruption of the BBB. Intravital imaging did reveal, however, that postcapillary venules, but not capillaries or arterioles, from mice with ECM, but not hyperparasitemia, exhibit platelet marginalization, extravascular fibrin deposition, CD14 expression, and extensive vascular leakage. Blockage of LFA-1 mediated cellular interactions prevented leukocyte adhesion, vascular leakage, neurological signs, and death from ECM. The endothelial barrier-stabilizing mediators imatinib and FTY720 inhibited vascular leakage and neurological signs and prolonged survival to ECM. Thus, it appears that neurological
Kaul, D K; Liu, X D; Nagel, R L; Shear, H L
1998-02-01
The cytoadherence of infected red blood cells (IRBCs) to the vascular endothelium is the major cause of IRBC sequestration and vessel blockage in the cerebral form of human malaria. Among the rodent models of malaria, Plasmodium yoelii 17XL-infected mice show many similarities with the human cerebral malaria caused by P. falciparum. In both, the sequestration of IRBCs in the brain vessels is secondary to the cytoadherence of IRBCs to the vascular endothelium. Similar to P. falciparum infection in the human but in contrast to P. berghei ANKA infection in mice, P. yoelii 17XL results in little, if any, accumulation of monocytes in the brain. In vivo microcirculatory studies reported here were designed to further understand the hemodynamic aspects and mechanisms underlying cytoadherence of IRBCs in the P. yoelii model using the easily accessible cremaster muscle vasculature. The results show significant decreases in arteriovenous red blood cell velocities (Vrbc) and wall shear rates in the microcirculation of P. yoelii-infected mice, with a maximal decrease occurring in small-diameter postcapillary venules, the main sites of cytoadherence. This reflects contributions from IRBC cytoadherence as well as from increased rigidity of parasitized red blood cells. No cytoadherence is observed in arterioles of the infected mice despite decreased wall shear rates, indicating that endothelial receptors for cytoadherence are restricted to venules. Infusion of a monoclonal antibody (MAb) against the intercellular adhesion molecule-1 (ICAM-1) resulted in significant increases in both arteriolar and venular Vrbc and wall shear rates, accompanied by detachment of adhered IRBCs at some venular sites. The peripheral blood smears taken after the MAb infusion showed a distinct increase in the percentage of schizonts, again indicating detachment and/or prevention of cytoadherence. An MAb against the vascular cell adhesion molecule-1 (VCAM-1) as well as an irrelevant control antibody had
Plasmodium glyceraldehyde-3-phosphate dehydrogenase: A potential malaria diagnostic target.
Krause, Robert G E; Hurdayal, Ramona; Choveaux, David; Przyborski, Jude M; Coetzer, Theresa H T; Goldring, J P Dean
2017-08-01
Malaria rapid diagnostic tests (RDTs) are immunochromatographic tests detecting Plasmodial histidine-rich protein 2 (HRP2), lactate dehydrogenase (LDH) and aldolase. HRP2 is only expressed by Plasmodium falciparum parasites and the protein is not expressed in several geographic isolates. LDH-based tests lack sensitivity compared to HRP2 tests. This study explored the potential of the Plasmodial glycolytic enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as a new malaria diagnostic biomarker. The P. falciparum and P. yoelii proteins were recombinantly expressed in BL21(DE3) Escherischia coli host cells and affinity purified. Two epitopes (CADGFLLIGEKKVSVFA and CAEKDPSQIPWGKCQV) specific to P. falciparum GAPDH and one common to all mammalian malaria species (CKDDTPIYVMGINH) were identified. Antibodies were raised in chickens against the two recombinant proteins and the three epitopes and affinity purified. The antibodies detected the native protein in parasite lysates as a 38 kDa protein and immunofluorescence verified a parasite cytosolic localization for the native protein. The antibodies suggested a 4-6 fold higher concentration of native PfGAPDH compared to PfLDH in immunoprecipitation and ELISA formats, consistent with published proteomic data. PfGAPDH shows interesting potential as a malaria diagnostic biomarker. Copyright © 2017 Elsevier Inc. All rights reserved.
Synthesis of 4-alkyl and 4-(beta-alkylvinyl) derivatives of primaquine as potential antimalarials.
Carroll, F I; Berrang, B D; Linn, C P
1979-11-01
4(beta-Alkylvinyl)-6-methoxy-8-nitroquinolines (6) were prepared from 6-methoxy-8-nitroquinoline-4-carboxaldehyde (5) via a Wittig reaction. Stannous chloride reduction of 6 gave 4-(beta-alkylvinyl)-8-amino-6-methoxyquinolines (8), whereas catalytic reduction of 6 using Raney nickel catalyst gave 4-alkyl-8-amino-6-methoxyquinolines (7). Alkylation of 7 and 8 with 4-iodo-1-phthalimidopentane, followed by removal of the phthaloyl-protecting group with hydrazine, gave 4-alkyl and 4-(beta-alkylvinyl) derivatives of primiquine, respectively. These compounds were evaluated for antimalarial activity against P. berghei and P. berghei yoelii in mice and against P. cynomolgi in rhesus monkeys. Several of the compounds were active in the P. bergheii yoelii screen. None of the compounds showed significant activity in the other two screens.
Fonseca, Jairo A; McCaffery, Jessica N; Kashentseva, Elena; Singh, Balwan; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto
2017-05-31
Malaria remains a considerable burden on public health. In 2015, the WHO estimates there were 212 million malaria cases causing nearly 429,000 deaths globally. A highly effective malaria vaccine is needed to reduce the burden of this disease. We have developed an experimental vaccine candidate (PyCMP) based on pre-erythrocytic (CSP) and erythrocytic (MSP1) stage antigens derived from the rodent malaria parasite P. yoelii. Our protein-based vaccine construct induces protective antibodies and CD4 + T cell responses. Based on evidence that viral vectors increase CD8 + T cell-mediated immunity, we also have tested heterologous prime-boost immunization regimens that included human adenovirus serotype 5 vector (Ad5), obtaining protective CD8 + T cell responses. While Ad5 is commonly used for vaccine studies, the high prevalence of pre-existing immunity to Ad5 severely compromises its utility. Here, we report the use of the novel simian adenovirus 36 (SAd36) as a candidate for a vectored malaria vaccine since this virus is not known to infect humans, and it is not neutralized by anti-Ad5 antibodies. Our study shows that the recombinant SAd36PyCMP can enhance specific CD8 + T cell response and elicit similar antibody titers when compared to an immunization regimen including the recombinant Ad5PyCMP. The robust immune responses induced by SAd36PyCMP are translated into a lower parasite load following P. yoelii infectious challenge when compared to mice immunized with Ad5PyCMP. Copyright © 2017 Elsevier Ltd. All rights reserved.
Herrera, Sócrates; Gómez, Andrés; Vera, Omaira; Vergara, Juana; Valderrama-Aguirre, Augusto; Maestre, Amanda; Méndez, Fabián; Wang, Ruobing; Chitnis, Chetan E; Yazdani, Syed S; Arévalo-Herrera, Myriam
2005-11-01
The Duffy antigen (Fy) is necessary for Plasmodium vivax invasion of human erythrocytes. Some populations have a highly prevalent Fy-negative phenotype; such persons are naturally protected from P. vivax blood infection but are expected to completely support the P. vivax pre-erythrocytic cycle, representing a valuable model for studying the immune response during these parasitic stages. We typed 214 individuals, mostly Afro-Colombians, from a P. vivax-endemic area for Fy expression and determined the antibody response to P. vivax pre-erythrocytic (sporozoites and CS) and blood-stage antigens (blood forms, P. vivax merozoite surface protein 1, and P. vivax Duffy binding protein [PvDBP]). Antibody titers to P. vivax circumsporozoite protein, P11, and N-terminal peptides and the number of responders were similar in Fy-negative and Fy-positive individuals. The number of responders to sporozoites, blood forms, and PvDBP were different between these groups. Thus, Fy-negative individuals from malaria-endemic areas can be used to study the immune response to the P. vivax liver phase without interference of the erythrocytic cycle.
Synthesis of chiral chloroquine and its analogues as antimalarial agents.
Sinha, Manish; Dola, Vasanth R; Soni, Awakash; Agarwal, Pooja; Srivastava, Kumkum; Haq, Wahajul; Puri, Sunil K; Katti, Seturam B
2014-11-01
In this investigation, we describe a new approach to chiral synthesis of chloroquine and its analogues. All tested compounds displayed potent activity against chloroquine sensitive as well as chloroquine resistant strains of Plasmodium falciparum in vitro and Plasmodium yoelii in vivo. Compounds S-13 b, S-13c, S-13 d and S-13 i displayed excellent in vitro antimalarial activity with an IC50 value of 56.82, 60.41, 21.82 and 7.94 nM, respectively, in the case of resistant strain. Furthermore, compounds S-13a, S-13c and S-13 d showed in vivo suppression of 100% parasitaemia on day 4 in the mouse model against Plasmodium yoelii when administered orally. These results underscore the application of synthetic methodology and need for further lead optimization. Copyright © 2014 Elsevier Ltd. All rights reserved.
Campo, Joe J; Aponte, John J; Skinner, Jeff; Nakajima, Rie; Molina, Douglas M; Liang, Li; Sacarlal, Jahit; Alonso, Pedro L; Crompton, Peter D; Felgner, Philip L; Dobaño, Carlota
2015-03-01
The leading malaria vaccine candidate, RTS,S, targets the sporozoite and liver stages of the Plasmodium falciparum life cycle, yet it provides partial protection against disease associated with the subsequent blood stage of infection. Antibodies against the vaccine target, the circumsporozoite protein, have not shown sufficient correlation with risk of clinical malaria to serve as a surrogate for protection. The mechanism by which a vaccine that targets the asymptomatic sporozoite and liver stages protects against disease caused by blood-stage parasites remains unclear. We hypothesized that vaccination with RTS,S protects from blood-stage disease by reducing the number of parasites emerging from the liver, leading to prolonged exposure to subclinical levels of blood-stage parasites that go undetected and untreated, which in turn boosts pre-existing antibody-mediated blood-stage immunity. To test this hypothesis, we compared antibody responses to 824 P. falciparum antigens by protein array in Mozambican children 6 months after receiving a full course of RTS,S (n = 291) versus comparator vaccine (n = 297) in a Phase IIb trial. Moreover, we used a nested case-control design to compare antibody responses of children who did or did not experience febrile malaria. Unexpectedly, we found that the breadth and magnitude of the antibody response to both liver and asexual blood-stage antigens was significantly lower in RTS,S vaccinees, with the exception of only four antigens, including the RTS,S circumsporozoite antigen. Contrary to our initial hypothesis, these findings suggest that RTS,S confers protection against clinical malaria by blocking sporozoite invasion of hepatocytes, thereby reducing exposure to the blood-stage parasites that cause disease. We also found that antibody profiles 6 months after vaccination did not distinguish protected and susceptible children during the subsequent 12-month follow-up period but were strongly associated with exposure. Together
Regis, David P.; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L.; Stefaniak, Maureen E.; Campo, Joseph J.; Carucci, Daniel J.; Roth, David A.; He, Huaping; Felgner, Philip L.; Doolan, Denise L.
2009-01-01
We have evaluated a technology called Transcriptionally Active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data. PMID:18164079
Regis, David P; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L; Stefaniak, Maureen E; Campo, Joseph J; Carucci, Daniel J; Roth, David A; He, Huaping; Felgner, Philip L; Doolan, Denise L
2008-03-01
We have evaluated a technology called transcriptionally active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data.
Leitner, Wolfgang W; Bergmann-Leitner, Elke S; Angov, Evelina
2010-05-27
The immunological mechanisms responsible for protection against malaria infection vary among Plasmodium species, host species and the developmental stage of parasite, and are poorly understood. A challenge with live parasites is the most relevant approach to testing the efficacy of experimental malaria vaccines. Nevertheless, in the mouse models of Plasmodium berghei and Plasmodium yoelii, parasites are usually delivered by intravenous injection. This route is highly artificial and particularly in the P. berghei model produces inconsistent challenge results. The initial objective of this study was to compare an optimized intravenous (IV) delivery challenge model with an optimized single infectious mosquito bite challenge model. Finding shortcomings of both approaches, an alternative approach was explored, i.e., the subcutaneous challenge. Mice were infected with P. berghei sporozoites by intravenous (tail vein) injection, single mosquito bite, or subcutaneous injection of isolated parasites into the subcutaneous pouch at the base of the hind leg. Infection was determined in blood smears 7 and 14 days later. To determine the usefulness of challenge models for vaccine testing, mice were immunized with circumsporozoite-based DNA vaccines by gene gun. Despite modifications that allowed infection with a much smaller than reported number of parasites, the IV challenge remained insufficiently reliable and reproducible. Variations in the virulence of the inoculum, if not properly monitored by the rigorous inclusion of sporozoite titration curves in each experiment, can lead to unacceptable variations in reported vaccine efficacies. In contrast, mice with different genetic backgrounds were consistently infected by a single mosquito bite, without overwhelming vaccine-induced protective immune responses. Because of the logistical challenges associated with the mosquito bite model, the subcutaneous challenge route was optimized. This approach, too, yields reliable challenge
Forbes, Emily K.; de Cassan, Simone C.; Llewellyn, David; Biswas, Sumi; Goodman, Anna L.; Cottingham, Matthew G.; Long, Carole A.; Pleass, Richard J.; Hill, Adrian V. S.; Hill, Fergal; Draper, Simon J.
2012-01-01
Viral vectored vaccines have been shown to induce both T cell and antibody responses in animals and humans. However, the induction of even higher level T cell responses may be crucial in achieving vaccine efficacy against difficult disease targets, especially in humans. Here we investigate the oligomerization domain of the α-chain of C4b-binding protein (C4 bp) as a candidate T cell “molecular adjuvant” when fused to malaria antigens expressed by human adenovirus serotype 5 (AdHu5) vectored vaccines in BALB/c mice. We demonstrate that i) C-terminal fusion of an oligomerization domain can enhance the quantity of antigen-specific CD4+ and CD8+ T cell responses induced in mice after only a single immunization of recombinant AdHu5, and that the T cells maintain similar functional cytokine profiles; ii) an adjuvant effect is observed for AdHu5 vectors expressing either the 42 kDa C-terminal domain of Plasmodium yoelii merozoite surface protein 1 (PyMSP142) or the 83 kDa ectodomain of P. falciparum strain 3D7 apical membrane antigen 1 (PfAMA1), but not a candidate 128kDa P. falciparum MSP1 biallelic fusion antigen; iii) following two homologous immunizations of AdHu5 vaccines, antigen-specific T cell responses are further enhanced, however, in both BALB/c mice and New Zealand White rabbits no enhancement of functional antibody responses is observed; and iv) that the T cell adjuvant activity of C4 bp is not dependent on a functional Fc-receptor γ-chain in the host, but is associated with the oligomerization of small (<80 kDa) antigens expressed by recombinant AdHu5. The oligomerization domain of C4 bp can thus adjuvant T cell responses induced by AdHu5 vectors against selected antigens and its clinical utility as well as mechanism of action warrant further investigation. PMID:22984589
Nawwab Al-Deen, F M; Selomulya, C; Kong, Y Y; Xiang, S D; Ma, C; Coppel, R L; Plebanski, M
2014-02-01
Dendritic cells (DC) targeting vaccines require high efficiency for uptake, followed by DC activation and maturation. We used magnetic vectors comprising polyethylenimine (PEI)-coated superparamagnetic iron oxide nanoparticles, with hyaluronic acid (HA) of different molecular weights (<10 and 900 kDa) to reduce cytotoxicity and to facilitate endocytosis of particles into DCs via specific surface receptors. DNA encoding Plasmodium yoelii merozoite surface protein 1-19 and a plasmid encoding yellow fluorescent gene were added to the magnetic complexes with various % charge ratios of HA: PEI. The presence of magnetic fields significantly enhanced DC transfection and maturation. Vectors containing a high-molecular-weight HA with 100% charge ratio of HA: PEI yielded a better transfection efficiency than others. This phenomenon was attributed to their longer molecular chains and higher mucoadhesive properties aiding DNA condensation and stability. Insights gained should improve the design of more effective DNA vaccine delivery systems.
2012-01-01
Background During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. Methods To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Results Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Conclusions Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses. PMID:22873687
Feng, Yonghui; Zhu, Xiaotong; Wang, Qinghui; Jiang, Yongjun; Shang, Hong; Cui, Liwang; Cao, Yaming
2012-08-08
During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses.
Kaul, D K; Nagel, R L; Llena, J F; Shear, H L
1994-04-01
To understand the microcirculatory events during cerebral malaria, we have studied the lethal strain of rodent Plasmodia, Plasmodium yoelii 17XL, originally described by Yoeli and Hargreaves in 1974. The virulence of P. yoelii 17XL is caused by intravascular sequestration of infected red blood cells (IRBCs), especially in the brain vessels and capillaries. This mouse model resembles human P. falciparum infection more closely than P. berghei ANKA infection since it shows little, if any, inflammation of the brain. In vivo microcirculatory studies on cytoadherence of IRBCs were performed using the cremaster muscle preparation, which is an easily accessible vasculature for intravital observations. Ex vivo assay of cytoadherence was carried out in the artificially perfused mesocecum preparation of the rat. The results in either preparation demonstrated cytoadherence of IRBCs that was restricted to postcapillary venules. Furthermore, the in vivo measurements showed the prevalence of cytoadherence in small-diameter (< 40 microns) venules in accordance with the local wall shear rates. The parasitized animals demonstrated significantly reduced red blood cell velocities and wall shear rates in the small-diameter postcapillary venules of the cremaster. The relationship between cytoadherence and venular wall shear rates was also reflected in the inverse correlation between the number of adhered cells and the venular diameter in the ex vivo mesocecum preparation. In the ex vivo preparation, cytoadherence of IRBCs was accompanied by a higher peripheral resistance. Transmission electron microscopy of the cremaster muscle and brain tissues showed a tight association of IRBCs with the endothelium of small venules. These observations demonstrate that cytoadherence of P. yoelii 17XL-infected mouse red blood cells is very similar to that of P. falciparum-infected cells. Thus, this model should allow a detailed analysis of the molecular mechanisms involved in the generation of cerebral
Bailey, Jeffrey A; Mvalo, Tisungane; Aragam, Nagesh; Weiser, Matthew; Congdon, Seth; Kamwendo, Debbie; Martinson, Francis; Hoffman, Irving; Meshnick, Steven R; Juliano, Jonathan J
2012-08-15
The development of an effective malaria vaccine has been hampered by the genetic diversity of commonly used target antigens. This diversity has led to concerns about allele-specific immunity limiting the effectiveness of vaccines. Despite extensive genetic diversity of circumsporozoite protein (CS), the most successful malaria vaccine is RTS/S, a monovalent CS vaccine. By use of massively parallel pyrosequencing, we evaluated the diversity of CS haplotypes across the T-cell epitopes in parasites from Lilongwe, Malawi. We identified 57 unique parasite haplotypes from 100 participants. By use of ecological and molecular indexes of diversity, we saw no difference in the diversity of CS haplotypes between adults and children. We saw evidence of weak variant-specific selection within this region of CS, suggesting naturally acquired immunity does induce variant-specific selection on CS. Therefore, the impact of CS vaccines on variant frequencies with widespread implementation of vaccination requires further study.
Extended protection capabilities of an immature dendritic-cell targeting malaria sporozoite vaccine.
Luo, Kun; Zavala, Fidel; Gordy, James; Zhang, Hong; Markham, Richard B
2017-04-25
Mouse studies evaluating candidate malaria vaccines have typically examined protective efficacy over the relatively short time frames of several weeks after the final of multiple immunizations. The current study examines the protective ability in a mouse model system of a novel protein vaccine construct in which the adjuvant polyinosinic polycytidilic acid (poly(I:C)) is used in combination with a vaccine in which the immature dendritic cell targeting chemokine, macrophage inflammatory protein 3 alpha (MIP3α), is fused to the circumsporozoite protein (CSP) of Plasmodium falciparum (P. falciparum). Two vaccinations, three weeks apart, elicited extraordinarily high, MIP3α-dependent antibody responses. MIP3α was able to target the vaccine to the CCR6 receptor found predominantly on immature dendritic cells and significantly enhanced the cellular influx at the vaccination site. At three and 23 weeks after the final of two immunizations, mice were challenged by intravenous injection of 5×10 3 transgenic Plasmodium berghei sporozoites expressing P. falciparum CSP, a challenge dose approximately one order of magnitude greater than that which is encountered after mosquito bite in the clinical setting. A ninety-seven percent reduction in liver sporozoite load was observed at both time points, 23 weeks being the last time point tested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fong, Mun-Yik; Rashdi, Sarah A A; Yusof, Ruhani; Lau, Yee-Ling
2015-02-21
Peninsular Malaysia. This difference may not be attributed to geographical separation because other genetic markers studied thus far such as the P. knowlesi circumsporozoite protein gene and small subunit ribosomal RNA do not display such differentiation. Immune evasion may possibly be the reason for the differentiation.
Mizutani, Masanori; Iyori, Mitsuhiro; Blagborough, Andrew M; Fukumoto, Shinya; Funatsu, Tomohiro; Sinden, Robert E; Yoshida, Shigeto
2014-10-01
A multistage malaria vaccine targeting the pre-erythrocytic and sexual stages of Plasmodium could effectively protect individuals against infection from mosquito bites and provide transmission-blocking (TB) activity against the sexual stages of the parasite, respectively. This strategy could help prevent malaria infections in individuals and, on a larger scale, prevent malaria transmission in communities of endemicity. Here, we describe the development of a multistage Plasmodium vivax vaccine which simultaneously expresses P. vivax circumsporozoite protein (PvCSP) and P25 (Pvs25) protein of this species as a fusion protein, thereby acting as a pre-erythrocytic vaccine and a TB vaccine, respectively. A new-concept vaccine platform based on the baculovirus dual-expression system (BDES) was evaluated. The BDES-Pvs25-PvCSP vaccine displayed correct folding of the Pvs25-PvCSP fusion protein on the viral envelope and was highly expressed upon transduction of mammalian cells in vitro. This vaccine induced high levels of antibodies to Pvs25 and PvCSP and elicited protective (43%) and TB (82%) efficacies against transgenic P. berghei parasites expressing the corresponding P. vivax antigens in mice. Our data indicate that our BDES, which functions as both a subunit and DNA vaccine, can offer a promising multistage vaccine capable of delivering a potent antimalarial pre-erythrocytic and TB response via a single immunization regimen. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.
2011-01-01
Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235
Clark, Eva H.; Silva, Claudia J.; Weiss, Greta E.; Li, Shanping; Padilla, Carlos; Crompton, Peter D.; Hernandez, Jean N.
2012-01-01
The development of clinical immunity to Plasmodium falciparum malaria is thought to require years of parasite exposure, a delay often attributed to difficulties in developing protective antibody levels. In this study, we evaluated several P. falciparum vaccine candidate antigens, including apical membrane antigen 1 (AMA-1), circumsporozoite protein (CSP), erythrocyte binding antigen 175 (EBA-175), and the 19-kDa region of merozoite surface protein 1 (MSP119). After observing a more robust antibody response to MSP119, we evaluated the magnitude and longevity of IgG responses specific to this antigen in Peruvian adults and children before, during, and after P. falciparum infection. In this low-transmission region, even one reported prior infection was sufficient to produce a positive anti-MSP119 IgG response for >5 months in the absence of reinfection. We also observed an expansion of the total plasmablast (CD19+ CD27+ CD38high) population in the majority of individuals shortly after infection and detected MSP1-specific memory B cells in a subset of individuals at various postinfection time points. This evidence supports our hypothesis that effective antimalaria humoral immunity can develop in low-transmission regions. PMID:22252876
Clark, Eva H; Silva, Claudia J; Weiss, Greta E; Li, Shanping; Padilla, Carlos; Crompton, Peter D; Hernandez, Jean N; Branch, OraLee H
2012-04-01
The development of clinical immunity to Plasmodium falciparum malaria is thought to require years of parasite exposure, a delay often attributed to difficulties in developing protective antibody levels. In this study, we evaluated several P. falciparum vaccine candidate antigens, including apical membrane antigen 1 (AMA-1), circumsporozoite protein (CSP), erythrocyte binding antigen 175 (EBA-175), and the 19-kDa region of merozoite surface protein 1 (MSP1(19)). After observing a more robust antibody response to MSP1(19), we evaluated the magnitude and longevity of IgG responses specific to this antigen in Peruvian adults and children before, during, and after P. falciparum infection. In this low-transmission region, even one reported prior infection was sufficient to produce a positive anti-MSP1(19) IgG response for >5 months in the absence of reinfection. We also observed an expansion of the total plasmablast (CD19(+) CD27(+) CD38(high)) population in the majority of individuals shortly after infection and detected MSP1-specific memory B cells in a subset of individuals at various postinfection time points. This evidence supports our hypothesis that effective antimalaria humoral immunity can develop in low-transmission regions.
The utility of Plasmodium berghei as a rodent model for anti-merozoite malaria vaccine assessment
Goodman, Anna L.; Forbes, Emily K.; Williams, Andrew R.; Douglas, Alexander D.; de Cassan, Simone C.; Bauza, Karolis; Biswas, Sumi; Dicks, Matthew D. J.; Llewellyn, David; Moore, Anne C.; Janse, Chris J.; Franke-Fayard, Blandine M.; Gilbert, Sarah C.; Hill, Adrian V. S.; Pleass, Richard J.; Draper, Simon J.
2013-01-01
Rodent malaria species Plasmodium yoelii and P. chabaudi have been widely used to validate vaccine approaches targeting blood-stage merozoite antigens. However, increasing data suggest the P. berghei rodent malaria may be able to circumvent vaccine-induced anti-merozoite responses. Here we confirm a failure to protect against P. berghei, despite successful antibody induction against leading merozoite antigens using protein-in-adjuvant or viral vectored vaccine delivery. No subunit vaccine approach showed efficacy in mice following immunization and challenge with the wild-type P. berghei strains ANKA or NK65, or against a chimeric parasite line encoding a merozoite antigen from P. falciparum. Protection was not improved in knockout mice lacking the inhibitory Fc receptor CD32b, nor against a Δsmac P. berghei parasite line with a non-sequestering phenotype. An improved understanding of the mechanisms responsible for protection, or failure of protection, against P. berghei merozoites could guide the development of an efficacious vaccine against P. falciparum. PMID:23609325
Kumar, Hirdesh; Frischknecht, Friedrich; Mair, Gunnar R; Gomes, James
2015-12-01
Genetically attenuated parasites (GAPs) that lack genes essential for the liver stage of the malaria parasite, and therefore cause developmental arrest, have been developed as live vaccines in rodent malaria models and recently been tested in humans. The genes targeted for deletion were often identified by trial and error. Here we present a systematic gene - protein and transcript - expression analyses of several Plasmodium species with the aim to identify candidate genes for the generation of novel GAPs. With a lack of liver stage expression data for human malaria parasites, we used data available for liver stage development of Plasmodium yoelii, a rodent malaria model, to identify proteins expressed in the liver stage but absent from blood stage parasites. An orthology-based search was then employed to identify orthologous proteins in the human malaria parasite Plasmodium falciparum resulting in a total of 310 genes expressed in the liver stage but lacking evidence of protein expression in blood stage parasites. Among these 310 possible GAP candidates, we further studied Plasmodium liver stage proteins by phyletic distribution and functional domain analyses and shortlisted twenty GAP-candidates; these are: fabB/F, fabI, arp, 3 genes encoding subunits of the PDH complex, dnaJ, urm1, rS5, ancp, mcp, arh, gk, lisp2, valS, palm, and four conserved Plasmodium proteins of unknown function. Parasites lacking one or several of these genes might yield new attenuated malaria parasites for experimental vaccination studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877
Heal, Karen G; Taylor-Robinson, Andrew W
2010-01-01
The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.
Designing malaria vaccines to circumvent antigen variability.
Ouattara, Amed; Barry, Alyssa E; Dutta, Sheetij; Remarque, Edmond J; Beeson, James G; Plowe, Christopher V
2015-12-22
Prospects for malaria eradication will be greatly enhanced by an effective vaccine, but parasite genetic diversity poses a major impediment to malaria vaccine efficacy. In recent pre-clinical and field trials, vaccines based on polymorphic Plasmodium falciparum antigens have shown efficacy only against homologous strains, raising the specter of allele-specific immunity such as that which plagues vaccines against influenza and HIV. The most advanced malaria vaccine, RTS,S, targets relatively conserved epitopes on the P. falciparum circumsporozoite protein. After more than 40 years of development and testing, RTS,S, has shown significant but modest efficacy against clinical malaria in phase 2 and 3 trials. Ongoing phase 2 studies of an irradiated sporozoite vaccine will ascertain whether the full protection against homologous experimental malaria challenge conferred by high doses of a whole organism vaccine can provide protection against diverse strains in the field. Here we review and evaluate approaches being taken to design broadly cross-protective malaria vaccines. Copyright © 2015. Published by Elsevier Ltd.
Designing malaria vaccines to circumvent antigen variability✩
Ouattara, Amed; Barry, Alyssa E.; Dutta, Sheetij; Remarque, Edmond J.; Beeson, James G.; Plowe, Christopher V.
2016-01-01
Prospects for malaria eradication will be greatly enhanced by an effective vaccine, but parasite genetic diversity poses a major impediment to malaria vaccine efficacy. In recent pre-clinical and field trials, vaccines based on polymorphic Plasmodium falciparum antigens have shown efficacy only against homologous strains, raising the specter of allele-specific immunity such as that which plagues vaccines against influenza and HIV. The most advanced malaria vaccine, RTS,S, targets relatively conserved epitopes on the P. falciparum circumsporozoite protein. After more than 40 years of development and testing, RTS,S, has shown significant but modest efficacy against clinical malaria in phase 2 and 3 trials. Ongoing phase 2 studies of an irradiated sporozoite vaccine will ascertain whether the full protection against homologous experimental malaria challenge conferred by high doses of a whole organism vaccine can provide protection against diverse strains in the field. Here we review and evaluate approaches being taken to design broadly cross-protective malaria vaccines. PMID:26475447
Spelman, Kevin; Depoix, Delphine; McCray, Megan; Mouray, Elisabeth; Grellier, Philippe
2010-01-01
Spilanthes spp. are used as traditional herbal medicines in Africa and India to treat malaria. Yet, to date, there is no data on active constituents or most effective extraction methods for this indication. The isolated alkylamides, spilanthol and undeca-2E-ene-8,10-diynoic acid isobutylamide, found in S. acmella Murr., were shown to have IC50s of 16.5 μg/mL and 41.4 μg/mL on Plasmodium falciparum strain PFB and IC50s of 5.8 μg/mL and 16.3 μg/mL for the chloroquine resistant P. falciparum K1 strain, respectively. Further investigations revealed that at relatively low concentrations, spilanthol and the water extract of S. acmella reduced the parasitemia 59% and 53% in mice infected with P. yoelii yoelii 17XNL at 5 mg/kg and 50 mg/kg, respectively. Unexpectedly, the 95% ethanol extract of S. acmella was less effective (36% reduction in parasitemia) at 50 mg/kg. These results provide the first evidence supporting S. acmella against malaria and demonstrating active constituents in S. acmella against P. falciparum. PMID:22692989
Burnett, Jennifer L; Carns, Jennifer L; Richards-Kortum, Rebecca
2017-11-07
Optical detection of circulating haemozoin has been suggested as a needle free method to diagnose malaria using in vivo microscopy. Haemozoin is generated within infected red blood cells by the malaria parasite, serving as a highly specific, endogenous biomarker of malaria. However, phagocytosis of haemozoin by white blood cells which persist after the infection is resolved presents the potential for false positive diagnosis; therefore, the focus of this work is to identify a feature of the haemozoin signal to discriminate between infected red blood cells and haemozoin-containing white blood cells. Conventional brightfield microscopy of thin film blood smears was used to analyse haemozoin absorbance signal in vitro. Cell type and parasite maturity were morphologically determined using colocalized DAPI staining. The ability of features to discriminate between infected red blood cells and haemozoin-containing white blood cells was evaluated using images of smears from subjects infected with two species of Plasmodium, Plasmodium yoelii and Plasmodium falciparum. Discriminating features identified by blood smear microscopy were characterized in vivo in P. yoelii-infected mice. Two features of the haemozoin signal, haemozoin diameter and normalized intensity difference, were identified as potential parameters to differentiate infected red blood cells and haemozoin-containing white blood cells. Classification performance was evaluated using the area under the receiver operating characteristic curve, with area under the curve values of 0.89 for the diameter parameter and 0.85 for the intensity parameter when assessed in P. yoelii samples. Similar results were obtained from P. falciparum blood smears, showing an AUC of 0.93 or greater for both classification features. For in vivo investigations, the intensity-based metric was the best classifier, with an AUC of 0.91. This work demonstrates that size and intensity features of haemozoin absorbance signal collected by in vivo
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Gaines, J C; Acebes, S; Virrueta, A; Butler, M; Regan, L; O'Hern, C S
2018-05-01
We compare side chain prediction and packing of core and non-core regions of soluble proteins, protein-protein interfaces, and transmembrane proteins. We first identified or created comparable databases of high-resolution crystal structures of these 3 protein classes. We show that the solvent-inaccessible cores of the 3 classes of proteins are equally densely packed. As a result, the side chains of core residues at protein-protein interfaces and in the membrane-exposed regions of transmembrane proteins can be predicted by the hard-sphere plus stereochemical constraint model with the same high prediction accuracies (>90%) as core residues in soluble proteins. We also find that for all 3 classes of proteins, as one moves away from the solvent-inaccessible core, the packing fraction decreases as the solvent accessibility increases. However, the side chain predictability remains high (80% within 30°) up to a relative solvent accessibility, rSASA≲0.3, for all 3 protein classes. Our results show that ≈40% of the interface regions in protein complexes are "core", that is, densely packed with side chain conformations that can be accurately predicted using the hard-sphere model. We propose packing fraction as a metric that can be used to distinguish real protein-protein interactions from designed, non-binding, decoys. Our results also show that cores of membrane proteins are the same as cores of soluble proteins. Thus, the computational methods we are developing for the analysis of the effect of hydrophobic core mutations in soluble proteins will be equally applicable to analyses of mutations in membrane proteins. © 2018 Wiley Periodicals, Inc.
Treatment of Chloroquine-Resistant Malaria with Esters of Cephalotaxine: Homoharringtonine
1990-01-01
AD-A233 355 1py Annals of Tropical Medicine and Parasitology, Vol. 84, No. 3,229-237 (1990) E L ECT E MAR 2 91991 Treatment of chloroquine -resistant...growth inhibition of two strains of chloroquine -resistant Plasmodiumfalciparum malaria in vitro. In vivo tests in mice infected with P.yoelii showed...usefulness of homoharringtonine in the treatment of chloroquine -resistant malaria, but also demonstrate the advantage of applying comparative biochemistry
Detecting protein-protein interactions using Renilla luciferase fusion proteins.
Burbelo, Peter D; Kisailus, Adam E; Peck, Jeremy W
2002-11-01
We have developed a novel system designated the luciferase assay for protein detection (LAPD) to study protein-protein interactions. This method involves two protein fusions, a soluble reporter fusion and a fusion for immobilizing the target protein. The soluble reporter is an N-terminal Renilla luciferase fusion protein that exhibits high Renilla luciferase activity. Crude cleared lysates from transfected Cos1 cells that express the Renilla luciferase fusion protein can be used in binding assays with immobilized target proteins. Following incubation and washing, target-bound Renilla luciferase fusion proteins produce light from the coelenterazine substrate, indicating an interaction between the two proteins of interest. As proof of the principle, we reproduced known, transient protein-protein interactions between the Cdc42 GTPase and its effector proteins. GTPase Renilla fusion proteins produced in Cos1 cells were tested with immobilized recombinant GST-N-WASP and CEP5 effector proteins. Using this assay, we could detect specific interactions of Cdc42 with these effector proteins in approximately 50 min. The specificity of these interactions was demonstrated by showing that they were GTPase-specific and GTP-dependent and not seen with other unrelated target proteins. These results suggest that the LAPD method, which is both rapid and sensitive, may have research and practical applications.
Greenhouse, Bryan; Ho, Benjamin; Hubbard, Alan; Njama-Meya, Denise; Narum, David L; Lanar, David E; Dutta, Sheetij; Rosenthal, Philip J; Dorsey, Grant; John, Chandy C
2011-07-01
Associations between antibody responses to Plasmodium falciparum antigens and protection against symptomatic malaria have been difficult to ascertain, in part because antibodies are potential markers of both exposure to P. falciparum and protection against disease. We measured IgG responses to P. falciparum circumsporozoite protein, liver-stage antigen 1, apical-membrane antigen 1 (AMA-1), and merozoite surface proteins (MSP) 1 and 3, in children in Kampala, Uganda, and measured incidence of malaria before and after antibody measurement. Stronger responses to all 5 antigens were associated with an increased risk of clinical malaria (P < .01) because of confounding with prior exposure to P. falciparum. However, with use of another assessment, risk of clinical malaria once parasitemic, stronger responses to AMA-1, MSP-1, and MSP-3 were associated with protection (odds ratios, 0.34, 0.36, and 0.31, respectively, per 10-fold increase; P < .01). Analyses assessing antibodies in combination suggested that any protective effect of antibodies was overestimated by associations between individual responses and protection. Using the risk of symptomatic malaria once parasitemic as an outcome may improve detection of associations between immune responses and protection from disease. Immunoepidemiology studies designed to detect mechanisms of immune protection should integrate prior exposure into the analysis and evaluate multiple immune responses.
Espinoza Mora, Maria del Rosario; Steeg, Christiane; Tartz, Susanne; Heussler, Volker; Sparwasser, Tim; Link, Andreas; Fleischer, Bernhard; Jacobs, Thomas
2014-01-01
Regulatory T cells (Treg) have been shown to restrict vaccine-induced T cell responses in different experimental models. In these studies CD4+CD25+ Treg were depleted using monoclonal antibodies against CD25, which might also interfere with CD25 on non-regulatory T cell populations and would have no effect on Foxp3+CD25− Treg. To obtain more insights in the specific function of Treg during vaccination we used mice that are transgenic for a bacterial artificial chromosome expressing a diphtheria toxin (DT) receptor-eGFP fusion protein under the control of the foxp3 gene locus (depletion of regulatory T cell mice; DEREG). As an experimental vaccine-carrier recombinant Bordetella adenylate cyclase toxoid fused with a MHC-class I-restricted epitope of the circumsporozoite protein (ACT-CSP) of Plasmodium berghei (Pb) was used. ACT-CSP was shown by us previously to introduce the CD8+ epitope of Pb-CSP into the MHC class I presentation pathway of professional antigen-presenting cells (APC). Using this system we demonstrate here that the number of CSP-specific T cells increases when Treg are depleted during prime but also during boost immunization. Importantly, despite this increase of T effector cells no difference in the number of antigen-specific memory cells was observed. PMID:25115805
Moon, James J; Suh, Heikyung; Polhemus, Mark E; Ockenhouse, Christian F; Yadava, Anjali; Irvine, Darrell J
2012-01-01
The parasite Plasmodium vivax is the most frequent cause of malaria outside of sub-Saharan Africa, but efforts to develop viable vaccines against P. vivax so far have been inadequate. We recently developed pathogen-mimicking polymeric vaccine nanoparticles composed of the FDA-approved biodegradable polymer poly(lactide-co-glycolide) acid (PLGA) "enveloped" by a lipid membrane. In this study, we sought to determine whether this vaccine delivery platform could be applied to enhance the immune response against P. vivax sporozoites. A candidate malaria antigen, VMP001, was conjugated to the lipid membrane of the particles, and an immunostimulatory molecule, monophosphoryl lipid A (MPLA), was incorporated into the lipid membranes, creating pathogen-mimicking nanoparticle vaccines (VMP001-NPs). Vaccination with VMP001-NPs promoted germinal center formation and elicited durable antigen-specific antibodies with significantly higher titers and more balanced Th1/Th2 responses in vivo, compared with vaccines composed of soluble protein mixed with MPLA. Antibodies raised by NP vaccinations also exhibited enhanced avidity and affinity toward the domains within the circumsporozoite protein implicated in protection and were able to agglutinate live P. vivax sporozoites. These results demonstrate that these VMP001-NPs are promising vaccines candidates that may elicit protective immunity against P. vivax sporozoites.
Protein docking prediction using predicted protein-protein interface.
Li, Bin; Kihara, Daisuke
2012-01-10
Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm), is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.
Zhang, Changsheng; Tang, Bo; Wang, Qian; Lai, Luhua
2014-10-01
Target structure-based virtual screening, which employs protein-small molecule docking to identify potential ligands, has been widely used in small-molecule drug discovery. In the present study, we used a protein-protein docking program to identify proteins that bind to a specific target protein. In the testing phase, an all-to-all protein-protein docking run on a large dataset was performed. The three-dimensional rigid docking program SDOCK was used to examine protein-protein docking on all protein pairs in the dataset. Both the binding affinity and features of the binding energy landscape were considered in the scoring function in order to distinguish positive binding pairs from negative binding pairs. Thus, the lowest docking score, the average Z-score, and convergency of the low-score solutions were incorporated in the analysis. The hybrid scoring function was optimized in the all-to-all docking test. The docking method and the hybrid scoring function were then used to screen for proteins that bind to tumor necrosis factor-α (TNFα), which is a well-known therapeutic target for rheumatoid arthritis and other autoimmune diseases. A protein library containing 677 proteins was used for the screen. Proteins with scores among the top 20% were further examined. Sixteen proteins from the top-ranking 67 proteins were selected for experimental study. Two of these proteins showed significant binding to TNFα in an in vitro binding study. The results of the present study demonstrate the power and potential application of protein-protein docking for the discovery of novel binding proteins for specific protein targets. © 2014 Wiley Periodicals, Inc.
Analogs of natural aminoacyl-tRNA synthetase inhibitors clear malaria in vivo
Novoa, Eva Maria; Camacho, Noelia; Tor, Anna; Wilkinson, Barrie; Moss, Steven; Marín-García, Patricia; Azcárate, Isabel G.; Bautista, José M.; Mirando, Adam C.; Francklyn, Christopher S.; Varon, Sònia; Royo, Miriam; Cortés, Alfred; Ribas de Pouplana, Lluís
2014-01-01
Malaria remains a major global health problem. Emerging resistance to existing antimalarial drugs drives the search for new antimalarials, and protein translation is a promising pathway to target. Here we explore the potential of the aminoacyl-tRNA synthetase (ARS) family as a source of antimalarial drug targets. First, a battery of known and novel ARS inhibitors was tested against Plasmodium falciparum cultures, and their activities were compared. Borrelidin, a natural inhibitor of threonyl-tRNA synthetase (ThrRS), stands out for its potent antimalarial effect. However, it also inhibits human ThrRS and is highly toxic to human cells. To circumvent this problem, we tested a library of bioengineered and semisynthetic borrelidin analogs for their antimalarial activity and toxicity. We found that some analogs effectively lose their toxicity against human cells while retaining a potent antiparasitic activity both in vitro and in vivo and cleared malaria from Plasmodium yoelii-infected mice, resulting in 100% mice survival rates. Our work identifies borrelidin analogs as potent, selective, and unexplored scaffolds that efficiently clear malaria both in vitro and in vivo. PMID:25489076
An outbreak of locally acquired Plasmodium vivax malaria among migrant workers in Oman.
Simon, Bruno; Sow, Fatimata; Al Mukhaini, Said K; Al-Abri, Seif; Ali, Osama A M; Bonnot, Guillaume; Bienvenu, Anne-Lise; Petersen, Eskild; Picot, Stéphane
2017-01-01
Plasmodium vivax is the most widely distributed human malaria parasite. Outside sub-Saharan Africa, the proportion of P. vivax malaria is rising. A major cause for concern is the re-emergence of Plasmodium vivax in malaria-free areas. Oman, situated in the south-eastern corner of the Arabian Peninsula, has long been an area of vivax malaria transmission but no locally acquired cases were reported in 2004. However, local transmission has been registered in small outbreaks since 2007. In this study, a local outbreak of 54 cases over 50 days in 2014 was analyzed retrospectively and stained blood slides have been obtained for parasite identification and genotyping. The aim of this study was to identify the geographical origin of these cases, in an attempt to differentiate between imported cases and local transmission. Using circumsporozoite protein (csp), merozoite surface protein 1 (msp1), and merozoite surface protein 3 (msp3) markers for genotyping of parasite DNA obtained by scrapping off the surface of smears, genetic diversity and phylogenetic analysis were performed. The study found that the samples had very low genetic diversity, a temperate genotype, and a high genetic distance, with most of the reference strains coming from endemic countries. We conclude that a small outbreak of imported malaria is not associated with re-emergence of malaria transmission in Oman, as no new cases have been seen since the outbreak ended. © B. Simon et al., published by EDP Sciences, 2017.
An outbreak of locally acquired Plasmodium vivax malaria among migrant workers in Oman
Simon, Bruno; Sow, Fatimata; Al Mukhaini, Said K.; Al-Abri, Seif; Ali, Osama A.M.; Bonnot, Guillaume; Bienvenu, Anne-Lise; Petersen, Eskild; Picot, Stéphane
2017-01-01
Plasmodium vivax is the most widely distributed human malaria parasite. Outside sub-Saharan Africa, the proportion of P. vivax malaria is rising. A major cause for concern is the re-emergence of Plasmodium vivax in malaria-free areas. Oman, situated in the south-eastern corner of the Arabian Peninsula, has long been an area of vivax malaria transmission but no locally acquired cases were reported in 2004. However, local transmission has been registered in small outbreaks since 2007. In this study, a local outbreak of 54 cases over 50 days in 2014 was analyzed retrospectively and stained blood slides have been obtained for parasite identification and genotyping. The aim of this study was to identify the geographical origin of these cases, in an attempt to differentiate between imported cases and local transmission. Using circumsporozoite protein (csp), merozoite surface protein 1 (msp1), and merozoite surface protein 3 (msp3) markers for genotyping of parasite DNA obtained by scrapping off the surface of smears, genetic diversity and phylogenetic analysis were performed. The study found that the samples had very low genetic diversity, a temperate genotype, and a high genetic distance, with most of the reference strains coming from endemic countries. We conclude that a small outbreak of imported malaria is not associated with re-emergence of malaria transmission in Oman, as no new cases have been seen since the outbreak ended. PMID:28695821
Interaction entropy for protein-protein binding
NASA Astrophysics Data System (ADS)
Sun, Zhaoxi; Yan, Yu N.; Yang, Maoyou; Zhang, John Z. H.
2017-03-01
Protein-protein interactions are at the heart of signal transduction and are central to the function of protein machine in biology. The highly specific protein-protein binding is quantitatively characterized by the binding free energy whose accurate calculation from the first principle is a grand challenge in computational biology. In this paper, we show how the interaction entropy approach, which was recently proposed for protein-ligand binding free energy calculation, can be applied to computing the entropic contribution to the protein-protein binding free energy. Explicit theoretical derivation of the interaction entropy approach for protein-protein interaction system is given in detail from the basic definition. Extensive computational studies for a dozen realistic protein-protein interaction systems are carried out using the present approach and comparisons of the results for these protein-protein systems with those from the standard normal mode method are presented. Analysis of the present method for application in protein-protein binding as well as the limitation of the method in numerical computation is discussed. Our study and analysis of the results provided useful information for extracting correct entropic contribution in protein-protein binding from molecular dynamics simulations.
Interaction entropy for protein-protein binding.
Sun, Zhaoxi; Yan, Yu N; Yang, Maoyou; Zhang, John Z H
2017-03-28
Protein-protein interactions are at the heart of signal transduction and are central to the function of protein machine in biology. The highly specific protein-protein binding is quantitatively characterized by the binding free energy whose accurate calculation from the first principle is a grand challenge in computational biology. In this paper, we show how the interactionentropy approach, which was recently proposed for protein-ligand binding free energy calculation, can be applied to computing the entropic contribution to the protein-protein binding free energy. Explicit theoretical derivation of the interactionentropy approach for protein-protein interaction system is given in detail from the basic definition. Extensive computational studies for a dozen realistic protein-protein interaction systems are carried out using the present approach and comparisons of the results for these protein-protein systems with those from the standard normal mode method are presented. Analysis of the present method for application in protein-protein binding as well as the limitation of the method in numerical computation is discussed. Our study and analysis of the results provided useful information for extracting correct entropic contribution in protein-protein binding from molecular dynamics simulations.
Abendroth, Jan; Robinson, Howard; Zhang, Yanfeng; Hewitt, Stephen N.; Edwards, Thomas E.; Van Voorhis, Wesley C.; Myler, Peter J.
2013-01-01
Macrophage migration inhibitory factor (MIF) is a eukaryotic cytokine that affects a broad spectrum of immune responses and its activation/inactivation is associated with numerous diseases. During protozoan infections MIF is not only expressed by the host, but, has also been observed to be expressed by some parasites and released into the host. To better understand the biological role of parasitic MIF proteins, the crystal structure of the MIF protein from Giardia lamblia (Gl-MIF), the etiological agent responsible for giardiasis, has been determined at 2.30 Å resolution. The 114-residue protein adopts an α/β fold consisting of a four-stranded β-sheet with two anti-parallel α-helices packed against a face of the β-sheet. An additional short β-strand aligns anti-parallel to β4 of the β-sheet in the adjacent protein unit to help stabilize a trimer, the biologically relevant unit observed in all solved MIF crystal structures to date, and form a discontinuous β-barrel. The structure of Gl-MIF is compared to the MIF structures from humans (Hs-MIF) and three Plasmodium species (falciparum, berghei, and yoelii). The structure of all five MIF proteins are generally similar with the exception of a channel that runs through the center of each trimer complex. Relative to Hs-MIF, there are differences in solvent accessibility and electrostatic potential distribution in the channel of Gl-MIF and the Plasmodium-MIFs due primarily to two “gate-keeper” residues in the parasitic MIFs. For the Plasmodium MIFs the gate-keeper residues are at positions 44 (Y⇒R) and 100 (V⇒D) and for Gl-MIF it is at position 100 (V⇒R). If these gate-keeper residues have a biological function and contribute to the progression of parasitemia they may also form the basis for structure-based drug design targeting parasitic MIF proteins. PMID:23709284
Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian
2017-07-01
In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a
The Clinically Tested Gardos Channel Inhibitor Senicapoc Exhibits Antimalarial Activity
Tubman, Venée N.; Mejia, Pedro; Shmukler, Boris E.; Bei, Amy K.; Alper, Seth L.; Mitchell, James R.
2015-01-01
Senicapoc, a Gardos channel inhibitor, prevented erythrocyte dehydration in clinical trials of patients with sickle cell disease. We tested the hypothesis that senicapoc-induced blockade of the Gardos channel inhibits Plasmodium growth. Senicapoc inhibited in vitro growth of human and primate plasmodia during the clinical blood stage. Senicapoc treatment suppressed P. yoelii parasitemia in vivo in C57BL/6 mice. The reassuring safety and biochemical profile of senicapoc encourage its use in antimalarial development. PMID:26459896
Optimization of protein-protein docking for predicting Fc-protein interactions.
Agostino, Mark; Mancera, Ricardo L; Ramsland, Paul A; Fernández-Recio, Juan
2016-11-01
The antibody crystallizable fragment (Fc) is recognized by effector proteins as part of the immune system. Pathogens produce proteins that bind Fc in order to subvert or evade the immune response. The structural characterization of the determinants of Fc-protein association is essential to improve our understanding of the immune system at the molecular level and to develop new therapeutic agents. Furthermore, Fc-binding peptides and proteins are frequently used to purify therapeutic antibodies. Although several structures of Fc-protein complexes are available, numerous others have not yet been determined. Protein-protein docking could be used to investigate Fc-protein complexes; however, improved approaches are necessary to efficiently model such cases. In this study, a docking-based structural bioinformatics approach is developed for predicting the structures of Fc-protein complexes. Based on the available set of X-ray structures of Fc-protein complexes, three regions of the Fc, loosely corresponding to three turns within the structure, were defined as containing the essential features for protein recognition and used as restraints to filter the initial docking search. Rescoring the filtered poses with an optimal scoring strategy provided a success rate of approximately 80% of the test cases examined within the top ranked 20 poses, compared to approximately 20% by the initial unrestrained docking. The developed docking protocol provides a significant improvement over the initial unrestrained docking and will be valuable for predicting the structures of currently undetermined Fc-protein complexes, as well as in the design of peptides and proteins that target Fc. Copyright © 2016 John Wiley & Sons, Ltd.
Protein-protein interactions: an application of Tus-Ter mediated protein microarray system.
Sitaraman, Kalavathy; Chatterjee, Deb K
2011-01-01
In this chapter, we present a novel, cost-effective microarray strategy that utilizes expression-ready plasmid DNAs to generate protein arrays on-demand and its use to validate protein-protein interactions. These expression plasmids were constructed in such a way so as to serve a dual purpose of synthesizing the protein of interest as well as capturing the synthesized protein. The microarray system is based on the high affinity binding of Escherichia coli "Tus" protein to "Ter," a 20 bp DNA sequence involved in the regulation of DNA replication. The protein expression is carried out in a cell-free protein synthesis system, with rabbit reticulocyte lysates, and the target proteins are detected either by labeled incorporated tag specific or by gene-specific antibodies. This microarray system has been successfully used for the detection of protein-protein interaction because both the target protein and the query protein can be transcribed and translated simultaneously in the microarray slides. The utility of this system for detecting protein-protein interaction is demonstrated by a few well-known examples: Jun/Fos, FRB/FKBP12, p53/MDM2, and CDK4/p16. In all these cases, the presence of protein complexes resulted in the localization of fluorophores at the specific sites of the immobilized target plasmids. Interestingly, during our interactions studies we also detected a previously unknown interaction between CDK2 and p16. Thus, this Tus-Ter based system of protein microarray can be used for the validation of known protein interactions as well as for identifying new protein-protein interactions. In addition, it can be used to examine and identify targets of nucleic acid-protein, ligand-receptor, enzyme-substrate, and drug-protein interactions.
Theoretical studies of protein-protein and protein-DNA binding rates
NASA Astrophysics Data System (ADS)
Alsallaq, Ramzi A.
Proteins are folded chains of amino acids. Some of the amino acids (e.g. Lys, Arg, His, Asp, and Glu) carry charges under physiological conditions. Proteins almost always function through binding to other proteins or ligands, for example barnase is a ribonuclease protein, found in the bacterium Bacillus amyloliquefaceus. Barnase degrades RNA by hydrolysis. For the bacterium to inhibit the potentially lethal action of Barnase within its own cell it co-produces another protein called barstar which binds quickly, and tightly, to barnase. The biological function of this binding is to block the active site of barnase. The speeds (rates) at which proteins associate are vital to many biological processes. They span a wide range (from less than 103 to 108 M-1s-1 ). Rates greater than ˜ 106 M -1s-1 are typically found to be manifestations of enhancements by long-range electrostatic interactions between the associating proteins. A different paradigm appears in the case of protein binding to DNA. The rate in this case is enhanced through attractive surface potential that effectively reduces the dimensionality of the available search space for the diffusing protein. This thesis presents computational and theoretical models on the rate of association of ligands/proteins to other proteins or DNA. For protein-protein association we present a general strategy for computing protein-protein rates of association. The main achievements of this strategy is the ability to obtain a stringent reaction criteria based on the landscape of short-range interactions between the associating proteins, and the ability to compute the effect of the electrostatic interactions on the rates of association accurately using the best known solvers for Poisson-Boltzmann equation presently available. For protein-DNA association we present a mathematical model for proteins targeting specific sites on a circular DNA topology. The main achievements are the realization that a linear DNA with reflecting ends
Electrostatic complementarity at protein/protein interfaces.
McCoy, A J; Chandana Epa, V; Colman, P M
1997-05-02
Calculation of the electrostatic potential of protein-protein complexes has led to the general assertion that protein-protein interfaces display "charge complementarity" and "electrostatic complementarity". In this study, quantitative measures for these two terms are developed and used to investigate protein-protein interfaces in a rigorous manner. Charge complementarity (CC) was defined using the correlation of charges on nearest neighbour atoms at the interface. All 12 protein-protein interfaces studied had insignificantly small CC values. Therefore, the term charge complementarity is not appropriate for the description of protein-protein interfaces when used in the sense measured by CC. Electrostatic complementarity (EC) was defined using the correlation of surface electrostatic potential at protein-protein interfaces. All twelve protein-protein interfaces studied had significant EC values, and thus the assertion that protein-protein association involves surfaces with complementary electrostatic potential was substantially confirmed. The term electrostatic complementarity can therefore be used to describe protein-protein interfaces when used in the sense measured by EC. Taken together, the results for CC and EC demonstrate the relevance of the long-range effects of charges, as described by the electrostatic potential at the binding interface. The EC value did not partition the complexes by type such as antigen-antibody and proteinase-inhibitor, as measures of the geometrical complementarity at protein-protein interfaces have done. The EC value was also not directly related to the number of salt bridges in the interface, and neutralisation of these salt bridges showed that other charges also contributed significantly to electrostatic complementarity and electrostatic interactions between the proteins. Electrostatic complementarity as defined by EC was extended to investigate the electrostatic similarity at the surface of influenza virus neuraminidase where the
Kim, Sanggil; Ko, Wooseok; Sung, Bong Hyun; Kim, Sun Chang; Lee, Hyun Soo
2016-11-15
Proteins often function as complex structures in conjunction with other proteins. Because these complex structures are essential for sophisticated functions, developing protein-protein conjugates has gained research interest. In this study, site-specific protein-protein conjugation was performed by genetically incorporating an azide-containing amino acid into one protein and a bicyclononyne (BCN)-containing amino acid into the other. Three to four sites in each of the proteins were tested for conjugation efficiency, and three combinations showed excellent conjugation efficiency. The genetic incorporation of unnatural amino acids (UAAs) is technically simple and produces the mutant protein in high yield. In addition, the conjugation reaction can be conducted by simple mixing, and does not require additional reagents or linker molecules. Therefore, this method may prove very useful for generating protein-protein conjugates and protein complexes of biochemical significance. Copyright © 2016. Published by Elsevier Ltd.
Hentz, N G; Daunert, S
1996-11-15
An affinity chromatography system is described that incorporates a genetically designed bifunctional affinity ligand. The utility of the system in protein purification and in the study of protein-protein interactions is demonstrated by using the interaction between protein A and the heat shock protein DnaK as a model system. The bifunctional affinity ligand was developed by genetically fusing calmodulin (CaM) to protein A (ProtA). The dual functionality of protein A-calmodulin (ProtA-CaM) stems from the molecular recognition properties of the two components of the fusion protein. In particular, CaM serves as the anchoring component by virtue of its binding properties toward phenothiazine. Thus, the ProtA-CaM can be immobilized on a solid support containing phenothiazine from the C-terminal domain of the fusion protein. Protein A is at the N-terminal domain of the fusion protein and serves as the affinity site for DnaK. While DnaK binds specifically to the protein A domain of the bifunctional ligand, it is released upon addition of ATP and under very mild conditions (pH 7.0). In addition to obtaining highly purified DnaK, this system is very rugged in terms of its performance. The proteinaceous bifunctional affinity ligand can be easily removed by addition of EGTA, and fresh ProtA-CaM can be easily reloaded onto the column. This allows for a facile regeneration of the affinity column because the phenothiazine-silica support matrix is stable for long periods of time under a variety of conditions. This study also demonstrates that calmodulin fusions can provide a new approach to study protein-protein interactions. Indeed, the ProtA-CaM fusion protein identified DnaK as a cellular component that interacts with protein A from among the thousands of proteins present in Escherichia coli.
Blanford, Simon; Read, Andrew F; Thomas, Matthew B
2009-01-01
Background Temperature is a critical determinant of the development of malaria parasites in mosquitoes, and hence the geographic distribution of malaria risk, but little is known about the thermal preferences of Anopheles. A number of other insects modify their thermal behaviour in response to infection. These alterations can be beneficial for the insect or for the infectious agent. Given current interest in developing fungal biopesticides for control of mosquitoes, Anopheles stephensi were examined to test whether mosquitoes showed thermally-mediated behaviour in response to infection with fungal entomopathogens and the rodent malaria, Plasmodium yoelii. Methods Over two experiments, groups of An. stephensi were infected with one of three entomopathogenic fungi, and/or P. yoelii. Infected and uninfected mosquitoes were released on to a thermal gradient (14 – 38°C) for "snapshot" assessments of thermal preference during the first five days post-infection. Mosquito survival was monitored for eight days and, where appropriate, oocyst prevalence and intensity was assessed. Results and conclusion Both infected and uninfected An. stephensi showed a non-random distribution on the gradient, indicating some capacity to behaviourally thermoregulate. However, chosen resting temperatures were not altered by any of the infections. There is thus no evidence that thermally-mediated behaviours play a role in determining malaria prevalence or that they will influence the performance of fungal biopesticides against adult Anopheles. PMID:19379519
Molecular modelling of protein-protein/protein-solvent interactions
NASA Astrophysics Data System (ADS)
Luchko, Tyler
The inner workings of individual cells are based on intricate networks of protein-protein interactions. However, each of these individual protein interactions requires a complex physical interaction between proteins and their aqueous environment at the atomic scale. In this thesis, molecular dynamics simulations are used in three theoretical studies to gain insight at the atomic scale about protein hydration, protein structure and tubulin-tubulin (protein-protein) interactions, as found in microtubules. Also presented, in a fourth project, is a molecular model of solvation coupled with the Amber molecular modelling package, to facilitate further studies without the need of explicitly modelled water. Basic properties of a minimally solvated protein were calculated through an extended study of myoglobin hydration with explicit solvent, directly investigating water and protein polarization. Results indicate a close correlation between polarization of both water and protein and the onset of protein function. The methodology of explicit solvent molecular dynamics was further used to study tubulin and microtubules. Extensive conformational sampling of the carboxy-terminal tails of 8-tubulin was performed via replica exchange molecular dynamics, allowing the characterisation of the flexibility, secondary structure and binding domains of the C-terminal tails through statistical analysis methods. Mechanical properties of tubulin and microtubules were calculated with adaptive biasing force molecular dynamics. The function of the M-loop in microtubule stability was demonstrated in these simulations. The flexibility of this loop allowed constant contacts between the protofilaments to be maintained during simulations while the smooth deformation provided a spring-like restoring force. Additionally, calculating the free energy profile between the straight and bent tubulin configurations was used to test the proposed conformational change in tubulin, thought to cause microtubule
Conformational Heterogeneity of Unbound Proteins Enhances Recognition in Protein-Protein Encounters.
Pallara, Chiara; Rueda, Manuel; Abagyan, Ruben; Fernández-Recio, Juan
2016-07-12
To understand cellular processes at the molecular level we need to improve our knowledge of protein-protein interactions, from a structural, mechanistic, and energetic point of view. Current theoretical studies and computational docking simulations show that protein dynamics plays a key role in protein association and support the need for including protein flexibility in modeling protein interactions. Assuming the conformational selection binding mechanism, in which the unbound state can sample bound conformers, one possible strategy to include flexibility in docking predictions would be the use of conformational ensembles originated from unbound protein structures. Here we present an exhaustive computational study about the use of precomputed unbound ensembles in the context of protein docking, performed on a set of 124 cases of the Protein-Protein Docking Benchmark 3.0. Conformational ensembles were generated by conformational optimization and refinement with MODELLER and by short molecular dynamics trajectories with AMBER. We identified those conformers providing optimal binding and investigated the role of protein conformational heterogeneity in protein-protein recognition. Our results show that a restricted conformational refinement can generate conformers with better binding properties and improve docking encounters in medium-flexible cases. For more flexible cases, a more extended conformational sampling based on Normal Mode Analysis was proven helpful. We found that successful conformers provide better energetic complementarity to the docking partners, which is compatible with recent views of binding association. In addition to the mechanistic considerations, these findings could be exploited for practical docking predictions of improved efficiency.
Sugiarto; Kesumawati Hadi, Upik; Soviana, Susi; Hakim, Lukman
2016-11-01
Anopheles mosquitoes may be incriminated as malaria vectors by observing sporozoites in their salivary glands and by testing heads or thoraces by an enzyme-linked immunosorbent assay (ELISA) to detect Plasmodium species-specific circumsporozoite proteins (CSP). This study tested Anopheles collected in Sungai Nyamuk Village for the presence of both Plasmodium falciparum and Plasmodium vivax CSP. The Anopheles spp. were collected by human landing collection indoors and outdoors and by indoor and outdoor resting catches in Sungai Nyamuk Village, Nunukan District, North Kalimantan Province from August 2010 to January 2012. Overall, 5,100 Anopheles spp. comprising 11 species were collected and 2,259 adult parous females were tested by ELISA. Of these, only one Anopheles peditaeniatus Leicester (3.8%, n = 26) and one Anopheles sundaicus sensu lato (0.6%, n = 157) that originated from outdoor biting catches tested positive for P. falciparum CSP. The remaining females from indoor biting, outdoor resting, and indoor resting catches were negative for P. falciparum and P. vivax proteins. Confirmation of these vectors biting outdoors indicated that P. falciparum transmission may be occurring outside of houses by An. peditaeniatus and An. sundaicus. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Protein- protein interaction detection system using fluorescent protein microdomains
Waldo, Geoffrey S.; Cabantous, Stephanie
2010-02-23
The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.
Peng, Wei; Wang, Jianxin; Cheng, Yingjiao; Lu, Yu; Wu, Fangxiang; Pan, Yi
2015-01-01
Prediction of essential proteins which are crucial to an organism's survival is important for disease analysis and drug design, as well as the understanding of cellular life. The majority of prediction methods infer the possibility of proteins to be essential by using the network topology. However, these methods are limited to the completeness of available protein-protein interaction (PPI) data and depend on the network accuracy. To overcome these limitations, some computational methods have been proposed. However, seldom of them solve this problem by taking consideration of protein domains. In this work, we first analyze the correlation between the essentiality of proteins and their domain features based on data of 13 species. We find that the proteins containing more protein domain types which rarely occur in other proteins tend to be essential. Accordingly, we propose a new prediction method, named UDoNC, by combining the domain features of proteins with their topological properties in PPI network. In UDoNC, the essentiality of proteins is decided by the number and the frequency of their protein domain types, as well as the essentiality of their adjacent edges measured by edge clustering coefficient. The experimental results on S. cerevisiae data show that UDoNC outperforms other existing methods in terms of area under the curve (AUC). Additionally, UDoNC can also perform well in predicting essential proteins on data of E. coli.
Identification of Protein-Protein Interactions with Glutathione-S-Transferase (GST) Fusion Proteins.
Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R
2007-08-01
INTRODUCTIONGlutathione-S-transferase (GST) fusion proteins have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis. This article describes the use of GST fusion proteins as probes for the identification of protein-protein interactions.
Protein-protein interaction network-based detection of functionally similar proteins within species.
Song, Baoxing; Wang, Fen; Guo, Yang; Sang, Qing; Liu, Min; Li, Dengyun; Fang, Wei; Zhang, Deli
2012-07-01
Although functionally similar proteins across species have been widely studied, functionally similar proteins within species showing low sequence similarity have not been examined in detail. Identification of these proteins is of significant importance for understanding biological functions, evolution of protein families, progression of co-evolution, and convergent evolution and others which cannot be obtained by detection of functionally similar proteins across species. Here, we explored a method of detecting functionally similar proteins within species based on graph theory. After denoting protein-protein interaction networks using graphs, we split the graphs into subgraphs using the 1-hop method. Proteins with functional similarities in a species were detected using a method of modified shortest path to compare these subgraphs and to find the eligible optimal results. Using seven protein-protein interaction networks and this method, some functionally similar proteins with low sequence similarity that cannot detected by sequence alignment were identified. By analyzing the results, we found that, sometimes, it is difficult to separate homologous from convergent evolution. Evaluation of the performance of our method by gene ontology term overlap showed that the precision of our method was excellent. Copyright © 2012 Wiley Periodicals, Inc.
Protein-Protein Docking in Drug Design and Discovery.
Kaczor, Agnieszka A; Bartuzi, Damian; Stępniewski, Tomasz Maciej; Matosiuk, Dariusz; Selent, Jana
2018-01-01
Protein-protein interactions (PPIs) are responsible for a number of key physiological processes in the living cells and underlie the pathomechanism of many diseases. Nowadays, along with the concept of so-called "hot spots" in protein-protein interactions, which are well-defined interface regions responsible for most of the binding energy, these interfaces can be targeted with modulators. In order to apply structure-based design techniques to design PPIs modulators, a three-dimensional structure of protein complex has to be available. In this context in silico approaches, in particular protein-protein docking, are a valuable complement to experimental methods for elucidating 3D structure of protein complexes. Protein-protein docking is easy to use and does not require significant computer resources and time (in contrast to molecular dynamics) and it results in 3D structure of a protein complex (in contrast to sequence-based methods of predicting binding interfaces). However, protein-protein docking cannot address all the aspects of protein dynamics, in particular the global conformational changes during protein complex formation. In spite of this fact, protein-protein docking is widely used to model complexes of water-soluble proteins and less commonly to predict structures of transmembrane protein assemblies, including dimers and oligomers of G protein-coupled receptors (GPCRs). In this chapter we review the principles of protein-protein docking, available algorithms and software and discuss the recent examples, benefits, and drawbacks of protein-protein docking application to water-soluble proteins, membrane anchoring and transmembrane proteins, including GPCRs.
Genome-wide protein-protein interactions and protein function exploration in cyanobacteria
Lv, Qi; Ma, Weimin; Liu, Hui; Li, Jiang; Wang, Huan; Lu, Fang; Zhao, Chen; Shi, Tieliu
2015-01-01
Genome-wide network analysis is well implemented to study proteins of unknown function. Here, we effectively explored protein functions and the biological mechanism based on inferred high confident protein-protein interaction (PPI) network in cyanobacteria. We integrated data from seven different sources and predicted 1,997 PPIs, which were evaluated by experiments in molecular mechanism, text mining of literatures in proved direct/indirect evidences, and “interologs” in conservation. Combined the predicted PPIs with known PPIs, we obtained 4,715 no-redundant PPIs (involving 3,231 proteins covering over 90% of genome) to generate the PPI network. Based on the PPI network, terms in Gene ontology (GO) were assigned to function-unknown proteins. Functional modules were identified by dissecting the PPI network into sub-networks and analyzing pathway enrichment, with which we investigated novel function of underlying proteins in protein complexes and pathways. Examples of photosynthesis and DNA repair indicate that the network approach is a powerful tool in protein function analysis. Overall, this systems biology approach provides a new insight into posterior functional analysis of PPIs in cyanobacteria. PMID:26490033
Ayisi, J G; Branch, OraLee H; Rafi-Janajreh, A; van Eijk, A M; ter Kuile, F O; Rosen, D H; Kager, P A; Lanar, D E; Barbosa, A; Kaslow, D; Nahlen, B L; Lal, A A
2003-04-01
HIV-seropositive pregnant women are more susceptible to malaria than HIV-seronegative women. We assessed whether HIV infection alters maternal and cord plasma malarial antibody responses and the mother-to-infant transfer of malaria antibodies. We determined plasma levels of maternal and cord antibodies [Immunoglobulin (IgG)] to recombinant malarial proteins [merozoite surface protein 1 (MSP-1(19kD)), the erythrocyte binding antigen (EBA-175)], the synthetic peptides [MSP-2, MSP-3, rhoptry associated protein 1 (RAP-1), and the pre-erythrocytic stage, circumsporozoite protein (NANP)(5)] antigenic determinants of Plasmodium falciparum; and tetanus toxoid (TT) by ELISA among samples of 99 HIV-seropositive mothers, 69 of their infants, 102 HIV-seronegative mothers and 62 of their infants. The prevalence of maternal antibodies to the malarial antigenic determinants ranged from 18% on MSP3 to 91% on EBA-175; in cord plasma it ranged from 13% to 91%, respectively. More than 97% of maternal and cord samples had antibodies to TT. In multivariate analysis, HIV infection was only associated with reduced antibodies to (NANP)(5) in maternal (P=0.001) and cord plasma (P=0.001); and reduced mother-to-infant antibody transfer to (NANP)(5) (P=0.012). This effect of HIV was independent of maternal age, gravidity and placental malaria. No consistent HIV-associated differences were observed for other antigenic determinants. An effect of HIV infection was only observed on one malarial antigenic determinant, suggesting that the increased susceptibility to malaria among HIV-infected pregnant women may not be explained on the basis of their reduced antibody response to malaria antigens.
Protein function prediction using neighbor relativity in protein-protein interaction network.
Moosavi, Sobhan; Rahgozar, Masoud; Rahimi, Amir
2013-04-01
There is a large gap between the number of discovered proteins and the number of functionally annotated ones. Due to the high cost of determining protein function by wet-lab research, function prediction has become a major task for computational biology and bioinformatics. Some researches utilize the proteins interaction information to predict function for un-annotated proteins. In this paper, we propose a novel approach called "Neighbor Relativity Coefficient" (NRC) based on interaction network topology which estimates the functional similarity between two proteins. NRC is calculated for each pair of proteins based on their graph-based features including distance, common neighbors and the number of paths between them. In order to ascribe function to an un-annotated protein, NRC estimates a weight for each neighbor to transfer its annotation to the unknown protein. Finally, the unknown protein will be annotated by the top score transferred functions. We also investigate the effect of using different coefficients for various types of functions. The proposed method has been evaluated on Saccharomyces cerevisiae and Homo sapiens interaction networks. The performance analysis demonstrates that NRC yields better results in comparison with previous protein function prediction approaches that utilize interaction network. Copyright © 2012 Elsevier Ltd. All rights reserved.
Protein Structure Prediction by Protein Threading
NASA Astrophysics Data System (ADS)
Xu, Ying; Liu, Zhijie; Cai, Liming; Xu, Dong
The seminal work of Bowie, Lüthy, and Eisenberg (Bowie et al., 1991) on "the inverse protein folding problem" laid the foundation of protein structure prediction by protein threading. By using simple measures for fitness of different amino acid types to local structural environments defined in terms of solvent accessibility and protein secondary structure, the authors derived a simple and yet profoundly novel approach to assessing if a protein sequence fits well with a given protein structural fold. Their follow-up work (Elofsson et al., 1996; Fischer and Eisenberg, 1996; Fischer et al., 1996a,b) and the work by Jones, Taylor, and Thornton (Jones et al., 1992) on protein fold recognition led to the development of a new brand of powerful tools for protein structure prediction, which we now term "protein threading." These computational tools have played a key role in extending the utility of all the experimentally solved structures by X-ray crystallography and nuclear magnetic resonance (NMR), providing structural models and functional predictions for many of the proteins encoded in the hundreds of genomes that have been sequenced up to now.
Predicting protein-protein interactions from protein domains using a set cover approach.
Huang, Chengbang; Morcos, Faruck; Kanaan, Simon P; Wuchty, Stefan; Chen, Danny Z; Izaguirre, Jesús A
2007-01-01
One goal of contemporary proteome research is the elucidation of cellular protein interactions. Based on currently available protein-protein interaction and domain data, we introduce a novel method, Maximum Specificity Set Cover (MSSC), for the prediction of protein-protein interactions. In our approach, we map the relationship between interactions of proteins and their corresponding domain architectures to a generalized weighted set cover problem. The application of a greedy algorithm provides sets of domain interactions which explain the presence of protein interactions to the largest degree of specificity. Utilizing domain and protein interaction data of S. cerevisiae, MSSC enables prediction of previously unknown protein interactions, links that are well supported by a high tendency of coexpression and functional homogeneity of the corresponding proteins. Focusing on concrete examples, we show that MSSC reliably predicts protein interactions in well-studied molecular systems, such as the 26S proteasome and RNA polymerase II of S. cerevisiae. We also show that the quality of the predictions is comparable to the Maximum Likelihood Estimation while MSSC is faster. This new algorithm and all data sets used are accessible through a Web portal at http://ppi.cse.nd.edu.
Do cancer proteins really interact strongly in the human protein-protein interaction network?
Xia, Junfeng; Sun, Jingchun; Jia, Peilin; Zhao, Zhongming
2011-01-01
Protein-protein interaction (PPI) network analysis has been widely applied in the investigation of the mechanisms of diseases, especially cancer. Recent studies revealed that cancer proteins tend to interact more strongly than other categories of proteins, even essential proteins, in the human interactome. However, it remains unclear whether this observation was introduced by the bias towards more cancer studies in humans. Here, we examined this important issue by uniquely comparing network characteristics of cancer proteins with three other sets of proteins in four organisms, three of which (fly, worm, and yeast) whose interactomes are essentially not biased towards cancer or other diseases. We confirmed that cancer proteins had stronger connectivity, shorter distance, and larger betweenness centrality than non-cancer disease proteins, essential proteins, and control proteins. Our statistical evaluation indicated that such observations were overall unlikely attributed to random events. Considering the large size and high quality of the PPI data in the four organisms, the conclusion that cancer proteins interact strongly in the PPI networks is reliable and robust. This conclusion suggests that perturbation of cancer proteins might cause major changes of cellular systems and result in abnormal cell function leading to cancer. PMID:21666777
Detection of protein complex from protein-protein interaction network using Markov clustering
NASA Astrophysics Data System (ADS)
Ochieng, P. J.; Kusuma, W. A.; Haryanto, T.
2017-05-01
Detection of complexes, or groups of functionally related proteins, is an important challenge while analysing biological networks. However, existing algorithms to identify protein complexes are insufficient when applied to dense networks of experimentally derived interaction data. Therefore, we introduced a graph clustering method based on Markov clustering algorithm to identify protein complex within highly interconnected protein-protein interaction networks. Protein-protein interaction network was first constructed to develop geometrical network, the network was then partitioned using Markov clustering to detect protein complexes. The interest of the proposed method was illustrated by its application to Human Proteins associated to type II diabetes mellitus. Flow simulation of MCL algorithm was initially performed and topological properties of the resultant network were analysed for detection of the protein complex. The results indicated the proposed method successfully detect an overall of 34 complexes with 11 complexes consisting of overlapping modules and 20 non-overlapping modules. The major complex consisted of 102 proteins and 521 interactions with cluster modularity and density of 0.745 and 0.101 respectively. The comparison analysis revealed MCL out perform AP, MCODE and SCPS algorithms with high clustering coefficient (0.751) network density and modularity index (0.630). This demonstrated MCL was the most reliable and efficient graph clustering algorithm for detection of protein complexes from PPI networks.
Wei, Yang; Thyparambil, Aby A.; Latour, Robert A.
2013-01-01
While protein-surface interactions have been widely studied, relatively little is understood at this time regarding how protein-surface interaction effects are influenced by protein-protein interactions and how these effects combine with the internal stability of a protein to influence its adsorbed-state structure and bioactivity. The objectives of this study were to develop a method to study these combined effects under widely varying protein-protein interaction conditions using hen egg-white lysozyme (HEWL) adsorbed on silica glass, poly(methyl methacrylate), and polyethylene as our model systems. In order to vary protein-protein interaction effects over a wide range, HEWL was first adsorbed to each surface type under widely varying protein solution concentrations for 2 h to saturate the surface, followed by immersion in pure buffer solution for 15 h to equilibrate the adsorbed protein layers in the absence of additionally adsorbing protein. Periodic measurements were made at selected time points of the areal density of the adsorbed protein layer as an indicator of the level of protein-protein interaction effects within the layer, and these values were then correlated with measurements of the adsorbed protein’s secondary structure and bioactivity. The results from these studies indicate that protein-protein interaction effects help stabilize the structure of HEWL adsorbed on silica glass, have little influence on the structural behavior of HEWL on HDPE, and actually serve to destabilize HEWL’s structure on PMMA. The bioactivity of HEWL on silica glass and HDPE was found to decrease in direct proportion to the degree of adsorption-induce protein unfolding. A direct correlation between bioactivity and the conformational state of adsorbed HEWL was less apparent on PMMA, thus suggesting that other factors influenced HEWL’s bioactivity on this surface, such as the accessibility of HEWL’s bioactive site being blocked by neighboring proteins or the surface
Do cancer proteins really interact strongly in the human protein-protein interaction network?
Xia, Junfeng; Sun, Jingchun; Jia, Peilin; Zhao, Zhongming
2011-06-01
Protein-protein interaction (PPI) network analysis has been widely applied in the investigation of the mechanisms of diseases, especially cancer. Recent studies revealed that cancer proteins tend to interact more strongly than other categories of proteins, even essential proteins, in the human interactome. However, it remains unclear whether this observation was introduced by the bias towards more cancer studies in humans. Here, we examined this important issue by uniquely comparing network characteristics of cancer proteins with three other sets of proteins in four organisms, three of which (fly, worm, and yeast) whose interactomes are essentially not biased towards cancer or other diseases. We confirmed that cancer proteins had stronger connectivity, shorter distance, and larger betweenness centrality than non-cancer disease proteins, essential proteins, and control proteins. Our statistical evaluation indicated that such observations were overall unlikely attributed to random events. Considering the large size and high quality of the PPI data in the four organisms, the conclusion that cancer proteins interact strongly in the PPI networks is reliable and robust. This conclusion suggests that perturbation of cancer proteins might cause major changes of cellular systems and result in abnormal cell function leading to cancer. © 2011 Elsevier Ltd. All rights reserved.
Quantifying protein-protein interactions in high throughput using protein domain microarrays.
Kaushansky, Alexis; Allen, John E; Gordus, Andrew; Stiffler, Michael A; Karp, Ethan S; Chang, Bryan H; MacBeath, Gavin
2010-04-01
Protein microarrays provide an efficient way to identify and quantify protein-protein interactions in high throughput. One drawback of this technique is that proteins show a broad range of physicochemical properties and are often difficult to produce recombinantly. To circumvent these problems, we have focused on families of protein interaction domains. Here we provide protocols for constructing microarrays of protein interaction domains in individual wells of 96-well microtiter plates, and for quantifying domain-peptide interactions in high throughput using fluorescently labeled synthetic peptides. As specific examples, we will describe the construction of microarrays of virtually every human Src homology 2 (SH2) and phosphotyrosine binding (PTB) domain, as well as microarrays of mouse PDZ domains, all produced recombinantly in Escherichia coli. For domains that mediate high-affinity interactions, such as SH2 and PTB domains, equilibrium dissociation constants (K(D)s) for their peptide ligands can be measured directly on arrays by obtaining saturation binding curves. For weaker binding domains, such as PDZ domains, arrays are best used to identify candidate interactions, which are then retested and quantified by fluorescence polarization. Overall, protein domain microarrays provide the ability to rapidly identify and quantify protein-ligand interactions with minimal sample consumption. Because entire domain families can be interrogated simultaneously, they provide a powerful way to assess binding selectivity on a proteome-wide scale and provide an unbiased perspective on the connectivity of protein-protein interaction networks.
Assessment of the reliability of protein-protein interactions and protein function prediction.
Deng, Minghua; Sun, Fengzhu; Chen, Ting
2003-01-01
As more and more high-throughput protein-protein interaction data are collected, the task of estimating the reliability of different data sets becomes increasingly important. In this paper, we present our study of two groups of protein-protein interaction data, the physical interaction data and the protein complex data, and estimate the reliability of these data sets using three different measurements: (1) the distribution of gene expression correlation coefficients, (2) the reliability based on gene expression correlation coefficients, and (3) the accuracy of protein function predictions. We develop a maximum likelihood method to estimate the reliability of protein interaction data sets according to the distribution of correlation coefficients of gene expression profiles of putative interacting protein pairs. The results of the three measurements are consistent with each other. The MIPS protein complex data have the highest mean gene expression correlation coefficients (0.256) and the highest accuracy in predicting protein functions (70% sensitivity and specificity), while Ito's Yeast two-hybrid data have the lowest mean (0.041) and the lowest accuracy (15% sensitivity and specificity). Uetz's data are more reliable than Ito's data in all three measurements, and the TAP protein complex data are more reliable than the HMS-PCI data in all three measurements as well. The complex data sets generally perform better in function predictions than do the physical interaction data sets. Proteins in complexes are shown to be more highly correlated in gene expression. The results confirm that the components of a protein complex can be assigned to functions that the complex carries out within a cell. There are three interaction data sets different from the above two groups: the genetic interaction data, the in-silico data and the syn-express data. Their capability of predicting protein functions generally falls between that of the Y2H data and that of the MIPS protein complex
Dos Santos Vasconcelos, Crhisllane Rafaele; de Lima Campos, Túlio; Rezende, Antonio Mauro
2018-03-06
Systematic analysis of a parasite interactome is a key approach to understand different biological processes. It makes possible to elucidate disease mechanisms, to predict protein functions and to select promising targets for drug development. Currently, several approaches for protein interaction prediction for non-model species incorporate only small fractions of the entire proteomes and their interactions. Based on this perspective, this study presents an integration of computational methodologies, protein network predictions and comparative analysis of the protozoan species Leishmania braziliensis and Leishmania infantum. These parasites cause Leishmaniasis, a worldwide distributed and neglected disease, with limited treatment options using currently available drugs. The predicted interactions were obtained from a meta-approach, applying rigid body docking tests and template-based docking on protein structures predicted by different comparative modeling techniques. In addition, we trained a machine-learning algorithm (Gradient Boosting) using docking information performed on a curated set of positive and negative protein interaction data. Our final model obtained an AUC = 0.88, with recall = 0.69, specificity = 0.88 and precision = 0.83. Using this approach, it was possible to confidently predict 681 protein structures and 6198 protein interactions for L. braziliensis, and 708 protein structures and 7391 protein interactions for L. infantum. The predicted networks were integrated to protein interaction data already available, analyzed using several topological features and used to classify proteins as essential for network stability. The present study allowed to demonstrate the importance of integrating different methodologies of interaction prediction to increase the coverage of the protein interaction of the studied protocols, besides it made available protein structures and interactions not previously reported.
Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.
He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J
2009-12-31
We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.
PREFACE: Protein protein interactions: principles and predictions
NASA Astrophysics Data System (ADS)
Nussinov, Ruth; Tsai, Chung-Jung
2005-06-01
Proteins are the `workhorses' of the cell. Their roles span functions as diverse as being molecular machines and signalling. They carry out catalytic reactions, transport, form viral capsids, traverse membranes and form regulated channels, transmit information from DNA to RNA, making possible the synthesis of new proteins, and they are responsible for the degradation of unnecessary proteins and nucleic acids. They are the vehicles of the immune response and are responsible for viral entry into the cell. Given their importance, considerable effort has been centered on the prediction of protein function. A prime way to do this is through identification of binding partners. If the function of at least one of the components with which the protein interacts is known, that should let us assign its function(s) and the pathway(s) in which it plays a role. This holds since the vast majority of their chores in the living cell involve protein-protein interactions. Hence, through the intricate network of these interactions we can map cellular pathways, their interconnectivities and their dynamic regulation. Their identification is at the heart of functional genomics; their prediction is crucial for drug discovery. Knowledge of the pathway, its topology, length, and dynamics may provide useful information for forecasting side effects. The goal of predicting protein-protein interactions is daunting. Some associations are obligatory, others are continuously forming and dissociating. In principle, from the physical standpoint, any two proteins can interact, but under what conditions and at which strength? The principles of protein-protein interactions are general: the non-covalent interactions of two proteins are largely the outcome of the hydrophobic effect, which drives the interactions. In addition, hydrogen bonds and electrostatic interactions play important roles. Thus, many of the interactions observed in vitro are the outcome of experimental overexpression. Protein disorder
Yang, Ming; Ge, Yan; Wu, Jiayan; Xiao, Jingfa; Yu, Jun
2011-05-20
Coevolution can be seen as the interdependency between evolutionary histories. In the context of protein evolution, functional correlation proteins are ever-present coordinated evolutionary characters without disruption of organismal integrity. As to complex system, there are two forms of protein--protein interactions in vivo, which refer to inter-complex interaction and intra-complex interaction. In this paper, we studied the difference of coevolution characters between inter-complex interaction and intra-complex interaction using "Mirror tree" method on the respiratory chain (RC) proteins. We divided the correlation coefficients of every pairwise RC proteins into two groups corresponding to the binary protein--protein interaction in intra-complex and the binary protein--protein interaction in inter-complex, respectively. A dramatical discrepancy is detected between the coevolution characters of the two sets of protein interactions (Wilcoxon test, p-value = 4.4 × 10(-6)). Our finding reveals some critical information on coevolutionary study and assists the mechanical investigation of protein--protein interaction. Furthermore, the results also provide some unique clue for supramolecular organization of protein complexes in the mitochondrial inner membrane. More detailed binding sites map and genome information of nuclear encoded RC proteins will be extraordinary valuable for the further mitochondria dynamics study. Copyright © 2011. Published by Elsevier Ltd.
The Clinically Tested Gardos Channel Inhibitor Senicapoc Exhibits Antimalarial Activity.
Tubman, Venée N; Mejia, Pedro; Shmukler, Boris E; Bei, Amy K; Alper, Seth L; Mitchell, James R; Brugnara, Carlo; Duraisingh, Manoj T
2016-01-01
Senicapoc, a Gardos channel inhibitor, prevented erythrocyte dehydration in clinical trials of patients with sickle cell disease. We tested the hypothesis that senicapoc-induced blockade of the Gardos channel inhibits Plasmodium growth. Senicapoc inhibited in vitro growth of human and primate plasmodia during the clinical blood stage. Senicapoc treatment suppressed P. yoelii parasitemia in vivo in C57BL/6 mice. The reassuring safety and biochemical profile of senicapoc encourage its use in antimalarial development. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Protein complex prediction in large ontology attributed protein-protein interaction networks.
Zhang, Yijia; Lin, Hongfei; Yang, Zhihao; Wang, Jian; Li, Yanpeng; Xu, Bo
2013-01-01
Protein complexes are important for unraveling the secrets of cellular organization and function. Many computational approaches have been developed to predict protein complexes in protein-protein interaction (PPI) networks. However, most existing approaches focus mainly on the topological structure of PPI networks, and largely ignore the gene ontology (GO) annotation information. In this paper, we constructed ontology attributed PPI networks with PPI data and GO resource. After constructing ontology attributed networks, we proposed a novel approach called CSO (clustering based on network structure and ontology attribute similarity). Structural information and GO attribute information are complementary in ontology attributed networks. CSO can effectively take advantage of the correlation between frequent GO annotation sets and the dense subgraph for protein complex prediction. Our proposed CSO approach was applied to four different yeast PPI data sets and predicted many well-known protein complexes. The experimental results showed that CSO was valuable in predicting protein complexes and achieved state-of-the-art performance.
Gong, Wei; He, Kun; Covington, Mike; Dinesh-Kumar, S. P.; Snyder, Michael; Harmer, Stacey L.; Zhu, Yu-Xian; Deng, Xing Wang
2009-01-01
We used our collection of Arabidopsis transcription factor (TF) ORFeome clones to construct protein microarrays containing as many as 802 TF proteins. These protein microarrays were used for both protein-DNA and protein-protein interaction analyses. For protein-DNA interaction studies, we examined AP2/ERF family TFs and their cognate cis-elements. By careful comparison of the DNA-binding specificity of 13 TFs on the protein microarray with previous non-microarray data, we showed that protein microarrays provide an efficient and high throughput tool for genome-wide analysis of TF-DNA interactions. This microarray protein-DNA interaction analysis allowed us to derive a comprehensive view of DNA-binding profiles of AP2/ERF family proteins in Arabidopsis. It also revealed four TFs that bound the EE (evening element) and had the expected phased gene expression under clock-regulation, thus providing a basis for further functional analysis of their roles in clock regulation of gene expression. We also developed procedures for detecting protein interactions using this TF protein microarray and discovered four novel partners that interact with HY5, which can be validated by yeast two-hybrid assays. Thus, plant TF protein microarrays offer an attractive high-throughput alternative to traditional techniques for TF functional characterization on a global scale. PMID:19802365
C-Myc Protein-Protein and Protein-DNA Interactions: Targets for Therapeutic Intervention.
1997-09-01
including those of the Myc family. In fact, members of different bHLH protein subgroups, including the Myc proteins, are characterized by conserved BR...important functional consequences, and they provide insights into how different bHLH proteins can act on different targets. The zinc finger protein...roles for a number of BR residues which do not contact bases, yet are conserved within different bHLH protein sub- families (Benezra et al. 1990), and
Protein Solubility and Protein Homeostasis: A Generic View of Protein Misfolding Disorders
Vendruscolo, Michele; Knowles, Tuomas P.J.; Dobson, Christopher M.
2011-01-01
According to the “generic view” of protein aggregation, the ability to self-assemble into stable and highly organized structures such as amyloid fibrils is not an unusual feature exhibited by a small group of peptides and proteins with special sequence or structural properties, but rather a property shared by most proteins. At the same time, through a wide variety of techniques, many of which were originally devised for applications in other disciplines, it has also been established that the maintenance of proteins in a soluble state is a fundamental aspect of protein homeostasis. Taken together, these advances offer a unified framework for understanding the molecular basis of protein aggregation and for the rational development of therapeutic strategies based on the biological and chemical regulation of protein solubility. PMID:21825020
Predicting disease-related proteins based on clique backbone in protein-protein interaction network.
Yang, Lei; Zhao, Xudong; Tang, Xianglong
2014-01-01
Network biology integrates different kinds of data, including physical or functional networks and disease gene sets, to interpret human disease. A clique (maximal complete subgraph) in a protein-protein interaction network is a topological module and possesses inherently biological significance. A disease-related clique possibly associates with complex diseases. Fully identifying disease components in a clique is conductive to uncovering disease mechanisms. This paper proposes an approach of predicting disease proteins based on cliques in a protein-protein interaction network. To tolerate false positive and negative interactions in protein networks, extending cliques and scoring predicted disease proteins with gene ontology terms are introduced to the clique-based method. Precisions of predicted disease proteins are verified by disease phenotypes and steadily keep to more than 95%. The predicted disease proteins associated with cliques can partly complement mapping between genotype and phenotype, and provide clues for understanding the pathogenesis of serious diseases.
Regulation of protein turnover by heat shock proteins.
Bozaykut, Perinur; Ozer, Nesrin Kartal; Karademir, Betul
2014-12-01
Protein turnover reflects the balance between synthesis and degradation of proteins, and it is a crucial process for the maintenance of the cellular protein pool. The folding of proteins, refolding of misfolded proteins, and also degradation of misfolded and damaged proteins are involved in the protein quality control (PQC) system. Correct protein folding and degradation are controlled by many different factors, one of the most important of which is the heat shock protein family. Heat shock proteins (HSPs) are in the class of molecular chaperones, which may prevent the inappropriate interaction of proteins and induce correct folding. On the other hand, these proteins play significant roles in the degradation pathways, including endoplasmic reticulum-associated degradation (ERAD), the ubiquitin-proteasome system, and autophagy. This review focuses on the emerging role of HSPs in the regulation of protein turnover; the effects of HSPs on the degradation machineries ERAD, autophagy, and proteasome; as well as the role of posttranslational modifications in the PQC system. Copyright © 2014 Elsevier Inc. All rights reserved.
Principles of Protein Recognition and Properties of Protein-protein Interfaces
NASA Astrophysics Data System (ADS)
Keskin, Ozlem; Gursoy, Attila; Nussinov, Ruth
In this chapter we address two aspects - the static physical interactions which allow the information transfer for the function to be performed; and the dynamic, i.e. how the information is transmitted between the binding sites in the single protein molecule and in the network. We describe the single protein molecules and their complexes; and the analogy between protein folding and protein binding. Eventually, to fully understand the interactome and how it performs the essential cellular functions, we have to put all together - and hierarchically progress through the system.
Proteins interacting with cloning scars: a source of false positive protein-protein interactions.
Banks, Charles A S; Boanca, Gina; Lee, Zachary T; Florens, Laurence; Washburn, Michael P
2015-02-23
A common approach for exploring the interactome, the network of protein-protein interactions in cells, uses a commercially available ORF library to express affinity tagged bait proteins; these can be expressed in cells and endogenous cellular proteins that copurify with the bait can be identified as putative interacting proteins using mass spectrometry. Control experiments can be used to limit false-positive results, but in many cases, there are still a surprising number of prey proteins that appear to copurify specifically with the bait. Here, we have identified one source of false-positive interactions in such studies. We have found that a combination of: 1) the variable sequence of the C-terminus of the bait with 2) a C-terminal valine "cloning scar" present in a commercially available ORF library, can in some cases create a peptide motif that results in the aberrant co-purification of endogenous cellular proteins. Control experiments may not identify false positives resulting from such artificial motifs, as aberrant binding depends on sequences that vary from one bait to another. It is possible that such cryptic protein binding might occur in other systems using affinity tagged proteins; this study highlights the importance of conducting careful follow-up studies where novel protein-protein interactions are suspected.
Proteins interacting with cloning scars: a source of false positive protein-protein interactions
Banks, Charles A. S.; Boanca, Gina; Lee, Zachary T.; Florens, Laurence; Washburn, Michael P.
2015-01-01
A common approach for exploring the interactome, the network of protein-protein interactions in cells, uses a commercially available ORF library to express affinity tagged bait proteins; these can be expressed in cells and endogenous cellular proteins that copurify with the bait can be identified as putative interacting proteins using mass spectrometry. Control experiments can be used to limit false-positive results, but in many cases, there are still a surprising number of prey proteins that appear to copurify specifically with the bait. Here, we have identified one source of false-positive interactions in such studies. We have found that a combination of: 1) the variable sequence of the C-terminus of the bait with 2) a C-terminal valine “cloning scar” present in a commercially available ORF library, can in some cases create a peptide motif that results in the aberrant co-purification of endogenous cellular proteins. Control experiments may not identify false positives resulting from such artificial motifs, as aberrant binding depends on sequences that vary from one bait to another. It is possible that such cryptic protein binding might occur in other systems using affinity tagged proteins; this study highlights the importance of conducting careful follow-up studies where novel protein-protein interactions are suspected. PMID:25704442
Predicting permanent and transient protein-protein interfaces.
La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke
2013-05-01
Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.
Human IgG repertoire of malaria antigen-immunized human immune system (HIS) mice.
Nogueira, Raquel Tayar; Sahi, Vincent; Huang, Jing; Tsuji, Moriya
2017-08-01
Humanized mouse models present an important tool for preclinical evaluation of new vaccines and therapeutics. Here we show the human variable repertoire of antibody sequences cloned from a previously described human immune system (HIS) mouse model that possesses functional human CD4+ T cells and B cells, namely HIS-CD4/B mice. We sequenced variable IgG genes from single memory B-cell and plasma-cell sorted from splenocytes or whole blood lymphocytes of HIS-CD4/B mice that were vaccinated with a human plasmodial antigen, a recombinant Plasmodium falciparum circumsporozoite protein (rPfCSP). We demonstrate that rPfCSP immunization triggers a diverse B-cell IgG repertoire composed of various human VH family genes and distinct V(D)J recombinations that constitute diverse CDR3 sequences similar to humans, although low hypermutated sequences were generated. These results demonstrate the substantial genetic diversity of responding human B cells of HIS-CD4/B mice and their capacity to mount human IgG class-switched antibody response upon vaccination. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
Molecular simulations of lipid-mediated protein-protein interactions.
de Meyer, Frédérick Jean-Marie; Venturoli, Maddalena; Smit, Berend
2008-08-01
Recent experimental results revealed that lipid-mediated interactions due to hydrophobic forces may be important in determining the protein topology after insertion in the membrane, in regulating the protein activity, in protein aggregation and in signal transduction. To gain insight into the lipid-mediated interactions between two intrinsic membrane proteins, we developed a mesoscopic model of a lipid bilayer with embedded proteins, which we studied with dissipative particle dynamics. Our calculations of the potential of mean force between transmembrane proteins show that hydrophobic forces drive long-range protein-protein interactions and that the nature of these interactions depends on the length of the protein hydrophobic segment, on the three-dimensional structure of the protein and on the properties of the lipid bilayer. To understand the nature of the computed potentials of mean force, the concept of hydrophilic shielding is introduced. The observed protein interactions are interpreted as resulting from the dynamic reorganization of the system to maintain an optimal hydrophilic shielding of the protein and lipid hydrophobic parts, within the constraint of the flexibility of the components. Our results could lead to a better understanding of several membrane processes in which protein interactions are involved.
Protocol for production of a genetic cross of the rodent malaria parasites.
Pattaradilokrat, Sittiporn; Li, Jian; Su, Xin-zhuan
2011-01-03
Variation in response to antimalarial drugs and in pathogenicity of malaria parasites is of biologic and medical importance. Linkage mapping has led to successful identification of genes or loci underlying various traits in malaria parasites of rodents and humans. The malaria parasite Plasmodium yoelii is one of many malaria species isolated from wild African rodents and has been adapted to grow in laboratories. This species reproduces many of the biologic characteristics of the human malaria parasites; genetic markers such as microsatellite and amplified fragment length polymorphism (AFLP) markers have also been developed for the parasite. Thus, genetic studies in rodent malaria parasites can be performed to complement research on Plasmodium falciparum. Here, we demonstrate the techniques for producing a genetic cross in P. yoelii that were first pioneered by Drs. David Walliker, Richard Carter, and colleagues at the University of Edinburgh. Genetic crosses in P. yoelii and other rodent malaria parasites are conducted by infecting mice Mus musculus with an inoculum containing gametocytes of two genetically distinct clones that differ in phenotypes of interest and by allowing mosquitoes to feed on the infected mice 4 days after infection. The presence of male and female gametocytes in the mouse blood is microscopically confirmed before feeding. Within 48 hrs after feeding, in the midgut of the mosquito, the haploid gametocytes differentiate into male and female gametes, fertilize, and form a diploid zygote (Fig. 1). During development of a zygote into an ookinete, meiosis appears to occur. If the zygote is derived through cross-fertilization between gametes of the two genetically distinct parasites, genetic exchanges (chromosomal reassortment and cross-overs between the non-sister chromatids of a pair of homologous chromosomes; Fig. 2) may occur, resulting in recombination of genetic material at homologous loci. Each zygote undergoes two successive nuclear
Nature and consequences of protein-protein interactions in high protein concentration solutions.
Saluja, Atul; Kalonia, Devendra S
2008-06-24
High protein concentration solutions are becoming increasingly important in the pharmaceutical industry. The solution behavior of proteins at high concentrations can markedly differ from that predicted based on dilute solution analysis due to thermodynamic non-ideality in these solutions. The non-ideality observed in these systems is related to the protein-protein interactions (PPI). Different types of forces play a key role in determining the overall nature and extent of these PPI and their relative contributions are affected by solute and solvent properties. However, individual contributions of these forces to the solution properties of concentrated protein solutions are not fully understood. The role of PPI, driven by these intermolecular forces, in governing solution rheology and physical stability of high protein concentration solutions is discussed from the point of view of pharmaceutical product development. Investigation of protein self-association and aggregation in concentrated protein solutions is crucial for ensuring the safety and efficacy of the final product for the duration of the desired product shelf life. Understanding rheology of high concentration protein solutions is critical for addressing issues during product manufacture and administration of final formulation to the patient. To this end, analysis of solution viscoelastic character can also provide an insight into the nature of PPI affecting solution rheology.
Computer Simulation of Protein-Protein and Protein-Peptide Interactions
1983-12-08
a full molecular dynamic z simulation is performed, with resulting dipolar re - laxation. However, this is prohibitive when a large . number of...1993 Dr. Mike Marron Program Manager Molecular Biology Office of Naval Research 800 N. Quincy Street Arlington, VA 22217 Dear Mike, Here is the...rztnbutior is unLi--ited. , 93-30630 98 12 12/08/93 01/0/92-;03/31/93: Final Report, Computer Simulation of Protein-Protein and Protein-Peptide
Prediction of physical protein protein interactions
NASA Astrophysics Data System (ADS)
Szilágyi, András; Grimm, Vera; Arakaki, Adrián K.; Skolnick, Jeffrey
2005-06-01
Many essential cellular processes such as signal transduction, transport, cellular motion and most regulatory mechanisms are mediated by protein-protein interactions. In recent years, new experimental techniques have been developed to discover the protein-protein interaction networks of several organisms. However, the accuracy and coverage of these techniques have proven to be limited, and computational approaches remain essential both to assist in the design and validation of experimental studies and for the prediction of interaction partners and detailed structures of protein complexes. Here, we provide a critical overview of existing structure-independent and structure-based computational methods. Although these techniques have significantly advanced in the past few years, we find that most of them are still in their infancy. We also provide an overview of experimental techniques for the detection of protein-protein interactions. Although the developments are promising, false positive and false negative results are common, and reliable detection is possible only by taking a consensus of different experimental approaches. The shortcomings of experimental techniques affect both the further development and the fair evaluation of computational prediction methods. For an adequate comparative evaluation of prediction and high-throughput experimental methods, an appropriately large benchmark set of biophysically characterized protein complexes would be needed, but is sorely lacking.
Paulmurugan, R; Gambhir, S S
2003-04-01
In this study we developed an inducible synthetic renilla luciferase protein-fragment-assisted complementation-based bioluminescence assay to quantitatively measure real time protein-protein interactions in mammalian cells. We identified suitable sites to generate fragments of N and C portions of the protein that yield significant recovered activity through complementation. We validate complementation-based activation of split synthetic renilla luciferase protein driven by the interaction of two strongly interacting proteins, MyoD and Id, in five different cell lines utilizing transient transfection studies. The expression level of the system was also modulated by tumor necrosis factor alpha through NFkappaB-promoter/enhancer elements used to drive expression of the N portion of synthetic renilla luciferase reporter gene. This new system should help in studying protein-protein interactions and when used with other split reporters (e.g., split firefly luciferase) should help to monitor different components of an intracellular network.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu,P.
2007-01-01
The utilization and availability of protein depended on the types of protein and their specific susceptibility to enzymatic hydrolysis (inhibitory activities) in the gastrointestine and was highly associated with protein molecular structures. Studying internal protein structure and protein subfraction profiles leaded to an understanding of the components that make up a whole protein. An understanding of the molecular structure of the whole protein was often vital to understanding its digestive behavior and nutritive value in animals. In this review, recently obtained information on protein molecular structural effects of heat processing was reviewed, in relation to protein characteristics affecting digestive behaviormore » and nutrient utilization and availability. The emphasis of this review was on (1) using the newly advanced synchrotron technology (S-FTIR) as a novel approach to reveal protein molecular chemistry affected by heat processing within intact plant tissues; (2) revealing the effects of heat processing on the profile changes of protein subfractions associated with digestive behaviors and kinetics manipulated by heat processing; (3) prediction of the changes of protein availability and supply after heat processing, using the advanced DVE/OEB and NRC-2001 models, and (4) obtaining information on optimal processing conditions of protein as intestinal protein source to achieve target values for potential high net absorbable protein in the small intestine. The information described in this article may give better insight in the mechanisms involved and the intrinsic protein molecular structural changes occurring upon processing.« less
CONVERSION OF PLASMA PROTEIN TO TISSUE PROTEIN WITHOUT EVIDENCE OF PROTEIN BREAKDOWN
Yuile, C. L.; Lamson, B. G.; Miller, L. L.; Whipple, G. H.
1951-01-01
Labeled plasma proteins obtained from donor dogs, previously fed ε-C14-dl-lysine, have been given intravenously to recipient dogs. The disappearance of labeled globulin from the plasma at a rate considerably faster than albumin has been confirmed. Evidence suggesting that the mass of protein in solution in the extravascular, extracellular fluid is approximately equal to the plasma proteins in circulation has been derived from a study of the dilution of labeled plasma protein by repeated injections of non-labeled plasma protein. In a period of 7 days the transfer of C14 from plasma to tissue proteins amounted to between 30 and 40 per cent of the activity in the labeled plasma protein injected intravenously. The conversion was accompanied by a very small loss of activity in the urine and expired air and the activity remained in the lysine residue of the liver and probably of other tissues. The data presented favor the view that plasma proteins are utilized in the body economy after partial catabolism within the cell area and provide no evidence of complete breakdown to the amino acid level. PMID:14832401
Benchmarking protein-protein interface predictions: why you should care about protein size.
Martin, Juliette
2014-07-01
A number of predictive methods have been developed to predict protein-protein binding sites. Each new method is traditionally benchmarked using sets of protein structures of various sizes, and global statistics are used to assess the quality of the prediction. Little attention has been paid to the potential bias due to protein size on these statistics. Indeed, small proteins involve proportionally more residues at interfaces than large ones. If a predictive method is biased toward small proteins, this can lead to an over-estimation of its performance. Here, we investigate the bias due to the size effect when benchmarking protein-protein interface prediction on the widely used docking benchmark 4.0. First, we simulate random scores that favor small proteins over large ones. Instead of the 0.5 AUC (Area Under the Curve) value expected by chance, these biased scores result in an AUC equal to 0.6 using hypergeometric distributions, and up to 0.65 using constant scores. We then use real prediction results to illustrate how to detect the size bias by shuffling, and subsequently correct it using a simple conversion of the scores into normalized ranks. In addition, we investigate the scores produced by eight published methods and show that they are all affected by the size effect, which can change their relative ranking. The size effect also has an impact on linear combination scores by modifying the relative contributions of each method. In the future, systematic corrections should be applied when benchmarking predictive methods using data sets with mixed protein sizes. © 2014 Wiley Periodicals, Inc.
Rigid-Docking Approaches to Explore Protein-Protein Interaction Space.
Matsuzaki, Yuri; Uchikoga, Nobuyuki; Ohue, Masahito; Akiyama, Yutaka
Protein-protein interactions play core roles in living cells, especially in the regulatory systems. As information on proteins has rapidly accumulated on publicly available databases, much effort has been made to obtain a better picture of protein-protein interaction networks using protein tertiary structure data. Predicting relevant interacting partners from their tertiary structure is a challenging task and computer science methods have the potential to assist with this. Protein-protein rigid docking has been utilized by several projects, docking-based approaches having the advantages that they can suggest binding poses of predicted binding partners which would help in understanding the interaction mechanisms and that comparing docking results of both non-binders and binders can lead to understanding the specificity of protein-protein interactions from structural viewpoints. In this review we focus on explaining current computational prediction methods to predict pairwise direct protein-protein interactions that form protein complexes.
Suratanee, Apichat; Plaimas, Kitiporn
2017-01-01
The associations between proteins and diseases are crucial information for investigating pathological mechanisms. However, the number of known and reliable protein-disease associations is quite small. In this study, an analysis framework to infer associations between proteins and diseases was developed based on a large data set of a human protein-protein interaction network integrating an effective network search, namely, the reverse k -nearest neighbor (R k NN) search. The R k NN search was used to identify an impact of a protein on other proteins. Then, associations between proteins and diseases were inferred statistically. The method using the R k NN search yielded a much higher precision than a random selection, standard nearest neighbor search, or when applying the method to a random protein-protein interaction network. All protein-disease pair candidates were verified by a literature search. Supporting evidence for 596 pairs was identified. In addition, cluster analysis of these candidates revealed 10 promising groups of diseases to be further investigated experimentally. This method can be used to identify novel associations to better understand complex relationships between proteins and diseases.
Purification of Proteins Fused to Maltose-Binding Protein.
Lebendiker, Mario; Danieli, Tsafi
2017-01-01
Maltose-Binding Protein (MBP) is one of the most popular fusion partners being used for producing recombinant proteins in bacterial cells. MBP allows the use of a simple capture affinity step on Amylose-Agarose or Dextrin-Sepharose columns, resulting in a protein that is often 70-90 % pure in a single step. In addition to protein isolation applications, MBP provides a high degree of translation, and facilitates the proper folding and solubility of the target protein. This paper describes efficient procedures for isolating highly purified MBP target proteins. Special attention is given to considerations for downstream applications such as structural determination studies, protein activity assays, and assessing the chemical characteristics of the target protein.
Parasites and cancers: parasite antigens as possible targets for cancer immunotherapy.
Darani, Hossein Yousofi; Yousefi, Morteza
2012-12-01
An adverse relationship between some parasite infections and cancer in the human population has been reported by different research groups. Anticancer activity of some parasites such as Trypanosoma cruzi, Toxoplasma gondii, Toxocara canis, Acantamoeba castellani and Plasmodium yoelii has been shown in experimental animals. Moreover, it has been shown that cancer-associated mucin-type O-glycan compositions are made by parasites, therefore cancers and parasites have common antigens. In this report anticancer activities of some parasites have been reviewed and the possible mechanisms of these actions have also been discussed.
What induces pocket openings on protein surface patches involved in protein-protein interactions?
Eyrisch, Susanne; Helms, Volkhard
2009-02-01
We previously showed for the proteins BCL-X(L), IL-2, and MDM2 that transient pockets at their protein-protein binding interfaces can be identified by applying the PASS algorithm to molecular dynamics (MD) snapshots. We now investigated which aspects of the natural conformational dynamics of proteins induce the formation of such pockets. The pocket detection protocol was applied to three different conformational ensembles for the same proteins that were extracted from MD simulations of the inhibitor bound crystal conformation in water and the free crystal/NMR structure in water and in methanol. Additional MD simulations studied the impact of backbone mobility. The more efficient CONCOORD or normal mode analysis (NMA) techniques gave significantly smaller pockets than MD simulations, whereas tCONCOORD generated pockets comparable to those observed in MD simulations for two of the three systems. Our findings emphasize the influence of solvent polarity and backbone rearrangements on the formation of pockets on protein surfaces and should be helpful in future generation of transient pockets as putative ligand binding sites at protein-protein interfaces.
Jaremko, Matt J; Lee, D John; Patel, Ashay; Winslow, Victoria; Opella, Stanley J; McCammon, J Andrew; Burkart, Michael D
2017-10-10
In an effort to elucidate and engineer interactions in type II nonribosomal peptide synthetases, we analyzed biomolecular recognition between the essential peptidyl carrier proteins and adenylation domains using nuclear magnetic resonance (NMR) spectroscopy, molecular dynamics, and mutational studies. Three peptidyl carrier proteins, PigG, PltL, and RedO, in addition to their cognate adenylation domains, PigI, PltF, and RedM, were investigated for their cross-species activity. Of the three peptidyl carrier proteins, only PigG showed substantial cross-pathway activity. Characterization of the novel NMR solution structure of holo-PigG and molecular dynamics simulations of holo-PltL and holo-PigG revealed differences in structures and dynamics of these carrier proteins. NMR titration experiments revealed perturbations of the chemical shifts of the loop 1 residues of these peptidyl carrier proteins upon their interaction with the adenylation domain. These experiments revealed a key region for the protein-protein interaction. Mutational studies supported the role of loop 1 in molecular recognition, as mutations to this region of the peptidyl carrier proteins significantly modulated their activities.
What induces pocket openings on protein surface patches involved in protein-protein interactions?
NASA Astrophysics Data System (ADS)
Eyrisch, Susanne; Helms, Volkhard
2009-02-01
We previously showed for the proteins BCL-XL, IL-2, and MDM2 that transient pockets at their protein-protein binding interfaces can be identified by applying the PASS algorithm to molecular dynamics (MD) snapshots. We now investigated which aspects of the natural conformational dynamics of proteins induce the formation of such pockets. The pocket detection protocol was applied to three different conformational ensembles for the same proteins that were extracted from MD simulations of the inhibitor bound crystal conformation in water and the free crystal/NMR structure in water and in methanol. Additional MD simulations studied the impact of backbone mobility. The more efficient CONCOORD or normal mode analysis (NMA) techniques gave significantly smaller pockets than MD simulations, whereas tCONCOORD generated pockets comparable to those observed in MD simulations for two of the three systems. Our findings emphasize the influence of solvent polarity and backbone rearrangements on the formation of pockets on protein surfaces and should be helpful in future generation of transient pockets as putative ligand binding sites at protein-protein interfaces.
Protein-Protein Interface and Disease: Perspective from Biomolecular Networks.
Hu, Guang; Xiao, Fei; Li, Yuqian; Li, Yuan; Vongsangnak, Wanwipa
Protein-protein interactions are involved in many important biological processes and molecular mechanisms of disease association. Structural studies of interfacial residues in protein complexes provide information on protein-protein interactions. Characterizing protein-protein interfaces, including binding sites and allosteric changes, thus pose an imminent challenge. With special focus on protein complexes, approaches based on network theory are proposed to meet this challenge. In this review we pay attention to protein-protein interfaces from the perspective of biomolecular networks and their roles in disease. We first describe the different roles of protein complexes in disease through several structural aspects of interfaces. We then discuss some recent advances in predicting hot spots and communication pathway analysis in terms of amino acid networks. Finally, we highlight possible future aspects of this area with respect to both methodology development and applications for disease treatment.
Protein-protein recognition control by modulating electrostatic interactions.
Han, Song; Yin, Shijin; Yi, Hong; Mouhat, Stéphanie; Qiu, Su; Cao, Zhijian; Sabatier, Jean-Marc; Wu, Yingliang; Li, Wenxin
2010-06-04
Protein-protein control recognition remains a huge challenge, and its development depends on understanding the chemical and biological mechanisms by which these interactions occur. Here we describe a protein-protein control recognition technique based on the dominant electrostatic interactions occurring between the proteins. We designed a potassium channel inhibitor, BmP05-T, that was 90.32% identical to wild-type BmP05. Negatively charged residues were translocated from the nonbinding interface to the binding interface of BmP05 inhibitor, such that BmP05-T now used BmP05 nonbinding interface as the binding interface. This switch demonstrated that nonbinding interfaces were able to control the orientation of protein binding interfaces in the process of protein-protein recognition. The novel function findings of BmP05-T peptide suggested that the control recognition technique described here had the potential for use in designing and utilizing functional proteins in many biological scenarios.
Biophysics of protein evolution and evolutionary protein biophysics
Sikosek, Tobias; Chan, Hue Sun
2014-01-01
The study of molecular evolution at the level of protein-coding genes often entails comparing large datasets of sequences to infer their evolutionary relationships. Despite the importance of a protein's structure and conformational dynamics to its function and thus its fitness, common phylogenetic methods embody minimal biophysical knowledge of proteins. To underscore the biophysical constraints on natural selection, we survey effects of protein mutations, highlighting the physical basis for marginal stability of natural globular proteins and how requirement for kinetic stability and avoidance of misfolding and misinteractions might have affected protein evolution. The biophysical underpinnings of these effects have been addressed by models with an explicit coarse-grained spatial representation of the polypeptide chain. Sequence–structure mappings based on such models are powerful conceptual tools that rationalize mutational robustness, evolvability, epistasis, promiscuous function performed by ‘hidden’ conformational states, resolution of adaptive conflicts and conformational switches in the evolution from one protein fold to another. Recently, protein biophysics has been applied to derive more accurate evolutionary accounts of sequence data. Methods have also been developed to exploit sequence-based evolutionary information to predict biophysical behaviours of proteins. The success of these approaches demonstrates a deep synergy between the fields of protein biophysics and protein evolution. PMID:25165599
Hubbard, Alan; Njama-Meya, Denise; Narum, David L.; Lanar, David E.; Dutta, Sheetij; Rosenthal, Philip J.; Dorsey, Grant; John, Chandy C.
2011-01-01
(See the article by Bejon et al, on pages 9–18, and Bousema et al, on pages 1–3.) Background. Associations between antibody responses to Plasmodium falciparum antigens and protection against symptomatic malaria have been difficult to ascertain, in part because antibodies are potential markers of both exposure to P. falciparum and protection against disease. Methods. We measured IgG responses to P. falciparum circumsporozoite protein, liver-stage antigen 1, apical-membrane antigen 1 (AMA-1), and merozoite surface proteins (MSP) 1 and 3, in children in Kampala, Uganda, and measured incidence of malaria before and after antibody measurement. Results. Stronger responses to all 5 antigens were associated with an increased risk of clinical malaria (P < .01) because of confounding with prior exposure to P. falciparum. However, with use of another assessment, risk of clinical malaria once parasitemic, stronger responses to AMA-1, MSP-1, and MSP-3 were associated with protection (odds ratios, 0.34, 0.36, and 0.31, respectively, per 10-fold increase; P < .01). Analyses assessing antibodies in combination suggested that any protective effect of antibodies was overestimated by associations between individual responses and protection. Conclusions. Using the risk of symptomatic malaria once parasitemic as an outcome may improve detection of associations between immune responses and protection from disease. Immunoepidemiology studies designed to detect mechanisms of immune protection should integrate prior exposure into the analysis and evaluate multiple immune responses. PMID:21628654
Cottingham, Matthew G; van Maurik, Andre; Zago, Manola; Newton, Angela T; Anderson, Richard J; Howard, M Keith; Schneider, Jörg; Skinner, Michael A
2006-07-01
The FP9 strain of F has been described as a more immunogenic recombinant vaccine vector than the Webster FPV-M (FPW) strain (R. J. Anderson et al., J. Immunol. 172:3094-3100, 2004). This study expands the comparison to include two separate recombinant antigens and multiple, rather than single, independent viral clones derived from the two strains. Dual-poxvirus heterologous prime-boost vaccination regimens using individual clones of recombinant FP9 or FPW in combination with recombinant modified V Ankara expressing the same antigen were evaluated for their ability to elicit T-cell responses against recombinant antigens from Plasmodium berghei (circumsporozoite protein) or human immunodeficiency virus type 1 (a Gag-Pol-Nef fusion protein). Gamma interferon enzyme-linked immunospot assay and fluorescence-activated cell sorting assays of the responses to specific epitopes confirmed the approximately twofold-greater cellular immunogenicity of FP9 compared to FPW, when given as the priming or boosting immunization. Equality of transgene expression in mouse cells infected with the two strains in vitro was verified by Western blotting. Directed partial sequence analysis and PCR analysis of FPW and comparison to available whole-genome sequences revealed that many loci that are mutated in the highly attenuated and culture-adapted FP9 strain are wild type in FPW, including the seven multikilobase deletions. These "passage-specific" alterations are hypothesized to be involved in determining the immunogenicity of fowlpox virus as a recombinant vaccine vector.
Crystal structure of a macrophage migration inhibitory factor from Giardia lamblia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buchko, Garry W.; Abendroth, Jan; Robinson, Howard
2013-06-15
Macrophage migration inhibitory factor (MIF) is a eukaryotic cytokine that affects a broad spectrum of immune responses and its activation/inactivation is associated with numerous diseases. During protozoan infections MIF is not only expressed by the host, but, has also been observed to be expressed by some parasites and released into the host. To better understand the biological role of parasitic MIF proteins, the crystal structure of the MIF protein from Giardia lamblia (Gl-MIF), the etiological agent responsible for giardiasis, has been determined at 2.30 Å resolution. The 114-residue protein adopts an α/β fold consisting of a four-stranded β-sheet with twomore » anti-parallel α-helices packed against a face of the β-sheet. An additional short β-strand aligns anti-parallel to β4 of the β-sheet in the adjacent protein unit to help stabilize a trimer, the biologically relevant unit observed in all solved MIF crystal structures to date, and form a discontinuous β-barrel. The structure of Gl-MIF is compared to the MIF structures from humans (Hs-MIF) and three Plasmodium species (falciparum, berghei, and yoelii). The structure of all five MIF proteins are generally similar with the exception of a channel that runs through the center of each trimer complex. Relative to Hs-MIF, there are differences in solvent accessibility and electrostatic potential distribution in the channel of Gl-MIF and the Plasmodium-MIFs due primarily to two “gate-keeper” residues in the parasitic MIFs. For the Plasmodium MIFs the gate-keeper residues are at positions 44 (Y==>R) and 100 (V==>D) and for Gl-MIF it is at position 100 (V==>R). If these gate-keeper residues have a biological function and contribute to the progression of parasitemia they may also form the basis for structure-based drug design targeting parasitic MIF proteins.« less
Protein and protein hydrolysates in sports nutrition.
van Loon, Luc J C; Kies, Arie K; Saris, Wim H M
2007-08-01
With the increasing knowledge about the role of nutrition in increasing exercise performance, it has become clear over the last 2 decades that amino acids, protein, and protein hydrolysates can play an important role. Most of the attention has been focused on their effects at a muscular level. As these nutrients are ingested, however, it also means that gastrointestinal digestibility and absorption can modulate their efficacy significantly. Therefore, discussing the role of amino acids, protein, and protein hydrolysates in sports nutrition entails holding a discussion on all levels of the metabolic route. On May 28-29, 2007, a small group of researchers active in the field of exercise science and protein metabolism presented an overview of the different aspects of the application of protein and protein hydrolysates in sports nutrition. In addition, they were asked to share their opinions on the future progress in their fields of research. In this overview, an introduction to the workshop and a short summary of its outcome is provided.
A modified Lowry protein test for dilute protein solutions
Garold F. Gregory; Keith F. Jensen
1971-01-01
A modified Lowry protein test for dilute protein solutions modified Lowry protein test was compared with the standard Lowry protein test. The modified test was found to give estimates of protein concentration that were as good as the standard test and has the advange that proteins can be measured in very dilute solutions.
The Role of Shape Complementarity in the Protein-Protein Interactions
NASA Astrophysics Data System (ADS)
Li, Ye; Zhang, Xianren; Cao, Dapeng
2013-11-01
We use a dissipative particle dynamic simulation to investigate the effects of shape complementarity on the protein-protein interactions. By monitoring different kinds of protein shape-complementarity modes, we gave a clear mechanism to reveal the role of the shape complementarity in the protein-protein interactions, i.e., when the two proteins with shape complementarity approach each other, the conformation of lipid chains between two proteins would be restricted significantly. The lipid molecules tend to leave the gap formed by two proteins to maximize the configuration entropy, and therefore yield an effective entropy-induced protein-protein attraction, which enhances the protein aggregation. In short, this work provides an insight into understanding the importance of the shape complementarity in the protein-protein interactions especially for protein aggregation and antibody-antigen complexes. Definitely, the shape complementarity is the third key factor affecting protein aggregation and complex, besides the electrostatic-complementarity and hydrophobic complementarity.
Electrostatic design of protein-protein association rates.
Schreiber, Gideon; Shaul, Yossi; Gottschalk, Kay E
2006-01-01
De novo design and redesign of proteins and protein complexes have made promising progress in recent years. Here, we give an overview of how to use available computer-based tools to design proteins to bind faster and tighter to their protein-complex partner by electrostatic optimization between the two proteins. Electrostatic optimization is possible because of the simple relation between the Debye-Huckel energy of interaction between a pair of proteins and their rate of association. This can be used for rapid, structure-based calculations of the electrostatic attraction between the two proteins in the complex. Using these principles, we developed two computer programs that predict the change in k(on), and as such the affinity, on introducing charged mutations. The two programs have a web interface that is available at
Targeting protein-protein interaction between MLL1 and reciprocal proteins for leukemia therapy.
Wang, Zhi-Hui; Li, Dong-Dong; Chen, Wei-Lin; You, Qi-Dong; Guo, Xiao-Ke
2018-01-15
The mixed lineage leukemia protein-1 (MLL1), as a lysine methyltransferase, predominantly regulates the methylation of histone H3 lysine 4 (H3K4) and functions in hematopoietic stem cell (HSC) self-renewal. MLL1 gene fuses with partner genes that results in the generation of MLL1 fusion proteins (MLL1-FPs), which are frequently detected in acute leukemia. In the progress of leukemogenesis, a great deal of proteins cooperate with MLL1 to form multiprotein complexes serving for the dysregulation of H3K4 methylation, the overexpression of homeobox (HOX) cluster genes, and the consequent generation of leukemia. Hence, disrupting the interactions between MLL1 and the reciprocal proteins has been considered to be a new treatment strategy for leukemia. Here, we reviewed potential protein-protein interactions (PPIs) between MLL1 and its reciprocal proteins, and summarized the inhibitors to target MLL1 PPIs. The druggability of MLL1 PPIs for leukemia were also discussed. Copyright © 2017. Published by Elsevier Ltd.
Liu, Lizhen; Sun, Xiaowu; Song, Wei; Du, Chao
2018-06-01
Predicting protein complexes from protein-protein interaction (PPI) network is of great significance to recognize the structure and function of cells. A protein may interact with different proteins under different time or conditions. Existing approaches only utilize static PPI network data that may lose much temporal biological information. First, this article proposed a novel method that combines gene expression data at different time points with traditional static PPI network to construct different dynamic subnetworks. Second, to further filter out the data noise, the semantic similarity based on gene ontology is regarded as the network weight together with the principal component analysis, which is introduced to deal with the weight computing by three traditional methods. Third, after building a dynamic PPI network, a predicting protein complexes algorithm based on "core-attachment" structural feature is applied to detect complexes from each dynamic subnetworks. Finally, it is revealed from the experimental results that our method proposed in this article performs well on detecting protein complexes from dynamic weighted PPI networks.
A protein interaction network analysis for yeast integral membrane protein.
Shi, Ming-Guang; Huang, De-Shuang; Li, Xue-Ling
2008-01-01
Although the yeast Saccharomyces cerevisiae is the best exemplified single-celled eukaryote, the vast number of protein-protein interactions of integral membrane proteins of Saccharomyces cerevisiae have not been characterized by experiments. Here, based on the kernel method of Greedy Kernel Principal Component analysis plus Linear Discriminant Analysis, we identify 300 protein-protein interactions involving 189 membrane proteins and get the outcome of a highly connected protein-protein interactions network. Furthermore, we study the global topological features of integral membrane proteins network of Saccharomyces cerevisiae. These results give the comprehensive description of protein-protein interactions of integral membrane proteins and reveal global topological and robustness of the interactome network at a system level. This work represents an important step towards a comprehensive understanding of yeast protein interactions.
Protein kinesis: The dynamics of protein trafficking and stability
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
The purpose of this conference is to provide a multidisciplinary forum for exchange of state-of-the-art information on protein kinesis. This volume contains abstracts of papers in the following areas: protein folding and modification in the endoplasmic reticulum; protein trafficking; protein translocation and folding; protein degradation; polarity; nuclear trafficking; membrane dynamics; and protein import into organelles.
The Role of Shape Complementarity in the Protein-Protein Interactions
Li, Ye; Zhang, Xianren; Cao, Dapeng
2013-01-01
We use a dissipative particle dynamic simulation to investigate the effects of shape complementarity on the protein-protein interactions. By monitoring different kinds of protein shape-complementarity modes, we gave a clear mechanism to reveal the role of the shape complementarity in the protein-protein interactions, i.e., when the two proteins with shape complementarity approach each other, the conformation of lipid chains between two proteins would be restricted significantly. The lipid molecules tend to leave the gap formed by two proteins to maximize the configuration entropy, and therefore yield an effective entropy-induced protein-protein attraction, which enhances the protein aggregation. In short, this work provides an insight into understanding the importance of the shape complementarity in the protein-protein interactions especially for protein aggregation and antibody–antigen complexes. Definitely, the shape complementarity is the third key factor affecting protein aggregation and complex, besides the electrostatic-complementarity and hydrophobic complementarity. PMID:24253561
FRODOCK 2.0: fast protein-protein docking server.
Ramírez-Aportela, Erney; López-Blanco, José Ramón; Chacón, Pablo
2016-08-01
The prediction of protein-protein complexes from the structures of unbound components is a challenging and powerful strategy to decipher the mechanism of many essential biological processes. We present a user-friendly protein-protein docking server based on an improved version of FRODOCK that includes a complementary knowledge-based potential. The web interface provides a very effective tool to explore and select protein-protein models and interactively screen them against experimental distance constraints. The competitive success rates and efficiency achieved allow the retrieval of reliable potential protein-protein binding conformations that can be further refined with more computationally demanding strategies. The server is free and open to all users with no login requirement at http://frodock.chaconlab.org pablo@chaconlab.org Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Computational prediction of host-pathogen protein-protein interactions.
Dyer, Matthew D; Murali, T M; Sobral, Bruno W
2007-07-01
Infectious diseases such as malaria result in millions of deaths each year. An important aspect of any host-pathogen system is the mechanism by which a pathogen can infect its host. One method of infection is via protein-protein interactions (PPIs) where pathogen proteins target host proteins. Developing computational methods that identify which PPIs enable a pathogen to infect a host has great implications in identifying potential targets for therapeutics. We present a method that integrates known intra-species PPIs with protein-domain profiles to predict PPIs between host and pathogen proteins. Given a set of intra-species PPIs, we identify the functional domains in each of the interacting proteins. For every pair of functional domains, we use Bayesian statistics to assess the probability that two proteins with that pair of domains will interact. We apply our method to the Homo sapiens-Plasmodium falciparum host-pathogen system. Our system predicts 516 PPIs between proteins from these two organisms. We show that pairs of human proteins we predict to interact with the same Plasmodium protein are close to each other in the human PPI network and that Plasmodium pairs predicted to interact with same human protein are co-expressed in DNA microarray datasets measured during various stages of the Plasmodium life cycle. Finally, we identify functionally enriched sub-networks spanned by the predicted interactions and discuss the plausibility of our predictions. Supplementary data are available at http://staff.vbi.vt.edu/dyermd/publications/dyer2007a.html. Supplementary data are available at Bioinformatics online.
The De Novo Design of Protein-Protein Interfaces
it was our intention to add to this body by engineering de novo (from scratch) protein/protein complexes. Using this inverse approach we have furthered...key physical features needed to drive specific protein/protein interactions. It is considered inverse because, instead of studying natural complexes
Influence of Protein Abundance on High-Throughput Protein-Protein Interaction Detection
2009-06-05
the interaction data sets we determined, via comparisons with strict randomized simulations , the propensity for essential proteins to selectively...and analysis of high- quality PPI data sets. Materials and Methods We analyzed protein interaction networks for yeast and E. coli determined from Y2H...we reinvestigated the centrality-lethality rule, which implies that proteins having more interactions are more likely to be essential. From analysis
Cheng, Yiming; Perocchi, Fabiana
2015-07-01
ProtPhylo is a web-based tool to identify proteins that are functionally linked to either a phenotype or a protein of interest based on co-evolution. ProtPhylo infers functional associations by comparing protein phylogenetic profiles (co-occurrence patterns of orthology relationships) for more than 9.7 million non-redundant protein sequences from all three domains of life. Users can query any of 2048 fully sequenced organisms, including 1678 bacteria, 255 eukaryotes and 115 archaea. In addition, they can tailor ProtPhylo to a particular kind of biological question by choosing among four main orthology inference methods based either on pair-wise sequence comparisons (One-way Best Hits and Best Reciprocal Hits) or clustering of orthologous proteins across multiple species (OrthoMCL and eggNOG). Next, ProtPhylo ranks phylogenetic neighbors of query proteins or phenotypic properties using the Hamming distance as a measure of similarity between pairs of phylogenetic profiles. Candidate hits can be easily and flexibly prioritized by complementary clues on subcellular localization, known protein-protein interactions, membrane spanning regions and protein domains. The resulting protein list can be quickly exported into a csv text file for further analyses. ProtPhylo is freely available at http://www.protphylo.org. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The NMR contribution to protein-protein networking in Fe-S protein maturation.
Banci, Lucia; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Piccioli, Mario
2018-03-22
Iron-sulfur proteins were among the first class of metalloproteins that were actively studied using NMR spectroscopy tailored to paramagnetic systems. The hyperfine shifts, their temperature dependencies and the relaxation rates of nuclei of cluster-bound residues are an efficient fingerprint of the nature and the oxidation state of the Fe-S cluster. NMR significantly contributed to the analysis of the magnetic coupling patterns and to the understanding of the electronic structure occurring in [2Fe-2S], [3Fe-4S] and [4Fe-4S] clusters bound to proteins. After the first NMR structure of a paramagnetic protein was obtained for the reduced E. halophila HiPIP I, many NMR structures were determined for several Fe-S proteins in different oxidation states. It was found that differences in chemical shifts, in patterns of unobserved residues, in internal mobility and in thermodynamic stability are suitable data to map subtle changes between the two different oxidation states of the protein. Recently, the interaction networks responsible for maturing human mitochondrial and cytosolic Fe-S proteins have been largely characterized by combining solution NMR standard experiments with those tailored to paramagnetic systems. We show here the contribution of solution NMR in providing a detailed molecular view of "Fe-S interactomics". This contribution was particularly effective when protein-protein interactions are weak and transient, and thus difficult to be characterized at high resolution with other methodologies.
Molecular tweezers modulate 14-3-3 protein-protein interactions
NASA Astrophysics Data System (ADS)
Bier, David; Rose, Rolf; Bravo-Rodriguez, Kenny; Bartel, Maria; Ramirez-Anguita, Juan Manuel; Dutt, Som; Wilch, Constanze; Klärner, Frank-Gerrit; Sanchez-Garcia, Elsa; Schrader, Thomas; Ottmann, Christian
2013-03-01
Supramolecular chemistry has recently emerged as a promising way to modulate protein functions, but devising molecules that will interact with a protein in the desired manner is difficult as many competing interactions exist in a biological environment (with solvents, salts or different sites for the target biomolecule). We now show that lysine-specific molecular tweezers bind to a 14-3-3 adapter protein and modulate its interaction with partner proteins. The tweezers inhibit binding between the 14-3-3 protein and two partner proteins—a phosphorylated (C-Raf) protein and an unphosphorylated one (ExoS)—in a concentration-dependent manner. Protein crystallography shows that this effect arises from the binding of the tweezers to a single surface-exposed lysine (Lys214) of the 14-3-3 protein in the proximity of its central channel, which normally binds the partner proteins. A combination of structural analysis and computer simulations provides rules for the tweezers' binding preferences, thus allowing us to predict their influence on this type of protein-protein interactions.
Shi, Xiaohe; Lu, Wen-Cong; Cai, Yu-Dong; Chou, Kuo-Chen
2011-01-01
Background With the huge amount of uncharacterized protein sequences generated in the post-genomic age, it is highly desirable to develop effective computational methods for quickly and accurately predicting their functions. The information thus obtained would be very useful for both basic research and drug development in a timely manner. Methodology/Principal Findings Although many efforts have been made in this regard, most of them were based on either sequence similarity or protein-protein interaction (PPI) information. However, the former often fails to work if a query protein has no or very little sequence similarity to any function-known proteins, while the latter had similar problem if the relevant PPI information is not available. In view of this, a new approach is proposed by hybridizing the PPI information and the biochemical/physicochemical features of protein sequences. The overall first-order success rates by the new predictor for the functions of mouse proteins on training set and test set were 69.1% and 70.2%, respectively, and the success rate covered by the results of the top-4 order from a total of 24 orders was 65.2%. Conclusions/Significance The results indicate that the new approach is quite promising that may open a new avenue or direction for addressing the difficult and complicated problem. PMID:21283518
TGF-beta signaling proteins and the Protein Ontology.
Arighi, Cecilia N; Liu, Hongfang; Natale, Darren A; Barker, Winona C; Drabkin, Harold; Blake, Judith A; Smith, Barry; Wu, Cathy H
2009-05-06
The Protein Ontology (PRO) is designed as a formal and principled Open Biomedical Ontologies (OBO) Foundry ontology for proteins. The components of PRO extend from a classification of proteins on the basis of evolutionary relationships at the homeomorphic level to the representation of the multiple protein forms of a gene, including those resulting from alternative splicing, cleavage and/or post-translational modifications. Focusing specifically on the TGF-beta signaling proteins, we describe the building, curation, usage and dissemination of PRO. PRO is manually curated on the basis of PrePRO, an automatically generated file with content derived from standard protein data sources. Manual curation ensures that the treatment of the protein classes and the internal and external relationships conform to the PRO framework. The current release of PRO is based upon experimental data from mouse and human proteins wherein equivalent protein forms are represented by single terms. In addition to the PRO ontology, the annotation of PRO terms is released as a separate PRO association file, which contains, for each given PRO term, an annotation from the experimentally characterized sub-types as well as the corresponding database identifiers and sequence coordinates. The annotations are added in the form of relationship to other ontologies. Whenever possible, equivalent forms in other species are listed to facilitate cross-species comparison. Splice and allelic variants, gene fusion products and modified protein forms are all represented as entities in the ontology. Therefore, PRO provides for the representation of protein entities and a resource for describing the associated data. This makes PRO useful both for proteomics studies where isoforms and modified forms must be differentiated, and for studies of biological pathways, where representations need to take account of the different ways in which the cascade of events may depend on specific protein modifications. PRO provides
Energy Landscape and Transition State of Protein-Protein Association
NASA Astrophysics Data System (ADS)
Alsallaq, Ramzi; Zhou, Huan-Xiang
2006-11-01
Formation of a stereospecific protein complex is favored by specific interactions between two proteins but disfavored by the loss of translational and rotational freedom. Echoing the protein folding process, we have previously proposed a transition state for protein-protein association. Here we clarify the specification of the transition state by working with two toy models for protein association. The models demonstrate that a sharp transition between the bound state with numerous short-range interactions but restricted translation and rotational freedom and the unbound state with at most a small number of interactions but expanded configurational freedom. This transition sets the outer boundary of the bound state as well as the transition state for association. The energy landscape is funnel-like, with the deep well of the bound state surrounded by a broad shallow basin. This formalism of protein-protein association is applied to four protein-protein complexes, and is found to give accurate predictions for the effects of charge mutations and ionic strength on the association rates.
An ontology-based search engine for protein-protein interactions.
Park, Byungkyu; Han, Kyungsook
2010-01-18
Keyword matching or ID matching is the most common searching method in a large database of protein-protein interactions. They are purely syntactic methods, and retrieve the records in the database that contain a keyword or ID specified in a query. Such syntactic search methods often retrieve too few search results or no results despite many potential matches present in the database. We have developed a new method for representing protein-protein interactions and the Gene Ontology (GO) using modified Gödel numbers. This representation is hidden from users but enables a search engine using the representation to efficiently search protein-protein interactions in a biologically meaningful way. Given a query protein with optional search conditions expressed in one or more GO terms, the search engine finds all the interaction partners of the query protein by unique prime factorization of the modified Gödel numbers representing the query protein and the search conditions. Representing the biological relations of proteins and their GO annotations by modified Gödel numbers makes a search engine efficiently find all protein-protein interactions by prime factorization of the numbers. Keyword matching or ID matching search methods often miss the interactions involving a protein that has no explicit annotations matching the search condition, but our search engine retrieves such interactions as well if they satisfy the search condition with a more specific term in the ontology.
Roy Choudhury, Swarup; Westfall, Corey S.; Laborde, John P.; Bisht, Naveen C.; Jez, Joseph M.; Pandey, Sona
2012-01-01
Heterotrimeric G-proteins and the regulator of G-protein signaling (RGS) proteins, which accelerate the inherent GTPase activity of Gα proteins, are common in animals and encoded by large gene families; however, in plants G-protein signaling is thought to be more limited in scope. For example, Arabidopsis thaliana contains one Gα, one Gβ, three Gγ, and one RGS protein. Recent examination of the Glycine max (soybean) genome reveals a larger set of G-protein-related genes and raises the possibility of more intricate G-protein networks than previously observed in plants. Stopped-flow analysis of GTP-binding and GDP/GTP exchange for the four soybean Gα proteins (GmGα1–4) reveals differences in their kinetic properties. The soybean genome encodes two chimeric RGS proteins with an N-terminal seven transmembrane domain and a C-terminal RGS box. Both GmRGS interact with each of the four GmGα and regulate their GTPase activity. The GTPase-accelerating activities of GmRGS1 and -2 differ for each GmGα, suggesting more than one possible rate of the G-protein cycle initiated by each of the Gα proteins. The differential effects of GmRGS1 and GmRGS2 on GmGα1–4 result from a single valine versus alanine difference. The emerging picture suggests complex regulation of the G-protein cycle in soybean and in other plants with expanded G-protein networks. PMID:22474294
Ruan, Peiying; Hayashida, Morihiro; Maruyama, Osamu; Akutsu, Tatsuya
2013-01-01
Since many proteins express their functional activity by interacting with other proteins and forming protein complexes, it is very useful to identify sets of proteins that form complexes. For that purpose, many prediction methods for protein complexes from protein-protein interactions have been developed such as MCL, MCODE, RNSC, PCP, RRW, and NWE. These methods have dealt with only complexes with size of more than three because the methods often are based on some density of subgraphs. However, heterodimeric protein complexes that consist of two distinct proteins occupy a large part according to several comprehensive databases of known complexes. In this paper, we propose several feature space mappings from protein-protein interaction data, in which each interaction is weighted based on reliability. Furthermore, we make use of prior knowledge on protein domains to develop feature space mappings, domain composition kernel and its combination kernel with our proposed features. We perform ten-fold cross-validation computational experiments. These results suggest that our proposed kernel considerably outperforms the naive Bayes-based method, which is the best existing method for predicting heterodimeric protein complexes. PMID:23776458
Paliwal, A; Asthagiri, D; Abras, D; Lenhoff, A M; Paulaitis, M E
2005-09-01
We model the hydration contribution to short-range electrostatic/dispersion protein interactions embodied in the osmotic second virial coefficient, B(2), by adopting a quasi-chemical description in which water molecules associated with the protein are identified through explicit molecular dynamics simulations. These water molecules reduce the surface complementarity of highly favorable short-range interactions, and therefore can play an important role in mediating protein-protein interactions. Here we examine this quasi-chemical view of hydration by predicting the interaction part of B(2) and comparing our results with those derived from light-scattering measurements of B(2) for staphylococcal nuclease, lysozyme, and chymotrypsinogen at 25 degrees C as a function of solution pH and ionic strength. We find that short-range protein interactions are influenced by water molecules strongly associated with a relatively small fraction of the protein surface. However, the effect of these strongly associated water molecules on the surface complementarity of short-range protein interactions is significant, and must be taken into account for an accurate description of B(2). We also observe remarkably similar hydration behavior for these proteins despite substantial differences in their three-dimensional structures and spatial charge distributions, suggesting a general characterization of protein hydration.
Computational Prediction of Protein-Protein Interactions
Ehrenberger, Tobias; Cantley, Lewis C.; Yaffe, Michael B.
2015-01-01
The prediction of protein-protein interactions and kinase-specific phosphorylation sites on individual proteins is critical for correctly placing proteins within signaling pathways and networks. The importance of this type of annotation continues to increase with the continued explosion of genomic and proteomic data, particularly with emerging data categorizing posttranslational modifications on a large scale. A variety of computational tools are available for this purpose. In this chapter, we review the general methodologies for these types of computational predictions and present a detailed user-focused tutorial of one such method and computational tool, Scansite, which is freely available to the entire scientific community over the Internet. PMID:25859943
NASA Astrophysics Data System (ADS)
Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.
2007-09-01
Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.
NASA Astrophysics Data System (ADS)
Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.
2014-07-01
Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.
Kristie, T M; LeBowitz, J H; Sharp, P A
1989-01-01
The herpes simplex virus transactivator, alpha TIF, stimulates transcription of the alpha/immediate early genes via a cis-acting site containing an octamer element and a conserved flanking sequence. The alpha TIF protein, produced in a baculovirus expression system, nucleates the formation of at least two DNA--protein complexes on this regulatory element. Both of these complexes contain the ubiquitous Oct-1 protein, whose POU domain alone is sufficient to allow assembly of the alpha TIF-dependent complexes. A second member of the POU domain family, the lymphoid specific Oct-2 protein, can also be assembled into similar complexes at high concentrations of alpha TIF protein. These complexes contain at least two cellular proteins in addition to Oct-1. One of these proteins is present in both insect and HeLa cells and probably recognizes sequences in the cis element. The second cellular protein, only present in HeLa cells, probably binds by protein-protein interactions. Images PMID:2556266
Kristie, T M; LeBowitz, J H; Sharp, P A
1989-12-20
The herpes simplex virus transactivator, alpha TIF, stimulates transcription of the alpha/immediate early genes via a cis-acting site containing an octamer element and a conserved flanking sequence. The alpha TIF protein, produced in a baculovirus expression system, nucleates the formation of at least two DNA--protein complexes on this regulatory element. Both of these complexes contain the ubiquitous Oct-1 protein, whose POU domain alone is sufficient to allow assembly of the alpha TIF-dependent complexes. A second member of the POU domain family, the lymphoid specific Oct-2 protein, can also be assembled into similar complexes at high concentrations of alpha TIF protein. These complexes contain at least two cellular proteins in addition to Oct-1. One of these proteins is present in both insect and HeLa cells and probably recognizes sequences in the cis element. The second cellular protein, only present in HeLa cells, probably binds by protein-protein interactions.
The Ser/Thr Protein Kinase Protein-Protein Interaction Map of M. tuberculosis.
Wu, Fan-Lin; Liu, Yin; Jiang, He-Wei; Luan, Yi-Zhao; Zhang, Hai-Nan; He, Xiang; Xu, Zhao-Wei; Hou, Jing-Li; Ji, Li-Yun; Xie, Zhi; Czajkowsky, Daniel M; Yan, Wei; Deng, Jiao-Yu; Bi, Li-Jun; Zhang, Xian-En; Tao, Sheng-Ce
2017-08-01
Mycobacterium tuberculosis (Mtb) is the causative agent of tuberculosis, the leading cause of death among all infectious diseases. There are 11 eukaryotic-like serine/threonine protein kinases (STPKs) in Mtb, which are thought to play pivotal roles in cell growth, signal transduction and pathogenesis. However, their underlying mechanisms of action remain largely uncharacterized. In this study, using a Mtb proteome microarray, we have globally identified the binding proteins in Mtb for all of the STPKs, and constructed the first STPK protein interaction (KPI) map that includes 492 binding proteins and 1,027 interactions. Bioinformatics analysis showed that the interacting proteins reflect diverse functions, including roles in two-component system, transcription, protein degradation, and cell wall integrity. Functional investigations confirmed that PknG regulates cell wall integrity through key components of peptidoglycan (PG) biosynthesis, e.g. MurC. The global STPK-KPIs network constructed here is expected to serve as a rich resource for understanding the key signaling pathways in Mtb, thus facilitating drug development and effective control of Mtb. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Chen, Ching-Tai; Peng, Hung-Pin; Jian, Jhih-Wei; Tsai, Keng-Chang; Chang, Jeng-Yih; Yang, Ei-Wen; Chen, Jun-Bo; Ho, Shinn-Ying; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Protein-protein interactions are key to many biological processes. Computational methodologies devised to predict protein-protein interaction (PPI) sites on protein surfaces are important tools in providing insights into the biological functions of proteins and in developing therapeutics targeting the protein-protein interaction sites. One of the general features of PPI sites is that the core regions from the two interacting protein surfaces are complementary to each other, similar to the interior of proteins in packing density and in the physicochemical nature of the amino acid composition. In this work, we simulated the physicochemical complementarities by constructing three-dimensional probability density maps of non-covalent interacting atoms on the protein surfaces. The interacting probabilities were derived from the interior of known structures. Machine learning algorithms were applied to learn the characteristic patterns of the probability density maps specific to the PPI sites. The trained predictors for PPI sites were cross-validated with the training cases (consisting of 432 proteins) and were tested on an independent dataset (consisting of 142 proteins). The residue-based Matthews correlation coefficient for the independent test set was 0.423; the accuracy, precision, sensitivity, specificity were 0.753, 0.519, 0.677, and 0.779 respectively. The benchmark results indicate that the optimized machine learning models are among the best predictors in identifying PPI sites on protein surfaces. In particular, the PPI site prediction accuracy increases with increasing size of the PPI site and with increasing hydrophobicity in amino acid composition of the PPI interface; the core interface regions are more likely to be recognized with high prediction confidence. The results indicate that the physicochemical complementarity patterns on protein surfaces are important determinants in PPIs, and a substantial portion of the PPI sites can be predicted correctly with
Protein subcellular localization assays using split fluorescent proteins
Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM
2009-09-08
The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).
An ontology-based search engine for protein-protein interactions
2010-01-01
Background Keyword matching or ID matching is the most common searching method in a large database of protein-protein interactions. They are purely syntactic methods, and retrieve the records in the database that contain a keyword or ID specified in a query. Such syntactic search methods often retrieve too few search results or no results despite many potential matches present in the database. Results We have developed a new method for representing protein-protein interactions and the Gene Ontology (GO) using modified Gödel numbers. This representation is hidden from users but enables a search engine using the representation to efficiently search protein-protein interactions in a biologically meaningful way. Given a query protein with optional search conditions expressed in one or more GO terms, the search engine finds all the interaction partners of the query protein by unique prime factorization of the modified Gödel numbers representing the query protein and the search conditions. Conclusion Representing the biological relations of proteins and their GO annotations by modified Gödel numbers makes a search engine efficiently find all protein-protein interactions by prime factorization of the numbers. Keyword matching or ID matching search methods often miss the interactions involving a protein that has no explicit annotations matching the search condition, but our search engine retrieves such interactions as well if they satisfy the search condition with a more specific term in the ontology. PMID:20122195
Hot-spot analysis for drug discovery targeting protein-protein interactions.
Rosell, Mireia; Fernández-Recio, Juan
2018-04-01
Protein-protein interactions are important for biological processes and pathological situations, and are attractive targets for drug discovery. However, rational drug design targeting protein-protein interactions is still highly challenging. Hot-spot residues are seen as the best option to target such interactions, but their identification requires detailed structural and energetic characterization, which is only available for a tiny fraction of protein interactions. Areas covered: In this review, the authors cover a variety of computational methods that have been reported for the energetic analysis of protein-protein interfaces in search of hot-spots, and the structural modeling of protein-protein complexes by docking. This can help to rationalize the discovery of small-molecule inhibitors of protein-protein interfaces of therapeutic interest. Computational analysis and docking can help to locate the interface, molecular dynamics can be used to find suitable cavities, and hot-spot predictions can focus the search for inhibitors of protein-protein interactions. Expert opinion: A major difficulty for applying rational drug design methods to protein-protein interactions is that in the majority of cases the complex structure is not available. Fortunately, computational docking can complement experimental data. An interesting aspect to explore in the future is the integration of these strategies for targeting PPIs with large-scale mutational analysis.
Protein-induced satiety: effects and mechanisms of different proteins.
Veldhorst, M; Smeets, A; Soenen, S; Hochstenbach-Waelen, A; Hursel, R; Diepvens, K; Lejeune, M; Luscombe-Marsh, N; Westerterp-Plantenga, M
2008-05-23
Relatively high protein diets, i.e. diets that maintain the absolute number of grams of protein ingested as compared to before dieting, are a popular strategy for weight loss and weight maintenance. Research into multiple mechanisms regulating body weight has focused on the effects of different quantities and types of dietary protein. Satiety and energy expenditure are important in protein-enhanced weight loss and weight maintenance. Protein-induced satiety has been shown acutely, with single meals, with contents of 25% to 81% of energy from protein in general or from specific proteins, while subsequent energy intake reduction was significant. Protein-induced satiety has been shown with high protein ad libitum diets, lasting from 1 to 6 days, up to 6 months. Also significantly greater weight loss has been observed in comparison with control. Mechanisms explaining protein-induced satiety are nutrient-specific, and consist mainly of synchronization with elevated amino acid concentrations. Different proteins cause different nutrient related responses of (an)orexigenic hormones. Protein-induced satiety coincides with a relatively high GLP-1 release, stimulated by the carbohydrate content of the diet, PYY release, while ghrelin does not seem to be especially affected, and little information is available on CCK. Protein-induced satiety is related to protein-induced energy expenditure. Finally, protein-induced satiety appears to be of vital importance for weight loss and weight maintenance. With respect to possible adverse events, chronic ingestion of large amounts of sulphur-containing amino acids may have an indirect effect on blood pressure by induction of renal subtle structural damage, ultimately leading to loss of nephron mass, and a secondary increase in blood pressure. The established synergy between obesity and low nephron number on induction of high blood pressure and further decline of renal function identifies subjects with obesity, metabolic syndrome and
A Discontinuous Potential Model for Protein-Protein Interactions.
Shao, Qing; Hall, Carol K
2016-01-01
Protein-protein interactions play an important role in many biologic and industrial processes. In this work, we develop a two-bead-per-residue model that enables us to account for protein-protein interactions in a multi-protein system using discontinuous molecular dynamics simulations. This model deploys discontinuous potentials to describe the non-bonded interactions and virtual bonds to keep proteins in their native state. The geometric and energetic parameters are derived from the potentials of mean force between sidechain-sidechain, sidechain-backbone, and backbone-backbone pairs. The energetic parameters are scaled with the aim of matching the second virial coefficient of lysozyme reported in experiment. We also investigate the performance of several bond-building strategies.
Xu, Yu; Wang, Hong; Nussinov, Ruth; Ma, Buyong
2013-01-01
We constructed and simulated a ‘minimal proteome’ model using Langevin dynamics. It contains 206 essential protein types which were compiled from the literature. For comparison, we generated six proteomes with randomized concentrations. We found that the net charges and molecular weights of the proteins in the minimal genome are not random. The net charge of a protein decreases linearly with molecular weight, with small proteins being mostly positively charged and large proteins negatively charged. The protein copy numbers in the minimal genome have the tendency to maximize the number of protein-protein interactions in the network. Negatively charged proteins which tend to have larger sizes can provide large collision cross-section allowing them to interact with other proteins; on the other hand, the smaller positively charged proteins could have higher diffusion speed and are more likely to collide with other proteins. Proteomes with random charge/mass populations form less stable clusters than those with experimental protein copy numbers. Our study suggests that ‘proper’ populations of negatively and positively charged proteins are important for maintaining a protein-protein interaction network in a proteome. It is interesting to note that the minimal genome model based on the charge and mass of E. Coli may have a larger protein-protein interaction network than that based on the lower organism M. pneumoniae. PMID:23420643
NMR Studies of Protein Hydration and Protein-Ligand Interactions
NASA Astrophysics Data System (ADS)
Chong, Yuan
Water on the surface of a protein is called hydration water. Hydration water is known to play a crucial role in a variety of biological processes including protein folding, enzymatic activation, and drug binding. Although the significance of hydration water has been recognized, the underlying mechanism remains far from being understood. This dissertation employs a unique in-situ nuclear magnetic resonance (NMR) technique to study the mechanism of protein hydration and the role of hydration in alcohol-protein interactions. Water isotherms in proteins are measured at different temperatures via the in-situ NMR technique. Water is found to interact differently with hydrophilic and hydrophobic groups on the protein. Water adsorption on hydrophilic groups is hardly affected by the temperature, while water adsorption on hydrophobic groups strongly depends on the temperature around 10 C, below which the adsorption is substantially reduced. This effect is induced by the dramatic decrease in the protein flexibility below 10 C. Furthermore, nanosecond to microsecond protein dynamics and the free energy, enthalpy, and entropy of protein hydration are studied as a function of hydration level and temperature. A crossover at 10 C in protein dynamics and thermodynamics is revealed. The effect of water at hydrophilic groups on protein dynamics and thermodynamics shows little temperature dependence, whereas water at hydrophobic groups has stronger effect above 10 C. In addition, I investigate the role of water in alcohol binding to the protein using the in-situ NMR detection. The isotherms of alcohols are first measured on dry proteins, then on proteins with a series of controlled hydration levels. The free energy, enthalpy, and entropy of alcohol binding are also determined. Two distinct types of alcohol binding are identified. On the one hand, alcohols can directly bind to a few specific sites on the protein. This type of binding is independent of temperature and can be
Exploiting Amino Acid Composition for Predicting Protein-Protein Interactions
Roy, Sushmita; Martinez, Diego; Platero, Harriett; Lane, Terran; Werner-Washburne, Margaret
2009-01-01
Background Computational prediction of protein interactions typically use protein domains as classifier features because they capture conserved information of interaction surfaces. However, approaches relying on domains as features cannot be applied to proteins without any domain information. In this paper, we explore the contribution of pure amino acid composition (AAC) for protein interaction prediction. This simple feature, which is based on normalized counts of single or pairs of amino acids, is applicable to proteins from any sequenced organism and can be used to compensate for the lack of domain information. Results AAC performed at par with protein interaction prediction based on domains on three yeast protein interaction datasets. Similar behavior was obtained using different classifiers, indicating that our results are a function of features and not of classifiers. In addition to yeast datasets, AAC performed comparably on worm and fly datasets. Prediction of interactions for the entire yeast proteome identified a large number of novel interactions, the majority of which co-localized or participated in the same processes. Our high confidence interaction network included both well-studied and uncharacterized proteins. Proteins with known function were involved in actin assembly and cell budding. Uncharacterized proteins interacted with proteins involved in reproduction and cell budding, thus providing putative biological roles for the uncharacterized proteins. Conclusion AAC is a simple, yet powerful feature for predicting protein interactions, and can be used alone or in conjunction with protein domains to predict new and validate existing interactions. More importantly, AAC alone performs at par with existing, but more complex, features indicating the presence of sequence-level information that is predictive of interaction, but which is not necessarily restricted to domains. PMID:19936254
Mistry, Divya; Wise, Roger P; Dickerson, Julie A
2017-01-01
Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be
In Situ Protein Binding Assay Using Fc-Fusion Proteins.
Padmanabhan, Nirmala; Siddiqui, Tabrez J
2017-01-01
This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.
SONAR Discovers RNA-Binding Proteins from Analysis of Large-Scale Protein-Protein Interactomes.
Brannan, Kristopher W; Jin, Wenhao; Huelga, Stephanie C; Banks, Charles A S; Gilmore, Joshua M; Florens, Laurence; Washburn, Michael P; Van Nostrand, Eric L; Pratt, Gabriel A; Schwinn, Marie K; Daniels, Danette L; Yeo, Gene W
2016-10-20
RNA metabolism is controlled by an expanding, yet incomplete, catalog of RNA-binding proteins (RBPs), many of which lack characterized RNA binding domains. Approaches to expand the RBP repertoire to discover non-canonical RBPs are currently needed. Here, HaloTag fusion pull down of 12 nuclear and cytoplasmic RBPs followed by quantitative mass spectrometry (MS) demonstrates that proteins interacting with multiple RBPs in an RNA-dependent manner are enriched for RBPs. This motivated SONAR, a computational approach that predicts RNA binding activity by analyzing large-scale affinity precipitation-MS protein-protein interactomes. Without relying on sequence or structure information, SONAR identifies 1,923 human, 489 fly, and 745 yeast RBPs, including over 100 human candidate RBPs that contain zinc finger domains. Enhanced CLIP confirms RNA binding activity and identifies transcriptome-wide RNA binding sites for SONAR-predicted RBPs, revealing unexpected RNA binding activity for disease-relevant proteins and DNA binding proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Schütze, Tonio; Ulrich, Alexander K C; Apelt, Luise; Will, Cindy L; Bartlick, Natascha; Seeger, Martin; Weber, Gert; Lührmann, Reinhard; Stelzl, Ulrich; Wahl, Markus C
2016-02-01
Spliceosomal Prp38 proteins contain a conserved amino-terminal domain, but only higher eukaryotic orthologs also harbor a carboxy-terminal RS domain, a hallmark of splicing regulatory SR proteins. We show by crystal structure analysis that the amino-terminal domain of human Prp38 is organized around three pairs of antiparallel α-helices and lacks similarities to RNA-binding domains found in canonical SR proteins. Instead, yeast two-hybrid analyses suggest that the amino-terminal domain is a versatile protein-protein interaction hub that possibly binds 12 other spliceosomal proteins, most of which are recruited at the same stage as Prp38. By quantitative, alanine surface-scanning two-hybrid screens and biochemical analyses we delineated four distinct interfaces on the Prp38 amino-terminal domain. In vitro interaction assays using recombinant proteins showed that Prp38 can bind at least two proteins simultaneously via two different interfaces. Addition of excess Prp38 amino-terminal domain to in vitro splicing assays, but not of an interaction-deficient mutant, stalled splicing at a precatalytic stage. Our results show that human Prp38 is an unusual SR protein, whose amino-terminal domain is a multi-interface protein-protein interaction platform that might organize the relative positioning of other proteins during splicing. © 2016 Schütze et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
A credit-card library approach for disrupting protein-protein interactions.
Xu, Yang; Shi, Jin; Yamamoto, Noboru; Moss, Jason A; Vogt, Peter K; Janda, Kim D
2006-04-15
Protein-protein interfaces are prominent in many therapeutically important targets. Using small organic molecules to disrupt protein-protein interactions is a current challenge in chemical biology. An important example of protein-protein interactions is provided by the Myc protein, which is frequently deregulated in human cancers. Myc belongs to the family of basic helix-loop-helix leucine zipper (bHLH-ZIP) transcription factors. It is biologically active only as heterodimer with the bHLH-ZIP protein Max. Herein, we report a new strategy for the disruption of protein-protein interactions that has been corroborated through the design and synthesis of a small parallel library composed of 'credit-card' compounds. These compounds are derived from a planar, aromatic scaffold and functionalized with four points of diversity. From a 285 membered library, several hits were obtained that disrupted the c-Myc-Max interaction and cellular functions of c-Myc. The IC50 values determined for this small focused library for the disruption of Myc-Max dimerization are quite potent, especially since small molecule antagonists of protein-protein interactions are notoriously difficult to find. Furthermore, several of the compounds were active at the cellular level as shown by their biological effects on Myc action in chicken embryo fibroblast assays. In light of our findings, this approach is considered a valuable addition to the armamentarium of new molecules being developed to interact with protein-protein interfaces. Finally, this strategy for disrupting protein-protein interactions should prove applicable to other families of proteins.
Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression
2005-04-26
reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al
Noninvasive imaging of protein-protein interactions in living animals
NASA Astrophysics Data System (ADS)
Luker, Gary D.; Sharma, Vijay; Pica, Christina M.; Dahlheimer, Julie L.; Li, Wei; Ochesky, Joseph; Ryan, Christine E.; Piwnica-Worms, Helen; Piwnica-Worms, David
2002-05-01
Protein-protein interactions control transcription, cell division, and cell proliferation as well as mediate signal transduction, oncogenic transformation, and regulation of cell death. Although a variety of methods have been used to investigate protein interactions in vitro and in cultured cells, none can analyze these interactions in intact, living animals. To enable noninvasive molecular imaging of protein-protein interactions in vivo by positron-emission tomography and fluorescence imaging, we engineered a fusion reporter gene comprising a mutant herpes simplex virus 1 thymidine kinase and green fluorescent protein for readout of a tetracycline-inducible, two-hybrid system in vivo. By using micro-positron-emission tomography, interactions between p53 tumor suppressor and the large T antigen of simian virus 40 were visualized in tumor xenografts of HeLa cells stably transfected with the imaging constructs. Imaging protein-binding partners in vivo will enable functional proteomics in whole animals and provide a tool for screening compounds targeted to specific protein-protein interactions in living animals.
NOXclass: prediction of protein-protein interaction types.
Zhu, Hongbo; Domingues, Francisco S; Sommer, Ingolf; Lengauer, Thomas
2006-01-19
Structural models determined by X-ray crystallography play a central role in understanding protein-protein interactions at the molecular level. Interpretation of these models requires the distinction between non-specific crystal packing contacts and biologically relevant interactions. This has been investigated previously and classification approaches have been proposed. However, less attention has been devoted to distinguishing different types of biological interactions. These interactions are classified as obligate and non-obligate according to the effect of the complex formation on the stability of the protomers. So far no automatic classification methods for distinguishing obligate, non-obligate and crystal packing interactions have been made available. Six interface properties have been investigated on a dataset of 243 protein interactions. The six properties have been combined using a support vector machine algorithm, resulting in NOXclass, a classifier for distinguishing obligate, non-obligate and crystal packing interactions. We achieve an accuracy of 91.8% for the classification of these three types of interactions using a leave-one-out cross-validation procedure. NOXclass allows the interpretation and analysis of protein quaternary structures. In particular, it generates testable hypotheses regarding the nature of protein-protein interactions, when experimental results are not available. We expect this server will benefit the users of protein structural models, as well as protein crystallographers and NMR spectroscopists. A web server based on the method and the datasets used in this study are available at http://noxclass.bioinf.mpi-inf.mpg.de/.
NASA Astrophysics Data System (ADS)
Millan, Jaime; McMillan, Janet; Brodin, Jeff; Lee, Byeongdu; Mirkin, Chad; Olvera de La Cruz, Monica
Programmable DNA interactions represent a robust scheme to self-assemble a rich variety of tunable superlattices, where intrinsic and in some cases non-desirable nano-scale building blocks interactions are substituted for DNA hybridization events. Recent advances in synthesis has allowed the extension of this successful scheme to proteins, where DNA distribution can be tuned independently of protein shape by selectively addressing surface residues, giving rise to assembly properties in three dimensional protein-nanoparticle superlattices dependent on DNA distribution. In parallel to this advances, we introduced a scalable coarse-grained model that faithfully reproduces the previously observed co-assemblies from nanoparticles and proteins conjugates. Herein, we implement this numerical model to explain the stability of complex protein-nanoparticle binary superlattices and to elucidate experimentally inaccessible features such as protein orientation. Also, we will discuss systematic studies that highlight the role of DNA distribution and sequence on two-dimensional protein-protein and protein-nanoparticle superlattices.
Hofmann, Melanie; Winzer, Matthias; Weber, Christian; Gieseler, Henning
2016-06-01
The development of highly concentrated protein formulations is more demanding than for conventional concentrations due to an elevated protein aggregation tendency. Predictive protein-protein interaction parameters, such as the second virial coefficient B22 or the interaction parameter kD, have already been used to predict aggregation tendency and optimize protein formulations. However, these parameters can only be determined in diluted solutions, up to 20 mg/mL. And their validity at high concentrations is currently controversially discussed. This work presents a μ-scale screening approach which has been adapted to early industrial project needs. The procedure is based on static light scattering to directly determine protein-protein interactions at concentrations up to 100 mg/mL. Three different therapeutic molecules were formulated, varying in pH, salt content, and addition of excipients (e.g., sugars, amino acids, polysorbates, or other macromolecules). Validity of the predicted aggregation tendency was confirmed by stability data of selected formulations. Based on the results obtained, the new prediction method is a promising screening tool for fast and easy formulation development of highly concentrated protein solutions, consuming only microliter of sample volumes. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Anomalous Protein-Protein Interactions in Multivalent Salt Solution.
Pasquier, Coralie; Vazdar, Mario; Forsman, Jan; Jungwirth, Pavel; Lund, Mikael
2017-04-13
The stability of aqueous protein solutions is strongly affected by multivalent ions, which induce ion-ion correlations beyond the scope of classical mean-field theory. Using all-atom molecular dynamics (MD) and coarse grained Monte Carlo (MC) simulations, we investigate the interaction between a pair of protein molecules in 3:1 electrolyte solution. In agreement with available experimental findings of "reentrant protein condensation", we observe an anomalous trend in the protein-protein potential of mean force with increasing electrolyte concentration in the order: (i) double-layer repulsion, (ii) ion-ion correlation attraction, (iii) overcharge repulsion, and in excess of 1:1 salt, (iv) non Coulombic attraction. To efficiently sample configurational space we explore hybrid continuum solvent models, applicable to many-protein systems, where weakly coupled ions are treated implicitly, while strongly coupled ones are treated explicitly. Good agreement is found with the primitive model of electrolytes, as well as with atomic models of protein and solvent.
Emerging Role of Protein-Protein Transnitrosylation in Cell Signaling Pathways
2013-01-01
Abstract Significance: Protein S-nitrosylation, a covalent reaction of a nitric oxide (NO) group with a critical protein thiol (or more properly thiolate anion), mediates an important form of redox-related signaling as well as aberrant signaling in disease states. Recent Advances: A growing literature suggests that over 3000 proteins are S-nitrosylated in cell systems. Our laboratory and several others have demonstrated that protein S-nitrosylation can regulate protein function by directly inhibiting catalytically active cysteines, by reacting with allosteric sites, or via influencing protein-protein interaction. For example, S-nitrosylation of critical cysteine thiols in protein-disulfide isomerase and in parkin alters their activity, thus contributing to protein misfolding in Parkinson's disease. Critical Issues: However, the mechanism by which specific protein S-nitrosylation occurs in cell signaling pathways is less well investigated. Interestingly, the recent discovery of protein-protein transnitrosylation reactions (transfer of an NO group from one protein to another) has revealed a unique mechanism whereby NO can S-nitrosylate a particular set of protein thiols, and represents a major class of nitrosylating/denitrosylating enzymes in mammalian systems. In this review, we will discuss recent evidence for transnitrosylation reactions between (i) hemoglobin/anion exchanger 1, (ii) thioredoxin/caspase-3, (iii) X-linked inhibitor of apoptosis/caspase-3, (iv) GAPDH-HDAC2/SIRT1/DNA-PK, and (v) Cdk5/dynamin related protein 1 (Drp1). This review also discusses experimental techniques useful in characterizing protein-protein transnitrosylations. Future Directions: Elucidation of additional transnitrosylation cascades will further our understanding of the enzymes that catalyze nitrosation, thereby contributing to NO-mediated signaling pathways. Antioxid. Redox Signal. 18, 239–249. PMID:22657837
Modular protein switches derived from antibody mimetic proteins.
Nicholes, N; Date, A; Beaujean, P; Hauk, P; Kanwar, M; Ostermeier, M
2016-02-01
Protein switches have potential applications as biosensors and selective protein therapeutics. Protein switches built by fusion of proteins with the prerequisite input and output functions are currently developed using an ad hoc process. A modular switch platform in which existing switches could be readily adapted to respond to any ligand would be advantageous. We investigated the feasibility of a modular protein switch platform based on fusions of the enzyme TEM-1 β-lactamase (BLA) with two different antibody mimetic proteins: designed ankyrin repeat proteins (DARPins) and monobodies. We created libraries of random insertions of the gene encoding BLA into genes encoding a DARPin or a monobody designed to bind maltose-binding protein (MBP). From these libraries, we used a genetic selection system for β-lactamase activity to identify genes that conferred MBP-dependent ampicillin resistance to Escherichia coli. Some of these selected genes encoded switch proteins whose enzymatic activity increased up to 14-fold in the presence of MBP. We next introduced mutations into the antibody mimetic domain of these switches that were known to cause binding to different ligands. To different degrees, introduction of the mutations resulted in switches with the desired specificity, illustrating the potential modularity of these platforms. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Optimizing energy functions for protein-protein interface design.
Sharabi, Oz; Yanover, Chen; Dekel, Ayelet; Shifman, Julia M
2011-01-15
Protein design methods have been originally developed for the design of monomeric proteins. When applied to the more challenging task of protein–protein complex design, these methods yield suboptimal results. In particular, they often fail to recapitulate favorable hydrogen bonds and electrostatic interactions across the interface. In this work, we aim to improve the energy function of the protein design program ORBIT to better account for binding interactions between proteins. By using the advanced machine learning framework of conditional random fields, we optimize the relative importance of all the terms in the energy function, attempting to reproduce the native side-chain conformations in protein–protein interfaces. We evaluate the performance of several optimized energy functions, each describes the van der Waals interactions using a different potential. In comparison with the original energy function, our best energy function (a) incorporates a much “softer” repulsive van der Waals potential, suitable for the discrete rotameric representation of amino acid side chains; (b) does not penalize burial of polar atoms, reflecting the frequent occurrence of polar buried residues in protein–protein interfaces; and (c) significantly up-weights the electrostatic term, attesting to the high importance of these interactions for protein–protein complex formation. Using this energy function considerably improves side chain placement accuracy for interface residues in a large test set of protein–protein complexes. Moreover, the optimized energy function recovers the native sequences of protein–protein interface at a higher rate than the default function and performs substantially better in predicting changes in free energy of binding due to mutations.
Meitzler, Jennifer L.; Hinde, Sara; Bánfi, Botond; Nauseef, William M.; Ortiz de Montellano, Paul R.
2013-01-01
Intramolecular disulfide bond formation is promoted in oxidizing extracellular and endoplasmic reticulum compartments and often contributes to protein stability and function. DUOX1 and DUOX2 are distinguished from other members of the NOX protein family by the presence of a unique extracellular N-terminal region. These peroxidase-like domains lack the conserved cysteines that confer structural stability to mammalian peroxidases. Sequence-based structure predictions suggest that the thiol groups present are solvent-exposed on a single protein surface and are too distant to support intramolecular disulfide bond formation. To investigate the role of these thiol residues, we introduced four individual cysteine to glycine mutations in the peroxidase-like domains of both human DUOXs and purified the recombinant proteins. The mutations caused little change in the stabilities of the monomeric proteins, supporting the hypothesis that the thiol residues are solvent-exposed and not involved in disulfide bonds that are critical for structural integrity. However, the ability of the isolated hDUOX1 peroxidase-like domain to dimerize was altered, suggesting a role for these cysteines in protein-protein interactions that could facilitate homodimerization of the peroxidase-like domain or, in the full-length protein, heterodimeric interactions with a maturation protein. When full-length hDUOX1 was expressed in HEK293 cells, the mutations resulted in decreased H2O2 production that correlated with a decreased amount of the enzyme localized to the membrane surface rather than with a loss of activity or with a failure to synthesize the mutant proteins. These results support a role for the cysteine residues in intermolecular disulfide bond formation with the DUOX maturation factor DUOXA1. PMID:23362256
B and T lymphocyte attenuator restricts the protective immune response against experimental malaria.
Adler, Guido; Steeg, Christiane; Pfeffer, Klaus; Murphy, Theresa L; Murphy, Kenneth M; Langhorne, Jean; Jacobs, Thomas
2011-11-15
The immune response against the blood stage of malaria has to be tightly regulated to allow for vigorous antiplasmodial activity while restraining potentially lethal immunopathologic damage to the host like cerebral malaria. Coinhibitory cell surface receptors are important modulators of immune activation. B and T lymphocyte attenuator (BTLA) (CD272) is a coinhibitory receptor expressed by most leukocytes, with the highest expression levels on T and B cells, and is involved in the maintenance of peripheral tolerance by dampening the activation of lymphocytes. The function of BTLA is described in several models of inflammatory disorders and autoimmunity, but its function in infectious diseases is less well characterized. Also, little is known about the influence of BTLA on non-T cells. In this study, we analyzed the function of BTLA during blood-stage malaria infection with the nonlethal Plasmodium yoelii strain 17NL. We show that BTLA knockout mice exhibit strongly reduced parasitemia and clear the infection earlier compared with wild-type mice. This increased resistance was seen before the onset of adaptive immune mechanisms and even in the absence of T and B cells but was more pronounced at later time points when activation of T and B cells was observed. We demonstrate that BTLA regulates production of proinflammatory cytokines in a T cell-intrinsic way and B cell intrinsically regulates the production of P. yoelii 17NL-specific Abs. These results indicate that the coinhibitory receptor BTLA plays a critical role during experimental malaria and attenuates the innate as well as the subsequent adaptive immune response.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lorenzini, Emily; Singer, Alexander; Singh, Bhag
2010-07-28
Comparative genomic studies have identified many proteins that are found only in various Chlamydiae species and exhibit no significant sequence similarity to any protein in organisms that do not belong to this group. The CT670 protein of Chlamydia trachomatis is one of the proteins whose genes are in one of the type III secretion gene clusters but whose cellular functions are not known. CT670 shares several characteristics with the YscO protein of Yersinia pestis, including the neighboring genes, size, charge, and secondary structure, but the structures and/or functions of these proteins remain to be determined. Although a BLAST search withmore » CT670 did not identify YscO as a related protein, our analysis indicated that these two proteins exhibit significant sequence similarity. In this paper, we report that the CT670 crystal, solved at a resolution of 2 {angstrom}, consists of a single coiled coil containing just two long helices. Gel filtration and analytical ultracentrifugation studies showed that in solution CT670 exists in both monomeric and dimeric forms and that the monomer predominates at lower protein concentrations. We examined the interaction of CT670 with many type III secretion system-related proteins (viz., CT091, CT665, CT666, CT667, CT668, CT669, CT671, CT672, and CT673) by performing bacterial two-hybrid assays. In these experiments, CT670 was found to interact only with the CT671 protein (YscP homolog), whose gene is immediately downstream of ct670. A specific interaction between CT670 and CT671 was also observed when affinity chromatography pull-down experiments were performed. These results suggest that CT670 and CT671 are putative homologs of the YcoO and YscP proteins, respectively, and that they likely form a chaperone-effector pair.« less
[Chromosomal proteins: histones and acid proteins].
Salvini, M; Gabrielli, F
1976-01-01
Experimental data about the chemistry and the biology of chromosomal proteins are reviewed. Paragraphs include: aminoacid sequential data and post-translational covalent modications of histones, histone chemical differences in different tissues of the same species and in homologous organs of different species, histone synthesis subcellular localization and its association with DNA synthesis, histone synthesis transcriptional and translational control, histone synthesis during meiosis, oogenesis and early embryogenesis. The possible role of histones as controllers of gene expression is discussed and a model of primary structure of chromatine is proposed. The "acidic proteins" data concern the high tissue eterogenity of these proteins and their role in the steroid-hormon-controlled gene expression. The possible role of acidic proteins as general controllers of gene expression in eucariotic cells is discussed.
Protein-protein interactions and cancer: targeting the central dogma.
Garner, Amanda L; Janda, Kim D
2011-01-01
Between 40,000 and 200,000 protein-protein interactions have been predicted to exist within the human interactome. As these interactions are of a critical nature in many important cellular functions and their dysregulation is causal of disease, the modulation of these binding events has emerged as a leading, yet difficult therapeutic arena. In particular, the targeting of protein-protein interactions relevant to cancer is of fundamental importance as the tumor-promoting function of several aberrantly expressed proteins in the cancerous state is directly resultant of its ability to interact with a protein-binding partner. Of significance, these protein complexes play a crucial role in each of the steps of the central dogma of molecular biology, the fundamental processes of genetic transmission. With the many important discoveries being made regarding the mechanisms of these genetic process, the identification of new chemical probes are needed to better understand and validate the druggability of protein-protein interactions related to the central dogma. In this review, we provide an overview of current small molecule-based protein-protein interaction inhibitors for each stage of the central dogma: transcription, mRNA splicing and translation. Importantly, through our analysis we have uncovered a lack of necessary probes targeting mRNA splicing and translation, thus, opening up the possibility for expansion of these fields.
Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.
He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J
2012-07-01
Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.
Dynamic imaging of protein-protein interactions by MP-FLIM
NASA Astrophysics Data System (ADS)
Ameer-Beg, Simon M.; Peter, Marion; Keppler, Melanie D.; Prag, Soren; Barber, Paul R.; Ng, Tony C.; Vojnovic, Borivoj
2005-03-01
The spatio-temporal localization of molecular interactions within cells in situ is of great importance in elucidating the key mechanisms in regulation of fundamental process within the cell. Measurements of such near-field localization of protein complexes may be achieved by the detection of fluorescence (or Forster) resonance energy transfer (FRET) between protein-conjugated fluorophores. We demonstrate the applicability of time-correlated single photon counting multiphoton microscopy to the spatio-temporal localization of protein-protein interactions in live and fixed cell populations. Intramolecular interactions between protein hetero-dimers are investigated using green fluorescent protein variants. We present an improved monomeric form of the red fluorescent protein, mRFP1, as the acceptor in biological fluorescence resonance energy transfer (FRET) experiments using the enhanced green fluorescent protein as donor. We find particular advantage in using this fluorophore pair for quantitative measurements of FRET. The technique was exploited to demonstrate a novel receptor-kinase interaction between the chemokine receptor (CXCR4) and protein kinase C (PKC) α in carcinoma cells for both live and fixed cell experiments.
Non-interacting surface solvation and dynamics in protein-protein interactions.
Visscher, Koen M; Kastritis, Panagiotis L; Bonvin, Alexandre M J J
2015-03-01
Protein-protein interactions control a plethora of cellular processes, including cell proliferation, differentiation, apoptosis, and signal transduction. Understanding how and why proteins interact will inevitably lead to novel structure-based drug design methods, as well as design of de novo binders with preferred interaction properties. At a structural and molecular level, interface and rim regions are not enough to fully account for the energetics of protein-protein binding, even for simple lock-and-key rigid binders. As we have recently shown, properties of the global surface might also play a role in protein-protein interactions. Here, we report on molecular dynamics simulations performed to understand solvent effects on protein-protein surfaces. We compare properties of the interface, rim, and non-interacting surface regions for five different complexes and their free components. Interface and rim residues become, as expected, less mobile upon complexation. However, non-interacting surface appears more flexible in the complex. Fluctuations of polar residues are always lower compared with charged ones, independent of the protein state. Further, stable water molecules are often observed around polar residues, in contrast to charged ones. Our analysis reveals that (a) upon complexation, the non-interacting surface can have a direct entropic compensation for the lower interface and rim entropy and (b) the mobility of the first hydration layer, which is linked to the stability of the protein-protein complex, is influenced by the local chemical properties of the surface. These findings corroborate previous hypotheses on the role of the hydration layer in shielding protein-protein complexes from unintended protein-protein interactions. © 2014 Wiley Periodicals, Inc.
Jones, Alan M
2010-01-01
N-myc downregulated (NDR) genes were discovered more than fifteen years ago. Indirect evidence support a role in tumor progression and cellular differentiation, but their biochemical function is still unknown. Our detailed analyses on Arabidopsis NDR proteins (deisgnated NDR-like, NDL) show their involvement in altering auxin transport, local auxin gradients and expression level of auxin transport proteins. Animal NDL proteins may be involved in membrane recycling of E-cadherin and effector for the small GTPase. In light of these findings, we hypothesize that NDL proteins regulate vesicular trafficking of auxin transport facilitator PIN proteins by biochemically alterating the local lipid environment of PIN proteins. PMID:20724844
The interface of protein structure, protein biophysics, and molecular evolution
Liberles, David A; Teichmann, Sarah A; Bahar, Ivet; Bastolla, Ugo; Bloom, Jesse; Bornberg-Bauer, Erich; Colwell, Lucy J; de Koning, A P Jason; Dokholyan, Nikolay V; Echave, Julian; Elofsson, Arne; Gerloff, Dietlind L; Goldstein, Richard A; Grahnen, Johan A; Holder, Mark T; Lakner, Clemens; Lartillot, Nicholas; Lovell, Simon C; Naylor, Gavin; Perica, Tina; Pollock, David D; Pupko, Tal; Regan, Lynne; Roger, Andrew; Rubinstein, Nimrod; Shakhnovich, Eugene; Sjölander, Kimmen; Sunyaev, Shamil; Teufel, Ashley I; Thorne, Jeffrey L; Thornton, Joseph W; Weinreich, Daniel M; Whelan, Simon
2012-01-01
Abstract The interface of protein structural biology, protein biophysics, molecular evolution, and molecular population genetics forms the foundations for a mechanistic understanding of many aspects of protein biochemistry. Current efforts in interdisciplinary protein modeling are in their infancy and the state-of-the art of such models is described. Beyond the relationship between amino acid substitution and static protein structure, protein function, and corresponding organismal fitness, other considerations are also discussed. More complex mutational processes such as insertion and deletion and domain rearrangements and even circular permutations should be evaluated. The role of intrinsically disordered proteins is still controversial, but may be increasingly important to consider. Protein geometry and protein dynamics as a deviation from static considerations of protein structure are also important. Protein expression level is known to be a major determinant of evolutionary rate and several considerations including selection at the mRNA level and the role of interaction specificity are discussed. Lastly, the relationship between modeling and needed high-throughput experimental data as well as experimental examination of protein evolution using ancestral sequence resurrection and in vitro biochemistry are presented, towards an aim of ultimately generating better models for biological inference and prediction. PMID:22528593
Evolutionary diversification of protein-protein interactions by interface add-ons.
Plach, Maximilian G; Semmelmann, Florian; Busch, Florian; Busch, Markus; Heizinger, Leonhard; Wysocki, Vicki H; Merkl, Rainer; Sterner, Reinhard
2017-10-03
Cells contain a multitude of protein complexes whose subunits interact with high specificity. However, the number of different protein folds and interface geometries found in nature is limited. This raises the question of how protein-protein interaction specificity is achieved on the structural level and how the formation of nonphysiological complexes is avoided. Here, we describe structural elements called interface add-ons that fulfill this function and elucidate their role for the diversification of protein-protein interactions during evolution. We identified interface add-ons in 10% of a representative set of bacterial, heteromeric protein complexes. The importance of interface add-ons for protein-protein interaction specificity is demonstrated by an exemplary experimental characterization of over 30 cognate and hybrid glutamine amidotransferase complexes in combination with comprehensive genetic profiling and protein design. Moreover, growth experiments showed that the lack of interface add-ons can lead to physiologically harmful cross-talk between essential biosynthetic pathways. In sum, our complementary in silico, in vitro, and in vivo analysis argues that interface add-ons are a practical and widespread evolutionary strategy to prevent the formation of nonphysiological complexes by specializing protein-protein interactions.
Identification of PDC-109-like protein(s) in buffalo seminal plasma.
Harshan, Hiron M; Sankar, Surya; Singh, L P; Singh, Manish Kumar; Sudharani, S; Ansari, M R; Singh, S K; Majumdar, A C; Joshi, P
2009-10-01
The FN-2 family of seminal plasma proteins represents the major protein fraction of bovine seminal plasma. These proteins also constitute the major seminal plasma proteins fraction in horse, goat and bison seminal plasma and are present in pig, rat, mouse, hamster and human seminal plasma. BSP-A1 and BSP-A2, the predominant proteins of the FN-2 family, are collectively termed as PDC-109. Fn-2 proteins play an important role in fertilization, including sperm capacitation and formation of oviductal sperm reservoirs. Significantly, BSP proteins were also shown to have negative effects in the context of sperm storage. No conclusive evidence for the presence of buffalo seminal plasma protein(s) similar to PDC-109 exists. Studies with buffalo seminal plasma indicated that isolation and identification of PDC-109-like protein(s) from buffalo seminal plasma by conventional methods might be difficult. Thus, antibodies raised against PDC-109 isolated, and purified from cattle seminal plasma, were used for investigating the presence of PDC-109-like protein(s) in buffalo seminal plasma. Buffalo seminal plasma proteins were resolved on SDS-PAGE, blotted to nitro cellulose membranes and probed for the presence of PDC-109-like protein(s) using the PDC-109 antisera raised in rabbits. A distinct immunoreactive band well below the 20-kDa regions indicated the presence of PDC-109-like protein(s) in buffalo seminal plasma.
Racemic & quasi-racemic protein crystallography enabled by chemical protein synthesis.
Kent, Stephen Bh
2018-04-04
A racemic protein mixture can be used to form centrosymmetric crystals for structure determination by X-ray diffraction. Both the unnatural d-protein and the corresponding natural l-protein are made by total chemical synthesis based on native chemical ligation-chemoselective condensation of unprotected synthetic peptide segments. Racemic protein crystallography is important for structure determination of the many natural protein molecules that are refractory to crystallization. Racemic mixtures facilitate the crystallization of recalcitrant proteins, and give diffraction-quality crystals. Quasi-racemic crystallization, using a single d-protein molecule, can facilitate the determination of the structures of a series of l-protein analog molecules. Copyright © 2018 Elsevier Ltd. All rights reserved.
General protein-protein cross-linking.
Alegria-Schaffer, Alice
2014-01-01
This protocol describes a general protein-to-protein cross-linking procedure using the water-soluble amine-reactive homobifunctional BS(3) (bis[sulfosuccinimidyl] suberate); however, the protocol can be easily adapted using other cross-linkers of similar properties. BS(3) is composed of two sulfo-NHS ester groups and an 11.4 Å linker. Sulfo-NHS ester groups react with primary amines in slightly alkaline conditions (pH 7.2-8.5) and yield stable amide bonds. The reaction releases N-hydroxysuccinimide (see an application of NHS esters on Labeling a protein with fluorophores using NHS ester derivitization). © 2014 Elsevier Inc. All rights reserved.
Surface energetics and protein-protein interactions: analysis and mechanistic implications
Peri, Claudio; Morra, Giulia; Colombo, Giorgio
2016-01-01
Understanding protein-protein interactions (PPI) at the molecular level is a fundamental task in the design of new drugs, the prediction of protein function and the clarification of the mechanisms of (dis)regulation of biochemical pathways. In this study, we use a novel computational approach to investigate the energetics of aminoacid networks located on the surface of proteins, isolated and in complex with their respective partners. Interestingly, the analysis of individual proteins identifies patches of surface residues that, when mapped on the structure of their respective complexes, reveal regions of residue-pair couplings that extend across the binding interfaces, forming continuous motifs. An enhanced effect is visible across the proteins of the dataset forming larger quaternary assemblies. The method indicates the presence of energetic signatures in the isolated proteins that are retained in the bound form, which we hypothesize to determine binding orientation upon complex formation. We propose our method, BLUEPRINT, as a complement to different approaches ranging from the ab-initio characterization of PPIs, to protein-protein docking algorithms, for the physico-chemical and functional investigation of protein-protein interactions. PMID:27050828
Quality control methodology for high-throughput protein-protein interaction screening.
Vazquez, Alexei; Rual, Jean-François; Venkatesan, Kavitha
2011-01-01
Protein-protein interactions are key to many aspects of the cell, including its cytoskeletal structure, the signaling processes in which it is involved, or its metabolism. Failure to form protein complexes or signaling cascades may sometimes translate into pathologic conditions such as cancer or neurodegenerative diseases. The set of all protein interactions between the proteins encoded by an organism constitutes its protein interaction network, representing a scaffold for biological function. Knowing the protein interaction network of an organism, combined with other sources of biological information, can unravel fundamental biological circuits and may help better understand the molecular basics of human diseases. The protein interaction network of an organism can be mapped by combining data obtained from both low-throughput screens, i.e., "one gene at a time" experiments and high-throughput screens, i.e., screens designed to interrogate large sets of proteins at once. In either case, quality controls are required to deal with the inherent imperfect nature of experimental assays. In this chapter, we discuss experimental and statistical methodologies to quantify error rates in high-throughput protein-protein interactions screens.
Purine inhibitors of protein kinases, G proteins and polymerases
Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent
2001-07-03
The present invention relates to purine analogs that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such purine analogs to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.
Mapping monomeric threading to protein-protein structure prediction.
Guerler, Aysam; Govindarajoo, Brandon; Zhang, Yang
2013-03-25
The key step of template-based protein-protein structure prediction is the recognition of complexes from experimental structure libraries that have similar quaternary fold. Maintaining two monomer and dimer structure libraries is however laborious, and inappropriate library construction can degrade template recognition coverage. We propose a novel strategy SPRING to identify complexes by mapping monomeric threading alignments to protein-protein interactions based on the original oligomer entries in the PDB, which does not rely on library construction and increases the efficiency and quality of complex template recognitions. SPRING is tested on 1838 nonhomologous protein complexes which can recognize correct quaternary template structures with a TM score >0.5 in 1115 cases after excluding homologous proteins. The average TM score of the first model is 60% and 17% higher than that by HHsearch and COTH, respectively, while the number of targets with an interface RMSD <2.5 Å by SPRING is 134% and 167% higher than these competing methods. SPRING is controlled with ZDOCK on 77 docking benchmark proteins. Although the relative performance of SPRING and ZDOCK depends on the level of homology filters, a combination of the two methods can result in a significantly higher model quality than ZDOCK at all homology thresholds. These data demonstrate a new efficient approach to quaternary structure recognition that is ready to use for genome-scale modeling of protein-protein interactions due to the high speed and accuracy.
Quantifying the Molecular Origins of Opposite Solvent Effects on Protein-Protein Interactions
Vagenende, Vincent; Han, Alvin X.; Pek, Han B.; Loo, Bernard L. W.
2013-01-01
Although the nature of solvent-protein interactions is generally weak and non-specific, addition of cosolvents such as denaturants and osmolytes strengthens protein-protein interactions for some proteins, whereas it weakens protein-protein interactions for others. This is exemplified by the puzzling observation that addition of glycerol oppositely affects the association constants of two antibodies, D1.3 and D44.1, with lysozyme. To resolve this conundrum, we develop a methodology based on the thermodynamic principles of preferential interaction theory and the quantitative characterization of local protein solvation from molecular dynamics simulations. We find that changes of preferential solvent interactions at the protein-protein interface quantitatively account for the opposite effects of glycerol on the antibody-antigen association constants. Detailed characterization of local protein solvation in the free and associated protein states reveals how opposite solvent effects on protein-protein interactions depend on the extent of dewetting of the protein-protein contact region and on structural changes that alter cooperative solvent-protein interactions at the periphery of the protein-protein interface. These results demonstrate the direct relationship between macroscopic solvent effects on protein-protein interactions and atom-scale solvent-protein interactions, and establish a general methodology for predicting and understanding solvent effects on protein-protein interactions in diverse biological environments. PMID:23696727
Quantifying the molecular origins of opposite solvent effects on protein-protein interactions.
Vagenende, Vincent; Han, Alvin X; Pek, Han B; Loo, Bernard L W
2013-01-01
Although the nature of solvent-protein interactions is generally weak and non-specific, addition of cosolvents such as denaturants and osmolytes strengthens protein-protein interactions for some proteins, whereas it weakens protein-protein interactions for others. This is exemplified by the puzzling observation that addition of glycerol oppositely affects the association constants of two antibodies, D1.3 and D44.1, with lysozyme. To resolve this conundrum, we develop a methodology based on the thermodynamic principles of preferential interaction theory and the quantitative characterization of local protein solvation from molecular dynamics simulations. We find that changes of preferential solvent interactions at the protein-protein interface quantitatively account for the opposite effects of glycerol on the antibody-antigen association constants. Detailed characterization of local protein solvation in the free and associated protein states reveals how opposite solvent effects on protein-protein interactions depend on the extent of dewetting of the protein-protein contact region and on structural changes that alter cooperative solvent-protein interactions at the periphery of the protein-protein interface. These results demonstrate the direct relationship between macroscopic solvent effects on protein-protein interactions and atom-scale solvent-protein interactions, and establish a general methodology for predicting and understanding solvent effects on protein-protein interactions in diverse biological environments.
Functionalizing Microporous Membranes for Protein Purification and Protein Digestion
NASA Astrophysics Data System (ADS)
Dong, Jinlan; Bruening, Merlin L.
2015-07-01
This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO2 nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.
Functionalizing Microporous Membranes for Protein Purification and Protein Digestion.
Dong, Jinlan; Bruening, Merlin L
2015-01-01
This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO₂ nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.
Hostetler, Jessica B.; Sharma, Sumana; Bartholdson, S. Josefin; Wright, Gavin J.; Fairhurst, Rick M.; Rayner, Julian C.
2015-01-01
Background A vaccine targeting Plasmodium vivax will be an essential component of any comprehensive malaria elimination program, but major gaps in our understanding of P. vivax biology, including the protein-protein interactions that mediate merozoite invasion of reticulocytes, hinder the search for candidate antigens. Only one ligand-receptor interaction has been identified, that between P. vivax Duffy Binding Protein (PvDBP) and the erythrocyte Duffy Antigen Receptor for Chemokines (DARC), and strain-specific immune responses to PvDBP make it a complex vaccine target. To broaden the repertoire of potential P. vivax merozoite-stage vaccine targets, we exploited a recent breakthrough in expressing full-length ectodomains of Plasmodium proteins in a functionally-active form in mammalian cells and initiated a large-scale study of P. vivax merozoite proteins that are potentially involved in reticulocyte binding and invasion. Methodology/Principal Findings We selected 39 P. vivax proteins that are predicted to localize to the merozoite surface or invasive secretory organelles, some of which show homology to P. falciparum vaccine candidates. Of these, we were able to express 37 full-length protein ectodomains in a mammalian expression system, which has been previously used to express P. falciparum invasion ligands such as PfRH5. To establish whether the expressed proteins were correctly folded, we assessed whether they were recognized by antibodies from Cambodian patients with acute vivax malaria. IgG from these samples showed at least a two-fold change in reactivity over naïve controls in 27 of 34 antigens tested, and the majority showed heat-labile IgG immunoreactivity, suggesting the presence of conformation-sensitive epitopes and native tertiary protein structures. Using a method specifically designed to detect low-affinity, extracellular protein-protein interactions, we confirmed a predicted interaction between P. vivax 6-cysteine proteins P12 and P41, further
Measuring protein-protein and protein-nucleic Acid interactions by biolayer interferometry.
Sultana, Azmiri; Lee, Jeffrey E
2015-02-02
Biolayer interferometry (BLI) is a simple, optical dip-and-read system useful for measuring interactions between proteins, peptides, nucleic acids, small molecules, and/or lipids in real time. In BLI, a biomolecular bait is immobilized on a matrix at the tip of a fiber-optic sensor. The binding between the immobilized ligand and another molecule in an analyte solution produces a change in optical thickness at the tip and results in a wavelength shift proportional to binding. BLI provides direct binding affinities and rates of association and dissociation. This unit describes an efficient approach using streptavidin-based BLI to analyze DNA-protein and protein-protein interactions. A quantitative set of equilibrium binding affinities (K(d)) and rates of association and dissociation (k(a)/k(d)) can be measured in minutes using nanomole quantities of sample. Copyright © 2015 John Wiley & Sons, Inc.
[Detection of protein-protein interactions by FRET and BRET methods].
Matoulková, E; Vojtěšek, B
2014-01-01
Nowadays, in vivo protein-protein interaction studies have become preferable detecting meth-ods that enable to show or specify (already known) protein interactions and discover their inhibitors. They also facilitate detection of protein conformational changes and discovery or specification of signaling pathways in living cells. One group of in vivo methods enabling these findings is based on fluorescent resonance energy transfer (FRET) and its bio-luminescent modification (BRET). They are based on visualization of protein-protein interactions via light or enzymatic excitation of fluorescent or bio-luminescent proteins. These methods allow not only protein localization within the cell or its organelles (or small animals) but they also allow us to quantify fluorescent signals and to discover weak or strong interaction partners. In this review, we explain the principles of FRET and BRET, their applications in the characterization of protein-protein interactions and we describe several findings using these two methods that clarify molecular and cellular mechanisms and signals related to cancer biology.
New paradigm in ankyrin repeats: Beyond protein-protein interaction module.
Islam, Zeyaul; Nagampalli, Raghavendra Sashi Krishna; Fatima, Munazza Tamkeen; Ashraf, Ghulam Md
2018-04-01
Classically, ankyrin repeat (ANK) proteins are built from tandems of two or more repeats and form curved solenoid structures that are associated with protein-protein interactions. These are short, widespread structural motif of around 33 amino acids repeats in tandem, having a canonical helix-loop-helix fold, found individually or in combination with other domains. The multiplicity of structural pattern enables it to form assemblies of diverse sizes, required for their abilities to confer multiple binding and structural roles of proteins. Three-dimensional structures of these repeats determined to date reveal a degree of structural variability that translates into the considerable functional versatility of this protein superfamily. Recent work on the ANK has proposed novel structural information, especially protein-lipid, protein-sugar and protein-protein interaction. Self-assembly of these repeats was also shown to prevent the associated protein in forming filaments. In this review, we summarize the latest findings and how the new structural information has increased our understanding of the structural determinants of ANK proteins. We discussed latest findings on how these proteins participate in various interactions to diversify the ANK roles in numerous biological processes, and explored the emerging and evolving field of designer ankyrins and its framework for protein engineering emphasizing on biotechnological applications. Copyright © 2017 Elsevier B.V. All rights reserved.
Correction to: The NMR contribution to protein-protein networking in Fe-S protein maturation.
Banci, Lucia; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Piccioli, Mario
2018-05-31
The article "The NMR contribution to protein-protein networking in Fe-S protein maturation", written by Lucia Banci, Francesca Camponeschi, Simone Ciofi‑Baffoni, Mario Piccioli was originally published electronically on the publisher's internet portal (currently SpringerLink) on 22 March, 2018 without open access.
Protein supplementation with sports protein bars in renal patients.
Meade, Anthony
2007-05-01
Malnutrition prevalence in patients on dialysis is well established. The protein requirements for both hemodialysis and peritoneal dialysis have been documented elsewhere, including the Kidney Disease Outcomes Quality Initiative Clinical Practice Guidelines for Nutrition in Chronic Renal Failure. The clinical challenge is to assist patients in meeting these targets, especially in those with anorexia. Traditional supplements have included fluid, which is an issue for patients who are fluid restricted. The study objectives were to (1) investigate the range of sports protein supplements that may be suitable for patients on hemodialysis to use and (2) trial nonfluid protein supplements in patients on hemodialysis. Known manufacturers of sports protein bars and other sports supplements available in Australia were contacted for the nutrient breakdown of high-protein products, specifically potassium, protein, and phosphorus contents. As a result, selected high-protein sports bars (Protein FX, Aussie Bodies, Port Melbourne, Victoria, Australia) were used as an alternative to the more commonly used renal-specific fluid supplements (Nepro, Abbott Laboratories, Abbott Park, IL; Novasource Renal, Novartis Nutrition Corporation, Fremont, MI; and Renilon, Nutricia, Wiltshire, UK) in patients with poor nutritional status requiring supplementation. Patient satisfaction and clinical nutrition markers were investigated. The study took place at inpatient, in-center, and satellite hemodialysis settings in Adelaide, South Australia. A total of 32 patients (16 females and 16 males) with an average age of 62.9 years (range 32-86 years) undergoing hemodialysis (acute and maintenance) were included. Subjects were selected by the author as part of routine clinical nutrition care. Patients trialed sports protein bars as a protein supplement alone or in conjunction with other supplementary products. All patients were in favor of the trial, with 22 of 32 patients continuing with the protein
Protein enriched pasta: structure and digestibility of its protein network.
Laleg, Karima; Barron, Cécile; Santé-Lhoutellier, Véronique; Walrand, Stéphane; Micard, Valérie
2016-02-01
Wheat (W) pasta was enriched in 6% gluten (G), 35% faba (F) or 5% egg (E) to increase its protein content (13% to 17%). The impact of the enrichment on the multiscale structure of the pasta and on in vitro protein digestibility was studied. Increasing the protein content (W- vs. G-pasta) strengthened pasta structure at molecular and macroscopic scales but reduced its protein digestibility by 3% by forming a higher covalently linked protein network. Greater changes in the macroscopic and molecular structure of the pasta were obtained by varying the nature of protein used for enrichment. Proteins in G- and E-pasta were highly covalently linked (28-32%) resulting in a strong pasta structure. Conversely, F-protein (98% SDS-soluble) altered the pasta structure by diluting gluten and formed a weak protein network (18% covalent link). As a result, protein digestibility in F-pasta was significantly higher (46%) than in E- (44%) and G-pasta (39%). The effect of low (55 °C, LT) vs. very high temperature (90 °C, VHT) drying on the protein network structure and digestibility was shown to cause greater molecular changes than pasta formulation. Whatever the pasta, a general strengthening of its structure, a 33% to 47% increase in covalently linked proteins and a higher β-sheet structure were observed. However, these structural differences were evened out after the pasta was cooked, resulting in identical protein digestibility in LT and VHT pasta. Even after VHT drying, F-pasta had the best amino acid profile with the highest protein digestibility, proof of its nutritional interest.
Transmembrane proteins in the Protein Data Bank: identification and classification.
Tusnády, Gábor E; Dosztányi, Zsuzsanna; Simon, István
2004-11-22
Integral membrane proteins play important roles in living cells. Although these proteins are estimated to constitute 25% of proteins at a genomic scale, the Protein Data Bank (PDB) contains only a few hundred membrane proteins due to the difficulties with experimental techniques. The presence of transmembrane proteins in the structure data bank, however, is quite invisible, as the annotation of these entries is rather poor. Even if a protein is identified as a transmembrane one, the possible location of the lipid bilayer is not indicated in the PDB because these proteins are crystallized without their natural lipid bilayer, and currently no method is publicly available to detect the possible membrane plane using the atomic coordinates of membrane proteins. Here, we present a new geometrical approach to distinguish between transmembrane and globular proteins using structural information only and to locate the most likely position of the lipid bilayer. An automated algorithm (TMDET) is given to determine the membrane planes relative to the position of atomic coordinates, together with a discrimination function which is able to separate transmembrane and globular proteins even in cases of low resolution or incomplete structures such as fragments or parts of large multi chain complexes. This method can be used for the proper annotation of protein structures containing transmembrane segments and paves the way to an up-to-date database containing the structure of all known transmembrane proteins and fragments (PDB_TM) which can be automatically updated. The algorithm is equally important for the purpose of constructing databases purely of globular proteins.
Predicting protein crystallization propensity from protein sequence
2011-01-01
The high-throughput structure determination pipelines developed by structural genomics programs offer a unique opportunity for data mining. One important question is how protein properties derived from a primary sequence correlate with the protein’s propensity to yield X-ray quality crystals (crystallizability) and 3D X-ray structures. A set of protein properties were computed for over 1,300 proteins that expressed well but were insoluble, and for ~720 unique proteins that resulted in X-ray structures. The correlation of the protein’s iso-electric point and grand average hydropathy (GRAVY) with crystallizability was analyzed for full length and domain constructs of protein targets. In a second step, several additional properties that can be calculated from the protein sequence were added and evaluated. Using statistical analyses we have identified a set of the attributes correlating with a protein’s propensity to crystallize and implemented a Support Vector Machine (SVM) classifier based on these. We have created applications to analyze and provide optimal boundary information for query sequences and to visualize the data. These tools are available via the web site http://bioinformatics.anl.gov/cgi-bin/tools/pdpredictor. PMID:20177794
Hayakawa, Eri H; Matsuoka, Hiroyuki
2016-10-01
Scanning electron microscopy (SEM) is a powerful tool used to investigate object surfaces and has been widely applied in both material science and biology. With respect to the study of malaria, SEM revealed that erythrocytes infected with Plasmodium falciparum, a human parasite, display 'knob-like' structures on their surface comprising parasitized proteins. However, detailed methodology for SEM studies of malaria parasites is lacking in the literature making such studies challenging. Here, we provide a step-by-step guide to preparing Plasmodium-infected erythrocytes from two mouse strains for SEM analysis with minimal structural deterioration. We tested three species of murine malaria parasites, P. berghei, P. yoelii, and P. chabaudi, as well as non-parasitized human erythrocytes and P. falciparum-infected erythrocytes for comparisons. Our data demonstrated that the surface structures of parasitized erythrocytes between the three species of murine parasites in the two different strains of mice were indistinguishable and no surface alterations were observed in P. falciparum-erythrocytes. Our SEM observations contribute towards an understanding of the molecular mechanisms of parasite maturation in the erythrocyte cytoplasm and, along with future studies using our detailed methodology, may help to gain insight into the clinical phenomena of human malaria. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Personalizing Protein Nourishment
DALLAS, DAVID C.; SANCTUARY, MEGAN R.; QU, YUNYAO; KHAJAVI, SHABNAM HAGHIGHAT; VAN ZANDT, ALEXANDRIA E.; DYANDRA, MELISSA; FRESE, STEVEN A.; BARILE, DANIELA; GERMAN, J. BRUCE
2016-01-01
Proteins are not equally digestible—their proteolytic susceptibility varies by their source and processing method. Incomplete digestion increases colonic microbial protein fermentation (putrefaction), which produces toxic metabolites that can induce inflammation in vitro and have been associated with inflammation in vivo. Individual humans differ in protein digestive capacity based on phenotypes, particularly disease states. To avoid putrefaction-induced intestinal inflammation, protein sources and processing methods must be tailored to the consumer’s digestive capacity. This review explores how food processing techniques alter protein digestibility and examines how physiological conditions alter digestive capacity. Possible solutions to improving digestive function or matching low digestive capacity with more digestible protein sources are explored. Beyond the ileal digestibility measurements of protein digestibility, less invasive, quicker and cheaper techniques for monitoring the extent of protein digestion and fermentation are needed to personalize protein nourishment. Biomarkers of protein digestive capacity and efficiency can be identified with the toolsets of peptidomics, metabolomics, microbial sequencing and multiplexed protein analysis of fecal and urine samples. By monitoring individual protein digestive function, the protein component of diets can be tailored via protein source and processing selection to match individual needs to minimize colonic putrefaction and, thus, optimize gut health. PMID:26713355
Energy design for protein-protein interactions
Ravikant, D. V. S.; Elber, Ron
2011-01-01
Proteins bind to other proteins efficiently and specifically to carry on many cell functions such as signaling, activation, transport, enzymatic reactions, and more. To determine the geometry and strength of binding of a protein pair, an energy function is required. An algorithm to design an optimal energy function, based on empirical data of protein complexes, is proposed and applied. Emphasis is made on negative design in which incorrect geometries are presented to the algorithm that learns to avoid them. For the docking problem the search for plausible geometries can be performed exhaustively. The possible geometries of the complex are generated on a grid with the help of a fast Fourier transform algorithm. A novel formulation of negative design makes it possible to investigate iteratively hundreds of millions of negative examples while monotonically improving the quality of the potential. Experimental structures for 640 protein complexes are used to generate positive and negative examples for learning parameters. The algorithm designed in this work finds the correct binding structure as the lowest energy minimum in 318 cases of the 640 examples. Further benchmarks on independent sets confirm the significant capacity of the scoring function to recognize correct modes of interactions. PMID:21842951
General introduction: recombinant protein production and purification of insoluble proteins.
Ferrer-Miralles, Neus; Saccardo, Paolo; Corchero, José Luis; Xu, Zhikun; García-Fruitós, Elena
2015-01-01
Proteins are synthesized in heterologous systems because of the impossibility to obtain satisfactory yields from natural sources. The production of soluble and functional recombinant proteins is among the main goals in the biotechnological field. In this context, it is important to point out that under stress conditions, protein folding machinery is saturated and this promotes protein misfolding and, consequently, protein aggregation. Thus, the selection of the optimal expression organism and the most appropriate growth conditions to minimize the formation of insoluble proteins should be done according to the protein characteristics and downstream requirements. Escherichia coli is the most popular recombinant protein expression system despite the great development achieved so far by eukaryotic expression systems. Besides, other prokaryotic expression systems, such as lactic acid bacteria and psychrophilic bacteria, are gaining interest in this field. However, it is worth mentioning that prokaryotic expression system poses, in many cases, severe restrictions for a successful heterologous protein production. Thus, eukaryotic systems such as mammalian cells, insect cells, yeast, filamentous fungus, and microalgae are an interesting alternative for the production of these difficult-to-express proteins.
Prediction of scaffold proteins based on protein interaction and domain architectures.
Oh, Kimin; Yi, Gwan-Su
2016-07-28
Scaffold proteins are known for being crucial regulators of various cellular functions by assembling multiple proteins involved in signaling and metabolic pathways. Identification of scaffold proteins and the study of their molecular mechanisms can open a new aspect of cellular systemic regulation and the results can be applied in the field of medicine and engineering. Despite being highlighted as the regulatory roles of dozens of scaffold proteins, there was only one known computational approach carried out so far to find scaffold proteins from interactomes. However, there were limitations in finding diverse types of scaffold proteins because their criteria were restricted to the classical scaffold proteins. In this paper, we will suggest a systematic approach to predict massive scaffold proteins from interactomes and to characterize the roles of scaffold proteins comprehensively. From a total of 10,419 basic scaffold protein candidates in protein interactomes, we classified them into three classes according to the structural evidences for scaffolding, such as domain architectures, domain interactions and protein complexes. Finally, we could define 2716 highly reliable scaffold protein candidates and their characterized functional features. To assess the accuracy of our prediction, the gold standard positive and negative data sets were constructed. We prepared 158 gold standard positive data and 844 gold standard negative data based on the functional information from Gene Ontology consortium. The precision, sensitivity and specificity of our testing was 80.3, 51.0, and 98.5 % respectively. Through the function enrichment analysis of highly reliable scaffold proteins, we could confirm the significantly enriched functions that are related to scaffold protein binding. We also identified functional association between scaffold proteins and their recruited proteins. Furthermore, we checked that the disease association of scaffold proteins is higher than kinases. In
Purine inhibitors of protein kinases, G proteins and polymerases
Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent
2004-10-12
The present invention relates to 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.
Zhao, Le; Lu, Wuyuan
2017-01-01
Proteins composed entirely of unnatural D-amino acids and the achiral amino acid glycine are mirror image forms of their native L-protein counterparts. Recent advances in chemical protein synthesis afford unique and facile synthetic access to domain-sized mirror image D-proteins, enabling protein research to be conducted through “the looking glass” and in a way previously unattainable. D-proteins can facilitate structure determination of their native L-forms that are difficult to crystallize (racemic X-ray crystallography); D-proteins can serve as the bait for library screening to ultimately yield pharmacologically superior D-peptide/D-protein therapeutics (mirror image phage display); D-proteins can also be used as a powerful mechanistic tool for probing molecular events in biology. This review examines recent progress in the application of mirror image proteins to structural biology, drug discovery, and immunology. PMID:25282524
Protein-Protein Interface Predictions by Data-Driven Methods: A Review
Xue, Li C; Dobbs, Drena; Bonvin, Alexandre M.J.J.; Honavar, Vasant
2015-01-01
Reliably pinpointing which specific amino acid residues form the interface(s) between a protein and its binding partner(s) is critical for understanding the structural and physicochemical determinants of protein recognition and binding affinity, and has wide applications in modeling and validating protein interactions predicted by high-throughput methods, in engineering proteins, and in prioritizing drug targets. Here, we review the basic concepts, principles and recent advances in computational approaches to the analysis and prediction of protein-protein interfaces. We point out caveats for objectively evaluating interface predictors, and discuss various applications of data-driven interface predictors for improving energy model-driven protein-protein docking. Finally, we stress the importance of exploiting binding partner information in reliably predicting interfaces and highlight recent advances in this emerging direction. PMID:26460190
The Proteins API: accessing key integrated protein and genome information
Antunes, Ricardo; Alpi, Emanuele; Gonzales, Leonardo; Liu, Wudong; Luo, Jie; Qi, Guoying; Turner, Edd
2017-01-01
Abstract The Proteins API provides searching and programmatic access to protein and associated genomics data such as curated protein sequence positional annotations from UniProtKB, as well as mapped variation and proteomics data from large scale data sources (LSS). Using the coordinates service, researchers are able to retrieve the genomic sequence coordinates for proteins in UniProtKB. This, the LSS genomics and proteomics data for UniProt proteins is programmatically only available through this service. A Swagger UI has been implemented to provide documentation, an interface for users, with little or no programming experience, to ‘talk’ to the services to quickly and easily formulate queries with the services and obtain dynamically generated source code for popular programming languages, such as Java, Perl, Python and Ruby. Search results are returned as standard JSON, XML or GFF data objects. The Proteins API is a scalable, reliable, fast, easy to use RESTful services that provides a broad protein information resource for users to ask questions based upon their field of expertise and allowing them to gain an integrated overview of protein annotations available to aid their knowledge gain on proteins in biological processes. The Proteins API is available at (http://www.ebi.ac.uk/proteins/api/doc). PMID:28383659
Berwanger, Anja; Eyrisch, Susanne; Schuster, Inge; Helms, Volkhard; Bernhardt, Rita
2010-02-01
Modulations of protein-protein interactions are a key step in regulating protein function, especially in networks. Modulators of these interactions are supposed to be candidates for the development of novel drugs. Here, we describe the role of the small, polycationic and highly abundant natural polyamines that could efficiently bind to charged spots at protein interfaces as modulators of such protein-protein interactions. Using the mitochondrial cytochrome P45011A1 (CYP11A1) electron transfer system as a model, we have analyzed the capability of putrescine, spermidine, and spermine at physiologically relevant concentrations to affect the protein-protein interactions between adrenodoxin reductase (AdR), adrenodoxin (Adx), and CYP11A1. The actions of polyamines on the individual components, on their association/dissociation, on electron transfer, and on substrate conversion were examined. These studies revealed modulating effects of polyamines on distinct interactions and on the entire system in a complex way. Modulation via changed protein-protein interactions appeared plausible from docking experiments that suggested favourable high-affinity binding sites of polyamines (spermine>spermidine>putrescine) at the AdR-Adx interface. Our findings imply for the first time that small endogenous compounds are capable of interfering with distinct components of transient protein complexes and might control protein functions by modulating electrostatic protein-protein interactions.
PDZ Protein Regulation of G Protein-Coupled Receptor Trafficking and Signaling Pathways.
Dunn, Henry A; Ferguson, Stephen S G
2015-10-01
G protein-coupled receptors (GPCRs) contribute to the regulation of every aspect of human physiology and are therapeutic targets for the treatment of numerous diseases. As a consequence, understanding the myriad of mechanisms controlling GPCR signaling and trafficking is essential for the development of new pharmacological strategies for the treatment of human pathologies. Of the many GPCR-interacting proteins, postsynaptic density protein of 95 kilodaltons, disc large, zona occludens-1 (PDZ) domain-containing proteins appear most abundant and have similarly been implicated in disease mechanisms. PDZ proteins play an important role in regulating receptor and channel protein localization within synapses and tight junctions and function to scaffold intracellular signaling protein complexes. In the current study, we review the known functional interactions between PDZ domain-containing proteins and GPCRs and provide insight into the potential mechanisms of action. These PDZ domain-containing proteins include the membrane-associated guanylate-like kinases [postsynaptic density protein of 95 kilodaltons; synapse-associated protein of 97 kilodaltons; postsynaptic density protein of 93 kilodaltons; synapse-associated protein of 102 kilodaltons; discs, large homolog 5; caspase activation and recruitment domain and membrane-associated guanylate-like kinase domain-containing protein 3; membrane protein, palmitoylated 3; calcium/calmodulin-dependent serine protein kinase; membrane-associated guanylate kinase protein (MAGI)-1, MAGI-2, and MAGI-3], Na(+)/H(+) exchanger regulatory factor proteins (NHERFs) (NHERF1, NHERF2, PDZ domain-containing kidney protein 1, and PDZ domain-containing kidney protein 2), Golgi-associated PDZ proteins (Gα-binding protein interacting protein, C-terminus and CFTR-associated ligand), PDZ domain-containing guanine nucleotide exchange factors (GEFs) 1 and 2, regulator of G protein signaling (RGS)-homology-RhoGEFs (PDZ domain-containing RhoGEF and
Integrated web visualizations for protein-protein interaction databases.
Jeanquartier, Fleur; Jean-Quartier, Claire; Holzinger, Andreas
2015-06-16
Understanding living systems is crucial for curing diseases. To achieve this task we have to understand biological networks based on protein-protein interactions. Bioinformatics has come up with a great amount of databases and tools that support analysts in exploring protein-protein interactions on an integrated level for knowledge discovery. They provide predictions and correlations, indicate possibilities for future experimental research and fill the gaps to complete the picture of biochemical processes. There are numerous and huge databases of protein-protein interactions used to gain insights into answering some of the many questions of systems biology. Many computational resources integrate interaction data with additional information on molecular background. However, the vast number of diverse Bioinformatics resources poses an obstacle to the goal of understanding. We present a survey of databases that enable the visual analysis of protein networks. We selected M=10 out of N=53 resources supporting visualization, and we tested against the following set of criteria: interoperability, data integration, quantity of possible interactions, data visualization quality and data coverage. The study reveals differences in usability, visualization features and quality as well as the quantity of interactions. StringDB is the recommended first choice. CPDB presents a comprehensive dataset and IntAct lets the user change the network layout. A comprehensive comparison table is available via web. The supplementary table can be accessed on http://tinyurl.com/PPI-DB-Comparison-2015. Only some web resources featuring graph visualization can be successfully applied to interactive visual analysis of protein-protein interaction. Study results underline the necessity for further enhancements of visualization integration in biochemical analysis tools. Identified challenges are data comprehensiveness, confidence, interactive feature and visualization maturing.
RNA polymerase II conserved protein domains as platforms for protein-protein interactions
García-López, M Carmen
2011-01-01
RNA polymerase II establishes many protein-protein interactions with transcriptional regulators to coordinate gene expression, but little is known about protein domains involved in the contact with them. We use a new approach to look for conserved regions of the RNA pol II of S. cerevisiae located at the surface of the structure of the complex, hypothesizing that they might be involved in the interaction with transcriptional regulators. We defined five different conserved domains and demonstrate that all of them make contact with transcriptional regulators. PMID:21922063
Mechanisms of protein stabilization and prevention of protein aggregation by glycerol.
Vagenende, Vincent; Yap, Miranda G S; Trout, Bernhardt L
2009-11-24
The stability of proteins in aqueous solution is routinely enhanced by cosolvents such as glycerol. Glycerol is known to shift the native protein ensemble to more compact states. Glycerol also inhibits protein aggregation during the refolding of many proteins. However, mechanistic insight into protein stabilization and prevention of protein aggregation by glycerol is still lacking. In this study, we derive mechanisms of glycerol-induced protein stabilization by combining the thermodynamic framework of preferential interactions with molecular-level insight into solvent-protein interactions gained from molecular simulations. Contrary to the common conception that preferential hydration of proteins in polyol/water mixtures is determined by the molecular size of the polyol and the surface area of the protein, we present evidence that preferential hydration of proteins in glycerol/water mixtures mainly originates from electrostatic interactions that induce orientations of glycerol molecules at the protein surface such that glycerol is further excluded. These interactions shift the native protein toward more compact conformations. Moreover, glycerol preferentially interacts with large patches of contiguous hydrophobicity where glycerol acts as an amphiphilic interface between the hydrophobic surface and the polar solvent. Accordingly, we propose that glycerol prevents protein aggregation by inhibiting protein unfolding and by stabilizing aggregation-prone intermediates through preferential interactions with hydrophobic surface regions that favor amphiphilic interface orientations of glycerol. These mechanisms agree well with experimental data available in the literature, and we discuss the extent to which these mechanisms apply to other cosolvents, including polyols, arginine, and urea.
Plasmodium parasite as an effective hepatocellular carcinoma antigen glypican-3 delivery vector.
Liu, Quan; Yang, Yijun; Tan, Xuefang; Tao, Zhu; Adah, Dickson; Yu, Songlin; Lu, Junnan; Zhao, Siting; Qin, Limei; Qin, Li; Chen, Xiaoping
2017-04-11
We have previously demonstrated that malaria parasite infection has an anti-tumor effect in a mouse model. This research aimed to investigate the possibility of using Plasmodium parasite as a novel vaccine vector for hepatocellular carcinoma (HCC) immunotherapy. We constructed a Plasmodium yoelii 17XNL strain (P.y) expressing murine glypican-3 (GPC3) protein (P.y-GPC3), and examined its therapeutic potency in a murine Hepa1-6-induced hepatoma model that highly expressed GPC3 protein. The prerequisites for invoking a CD8+ T cell response were assessed after P.y-based immunization, which included obviously increased concentrations of T helper cell type 1 (Th1)-associated cytokines, such as IL-2, IFN-γ and TNF-α, in serum and preferential expansion of the CD8α+ dendritic cell (DC) subset with higher expression of CD80 and CD86 molecules. Compared with uninfected and wild-type P.y-infected mice, a significant GPC3-specific cytotoxic T lymphocyte (CTL) response was detected in P.y-GPC3 vaccinated mice. Furthermore, P.y-GPC3-based vaccination dramatically inhibited Hepa1-6-induced tumor growth in the implanted HCC and prolonged the survival of tumor-bearing mice. We concluded that a Plasmodium-based vector is highly efficient in inducing tumor antigen-specific T cell-mediated immunity and protection against tumor cells. More broadly, this strategy supported our hypothesis that Plasmodium parasites, as novel therapeutic antigen vectors, may be applicable to tumor immunotherapy for patients with HCC.
Protein leverage affects energy intake of high-protein diets in humans.
Martens, Eveline A; Lemmens, Sofie G; Westerterp-Plantenga, Margriet S
2013-01-01
The protein leverage hypothesis requires specific evidence that protein intake is regulated more strongly than energy intake. The objective was to determine ad libitum energy intake, body weight changes, and appetite profile in response to protein-to-carbohydrate + fat ratio over 12 consecutive days and in relation to age, sex, BMI, and type of protein. A 12-d randomized crossover study was performed in 40 men and 39 women [mean ± SD age: 34.0 ± 17.6 y; BMI (in kg/m(2)): 23.7 ± 3.4] with the use of diets containing 5%, 15%, and 30% of energy from protein from a milk or plant source. Protein-content effects did not differ by age, sex, BMI, or type of protein. Total energy intake was significantly lower in the high-protein (7.21 ± 3.08 MJ/d) condition than in the low-protein (9.33 ± 3.52 MJ/d) and normal-protein (9.62 ± 3.51 MJ/d) conditions (P = 0.001), which was predominantly the result of a lower energy intake from meals (P = 0.001). Protein intake varied directly according to the amount of protein in the diet (P = 0.001). The AUC of visual analog scale appetite ratings did not differ significantly, yet fluctuations in hunger (P = 0.019) and desire to eat (P = 0.026) over the day were attenuated in the high-protein condition compared with the normal-protein condition. We found evidence to support the protein leverage hypothesis in that individuals underate relative to energy balance from diets containing a higher protein-to-carbohydrate + fat ratio. No evidence for protein leverage effects from diets containing a lower ratio of protein to carbohydrate + fat was obtained. It remains to be shown whether a relatively low protein intake would cause overeating or would be the effect of overeating of carbohydrate and fat. The study was registered at clinicaltrials.gov as NCT01320189.
Exploring the repeat protein universe through computational protein design
Brunette, TJ; Parmeggiani, Fabio; Huang, Po-Ssu; ...
2015-12-16
A central question in protein evolution is the extent to which naturally occurring proteins sample the space of folded structures accessible to the polypeptide chain. Repeat proteins composed of multiple tandem copies of a modular structure unit are widespread in nature and have critical roles in molecular recognition, signalling, and other essential biological processes. Naturally occurring repeat proteins have been re-engineered for molecular recognition and modular scaffolding applications. In this paper, we use computational protein design to investigate the space of folded structures that can be generated by tandem repeating a simple helix–loop–helix–loop structural motif. Eighty-three designs with sequences unrelatedmore » to known repeat proteins were experimentally characterized. Of these, 53 are monomeric and stable at 95 °C, and 43 have solution X-ray scattering spectra consistent with the design models. Crystal structures of 15 designs spanning a broad range of curvatures are in close agreement with the design models with root mean square deviations ranging from 0.7 to 2.5 Å. Finally, our results show that existing repeat proteins occupy only a small fraction of the possible repeat protein sequence and structure space and that it is possible to design novel repeat proteins with precisely specified geometries, opening up a wide array of new possibilities for biomolecular engineering.« less
Protein profiling of water and alkali soluble cottonseed protein isolates.
He, Zhongqi; Zhang, Dunhua; Cao, Heping
2018-06-18
Currently, there is only limited knowledge on the protein types and structures of the cottonseed proteins. In this work, water-soluble cottonseed proteins (CSPw) and alkali-soluble cottonseed proteins (CSPa) were sequentially extracted from defatted cottonseed meal. Proteins of the two fractions were separated by 4-20% gradient polyacrylamide gel electrophoresis (SDS-PAGE); There were 7 and 12 polypeptide bands on SDS-PAGE of CSPa and CSPw, respectively. These individual bands were then excised from the gel and subjected to mass spectrometric analysis. There were total 70 polypeptides identified from the proteins of the two cottonseed preparations, with molecular weights ranging from 10 to 381 kDa. While many proteins or their fragments were found in multiple bands, 18 proteins appeared only in one SDS-PAGE band (6 in CSPa, 12 in CSPw). Putative functions of these proteins include storage, transcription/translation, synthesis, energy metabolism, antimicrobial activity, and embryogenesis. Among the most abundant are legumin A (58 kDa), legumin B (59 kDa), vicilin C72 (70 kDa), vicilin GC72-A (71 kDa), and vicilin-like antimicrobial peptides (62 kDa). This work enriched the fundamental knowledge on cottonseed protein composition, and would help in better understanding of the functional and physicochemical properties of cottonseed protein and for enhancing its biotechnological utilization.
The Proteins API: accessing key integrated protein and genome information.
Nightingale, Andrew; Antunes, Ricardo; Alpi, Emanuele; Bursteinas, Borisas; Gonzales, Leonardo; Liu, Wudong; Luo, Jie; Qi, Guoying; Turner, Edd; Martin, Maria
2017-07-03
The Proteins API provides searching and programmatic access to protein and associated genomics data such as curated protein sequence positional annotations from UniProtKB, as well as mapped variation and proteomics data from large scale data sources (LSS). Using the coordinates service, researchers are able to retrieve the genomic sequence coordinates for proteins in UniProtKB. This, the LSS genomics and proteomics data for UniProt proteins is programmatically only available through this service. A Swagger UI has been implemented to provide documentation, an interface for users, with little or no programming experience, to 'talk' to the services to quickly and easily formulate queries with the services and obtain dynamically generated source code for popular programming languages, such as Java, Perl, Python and Ruby. Search results are returned as standard JSON, XML or GFF data objects. The Proteins API is a scalable, reliable, fast, easy to use RESTful services that provides a broad protein information resource for users to ask questions based upon their field of expertise and allowing them to gain an integrated overview of protein annotations available to aid their knowledge gain on proteins in biological processes. The Proteins API is available at (http://www.ebi.ac.uk/proteins/api/doc). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Laine, Elodie; Carbone, Alessandra
2015-01-01
Protein-protein interactions (PPIs) are essential to all biological processes and they represent increasingly important therapeutic targets. Here, we present a new method for accurately predicting protein-protein interfaces, understanding their properties, origins and binding to multiple partners. Contrary to machine learning approaches, our method combines in a rational and very straightforward way three sequence- and structure-based descriptors of protein residues: evolutionary conservation, physico-chemical properties and local geometry. The implemented strategy yields very precise predictions for a wide range of protein-protein interfaces and discriminates them from small-molecule binding sites. Beyond its predictive power, the approach permits to dissect interaction surfaces and unravel their complexity. We show how the analysis of the predicted patches can foster new strategies for PPIs modulation and interaction surface redesign. The approach is implemented in JET2, an automated tool based on the Joint Evolutionary Trees (JET) method for sequence-based protein interface prediction. JET2 is freely available at www.lcqb.upmc.fr/JET2. PMID:26690684
Du, Pufeng; Wang, Lusheng
2014-01-01
One of the fundamental tasks in biology is to identify the functions of all proteins to reveal the primary machinery of a cell. Knowledge of the subcellular locations of proteins will provide key hints to reveal their functions and to understand the intricate pathways that regulate biological processes at the cellular level. Protein subcellular location prediction has been extensively studied in the past two decades. A lot of methods have been developed based on protein primary sequences as well as protein-protein interaction network. In this paper, we propose to use the protein-protein interaction network as an infrastructure to integrate existing sequence based predictors. When predicting the subcellular locations of a given protein, not only the protein itself, but also all its interacting partners were considered. Unlike existing methods, our method requires neither the comprehensive knowledge of the protein-protein interaction network nor the experimentally annotated subcellular locations of most proteins in the protein-protein interaction network. Besides, our method can be used as a framework to integrate multiple predictors. Our method achieved 56% on human proteome in absolute-true rate, which is higher than the state-of-the-art methods. PMID:24466278
HDOCK: a web server for protein-protein and protein-DNA/RNA docking based on a hybrid strategy.
Yan, Yumeng; Zhang, Di; Zhou, Pei; Li, Botong; Huang, Sheng-You
2017-07-03
Protein-protein and protein-DNA/RNA interactions play a fundamental role in a variety of biological processes. Determining the complex structures of these interactions is valuable, in which molecular docking has played an important role. To automatically make use of the binding information from the PDB in docking, here we have presented HDOCK, a novel web server of our hybrid docking algorithm of template-based modeling and free docking, in which cases with misleading templates can be rescued by the free docking protocol. The server supports protein-protein and protein-DNA/RNA docking and accepts both sequence and structure inputs for proteins. The docking process is fast and consumes about 10-20 min for a docking run. Tested on the cases with weakly homologous complexes of <30% sequence identity from five docking benchmarks, the HDOCK pipeline tied with template-based modeling on the protein-protein and protein-DNA benchmarks and performed better than template-based modeling on the three protein-RNA benchmarks when the top 10 predictions were considered. The performance of HDOCK became better when more predictions were considered. Combining the results of HDOCK and template-based modeling by ranking first of the template-based model further improved the predictive power of the server. The HDOCK web server is available at http://hdock.phys.hust.edu.cn/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Druggable orthosteric and allosteric hot spots to target protein-protein interactions.
Ma, Buyong; Nussinov, Ruth
2014-01-01
Drug designing targeting protein-protein interactions is challenging. Because structural elucidation and computational analysis have revealed the importance of hot spot residues in stabilizing these interactions, there have been on-going efforts to develop drugs which bind the hot spots and out-compete the native protein partners. The question arises as to what are the key 'druggable' properties of hot spots in protein-protein interactions and whether these mimic the general hot spot definition. Identification of orthosteric (at the protein- protein interaction site) and allosteric (elsewhere) druggable hot spots is expected to help in discovering compounds that can more effectively modulate protein-protein interactions. For example, are there any other significant features beyond their location in pockets in the interface? The interactions of protein-protein hot spots are coupled with conformational dynamics of protein complexes. Currently increasing efforts focus on the allosteric drug discovery. Allosteric drugs bind away from the native binding site and can modulate the native interactions. We propose that identification of allosteric hot spots could similarly help in more effective allosteric drug discovery. While detection of allosteric hot spots is challenging, targeting drugs to these residues has the potential of greatly increasing the hot spot and protein druggability.
Picornavirus proteins share antigenic determinants with heat shock proteins 60/65.
Härkönen, T; Puolakkainen, M; Sarvas, M; Airaksinen, U; Hovi, T; Roivainen, M
2000-11-01
Immunological cross-reactions between enteroviruses and islet cell autoantigens have been suggested to play a role in the etiopathogenesis of insulin dependent diabetes mellitus (IDDM). In the nonobese diabetic mouse, an autoimmune model of IDDM, one of the reactive beta cell autoantigens is the heat shock protein 60 (HSP60). These studies were prompted by sequence homology discovered between the immunogenic region in HSP60 and two regions in enterovirus capsid proteins, one in the VP1 protein and the other in the VP0, the precursor of VP2 and VP4 proteins. Possible immunological cross-reactions between enterovirus proteins and heat shock proteins were studied by EIA and immunoblotting by using purified virus preparations, viral expression proteins VP1 and VP0, and recombinant HSP60/65 proteins, and corresponding polyclonal antisera. The HSP60/65 family of proteins is highly conserved and there is a striking degree of homology between bacterial and human heat shock proteins. Rabbit antibodies to HSP65 of Mycobacterium bovis that reacted with human HSP60 were also found to recognise capsid protein VP1 of coxsackievirus A9, VP1, and/or VP2 of coxsackievirus B4. Both viruses were also recognised by antisera raised against HSP60 of Chlamydia pneumoniae. In addition to the capsid proteins derived from native virions, antisera to both bacterial HSP proteins recognised expression protein VP1 of coxsackievirus A9. The cross-reactivity was also demonstrated the other way around; antisera to purified virus particles reacted with the HSP 60/65 proteins to some extent. These results suggest that apart from the well-documented sequence homology between the 2C protein of coxsackieviruses and the beta-cell autoantigen glutamic acid decarboxylase, there are other motifs in picornavirus proteins homologous to islet cell autoantigens, which might induce cross-reacting immune responses during picornavirus infections.
Mao, Yimin; Kuo, Su-Wei; Chen, Le; Heckman, C J; Jiang, M C
2017-01-01
Amyotrophic Lateral Sclerosis (ALS) is a devastative neurodegenerative disease characterized by selective loss of motoneurons. While several breakthroughs have been made in identifying ALS genetic defects, the detailed molecular mechanisms are still unclear. These genetic defects involve in numerous biological processes, which converge to a common destiny: motoneuron degeneration. In addition, the common comorbid Frontotemporal Dementia (FTD) further complicates the investigation of ALS etiology. In this study, we aimed to explore the protein-protein interaction network built on known ALS-causative genes to identify essential proteins and common downstream proteins between classical ALS and ALS+FTD (classical ALS + ALS/FTD) groups. The results suggest that classical ALS and ALS+FTD share similar essential protein set (VCP, FUS, TDP-43 and hnRNPA1) but have distinctive functional enrichment profiles. Thus, disruptions to these essential proteins might cause motoneuron susceptible to cellular stresses and eventually vulnerable to proteinopathies. Moreover, we identified a common downstream protein, ubiquitin-C, extensively interconnected with ALS-causative proteins (22 out of 24) which was not linked to ALS previously. Our in silico approach provides the computational background for identifying ALS therapeutic targets, and points out the potential downstream common ground of ALS-causative mutations.
Interplay between binding affinity and kinetics in protein-protein interactions.
Cao, Huaiqing; Huang, Yongqi; Liu, Zhirong
2016-07-01
To clarify the interplay between the binding affinity and kinetics of protein-protein interactions, and the possible role of intrinsically disordered proteins in such interactions, molecular simulations were carried out on 20 protein complexes. With bias potential and reweighting techniques, the free energy profiles were obtained under physiological affinities, which showed that the bound-state valley is deep with a barrier height of 12 - 33 RT. From the dependence of the affinity on interface interactions, the entropic contribution to the binding affinity is approximated to be proportional to the interface area. The extracted dissociation rates based on the Arrhenius law correlate reasonably well with the experimental values (Pearson correlation coefficient R = 0.79). For each protein complex, a linear free energy relationship between binding affinity and the dissociation rate was confirmed, but the distribution of the slopes for intrinsically disordered proteins showed no essential difference with that observed for ordered proteins. A comparison with protein folding was also performed. Proteins 2016; 84:920-933. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Protein annotation from protein interaction networks and Gene Ontology.
Nguyen, Cao D; Gardiner, Katheleen J; Cios, Krzysztof J
2011-10-01
We introduce a novel method for annotating protein function that combines Naïve Bayes and association rules, and takes advantage of the underlying topology in protein interaction networks and the structure of graphs in the Gene Ontology. We apply our method to proteins from the Human Protein Reference Database (HPRD) and show that, in comparison with other approaches, it predicts protein functions with significantly higher recall with no loss of precision. Specifically, it achieves 51% precision and 60% recall versus 45% and 26% for Majority and 24% and 61% for χ²-statistics, respectively. Copyright © 2011 Elsevier Inc. All rights reserved.
Interplay Between Protein Homeostasis Networks in Protein Aggregation and Proteotoxicity
Douglas, Peter M.; Cyr, Douglas M.
2010-01-01
The misfolding and aggregation of disease proteins is characteristic of numerous neurodegenerative diseases. Particular neuronal populations are more vulnerable to proteotoxicity while others are more apt to tolerate the misfolding and aggregation of disease proteins. Thus, the cellular environment must play a significant role in determining whether disease proteins are converted into toxic or benign forms. The endomembrane network of eukaryotes divides the cell into different subcellular compartments that possess distinct sets of molecular chaperones and protein interaction networks. Chaperones act as agonists and antagonists of disease protein aggregation to prevent the accumulation of toxic intermediates in the aggregation pathway. Interacting partners can also modulate the conformation and localization of disease proteins and thereby influence proteotoxicity. Thus, interplay between these protein homeostasis network components can modulate the self-association of disease proteins and determine whether they elicit a toxic or benign outcome. PMID:19768782
Modifications in nanoparticle-protein interactions by varying the protein conformation
NASA Astrophysics Data System (ADS)
Kumar, Sugam; Yadav, I.; Aswal, V. K.; Kohlbrecher, J.
2017-05-01
Small-angle neutron scattering has been used to study the interaction of silica nanoparticle with Bovine Serum Albumin (BSA) protein without and with a protein denaturing agent urea. The measurements have been carried out at pH 7 where both the components (nanoparticle and protein) are similarly charged. We show that the interactions in nanoparticle-protein system can be modified by changing the conformation of protein through the presence of urea. In the absence of urea, the strong electrostatic repulsion between the nanoparticle and protein prevents protein adsorption on nanoparticle surface. This non-adsorption, in turn gives rise to depletion attraction between nanoparticles. However, with addition of urea the depletion attraction is completely suppressed. Urea driven denaturation of protein is utilized to expose the positively charged patched of the BSA molecules which eventually leads to adsorption of BSA on nanoparticles eliminating the depletion interaction.
Dietary Protein Intake in Dutch Elderly People: A Focus on Protein Sources.
Tieland, Michael; Borgonjen-Van den Berg, Karin J; Van Loon, Luc J C; de Groot, Lisette C P G M
2015-11-25
Sufficient high quality dietary protein intake is required to prevent or treat sarcopenia in elderly people. Therefore, the intake of specific protein sources as well as their timing of intake are important to improve dietary protein intake in elderly people. to assess the consumption of protein sources as well as the distribution of protein sources over the day in community-dwelling, frail and institutionalized elderly people. Habitual dietary intake was evaluated using 2- and 3-day food records collected from various studies involving 739 community-dwelling, 321 frail and 219 institutionalized elderly people. Daily protein intake averaged 71 ± 18 g/day in community-dwelling, 71 ± 20 g/day in frail and 58 ± 16 g/day in institutionalized elderly people and accounted for 16% ± 3%, 16% ± 3% and 17% ± 3% of their energy intake, respectively. Dietary protein intake ranged from 10 to 12 g at breakfast, 15 to 23 g at lunch and 24 to 31 g at dinner contributing together over 80% of daily protein intake. The majority of dietary protein consumed originated from animal sources (≥60%) with meat and dairy as dominant sources. Thus, 40% of the protein intake in community-dwelling, 37% in frail and 29% in institutionalized elderly originated from plant based protein sources with bread as the principle source. Plant based proteins contributed for >50% of protein intake at breakfast and between 34% and 37% at lunch, with bread as the main source. During dinner, >70% of the protein intake originated from animal protein, with meat as the dominant source. Daily protein intake in these older populations is mainly (>80%) provided by the three main meals, with most protein consumed during dinner. More than 60% of daily protein intake consumed is of animal origin, with plant based protein sources representing nearly 40% of total protein consumed. During dinner, >70% of the protein intake originated from animal protein, while during breakfast and lunch a large proportion of
Lee, Samuel; Min Kim, Soo; Dotimas, James; Li, Letitia; Feener, Edward P; Baldus, Stephan; Myers, Ronald B; Chutkow, William A; Patwari, Parth; Yoshioka, Jun; Lee, Richard T
2014-06-01
The endoplasmic reticulum (ER) is responsible for protein folding, modification, and trafficking. Accumulation of unfolded or misfolded proteins represents the condition of ER stress and triggers the unfolded protein response (UPR), a key mechanism linking supply of excess nutrients to insulin resistance and type 2 diabetes in obesity. The ER harbors proteins that participate in protein folding including protein disulfide isomerases (PDIs). Changes in PDI activity are associated with protein misfolding and ER stress. Here, we show that thioredoxin-interacting protein (Txnip), a member of the arrestin protein superfamily and one of the most strongly induced proteins in diabetic patients, regulates PDI activity and UPR signaling. We found that Txnip binds to PDIs and increases their enzymatic activity. Genetic deletion of Txnip in cells and mice led to increased protein ubiquitination and splicing of the UPR regulated transcription factor X-box-binding protein 1 (Xbp1s) at baseline as well as under ER stress. Our results reveal Txnip as a novel direct regulator of PDI activity and a feedback mechanism of UPR signaling to decrease ER stress. © 2014 Brigham and Women's Hospital. Published under the terms of the CC BY 4.0 license.
Introduction to current and future protein therapeutics: a protein engineering perspective.
Carter, Paul J
2011-05-15
Protein therapeutics and its enabling sister discipline, protein engineering, have emerged since the early 1980s. The first protein therapeutics were recombinant versions of natural proteins. Proteins purposefully modified to increase their clinical potential soon followed with enhancements derived from protein or glycoengineering, Fc fusion or conjugation to polyethylene glycol. Antibody-based drugs subsequently arose as the largest and fastest growing class of protein therapeutics. The rationale for developing better protein therapeutics with enhanced efficacy, greater safety, reduced immunogenicity or improved delivery comes from the convergence of clinical, scientific, technological and commercial drivers that have identified unmet needs and provided strategies to address them. Future protein drugs seem likely to be more extensively engineered to improve their performance, e.g., antibodies and Fc fusion proteins with enhanced effector functions or extended half-life. Two old concepts for improving antibodies, namely antibody-drug conjugates and bispecific antibodies, have advanced to the cusp of clinical success. As for newer protein therapeutic platform technologies, several engineered protein scaffolds are in early clinical development and offer differences and some potential advantages over antibodies. Copyright © 2011 Elsevier Inc. All rights reserved.
Introduction to current and future protein therapeutics: A protein engineering perspective
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carter, Paul J., E-mail: pjc@gene.com
2011-05-15
Protein therapeutics and its enabling sister discipline, protein engineering, have emerged since the early 1980s. The first protein therapeutics were recombinant versions of natural proteins. Proteins purposefully modified to increase their clinical potential soon followed with enhancements derived from protein or glycoengineering, Fc fusion or conjugation to polyethylene glycol. Antibody-based drugs subsequently arose as the largest and fastest growing class of protein therapeutics. The rationale for developing better protein therapeutics with enhanced efficacy, greater safety, reduced immunogenicity or improved delivery comes from the convergence of clinical, scientific, technological and commercial drivers that have identified unmet needs and provided strategies tomore » address them. Future protein drugs seem likely to be more extensively engineered to improve their performance, e.g., antibodies and Fc fusion proteins with enhanced effector functions or extended half-life. Two old concepts for improving antibodies, namely antibody-drug conjugates and bispecific antibodies, have advanced to the cusp of clinical success. As for newer protein therapeutic platform technologies, several engineered protein scaffolds are in early clinical development and offer differences and some potential advantages over antibodies.« less
Protein design to understand peptide ligand recognition by tetratricopeptide repeat proteins.
Cortajarena, Aitziber L; Kajander, Tommi; Pan, Weilan; Cocco, Melanie J; Regan, Lynne
2004-04-01
Protein design aims to understand the fundamentals of protein structure by creating novel proteins with pre-specified folds. An equally important goal is to understand protein function by creating novel proteins with pre-specified activities. Here we describe the design and characterization of a tetratricopeptide (TPR) protein, which binds to the C-terminal peptide of the eukaryotic chaperone Hsp90. The design emphasizes the importance of both direct, short-range protein-peptide interactions and of long-range electrostatic optimization. We demonstrate that the designed protein binds specifically to the desired peptide and discriminates between it and the similar C-terminal peptide of Hsp70.
Guo, Deyin; Spetz, Carl; Saarma, Mart; Valkonen, Jari P T
2003-05-01
Potyviral helper-component proteinase (HCpro) is a multifunctional protein exerting its cellular functions in interaction with putative host proteins. In this study, cellular protein partners of the HCpro encoded by Potato virus A (PVA) (genus Potyvirus) were screened in a potato leaf cDNA library using a yeast two-hybrid system. Two cellular proteins were obtained that interact specifically with PVA HCpro in yeast and in the two in vitro binding assays used. Both proteins are encoded by single-copy genes in the potato genome. Analysis of the deduced amino acid sequences revealed that one (HIP1) of the two HCpro interactors is a novel RING finger protein. The sequence of the other protein (HIP2) showed no resemblance to the protein sequences available from databanks and has known biological functions.
Onwulata, Charles I; Phillips, John G; Tunick, Michael H; Qi, Phoebi X; Cooke, Peter H
2010-03-01
Dairy proteins are amenable to structural modifications induced by high temperature, shear, and moisture; in particular, whey proteins can change conformation to new unfolded states. The change in protein state is a basis for creating new foods. The dairy products, nonfat dried milk (NDM), whey protein concentrate (WPC), and whey protein isolate (WPI) were modified using a twin-screw extruder at melt temperatures of 50, 75, and 100 degrees C, and moistures ranging from 20 to 70 wt%. Viscoelasticity and solubility measurements showed that extrusion temperature was a more significant (P < 0.05) change factor than moisture content. The degree of texturization, or change in protein state, was characterized by solubility (R(2)= 0.98). The consistency of the extruded dairy protein ranged from rigid (2500 N) to soft (2.7 N). Extruding at or above 75 degrees C resulted in increased peak force for WPC (138 to 2500 N) and WPI (2.7 to 147.1 N). NDM was marginally texturized; the presence of lactose interfered with its texturization. WPI products extruded at 50 degrees C were not texturized; their solubility values ranged from 71.8% to 92.6%. A wide possibility exists for creating new foods with texturized dairy proteins due to the extensive range of states achievable. Dairy proteins can be used to boost the protein content in puffed snacks made from corn meal, but unmodified, they bind water and form doughy pastes with starch. To minimize the water binding property of dairy proteins, WPI, or WPC, or NDM were modified by extrusion processing. Extrusion temperature conditions were adjusted to 50, 75, or 100 degrees C, sufficient to change the structure of the dairy proteins, but not destroy them. Extrusion modified the structures of these dairy proteins for ease of use in starchy foods to boost nutrient levels. Dairy proteins can be used to boost the protein content in puffed snacks made from corn meal, but unmodified, they bind water and form doughy pastes with starch. To
Rapid discovery of protein interactions by cell-free protein technologies.
He, M; Taussig, M J
2007-11-01
Cell-free transcription and translation provides an open, controllable environment for production of correctly folded, soluble proteins and allows the rapid generation of proteins from DNA without the need for cloning. Thus it is becoming an increasingly attractive alternative to conventional in vivo expression systems, especially when parallel expression of multiple proteins is required. Through novel design and exploitation, powerful cell-free technologies of ribosome display and protein in situ arrays have been developed for in vitro production and isolation of protein-binding molecules from large libraries. These technologies can be combined for rapid detection of protein interactions.
NASA Astrophysics Data System (ADS)
Batoulis, Helena; Schmidt, Thomas H.; Weber, Pascal; Schloetel, Jan-Gero; Kandt, Christian; Lang, Thorsten
2016-04-01
Salts and proteins comprise two of the basic molecular components of biological materials. Kosmotropic/chaotropic co-solvation and matching ion water affinities explain basic ionic effects on protein aggregation observed in simple solutions. However, it is unclear how these theories apply to proteins in complex biological environments and what the underlying ionic binding patterns are. Using the positive ion Ca2+ and the negatively charged membrane protein SNAP25, we studied ion effects on protein oligomerization in solution, in native membranes and in molecular dynamics (MD) simulations. We find that concentration-dependent ion-induced protein oligomerization is a fundamental chemico-physical principle applying not only to soluble but also to membrane-anchored proteins in their native environment. Oligomerization is driven by the interaction of Ca2+ ions with the carboxylate groups of aspartate and glutamate. From low up to middle concentrations, salt bridges between Ca2+ ions and two or more protein residues lead to increasingly larger oligomers, while at high concentrations oligomers disperse due to overcharging effects. The insights provide a conceptual framework at the interface of physics, chemistry and biology to explain binding of ions to charged protein surfaces on an atomistic scale, as occurring during protein solubilisation, aggregation and oligomerization both in simple solutions and membrane systems.
Topology-function conservation in protein-protein interaction networks.
Davis, Darren; Yaveroğlu, Ömer Nebil; Malod-Dognin, Noël; Stojmirovic, Aleksandar; Pržulj, Nataša
2015-05-15
Proteins underlay the functioning of a cell and the wiring of proteins in protein-protein interaction network (PIN) relates to their biological functions. Proteins with similar wiring in the PIN (topology around them) have been shown to have similar functions. This property has been successfully exploited for predicting protein functions. Topological similarity is also used to guide network alignment algorithms that find similarly wired proteins between PINs of different species; these similarities are used to transfer annotation across PINs, e.g. from model organisms to human. To refine these functional predictions and annotation transfers, we need to gain insight into the variability of the topology-function relationships. For example, a function may be significantly associated with specific topologies, while another function may be weakly associated with several different topologies. Also, the topology-function relationships may differ between different species. To improve our understanding of topology-function relationships and of their conservation among species, we develop a statistical framework that is built upon canonical correlation analysis. Using the graphlet degrees to represent the wiring around proteins in PINs and gene ontology (GO) annotations to describe their functions, our framework: (i) characterizes statistically significant topology-function relationships in a given species, and (ii) uncovers the functions that have conserved topology in PINs of different species, which we term topologically orthologous functions. We apply our framework to PINs of yeast and human, identifying seven biological process and two cellular component GO terms to be topologically orthologous for the two organisms. © The Author 2015. Published by Oxford University Press.
Protein space: a natural method for realizing the nature of protein universe.
Yu, Chenglong; Deng, Mo; Cheng, Shiu-Yuen; Yau, Shek-Chung; He, Rong L; Yau, Stephen S-T
2013-02-07
Current methods cannot tell us what the nature of the protein universe is concretely. They are based on different models of amino acid substitution and multiple sequence alignment which is an NP-hard problem and requires manual intervention. Protein structural analysis also gives a direction for mapping the protein universe. Unfortunately, now only a minuscule fraction of proteins' 3-dimensional structures are known. Furthermore, the phylogenetic tree representations are not unique for any existing tree construction methods. Here we develop a novel method to realize the nature of protein universe. We show the protein universe can be realized as a protein space in 60-dimensional Euclidean space using a distance based on a normalized distribution of amino acids. Every protein is in one-to-one correspondence with a point in protein space, where proteins with similar properties stay close together. Thus the distance between two points in protein space represents the biological distance of the corresponding two proteins. We also propose a natural graphical representation for inferring phylogenies. The representation is natural and unique based on the biological distances of proteins in protein space. This will solve the fundamental question of how proteins are distributed in the protein universe. Copyright © 2012 Elsevier Ltd. All rights reserved.
Protein interactions and ligand binding: from protein subfamilies to functional specificity.
Rausell, Antonio; Juan, David; Pazos, Florencio; Valencia, Alfonso
2010-02-02
The divergence accumulated during the evolution of protein families translates into their internal organization as subfamilies, and it is directly reflected in the characteristic patterns of differentially conserved residues. These specifically conserved positions in protein subfamilies are known as "specificity determining positions" (SDPs). Previous studies have limited their analysis to the study of the relationship between these positions and ligand-binding specificity, demonstrating significant yet limited predictive capacity. We have systematically extended this observation to include the role of differential protein interactions in the segregation of protein subfamilies and explored in detail the structural distribution of SDPs at protein interfaces. Our results show the extensive influence of protein interactions in the evolution of protein families and the widespread association of SDPs with protein interfaces. The combined analysis of SDPs in interfaces and ligand-binding sites provides a more complete picture of the organization of protein families, constituting the necessary framework for a large scale analysis of the evolution of protein function.
R4 RGS Proteins: Regulation of G Protein Signaling and Beyond
Bansal, Geetanjali; Druey, Kirk M.; Xie, Zhihui
2007-01-01
The Regulators of G protein Signaling (RGS) proteins were initially characterized as inhibitors of signal transduction cascades initiated by G-protein-coupled receptors (GPCRs) because of their ability to increase the intrinsic GTPase activity of heterotrimeric G proteins. This GTPase accelerating (GAP) activity enhances G protein deactivation and promotes desensitization. However, in addition to this signature trait, emerging data have revealed an expanding network of proteins, lipids, and ions that interact with RGS proteins and confer additional regulatory functions. This review highlights recent advances in our understanding of the physiological functions of one subfamily of RGS proteins with a high degree of homology (B/R4) gleaned from recent studies of knockout mice or cells with reduced RGS expression. We also discuss some of the newly-appreciated interactions of RGS proteins with cellular factors that suggest RGS control of several components of G-protein-mediated pathways as well as a diverse array of non-GPCR-mediated biological responses. PMID:18006065
Optimization of non-denaturing protein extraction conditions for plant PPR proteins.
Andrés-Colás, Nuria; Van Der Straeten, Dominique
2017-01-01
Pentatricopeptide repeat proteins are one of the major protein families in flowering plants, containing around 450 members. They participate in RNA editing and are related to plant growth, development and reproduction, as well as to responses to ABA and abiotic stresses. Their characteristics have been described in silico; however, relatively little is known about their biochemical properties. Different types of PPR proteins, with different tasks in RNA editing, have been suggested to interact in an editosome to complete RNA editing. Other non-PPR editing factors, such as the multiple organellar RNA editing factors and the organelle RNA recognition motif-containing protein family, for example, have also been described in plants. However, while evidence on protein interactions between non-PPR RNA editing proteins is accumulating, very few PPR protein interactions have been reported; possibly due to their high instability. In this manuscript, we aimed to optimize the conditions for non-denaturing protein extraction of PPR proteins allowing in vivo protein analyses, such as interaction assays by co-immunoprecipitation. The unusually high protein degradation rate, the aggregation properties and the high pI, as well as the ATP-dependence of some PPR proteins, are key aspects to be considered when extracting PPR proteins in a non-denatured state. During extraction of PPR proteins, the use of proteasome and phosphatase inhibitors is critical. The use of the ATP-cofactor reduces considerably the degradation of PPR proteins. A short centrifugation step to discard cell debris is essential to avoid PPR precipitation; while in some cases, addition of a reductant is needed, probably caused by the pI/pH context. This work provides an easy and rapid optimized non-denaturing total protein extraction protocol from plant tissue, suitable for polypeptides of the PPR family.
Molecular simulation of the effect of cholesterol on lipid-mediated protein-protein interactions.
de Meyer, Frédérick J-M; Rodgers, Jocelyn M; Willems, Thomas F; Smit, Berend
2010-12-01
Experiments and molecular simulations have shown that the hydrophobic mismatch between proteins and membranes contributes significantly to lipid-mediated protein-protein interactions. In this article, we discuss the effect of cholesterol on lipid-mediated protein-protein interactions as function of hydrophobic mismatch, protein diameter and protein cluster size, lipid tail length, and temperature. To do so, we study a mesoscopic model of a hydrated bilayer containing lipids and cholesterol in which proteins are embedded, with a hybrid dissipative particle dynamics-Monte Carlo method. We propose a mechanism by which cholesterol affects protein interactions: protein-induced, cholesterol-enriched, or cholesterol-depleted lipid shells surrounding the proteins affect the lipid-mediated protein-protein interactions. Our calculations of the potential of mean force between proteins and protein clusters show that the addition of cholesterol dramatically reduces repulsive lipid-mediated interactions between proteins (protein clusters) with positive mismatch, but does not affect attractive interactions between proteins with negative mismatch. Cholesterol has only a modest effect on the repulsive interactions between proteins with different mismatch. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Protein-protein interactions within late pre-40S ribosomes.
Campbell, Melody G; Karbstein, Katrin
2011-01-20
Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
Validation of Biomarker Proteins Using Reverse Capture Protein Microarrays.
Jozwik, Catherine; Eidelman, Ofer; Starr, Joshua; Pollard, Harvey B; Srivastava, Meera
2017-01-01
Genomics has revolutionized large-scale and high-throughput sequencing and has led to the discovery of thousands of new proteins. Protein chip technology is emerging as a miniaturized and highly parallel platform that is suited to rapid, simultaneous screening of large numbers of proteins and the analysis of various protein-binding activities, enzyme substrate relationships, and posttranslational modifications. Specifically, reverse capture protein microarrays provide the most appropriate platform for identifying low-abundance, disease-specific biomarker proteins in a sea of high-abundance proteins from biological fluids such as blood, serum, plasma, saliva, urine, and cerebrospinal fluid as well as tissues and cells obtained by biopsy. Samples from hundreds of patients can be spotted in serial dilutions on many replicate glass slides. Each slide can then be probed with one specific antibody to the biomarker of interest. That antibody's titer can then be determined quantitatively for each patient, allowing for the statistical assessment and validation of the diagnostic or prognostic utility of that particular antigen. As the technology matures and the availability of validated, platform-compatible antibodies increases, the platform will move further into the desirable realm of discovery science for detecting and quantitating low-abundance signaling proteins. In this chapter, we describe methods for the successful application of the reverse capture protein microarray platform for which we have made substantial contributions to the development and application of this method, particularly in the use of body fluids other than serum/plasma.
Di Domenico, Antonella; Hofer, Annette; Tundo, Federica; Wenz, Tina
2014-11-01
Changes in nutrient supply require global metabolic reprogramming to optimize the utilization of the nutrients. Mitochondria as a central component of the cellular metabolism play a key role in this adaptive process. Since mitochondria harbor their own genome, which encodes essential enzymes, mitochondrial protein synthesis is a determinant of metabolic adaptation. While regulation of cytoplasmic protein synthesis in response to metabolic challenges has been studied in great detail, mechanisms which adapt mitochondrial translation in response to metabolic challenges remain elusive. Our results suggest that the mitochondrial acetylation status controlled by Sirt3 and its proposed opponent GCN5L1 is an important regulator of the metabolic adaptation of mitochondrial translation. Moreover, both proteins modulate regulators of cytoplasmic protein synthesis as well as the mitonuclear protein balance making Sirt3 and GCN5L1 key players in synchronizing mitochondrial and cytoplasmic translation. Our results thereby highlight regulation of mitochondrial translation as a novel component in the cellular nutrient sensing scheme and identify mitochondrial acetylation as a new regulatory principle for the metabolic competence of mitochondrial protein synthesis. © 2014 International Union of Biochemistry and Molecular Biology.
Protein-protein interaction predictions using text mining methods.
Papanikolaou, Nikolas; Pavlopoulos, Georgios A; Theodosiou, Theodosios; Iliopoulos, Ioannis
2015-03-01
It is beyond any doubt that proteins and their interactions play an essential role in most complex biological processes. The understanding of their function individually, but also in the form of protein complexes is of a great importance. Nowadays, despite the plethora of various high-throughput experimental approaches for detecting protein-protein interactions, many computational methods aiming to predict new interactions have appeared and gained interest. In this review, we focus on text-mining based computational methodologies, aiming to extract information for proteins and their interactions from public repositories such as literature and various biological databases. We discuss their strengths, their weaknesses and how they complement existing experimental techniques by simultaneously commenting on the biological databases which hold such information and the benchmark datasets that can be used for evaluating new tools. Copyright © 2014 Elsevier Inc. All rights reserved.
Probing Protein-Protein Interactions by Dynamic Force Correlation Spectroscopy
NASA Astrophysics Data System (ADS)
Barsegov, V.; Thirumalai, D.
2005-10-01
We develop a formalism for single molecule dynamic force spectroscopy to map the energy landscape of protein-protein complex (P1P2). The joint distribution P(τ1,τ2) of unbinding lifetimes τ1 and τ2, measurable in a compression-tension cycle, which accounts for the internal relaxation dynamics of the proteins under tension, shows that the histogram of τ1 is not Poissonian. The theory is applied to the forced unbinding of protein P1, modeled as a wormlike chain, from P1P2. We propose a new class of experiments which can resolve the effect of internal protein dynamics on the unbinding lifetimes.
Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang
2018-03-10
Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's homology-based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's homology-based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence homology-based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at http://zhanglab.ccmb.med.umich.edu/MetaGO/. Copyright © 2018. Published by Elsevier Ltd.
Anomalous Dynamics of Water Confined in Protein-Protein and Protein-DNA Interfaces.
Chong, Song-Ho; Ham, Sihyun
2016-10-06
Confined water often exhibits anomalous properties not observable in the bulk phase. Although water in hydrophobic confinement has been the focus of intense investigation, the behavior of water confined between hydrophilic surfaces, which are more frequently found in biological systems, has not been fully explored. Here, we investigate using molecular dynamics simulations dynamical properties of the water confined in hydrophilic protein-protein and protein-DNA interfaces. We find that the interfacial water exhibits glassy slow relaxations even at 300 K. In particular, the rotational dynamics show a logarithmic decay that was observed in glass-forming liquids at deeply supercooled states. We argue that such slow water dynamics are indeed induced by the hydrophilic binding surfaces, which is in opposition to the picture that the hydration water slaves protein motions. Our results will significantly impact the view on the role of water in biomolecular interactions.
Protein particulates: another generic form of protein aggregation?
Krebs, Mark R H; Devlin, Glyn L; Donald, A M
2007-02-15
Protein aggregation is a problem with a multitude of consequences, ranging from affecting protein expression to its implication in many diseases. Of recent interest is the specific form of aggregation leading to the formation of amyloid fibrils, structures associated with diseases such as Alzheimer's disease. The ability to form amyloid fibrils is now regarded as a property generic to all polypeptide chains. Here we show that around the isoelectric point a different generic form of aggregation can also occur by studying seven widely different, nonrelated proteins that are also all known to form amyloid fibrils. Under these conditions gels consisting of relatively monodisperse spherical particulates are formed. Although these gels have been described before for beta-lactoglobulin, our results suggest that the formation of particulates in the regime where charge on the molecules is minimal is a common property of all proteins. Because the proteins used here also form amyloid fibrils, we further propose that protein misfolding into clearly defined aggregates is a generic process whose outcome depends solely on the general properties of the state the protein is in when aggregation occurs, rather than the specific amino acid sequence. Thus under conditions of high net charge, amyloid fibrils form, whereas under conditions of low net charge, particulates form. This observation furthermore suggests that the rules of soft matter physics apply to these systems.
Raut, Ashlesha S; Kalonia, Devendra S
2016-01-01
Increased solution viscosity results in difficulties in manufacturing and delivery of therapeutic protein formulations, increasing both the time and production costs, and leading to patient inconvenience. The solution viscosity is affected by the molecular properties of both the solute and the solvent. The purpose of this work was to investigate the effect of size, charge and protein-protein interactions on the viscosity of Dual Variable Domain Immunoglobulin (DVD-Ig(TM)) protein solutions. The effect of size of the protein molecule on solution viscosity was investigated by measuring intrinsic viscosity and excluded volume calculations for monoclonal antibody (mAb) and DVD-Ig(TM) protein solutions. The role of the electrostatic charge resulting in electroviscous effects for DVD-Ig(TM) protein was assessed by measuring zeta potential. Light scattering measurements were performed to detect protein-protein interactions affecting solution viscosity. DVD-Ig(TM) protein exhibited significantly higher viscosity compared to mAb. Intrinsic viscosity and excluded volume calculations indicated that the size of the molecule affects viscosity significantly at higher concentrations, while the effect was minimal at intermediate concentrations. Electroviscous contribution to the viscosity of DVD-Ig(TM) protein varied depending on the presence or absence of ions in the solution. In buffered solutions, negative k D and B 2 values indicated the presence of attractive interactions which resulted in high viscosity for DVD-Ig(TM) protein at certain pH and ionic strength conditions. Results show that more than one factor contributes to the increased viscosity of DVD-Ig(TM) protein and interplay of these factors modulates the overall viscosity behavior of the solution, especially at higher concentrations.
Fuxe, Kjell; Borroto-Escuela, Dasiel O; Romero-Fernandez, Wilber; Palkovits, Miklós; Tarakanov, Alexander O; Ciruela, Francisco; Agnati, Luigi F
2014-01-01
There is serious interest in understanding the dynamics of the receptor–receptor and receptor–protein interactions in space and time and their integration in GPCR heteroreceptor complexes of the CNS. Moonlighting proteins are special multifunctional proteins because they perform multiple autonomous, often unrelated, functions without partitioning into different protein domains. Moonlighting through receptor oligomerization can be operationally defined as an allosteric receptor–receptor interaction, which leads to novel functions of at least one receptor protomer. GPCR-mediated signaling is a more complicated process than previously described as every GPCR and GPCR heteroreceptor complex requires a set of G protein interacting proteins, which interacts with the receptor in an orchestrated spatio-temporal fashion. GPCR heteroreceptor complexes with allosteric receptor–receptor interactions operating through the receptor interface have become major integrative centers at the molecular level and their receptor protomers act as moonlighting proteins. The GPCR heteroreceptor complexes in the CNS have become exciting new targets for neurotherapeutics in Parkinson's disease, schizophrenia, drug addiction, and anxiety and depression opening a new field in neuropsychopharmacology. PMID:24105074
[Chemical libraries dedicated to protein-protein interactions].
Sperandio, Olivier; Villoutreix, Bruno O; Morelli, Xavier; Roche, Philippe
2015-03-01
The identification of complete networks of protein-protein interactions (PPI) within a cell has contributed to major breakthroughs in understanding biological pathways, host-pathogen interactions and cancer development. As a consequence, PPI have emerged as a new class of promising therapeutic targets. However, they are still considered as a challenging class of targets for drug discovery programs. Recent successes have allowed the characterization of structural and physicochemical properties of protein-protein interfaces leading to a better understanding of how they can be disrupted with small molecule compounds. In addition, characterization of the profiles of PPI inhibitors has allowed the development of PPI-focused libraries. In this review, we present the current efforts at developing chemical libraries dedicated to these innovative targets. © 2015 médecine/sciences – Inserm.
Bourgeois, Michael; Jacquin, Françoise; Cassecuelle, Florence; Savois, Vincent; Belghazi, Maya; Aubert, Grégoire; Quillien, Laurence; Huart, Myriam; Marget, Pascal; Burstin, Judith
2011-05-01
Legume seeds are a major source of dietary proteins for humans and animals. Deciphering the genetic control of their accumulation is thus of primary significance towards their improvement. At first, we analysed the genetic variability of the pea seed proteome of three genotypes over 3 years of cultivation. This revealed that seed protein composition variability was under predominant genetic control, with as much as 60% of the spots varying quantitatively among the three genotypes. Then, by combining proteomic and quantitative trait loci (QTL) mapping approaches, we uncovered the genetic architecture of seed proteome variability. Protein quantity loci (PQL) were searched for 525 spots detected on 2-D gels obtained for 157 recombinant inbred lines. Most protein quantity loci mapped in clusters, suggesting that the accumulation of the major storage protein families was under the control of a limited number of loci. While convicilin accumulation was mainly under the control of cis-regulatory regions, vicilins and legumins were controlled by both cis- and trans-regulatory regions. Some loci controlled both seed protein composition and protein content and a locus on LGIIa appears to be a major regulator of protein composition and of protein in vitro digestibility. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Using modified soy protein to enhance foaming of egg white protein.
Wang, Guang; Troendle, Molly; Reitmeier, Cheryll A; Wang, Tong
2012-08-15
It is well known that the foaming properties of egg white protein are significantly reduced when a small amount of yolk is mixed in the white. To improve foaming properties of yolk-contaminated egg white protein, soy protein isolate (SPI) and egg proteins were modified to make basic proteins, and effects of these modified proteins on egg white foaming were evaluated in a model and an angel cake system. SPI and egg yolk proteins were modified to have an isoelectric point of 10, and sonication was used to increase protein dispersibility after the ethyl esterification reaction. However, only the addition of sonicated and modified SPI (SMSPI) showed improvement of foaming in the 5% egg protein model system with 0.4% yolk addition. SMSPI was then used in making angel food cake to examine whether the cake performance reduction due to yolk contamination of the white would be restored by such alkaline protein. Cake performance was improved when cream of tartar was used together with SMSPI. Basic soy protein can be made and used to improve egg white foaming properties and cake performance. Copyright © 2012 Society of Chemical Industry.
Resolubilization of Protein from Water-Insoluble Phlorotannin–Protein Complexes upon Acidification
2017-01-01
Marine phlorotannins (PhT) from Laminaria digitata might protect feed proteins from ruminal digestion by formation of insoluble non-covalent tannin–protein complexes at rumen pH (6–7). Formation and disintegration of PhT–protein complexes was studied with β-casein (random coil) and bovine serum albumin (BSA, globular) at various pH. PhT had similar binding affinity for β-casein and BSA as pentagalloyl glucose, as studied by fluorescence quenching. The affinity of PhT for both proteins was independent of pH (3.0, 6.0, and 8.0). In the presence of PhT, the pH range for precipitation of tannin–protein complexes widened to 0.5–1.5 pH units around the isoelectric point (pI) of the protein. Complete protein resolubilization from insoluble PhT–protein complexes was achieved at pH 7 and 2 for β-casein and BSA, respectively. It was demonstrated that PhT modulate the solubility of proteins at neutral pH and that resolubilization of PhT–protein complexes at pH deviating from pI is mainly governed by the charge state of the protein. PMID:29058916
Specificity of molecular interactions in transient protein-protein interaction interfaces.
Cho, Kyu-il; Lee, KiYoung; Lee, Kwang H; Kim, Dongsup; Lee, Doheon
2006-11-15
In this study, we investigate what types of interactions are specific to their biological function, and what types of interactions are persistent regardless of their functional category in transient protein-protein heterocomplexes. This is the first approach to analyze protein-protein interfaces systematically at the molecular interaction level in the context of protein functions. We perform systematic analysis at the molecular interaction level using classification and feature subset selection technique prevalent in the field of pattern recognition. To represent the physicochemical properties of protein-protein interfaces, we design 18 molecular interaction types using canonical and noncanonical interactions. Then, we construct input vector using the frequency of each interaction type in protein-protein interface. We analyze the 131 interfaces of transient protein-protein heterocomplexes in PDB: 33 protease-inhibitors, 52 antibody-antigens, 46 signaling proteins including 4 cyclin dependent kinase and 26 G-protein. Using kNN classification and feature subset selection technique, we show that there are specific interaction types based on their functional category, and such interaction types are conserved through the common binding mechanism, rather than through the sequence or structure conservation. The extracted interaction types are C(alpha)-- H...O==C interaction, cation...anion interaction, amine...amine interaction, and amine...cation interaction. With these four interaction types, we achieve the classification success rate up to 83.2% with leave-one-out cross-validation at k = 15. Of these four interaction types, C(alpha)--H...O==C shows binding specificity for protease-inhibitor complexes, while cation-anion interaction is predominant in signaling complexes. The amine ... amine and amine...cation interaction give a minor contribution to the classification accuracy. When combined with these two interactions, they increase the accuracy by 3.8%. In the case of
Protein-protein interactions in the regulation of WRKY transcription factors.
Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang
2013-03-01
It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.
Kinjo, Akira R; Nakamura, Haruki
2013-01-01
Protein functions are mediated by interactions between proteins and other molecules. One useful approach to analyze protein functions is to compare and classify the structures of interaction interfaces of proteins. Here, we describe the procedures for compiling a database of interface structures and efficiently comparing the interface structures. To do so requires a good understanding of the data structures of the Protein Data Bank (PDB). Therefore, we also provide a detailed account of the PDB exchange dictionary necessary for extracting data that are relevant for analyzing interaction interfaces and secondary structures. We identify recurring structural motifs by classifying similar interface structures, and we define a coarse-grained representation of supersecondary structures (SSS) which represents a sequence of two or three secondary structure elements including their relative orientations as a string of four to seven letters. By examining the correspondence between structural motifs and SSS strings, we show that no SSS string has particularly high propensity to be found interaction interfaces in general, indicating any SSS can be used as a binding interface. When individual structural motifs are examined, there are some SSS strings that have high propensity for particular groups of structural motifs. In addition, it is shown that while the SSS strings found in particular structural motifs for nonpolymer and protein interfaces are as abundant as in other structural motifs that belong to the same subunit, structural motifs for nucleic acid interfaces exhibit somewhat stronger preference for SSS strings. In regard to protein folds, many motif-specific SSS strings were found across many folds, suggesting that SSS may be a useful description to investigate the universality of ligand binding modes.
Saito, Rintaro; Suzuki, Harukazu; Hayashizaki, Yoshihide
2003-04-12
Recent screening techniques have made large amounts of protein-protein interaction data available, from which biologically important information such as the function of uncharacterized proteins, the existence of novel protein complexes, and novel signal-transduction pathways can be discovered. However, experimental data on protein interactions contain many false positives, making these discoveries difficult. Therefore computational methods of assessing the reliability of each candidate protein-protein interaction are urgently needed. We developed a new 'interaction generality' measure (IG2) to assess the reliability of protein-protein interactions using only the topological properties of their interaction-network structure. Using yeast protein-protein interaction data, we showed that reliable protein-protein interactions had significantly lower IG2 values than less-reliable interactions, suggesting that IG2 values can be used to evaluate and filter interaction data to enable the construction of reliable protein-protein interaction networks.
Goichon, Alexis; Bertrand, Julien; Chan, Philippe; Lecleire, Stéphane; Coquard, Aude; Cailleux, Anne-Françoise; Vaudry, David; Déchelotte, Pierre; Coëffier, Moïse
2015-08-01
Amino acids are well known to be key effectors of gut protein turnover. We recently reported that enteral delivery of proteins markedly stimulated global duodenal protein synthesis in carbohydrate-fed healthy humans, but specifically affected proteins remain unknown. We aimed to assess the influence of an enteral protein supply on the duodenal mucosal proteome in carbohydrate-fed humans. Six healthy volunteers received for 5 h, on 2 occasions and in random order, either an enteral infusion of maltodextrins alone (0.25 g · kg⁻¹ · h⁻¹) mimicking the fed state or maltodextrins with a protein powder (0.14 g proteins · kg⁻¹ · h⁻¹). Endoscopic duodenal biopsy specimens were then collected and frozen until analysis. A 2-dimensional polyacrylamide gel electrophoresis-based comparative proteomics analysis was then performed, and differentially expressed proteins (at least ±1.5-fold change; Student's t test, P < 0.05) were identified by mass spectrometry. Protein expression changes were confirmed by Western blot analysis. Thirty-two protein spots were differentially expressed after protein delivery compared with maltodextrins alone: 28 and 4 spots were up- or downregulated, respectively. Among the 22 identified proteins, 11 upregulated proteins were involved either in the cytoskeleton (ezrin, moesin, plastin 1, lamin B1, vimentin, and β-actin) or in protein biosynthesis (glutamyl-prolyl-transfer RNA synthetase, glutaminyl-transfer RNA synthetase, elongation factor 2, elongation factor 1δ, and eukaryotic translation and initiation factor 3 subunit f). Enteral delivery of proteins altered the duodenal mucosal proteome and mainly stimulated the expression of proteins involved in cytoskeleton and protein biosynthesis. These results suggest that protein supply may affect intestinal morphology by stimulating actin cytoskeleton remodeling. © 2015 American Society for Nutrition.
Prediction of protein-protein interaction sites using electrostatic desolvation profiles.
Fiorucci, Sébastien; Zacharias, Martin
2010-05-19
Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles
Fiorucci, Sébastien; Zacharias, Martin
2010-01-01
Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756
On the role of electrostatics in protein-protein interactions
NASA Astrophysics Data System (ADS)
Zhang, Zhe; Witham, Shawn; Alexov, Emil
2011-06-01
The role of electrostatics in protein-protein interactions and binding is reviewed in this paper. A brief outline of the computational modeling, in the framework of continuum electrostatics, is presented and the basic electrostatic effects occurring upon the formation of the complex are discussed. The effect of the salt concentration and pH of the water phase on protein-protein binding free energy is demonstrated which indicates that the increase of the salt concentration tends to weaken the binding, an observation that is attributed to the optimization of the charge-charge interactions across the interface. It is pointed out that the pH-optimum (pH of optimal binding affinity) varies among the protein-protein complexes, and perhaps is a result of their adaptation to particular subcellular compartments. The similarities and differences between hetero- and homo-complexes are outlined and discussed with respect to the binding mode and charge complementarity.
Mapping protein-protein interactions using yeast two-hybrid assays.
Mehla, Jitender; Caufield, J Harry; Uetz, Peter
2015-05-01
Yeast two-hybrid (Y2H) screens are an efficient system for mapping protein-protein interactions and whole interactomes. The screens can be performed using random libraries or collections of defined open reading frames (ORFs) called ORFeomes. This protocol describes both library and array-based Y2H screening, with an emphasis on array-based assays. Array-based Y2H is commonly used to test a number of "prey" proteins for interactions with a single "bait" (target) protein or pool of proteins. The advantage of this approach is the direct identification of interacting protein pairs without further downstream experiments: The identity of the preys is known and does not require further confirmation. In contrast, constructing and screening a random prey library requires identification of individual prey clones and systematic retesting. Retesting is typically performed in an array format. © 2015 Cold Spring Harbor Laboratory Press.
Protein-Protein Interactions within Late Pre-40S Ribosomes
Campbell, Melody G.; Karbstein, Katrin
2011-01-01
Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762
Coarse-Grained Simulations of Protein-Protein Association: An Energy Landscape Perspective
Ravikumar, Krishnakumar M.; Huang, Wei; Yang, Sichun
2012-01-01
Understanding protein-protein association is crucial in revealing the molecular basis of many biological processes. Here, we describe a theoretical simulation pipeline to study protein-protein association from an energy landscape perspective. First, a coarse-grained model is implemented and its applications are demonstrated via molecular dynamics simulations for several protein complexes. Second, an enhanced search method is used to efficiently sample a broad range of protein conformations. Third, multiple conformations are identified and clustered from simulation data and further projected on a three-dimensional globe specifying protein orientations and interacting energies. Results from several complexes indicate that the crystal-like conformation is favorable on the energy landscape even if the landscape is relatively rugged with metastable conformations. A closer examination on molecular forces shows that the formation of associated protein complexes can be primarily electrostatics-driven, hydrophobics-driven, or a combination of both in stabilizing specific binding interfaces. Taken together, these results suggest that the coarse-grained simulations and analyses provide an alternative toolset to study protein-protein association occurring in functional biomolecular complexes. PMID:22947945
Potential Interference of Protein-Protein Interactions by Graphyne.
Luan, Binquan; Huynh, Tien; Zhou, Ruhong
2016-03-10
Graphyne has attracted tremendous attention recently due to its many potentially superior properties relative to those of graphene. Although extensive efforts have been devoted to explore the applicability of graphyne as an alternative nanomaterial for state-of-the-art nanotechnology (including biomedical applications), knowledge regarding its possible adverse effects to biological cells is still lacking. Here, using large-scale all-atom molecular dynamics simulations, we investigate the potential toxicity of graphyne by interfering a protein-protein interaction (ppI). We found that graphyne could indeed disrupt the ppIs by cutting through the protein-protein interface and separating the protein complex into noncontacting ones, due to graphyne's dispersive and hydrophobic interaction with the hydrophobic residues residing at the dimer interface. Our results help to elucidate the mechanism of interaction between graphyne and ppI networks within a biological cell and provide insights for its hazard reduction.
InterPred: A pipeline to identify and model protein-protein interactions.
Mirabello, Claudio; Wallner, Björn
2017-06-01
Protein-protein interactions (PPI) are crucial for protein function. There exist many techniques to identify PPIs experimentally, but to determine the interactions in molecular detail is still difficult and very time-consuming. The fact that the number of PPIs is vastly larger than the number of individual proteins makes it practically impossible to characterize all interactions experimentally. Computational approaches that can bridge this gap and predict PPIs and model the interactions in molecular detail are greatly needed. Here we present InterPred, a fully automated pipeline that predicts and model PPIs from sequence using structural modeling combined with massive structural comparisons and molecular docking. A key component of the method is the use of a novel random forest classifier that integrate several structural features to distinguish correct from incorrect protein-protein interaction models. We show that InterPred represents a major improvement in protein-protein interaction detection with a performance comparable or better than experimental high-throughput techniques. We also show that our full-atom protein-protein complex modeling pipeline performs better than state of the art protein docking methods on a standard benchmark set. In addition, InterPred was also one of the top predictors in the latest CAPRI37 experiment. InterPred source code can be downloaded from http://wallnerlab.org/InterPred Proteins 2017; 85:1159-1170. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
3DProIN: Protein-Protein Interaction Networks and Structure Visualization.
Li, Hui; Liu, Chunmei
2014-06-14
3DProIN is a computational tool to visualize protein-protein interaction networks in both two dimensional (2D) and three dimensional (3D) view. It models protein-protein interactions in a graph and explores the biologically relevant features of the tertiary structures of each protein in the network. Properties such as color, shape and name of each node (protein) of the network can be edited in either 2D or 3D views. 3DProIN is implemented using 3D Java and C programming languages. The internet crawl technique is also used to parse dynamically grasped protein interactions from protein data bank (PDB). It is a java applet component that is embedded in the web page and it can be used on different platforms including Linux, Mac and Window using web browsers such as Firefox, Internet Explorer, Chrome and Safari. It also was converted into a mac app and submitted to the App store as a free app. Mac users can also download the app from our website. 3DProIN is available for academic research at http://bicompute.appspot.com.
Conservation of hot regions in protein-protein interaction in evolution.
Hu, Jing; Li, Jiarui; Chen, Nansheng; Zhang, Xiaolong
2016-11-01
The hot regions of protein-protein interactions refer to the active area which formed by those most important residues to protein combination process. With the research development on protein interactions, lots of predicted hot regions can be discovered efficiently by intelligent computing methods, while performing biology experiments to verify each every prediction is hardly to be done due to the time-cost and the complexity of the experiment. This study based on the research of hot spot residue conservations, the proposed method is used to verify authenticity of predicted hot regions that using machine learning algorithm combined with protein's biological features and sequence conservation, though multiple sequence alignment, module substitute matrix and sequence similarity to create conservation scoring algorithm, and then using threshold module to verify the conservation tendency of hot regions in evolution. This research work gives an effective method to verify predicted hot regions in protein-protein interactions, which also provides a useful way to deeply investigate the functional activities of protein hot regions. Copyright © 2016. Published by Elsevier Inc.
Kelly, M; Vardhanabhuti, B; Luck, P; Drake, M A; Osborne, J; Foegeding, E A
2010-05-01
Whey protein beverages are adjusted to pH <4.5 to enhance clarity and stability, but this pH level is also associated with increased astringency. The goal of this investigation was to determine the effects of protein concentration on astringency and interactions between whey and salivary proteins. Whey protein beverages containing 0.25 to 13% (wt/wt) beta-lactoglobulin and 0.017% (wt/wt) sucralose at pH 2.6 to 4.2 were examined using descriptive sensory analysis. Controls were similar pH phosphate buffers at phosphate concentrations equivalent to the amount of phosphoric acid required to adjust the pH of the protein solution. Changes in astringency with protein concentration depended on pH. At pH 3.5, astringency significantly increased with protein concentration from 0.25 to 4% (wt/wt) and then remained constant from 4 to 13% (wt/wt). Conversely, at pH 2.6, astringency decreased with an increase in protein concentration [0.5-10% (wt/wt)]. This suggests a complex relationship that includes pH and buffering capacity of the beverages. Furthermore, saliva flow rates increased with increasing protein concentrations, showing that the physiological conditions in the mouth change with protein concentration. Maximum turbidity of whey protein-saliva mixtures was observed between pH 4.6 and 5.2. Both sensory evaluation and in vitro study of interactions between beta-LG and saliva indicate that astringency of whey proteins is a complex process determined by the extent of aggregation occurring in the mouth, which depends on the whey protein beverage pH and buffering capacity in addition to saliva flow rate. Copyright 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Racemic protein crystallography.
Yeates, Todd O; Kent, Stephen B H
2012-01-01
Although natural proteins are chiral and are all of one "handedness," their mirror image forms can be prepared by chemical synthesis. This opens up new opportunities for protein crystallography. A racemic mixture of the enantiomeric forms of a protein molecule can crystallize in ways that natural proteins cannot. Recent experimental data support a theoretical prediction that this should make racemic protein mixtures highly amenable to crystallization. Crystals obtained from racemic mixtures also offer advantages in structure determination strategies. The relevance of these potential advantages is heightened by advances in synthetic methods, which are extending the size limit for proteins that can be prepared by chemical synthesis. Recent ideas and results in the area of racemic protein crystallography are reviewed.
DOCKSCORE: a webserver for ranking protein-protein docked poses.
Malhotra, Sony; Mathew, Oommen K; Sowdhamini, Ramanathan
2015-04-24
Proteins interact with a variety of other molecules such as nucleic acids, small molecules and other proteins inside the cell. Structure-determination of protein-protein complexes is challenging due to several reasons such as the large molecular weights of these macromolecular complexes, their dynamic nature, difficulty in purification and sample preparation. Computational docking permits an early understanding of the feasibility and mode of protein-protein interactions. However, docking algorithms propose a number of solutions and it is a challenging task to select the native or near native pose(s) from this pool. DockScore is an objective scoring scheme that can be used to rank protein-protein docked poses. It considers several interface parameters, namely, surface area, evolutionary conservation, hydrophobicity, short contacts and spatial clustering at the interface for scoring. We have implemented DockScore in form of a webserver for its use by the scientific community. DockScore webserver can be employed, subsequent to docking, to perform scoring of the docked solutions, starting from multiple poses as inputs. The results, on scores and ranks for all the poses, can be downloaded as a csv file and graphical view of the interface of best ranking poses is possible. The webserver for DockScore is made freely available for the scientific community at: http://caps.ncbs.res.in/dockscore/ .
Modularity in protein structures: study on all-alpha proteins.
Khan, Taushif; Ghosh, Indira
2015-01-01
Modularity is known as one of the most important features of protein's robust and efficient design. The architecture and topology of proteins play a vital role by providing necessary robust scaffolds to support organism's growth and survival in constant evolutionary pressure. These complex biomolecules can be represented by several layers of modular architecture, but it is pivotal to understand and explore the smallest biologically relevant structural component. In the present study, we have developed a component-based method, using protein's secondary structures and their arrangements (i.e. patterns) in order to investigate its structural space. Our result on all-alpha protein shows that the known structural space is highly populated with limited set of structural patterns. We have also noticed that these frequently observed structural patterns are present as modules or "building blocks" in large proteins (i.e. higher secondary structure content). From structural descriptor analysis, observed patterns are found to be within similar deviation; however, frequent patterns are found to be distinctly occurring in diverse functions e.g. in enzymatic classes and reactions. In this study, we are introducing a simple approach to explore protein structural space using combinatorial- and graph-based geometry methods, which can be used to describe modularity in protein structures. Moreover, analysis indicates that protein function seems to be the driving force that shapes the known structure space.
Adaptor proteins in protein kinase C-mediated signal transduction.
Schechtman, D; Mochly-Rosen, D
2001-10-01
Spatial and temporal organization of signal transduction is essential in determining the speed and precision by which signaling events occur. Adaptor proteins are key to organizing signaling enzymes near their select substrates and away from others in order to optimize precision and speed of response. Here, we describe the role of adaptor proteins in determining the specific function of individual protein kinase C (PKC) isozymes. These isozyme-selective proteins were called collectively RACKs (receptors for activated C-kinase). The role of RACKs in PKC-mediated signaling was determined using isozyme-specific inhibitors and activators of the binding of each isozyme to its respective RACK. In addition to anchoring activated PKC isozymes, RACKs anchor other signaling enzymes. RACK1, the anchoring protein for activated betaIIPKC, binds for example, Src tyrosine kinase, integrin, and phosphodiesterase. RACK2, the epsilonPKC-specific RACK, is a coated-vesicle protein and thus is involved in vesicular release and cell-cell communication. Therefore, RACKs are not only adaptors for PKC, but also serve as adaptor proteins for several other signaling enzymes. Because at least some of the proteins that bind to RACKs, including PKC itself, regulate cell growth, modulating their interactions with RACKs may help elucidate signaling pathways leading to carcinogenesis and could result in the identification of novel therapeutic targets.
In silico prediction of protein-protein interactions in human macrophages
2014-01-01
Background Protein-protein interaction (PPI) network analyses are highly valuable in deciphering and understanding the intricate organisation of cellular functions. Nevertheless, the majority of available protein-protein interaction networks are context-less, i.e. without any reference to the spatial, temporal or physiological conditions in which the interactions may occur. In this work, we are proposing a protocol to infer the most likely protein-protein interaction (PPI) network in human macrophages. Results We integrated the PPI dataset from the Agile Protein Interaction DataAnalyzer (APID) with different meta-data to infer a contextualized macrophage-specific interactome using a combination of statistical methods. The obtained interactome is enriched in experimentally verified interactions and in proteins involved in macrophage-related biological processes (i.e. immune response activation, regulation of apoptosis). As a case study, we used the contextualized interactome to highlight the cellular processes induced upon Mycobacterium tuberculosis infection. Conclusion Our work confirms that contextualizing interactomes improves the biological significance of bioinformatic analyses. More specifically, studying such inferred network rather than focusing at the gene expression level only, is informative on the processes involved in the host response. Indeed, important immune features such as apoptosis are solely highlighted when the spotlight is on the protein interaction level. PMID:24636261
Electrostatic contribution to the binding stability of protein-protein complexes.
Dong, Feng; Zhou, Huan-Xiang
2006-10-01
To investigate roles of electrostatic interactions in protein binding stability, electrostatic calculations were carried out on a set of 64 mutations over six protein-protein complexes. These mutations alter polar interactions across the interface and were selected for putative dominance of electrostatic contributions to the binding stability. Three protocols of implementing the Poisson-Boltzmann model were tested. In vdW4 the dielectric boundary between the protein low dielectric and the solvent high dielectric is defined as the protein van der Waals surface and the protein dielectric constant is set to 4. In SE4 and SE20, the dielectric boundary is defined as the surface of the protein interior inaccessible to a 1.4-A solvent probe, and the protein dielectric constant is set to 4 and 20, respectively. In line with earlier studies on the barnase-barstar complex, the vdW4 results on the large set of mutations showed the closest agreement with experimental data. The agreement between vdW4 and experiment supports the contention of dominant electrostatic contributions for the mutations, but their differences also suggest van der Waals and hydrophobic contributions. The results presented here will serve as a guide for future refinement in electrostatic calculation and inclusion of nonelectrostatic effects. Proteins 2006. (c) 2006 Wiley-Liss, Inc.
Dynamic Fluctuations of Protein-Carbohydrate Interactions Promote Protein Aggregation
Voynov, Vladimir; Chennamsetty, Naresh; Kayser, Veysel; Helk, Bernhard; Forrer, Kurt; Zhang, Heidi; Fritsch, Cornelius; Heine, Holger; Trout, Bernhardt L.
2009-01-01
Protein-carbohydrate interactions are important for glycoprotein structure and function. Antibodies of the IgG class, with increasing significance as therapeutics, are glycosylated at a conserved site in the constant Fc region. We hypothesized that disruption of protein-carbohydrate interactions in the glycosylated domain of antibodies leads to the exposure of aggregation-prone motifs. Aggregation is one of the main problems in protein-based therapeutics because of immunogenicity concerns and decreased efficacy. To explore the significance of intramolecular interactions between aromatic amino acids and carbohydrates in the IgG glycosylated domain, we utilized computer simulations, fluorescence analysis, and site-directed mutagenesis. We find that the surface exposure of one aromatic amino acid increases due to dynamic fluctuations. Moreover, protein-carbohydrate interactions decrease upon stress, while protein-protein and carbohydrate-carbohydrate interactions increase. Substitution of the carbohydrate-interacting aromatic amino acids with non-aromatic residues leads to a significantly lower stability than wild type, and to compromised binding to Fc receptors. Our results support a mechanism for antibody aggregation via decreased protein-carbohydrate interactions, leading to the exposure of aggregation-prone regions, and to aggregation. PMID:20037630
Drug Target Protein-Protein Interaction Networks: A Systematic Perspective
2017-01-01
The identification and validation of drug targets are crucial in biomedical research and many studies have been conducted on analyzing drug target features for getting a better understanding on principles of their mechanisms. But most of them are based on either strong biological hypotheses or the chemical and physical properties of those targets separately. In this paper, we investigated three main ways to understand the functional biomolecules based on the topological features of drug targets. There are no significant differences between targets and common proteins in the protein-protein interactions network, indicating the drug targets are neither hub proteins which are dominant nor the bridge proteins. According to some special topological structures of the drug targets, there are significant differences between known targets and other proteins. Furthermore, the drug targets mainly belong to three typical communities based on their modularity. These topological features are helpful to understand how the drug targets work in the PPI network. Particularly, it is an alternative way to predict potential targets or extract nontargets to test a new drug target efficiently and economically. By this way, a drug target's homologue set containing 102 potential target proteins is predicted in the paper. PMID:28691014
ERIC Educational Resources Information Center
Asmus, Elaine Garbarino
2007-01-01
Individual students model specific amino acids and then, through dehydration synthesis, a class of students models a protein. The students clearly learn amino acid structure, primary, secondary, tertiary, and quaternary structure in proteins and the nature of the bonds maintaining a protein's shape. This activity is fun, concrete, inexpensive and…
Categorizing Biases in High-Confidence High-Throughput Protein-Protein Interaction Data Sets*
Yu, Xueping; Ivanic, Joseph; Memišević, Vesna; Wallqvist, Anders; Reifman, Jaques
2011-01-01
We characterized and evaluated the functional attributes of three yeast high-confidence protein-protein interaction data sets derived from affinity purification/mass spectrometry, protein-fragment complementation assay, and yeast two-hybrid experiments. The interacting proteins retrieved from these data sets formed distinct, partially overlapping sets with different protein-protein interaction characteristics. These differences were primarily a function of the deployed experimental technologies used to recover these interactions. This affected the total coverage of interactions and was especially evident in the recovery of interactions among different functional classes of proteins. We found that the interaction data obtained by the yeast two-hybrid method was the least biased toward any particular functional characterization. In contrast, interacting proteins in the affinity purification/mass spectrometry and protein-fragment complementation assay data sets were over- and under-represented among distinct and different functional categories. We delineated how these differences affected protein complex organization in the network of interactions, in particular for strongly interacting complexes (e.g. RNA and protein synthesis) versus weak and transient interacting complexes (e.g. protein transport). We quantified methodological differences in detecting protein interactions from larger protein complexes, in the correlation of protein abundance among interacting proteins, and in their connectivity of essential proteins. In the latter case, we showed that minimizing inherent methodology biases removed many of the ambiguous conclusions about protein essentiality and protein connectivity. We used these findings to rationalize how biological insights obtained by analyzing data sets originating from different sources sometimes do not agree or may even contradict each other. An important corollary of this work was that discrepancies in biological insights did not
A novel microfluidics-based method for probing weak protein-protein interactions.
Tan, Darren Cherng-wen; Wijaya, I Putu Mahendra; Andreasson-Ochsner, Mirjam; Vasina, Elena Nikolaevna; Nallani, Madhavan; Hunziker, Walter; Sinner, Eva-Kathrin
2012-08-07
We report the use of a novel microfluidics-based method to detect weak protein-protein interactions between membrane proteins. The tight junction protein, claudin-2, synthesised in vitro using a cell-free expression system in the presence of polymer vesicles as membrane scaffolds, was used as a model membrane protein. Individual claudin-2 molecules interact weakly, although the cumulative effect of these interactions is significant. This effect results in a transient decrease of average vesicle dispersivity and reduction in transport speed of claudin-2-functionalised vesicles. Polymer vesicles functionalised with claudin-2 were perfused through a microfluidic channel and the time taken to traverse a defined distance within the channel was measured. Functionalised vesicles took 1.19 to 1.69 times longer to traverse this distance than unfunctionalised ones. Coating the channel walls with protein A and incubating the vesicles with anti-claudin-2 antibodies prior to perfusion resulted in the functionalised vesicles taking 1.75 to 2.5 times longer to traverse this distance compared to the controls. The data show that our system is able to detect weak as well as strong protein-protein interactions. This system offers researchers a portable, easily operated and customizable platform for the study of weak protein-protein interactions, particularly between membrane proteins.
Modeling Protein Expression and Protein Signaling Pathways
Telesca, Donatello; Müller, Peter; Kornblau, Steven M.; Suchard, Marc A.; Ji, Yuan
2015-01-01
High-throughput functional proteomic technologies provide a way to quantify the expression of proteins of interest. Statistical inference centers on identifying the activation state of proteins and their patterns of molecular interaction formalized as dependence structure. Inference on dependence structure is particularly important when proteins are selected because they are part of a common molecular pathway. In that case, inference on dependence structure reveals properties of the underlying pathway. We propose a probability model that represents molecular interactions at the level of hidden binary latent variables that can be interpreted as indicators for active versus inactive states of the proteins. The proposed approach exploits available expert knowledge about the target pathway to define an informative prior on the hidden conditional dependence structure. An important feature of this prior is that it provides an instrument to explicitly anchor the model space to a set of interactions of interest, favoring a local search approach to model determination. We apply our model to reverse-phase protein array data from a study on acute myeloid leukemia. Our inference identifies relevant subpathways in relation to the unfolding of the biological process under study. PMID:26246646
Encounter complexes and dimensionality reduction in protein-protein association.
Kozakov, Dima; Li, Keyong; Hall, David R; Beglov, Dmitri; Zheng, Jiefu; Vakili, Pirooz; Schueler-Furman, Ora; Paschalidis, Ioannis Ch; Clore, G Marius; Vajda, Sandor
2014-04-08
An outstanding challenge has been to understand the mechanism whereby proteins associate. We report here the results of exhaustively sampling the conformational space in protein-protein association using a physics-based energy function. The agreement between experimental intermolecular paramagnetic relaxation enhancement (PRE) data and the PRE profiles calculated from the docked structures shows that the method captures both specific and non-specific encounter complexes. To explore the energy landscape in the vicinity of the native structure, the nonlinear manifold describing the relative orientation of two solid bodies is projected onto a Euclidean space in which the shape of low energy regions is studied by principal component analysis. Results show that the energy surface is canyon-like, with a smooth funnel within a two dimensional subspace capturing over 75% of the total motion. Thus, proteins tend to associate along preferred pathways, similar to sliding of a protein along DNA in the process of protein-DNA recognition. DOI: http://dx.doi.org/10.7554/eLife.01370.001.
On the role of electrostatics on protein-protein interactions
Zhang, Zhe; Witham, Shawn; Alexov, Emil
2011-01-01
The role of electrostatics on protein-protein interactions and binding is reviewed in this article. A brief outline of the computational modeling, in the framework of continuum electrostatics, is presented and basic electrostatic effects occurring upon the formation of the complex are discussed. The role of the salt concentration and pH of the water phase on protein-protein binding free energy is demonstrated and indicates that the increase of the salt concentration tends to weaken the binding, an observation that is attributed to the optimization of the charge-charge interactions across the interface. It is pointed out that the pH-optimum (pH of optimal binding affinity) varies among the protein-protein complexes, and perhaps is a result of their adaptation to particular subcellular compartment. At the end, the similarities and differences between hetero- and homo-complexes are outlined and discussed with respect to the binding mode and charge complementarity. PMID:21572182
Evolution of an intricate J-protein network driving protein disaggregation in eukaryotes.
Nillegoda, Nadinath B; Stank, Antonia; Malinverni, Duccio; Alberts, Niels; Szlachcic, Anna; Barducci, Alessandro; De Los Rios, Paolo; Wade, Rebecca C; Bukau, Bernd
2017-05-15
Hsp70 participates in a broad spectrum of protein folding processes extending from nascent chain folding to protein disaggregation. This versatility in function is achieved through a diverse family of J-protein cochaperones that select substrates for Hsp70. Substrate selection is further tuned by transient complexation between different classes of J-proteins, which expands the range of protein aggregates targeted by metazoan Hsp70 for disaggregation. We assessed the prevalence and evolutionary conservation of J-protein complexation and cooperation in disaggregation. We find the emergence of a eukaryote-specific signature for interclass complexation of canonical J-proteins. Consistently, complexes exist in yeast and human cells, but not in bacteria, and correlate with cooperative action in disaggregation in vitro. Signature alterations exclude some J-proteins from networking, which ensures correct J-protein pairing, functional network integrity and J-protein specialization. This fundamental change in J-protein biology during the prokaryote-to-eukaryote transition allows for increased fine-tuning and broadening of Hsp70 function in eukaryotes.
Quantitative study of protein-protein interactions by quartz nanopipettes
NASA Astrophysics Data System (ADS)
Tiwari, Purushottam Babu; Astudillo, Luisana; Miksovska, Jaroslava; Wang, Xuewen; Li, Wenzhi; Darici, Yesim; He, Jin
2014-08-01
In this report, protein-modified quartz nanopipettes were used to quantitatively study protein-protein interactions in attoliter sensing volumes. As shown by numerical simulations, the ionic current through the conical-shaped nanopipette is very sensitive to the surface charge variation near the pore mouth. With the appropriate modification of negatively charged human neuroglobin (hNgb) onto the inner surface of a nanopipette, we were able to detect concentration-dependent current change when the hNgb-modified nanopipette tip was exposed to positively charged cytochrome c (Cyt c) with a series of concentrations in the bath solution. Such current change is due to the adsorption of Cyt c to the inner surface of the nanopipette through specific interactions with hNgb. In contrast, a smaller current change with weak concentration dependence was observed when Cyt c was replaced with lysozyme, which does not specifically bind to hNgb. The equilibrium dissociation constant (KD) for the Cyt c-hNgb complex formation was derived and the value matched very well with the result from surface plasmon resonance measurement. This is the first quantitative study of protein-protein interactions by a conical-shaped nanopore based on charge sensing. Our results demonstrate that nanopipettes can potentially be used as a label-free analytical tool to quantitatively characterize protein-protein interactions.In this report, protein-modified quartz nanopipettes were used to quantitatively study protein-protein interactions in attoliter sensing volumes. As shown by numerical simulations, the ionic current through the conical-shaped nanopipette is very sensitive to the surface charge variation near the pore mouth. With the appropriate modification of negatively charged human neuroglobin (hNgb) onto the inner surface of a nanopipette, we were able to detect concentration-dependent current change when the hNgb-modified nanopipette tip was exposed to positively charged cytochrome c (Cyt c) with
Protein-protein interaction networks (PPI) and complex diseases
Safari-Alighiarloo, Nahid; Taghizadeh, Mohammad; Rezaei-Tavirani, Mostafa; Goliaei, Bahram
2014-01-01
The physical interaction of proteins which lead to compiling them into large densely connected networks is a noticeable subject to investigation. Protein interaction networks are useful because of making basic scientific abstraction and improving biological and biomedical applications. Based on principle roles of proteins in biological function, their interactions determine molecular and cellular mechanisms, which control healthy and diseased states in organisms. Therefore, such networks facilitate the understanding of pathogenic (and physiologic) mechanisms that trigger the onset and progression of diseases. Consequently, this knowledge can be translated into effective diagnostic and therapeutic strategies. Furthermore, the results of several studies have proved that the structure and dynamics of protein networks are disturbed in complex diseases such as cancer and autoimmune disorders. Based on such relationship, a novel paradigm is suggested in order to confirm that the protein interaction networks can be the target of therapy for treatment of complex multi-genic diseases rather than individual molecules with disrespect the network. PMID:25436094
Coarse-grained simulations of protein-protein association: an energy landscape perspective.
Ravikumar, Krishnakumar M; Huang, Wei; Yang, Sichun
2012-08-22
Understanding protein-protein association is crucial in revealing the molecular basis of many biological processes. Here, we describe a theoretical simulation pipeline to study protein-protein association from an energy landscape perspective. First, a coarse-grained model is implemented and its applications are demonstrated via molecular dynamics simulations for several protein complexes. Second, an enhanced search method is used to efficiently sample a broad range of protein conformations. Third, multiple conformations are identified and clustered from simulation data and further projected on a three-dimensional globe specifying protein orientations and interacting energies. Results from several complexes indicate that the crystal-like conformation is favorable on the energy landscape even if the landscape is relatively rugged with metastable conformations. A closer examination on molecular forces shows that the formation of associated protein complexes can be primarily electrostatics-driven, hydrophobics-driven, or a combination of both in stabilizing specific binding interfaces. Taken together, these results suggest that the coarse-grained simulations and analyses provide an alternative toolset to study protein-protein association occurring in functional biomolecular complexes. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Suga, Hinako; Haga, Tatsuya
2007-01-01
G protein-coupled receptors (GPCRs) constitute one of the largest families of genes in the human genome, and are the largest targets for drug development. Although a large number of GPCR genes have recently been identified, ligands have not yet been identified for many of them. Various assay systems have been employed to identify ligands for orphan GPCRs, but there is still no simple and general method to screen for ligands of such GPCRs, particularly of G(i)-coupled receptors. We have examined whether fusion proteins of GPCRs with G protein alpha subunit (Galpha) could be utilized for ligand screening and showed that the fusion proteins provide an effective method for the purpose. This article focuses on the followings: (1) characterization of GPCR genes and GPCRs, (2) identification of ligands for orphan GPCRs, (3) characterization of GPCR-Galpha fusion proteins, and (4) identification of ligands for orphan GPCRs using GPCR-Galpha fusion proteins.
Revealing protein functions based on relationships of interacting proteins and GO terms.
Teng, Zhixia; Guo, Maozu; Liu, Xiaoyan; Tian, Zhen; Che, Kai
2017-09-20
In recent years, numerous computational methods predicted protein function based on the protein-protein interaction (PPI) network. These methods supposed that two proteins share the same function if they interact with each other. However, it is reported by recent studies that the functions of two interacting proteins may be just related. It will mislead the prediction of protein function. Therefore, there is a need for investigating the functional relationship between interacting proteins. In this paper, the functional relationship between interacting proteins is studied and a novel method, called as GoDIN, is advanced to annotate functions of interacting proteins in Gene Ontology (GO) context. It is assumed that the functional difference between interacting proteins can be expressed by semantic difference between GO term and its relatives. Thus, the method uses GO term and its relatives to annotate the interacting proteins separately according to their functional roles in the PPI network. The method is validated by a series of experiments and compared with the concerned method. The experimental results confirm the assumption and suggest that GoDIN is effective on predicting functions of protein. This study demonstrates that: (1) interacting proteins are not equal in the PPI network, and their function may be same or similar, or just related; (2) functional difference between interacting proteins can be measured by their degrees in the PPI network; (3) functional relationship between interacting proteins can be expressed by relationship between GO term and its relatives.
Comparative Protein Profiling of Intraphagosomal Expressed Proteins of Mycobacterium bovis BCG.
Singhal, Neelja; Kumar, Manish; Sharma, Divakar; Bisht, Deepa
2016-01-01
BCG, the only available vaccine against tuberculosis affords a variable protection which wanes with time. In this study we have analyzed and compared the proteins which are expressed differentially during broth-culture and intraphagosomal growth of M.bovis BCG. Eight proteins which showed increased expression during the intraphagosomal growth were identified by MALDI-TOF/MS. These were - a precursor of alanine and proline-rich secreted protein apa, isoforms of malate dehydrogenase, large subunit alpha (Alpha-ETF) of electron transfer flavoprotein, immunogenic protein MPB64 precursor, UPF0036 protein, and two proteins with unknown function. Based on these findings we speculate that higher expression of these proteins has a probable role in intracellular survival, adaptation and/or immunoprotective effect of BCG. Further, these proteins might also be used as gene expression markers for endosome trafficking events of BCG.
Lipid-protein interaction in the phosphatidylcholine exchange protein.
Devaux, P F; Moonen, P; Bienvenue, A; Wirtz, K W
1977-01-01
Incorporation of 2-acyl spin-labeled lecithin into the phosphatidylcholine protein from bovine liver results in an immobilization of the spin-label at the methyl and the carboxyl terminal end of the acyl chain. The nitroxide group on the protein-bound lecithin molecule is not accessible to ascorbate. This suggests that lecithin is buried in a pocket on the protein, which effectively shields the acyl chains from the medium. PMID:194240
A web interface for easy flexible protein-protein docking with ATTRACT.
de Vries, Sjoerd J; Schindler, Christina E M; Chauvot de Beauchêne, Isaure; Zacharias, Martin
2015-02-03
Protein-protein docking programs can give valuable insights into the structure of protein complexes in the absence of an experimental complex structure. Web interfaces can facilitate the use of docking programs by structural biologists. Here, we present an easy web interface for protein-protein docking with the ATTRACT program. While aimed at nonexpert users, the web interface still covers a considerable range of docking applications. The web interface supports systematic rigid-body protein docking with the ATTRACT coarse-grained force field, as well as various kinds of protein flexibility. The execution of a docking protocol takes up to a few hours on a standard desktop computer. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Shape Complementarity of Protein-Protein Complexes at Multiple Resolutions
Zhang, Qing; Sanner, Michel; Olson, Arthur J.
2010-01-01
Biological complexes typically exhibit intermolecular interfaces of high shape complementarity. Many computational docking approaches use this surface complementarity as a guide in the search for predicting the structures of protein-protein complexes. Proteins often undergo conformational changes in order to create a highly complementary interface when associating. These conformational changes are a major cause of failure for automated docking procedures when predicting binding modes between proteins using their unbound conformations. Low resolution surfaces in which high frequency geometric details are omitted have been used to address this problem. These smoothed, or blurred, surfaces are expected to minimize the differences between free and bound structures, especially those that are due to side chain conformations or small backbone deviations. In spite of the fact that this approach has been used in many docking protocols, there has yet to be a systematic study of the effects of such surface smoothing on the shape complementarity of the resulting interfaces. Here we investigate this question by computing shape complementarity of a set of 66 protein-protein complexes represented by multi-resolution blurred surfaces. Complexed and unbound structures are available for these protein-protein complexes. They are a subset of complexes from a non-redundant docking benchmark selected for rigidity (i.e. the proteins undergo limited conformational changes between their bound and unbound states). In this work we construct the surfaces by isocontouring a density map obtained by accumulating the densities of Gaussian functions placed at all atom centers of the molecule. The smoothness or resolution is specified by a Gaussian fall-off coefficient, termed “blobbyness”. Shape complementarity is quantified using a histogram of the shortest distances between two proteins' surface mesh vertices for both the crystallographic complexes and the complexes built using the protein
New molecular settings to support in vivo anti-malarial assays.
Bahamontes-Rosa, Noemí; Alejandre, Ane Rodriguez; Gomez, Vanesa; Viera, Sara; Gomez-Lorenzo, María G; Sanz-Alonso, Laura María; Mendoza-Losana, Alfonso
2016-03-08
Quantitative real-time PCR (qPCR) is now commonly used as a method to confirm diagnosis of malaria and to differentiate recrudescence from re-infection, especially in clinical trials and in reference laboratories where precise quantification is critical. Although anti-malarial drug discovery is based on in vivo murine efficacy models, use of molecular analysis has been limited. The aim of this study was to develop qPCR as a valid methodology to support pre-clinical anti-malarial models by using filter papers to maintain material for qPCR and to compare this with traditional methods. FTA technology (Whatman) is a rapid and safe method for extracting nucleic acids from blood. Peripheral blood samples from mice infected with Plasmodium berghei, P. yoelii, or P. falciparum were kept as frozen samples or as spots on FTA cards. The extracted genetic material from both types of samples was assessed for quantification by qPCR using sets of specific primers specifically designed for Plasmodium 18S rRNA, LDH, and CytB genes. The optimal conditions for nucleic acid extraction from FTA cards and qPCR amplification were set up, and were confirmed to be suitable for parasite quantification using DNA as template after storage at room temperature for as long as 26 months in the case of P. berghei samples and 52 months for P. falciparum and P. yoelii. The quality of DNA extracted from the FTA cards for gene sequencing and microsatellite amplification was also assessed. This is the first study to report the suitability of FTA cards and qPCR assay to quantify parasite load in samples from in vivo efficacy models to support the drug discovery process.
Agrawal, Neeraj J; Helk, Bernhard; Trout, Bernhardt L
2014-01-21
Identifying hot-spot residues - residues that are critical to protein-protein binding - can help to elucidate a protein's function and assist in designing therapeutic molecules to target those residues. We present a novel computational tool, termed spatial-interaction-map (SIM), to predict the hot-spot residues of an evolutionarily conserved protein-protein interaction from the structure of an unbound protein alone. SIM can predict the protein hot-spot residues with an accuracy of 36-57%. Thus, the SIM tool can be used to predict the yet unknown hot-spot residues for many proteins for which the structure of the protein-protein complexes are not available, thereby providing a clue to their functions and an opportunity to design therapeutic molecules to target these proteins. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Advances in engineering of fluorescent proteins and photoactivatable proteins with red emission.
Piatkevich, Kiryl D; Verkhusha, Vladislav V
2010-02-01
Monomeric fluorescent proteins of different colors are widely used to study behavior and targeting of proteins in living cells. Fluorescent proteins that irreversibly change their spectral properties in response to light irradiation of a specific wavelength, or photoactivate, have become increasingly popular to image intracellular dynamics and superresolution protein localization. Until recently, however, no optimized monomeric red fluorescent proteins and red photoactivatable proteins have been available. Furthermore, monomeric fluorescent proteins, which change emission from blue to red simply with time, so-called fluorescent timers, were developed to study protein age and turnover. Understanding of chemical mechanisms of the chromophore maturation or photoactivation into a red form will further advance engineering of fluorescent timers and photoactivatable proteins with enhanced and novel properties. 2009 Elsevier Ltd. All rights reserved.
Pandey, Aditya; Shin, Kyungsoo; Patterson, Robin E; Liu, Xiang-Qin; Rainey, Jan K
2016-12-01
Membrane proteins are still heavily under-represented in the protein data bank (PDB), owing to multiple bottlenecks. The typical low abundance of membrane proteins in their natural hosts makes it necessary to overexpress these proteins either in heterologous systems or through in vitro translation/cell-free expression. Heterologous expression of proteins, in turn, leads to multiple obstacles, owing to the unpredictability of compatibility of the target protein for expression in a given host. The highly hydrophobic and (or) amphipathic nature of membrane proteins also leads to challenges in producing a homogeneous, stable, and pure sample for structural studies. Circumventing these hurdles has become possible through the introduction of novel protein production protocols; efficient protein isolation and sample preparation methods; and, improvement in hardware and software for structural characterization. Combined, these advances have made the past 10-15 years very exciting and eventful for the field of membrane protein structural biology, with an exponential growth in the number of solved membrane protein structures. In this review, we focus on both the advances and diversity of protein production and purification methods that have allowed this growth in structural knowledge of membrane proteins through X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, and cryo-electron microscopy (cryo-EM).
Pandey, Aditya; Shin, Kyungsoo; Patterson, Robin E.; Liu, Xiang-Qin; Rainey, Jan K.
2017-01-01
Membrane proteins are still heavily underrepresented in the protein data bank (PDB) due to multiple bottlenecks. The typical low abundance of membrane proteins in their natural hosts makes it necessary to overexpress these proteins either in heterologous systems or through in vitro translation/cell-free expression. Heterologous expression of proteins, in turn, leads to multiple obstacles due to the unpredictability of compatibility of the target protein for expression in a given host. The highly hydrophobic and/or amphipathic nature of membrane proteins also leads to challenges in producing a homogeneous, stable, and pure sample for structural studies. Circumventing these hurdles has become possible through introduction of novel protein production protocols; efficient protein isolation and sample preparation methods; and, improvement in hardware and software for structural characterization. Combined, these advances have made the past 10–15 years very exciting and eventful for the field of membrane protein structural biology, with an exponential growth in the number of solved membrane protein structures. In this review, we focus on both the advances and diversity of protein production and purification methods that have allowed this growth in structural knowledge of membrane proteins through X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, and cryo-electron microscopy (cryo-EM). PMID:27010607
Single Honeybee Silk Protein Mimics Properties of Multi-Protein Silk
Sutherland, Tara D.; Church, Jeffrey S.; Hu, Xiao; Huson, Mickey G.; Kaplan, David L.; Weisman, Sarah
2011-01-01
Honeybee silk is composed of four fibrous proteins that, unlike other silks, are readily synthesized at full-length and high yield. The four silk genes have been conserved for over 150 million years in all investigated bee, ant and hornet species, implying a distinct functional role for each protein. However, the amino acid composition and molecular architecture of the proteins are similar, suggesting functional redundancy. In this study we compare materials generated from a single honeybee silk protein to materials containing all four recombinant proteins or to natural honeybee silk. We analyse solution conformation by dynamic light scattering and circular dichroism, solid state structure by Fourier Transform Infrared spectroscopy and Raman spectroscopy, and fiber tensile properties by stress-strain analysis. The results demonstrate that fibers artificially generated from a single recombinant silk protein can reproduce the structural and mechanical properties of the natural silk. The importance of the four protein complex found in natural silk may lie in biological silk storage or hierarchical self-assembly. The finding that the functional properties of the mature material can be achieved with a single protein greatly simplifies the route to production for artificial honeybee silk. PMID:21311767
Eisenberg, David; Marcotte, Edward M.; Pellegrini, Matteo; Thompson, Michael J.; Yeates, Todd O.
2002-10-15
A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.
Efficient Relaxation of Protein-Protein Interfaces by Discrete Molecular Dynamics Simulations.
Emperador, Agusti; Solernou, Albert; Sfriso, Pedro; Pons, Carles; Gelpi, Josep Lluis; Fernandez-Recio, Juan; Orozco, Modesto
2013-02-12
Protein-protein interactions are responsible for the transfer of information inside the cell and represent one of the most interesting research fields in structural biology. Unfortunately, after decades of intense research, experimental approaches still have difficulties in providing 3D structures for the hundreds of thousands of interactions formed between the different proteins in a living organism. The use of theoretical approaches like docking aims to complement experimental efforts to represent the structure of the protein interactome. However, we cannot ignore that current methods have limitations due to problems of sampling of the protein-protein conformational space and the lack of accuracy of available force fields. Cases that are especially difficult for prediction are those in which complex formation implies a non-negligible change in the conformation of the interacting proteins, i.e., those cases where protein flexibility plays a key role in protein-protein docking. In this work, we present a new approach to treat flexibility in docking by global structural relaxation based on ultrafast discrete molecular dynamics. On a standard benchmark of protein complexes, the method provides a general improvement over the results obtained by rigid docking. The method is especially efficient in cases with large conformational changes upon binding, in which structure relaxation with discrete molecular dynamics leads to a predictive success rate double that obtained with state-of-the-art rigid-body docking.
Selection of peptides interfering with protein-protein interaction.
Gaida, Annette; Hagemann, Urs B; Mattay, Dinah; Räuber, Christina; Müller, Kristian M; Arndt, Katja M
2009-01-01
Cell physiology depends on a fine-tuned network of protein-protein interactions, and misguided interactions are often associated with various diseases. Consequently, peptides, which are able to specifically interfere with such adventitious interactions, are of high interest for analytical as well as medical purposes. One of the most abundant protein interaction domains is the coiled-coil motif, and thus provides a premier target. Coiled coils, which consist of two or more alpha-helices wrapped around each other, have one of the simplest interaction interfaces, yet they are able to confer highly specific homo- and heterotypic interactions involved in virtually any cellular process. While there are several ways to generate interfering peptides, the combination of library design with a powerful selection system seems to be one of the most effective and promising approaches. This chapter guides through all steps of such a process, starting with library options and cloning, detailing suitable selection techniques and ending with purification for further down-stream characterization. Such generated peptides will function as versatile tools to interfere with the natural function of their targets thereby illuminating their down-stream signaling and, in general, promoting understanding of factors leading to specificity and stability in protein-protein interactions. Furthermore, peptides interfering with medically relevant proteins might become important diagnostics and therapeutics.
Phthalic acid chemical probes synthesized for protein-protein interaction analysis.
Liang, Shih-Shin; Liao, Wei-Ting; Kuo, Chao-Jen; Chou, Chi-Hsien; Wu, Chin-Jen; Wang, Hui-Min
2013-06-24
Plasticizers are additives that are used to increase the flexibility of plastic during manufacturing. However, in injection molding processes, plasticizers cannot be generated with monomers because they can peel off from the plastics into the surrounding environment, water, or food, or become attached to skin. Among the various plasticizers that are used, 1,2-benzenedicarboxylic acid (phthalic acid) is a typical precursor to generate phthalates. In addition, phthalic acid is a metabolite of diethylhexyl phthalate (DEHP). According to Gene_Ontology gene/protein database, phthalates can cause genital diseases, cardiotoxicity, hepatotoxicity, nephrotoxicity, etc. In this study, a silanized linker (3-aminopropyl triethoxyslane, APTES) was deposited on silicon dioxides (SiO2) particles and phthalate chemical probes were manufactured from phthalic acid and APTES-SiO2. These probes could be used for detecting proteins that targeted phthalic acid and for protein-protein interactions. The phthalic acid chemical probes we produced were incubated with epithelioid cell lysates of normal rat kidney (NRK-52E cells) to detect the interactions between phthalic acid and NRK-52E extracted proteins. These chemical probes interacted with a number of chaperones such as protein disulfide-isomerase A6, heat shock proteins, and Serpin H1. Ingenuity Pathways Analysis (IPA) software showed that these chemical probes were a practical technique for protein-protein interaction analysis.
Raut, Ashlesha S; Kalonia, Devendra S
2015-09-08
Dual variable domain immunoglobulin proteins (DVD-Ig proteins) are large molecules (MW ∼ 200 kDa) with increased asymmetry because of their extended Y-like shape, which results in increased formulation challenges. Liquid-liquid phase separation (LLPS) of protein solutions into protein-rich and protein-poor phases reduces solution stability at intermediate concentrations and lower temperatures, and is a serious concern in formulation development as therapeutic proteins are generally stored at refrigerated conditions. In the current work, LLPS was studied for a DVD-Ig protein molecule as a function of solution conditions by measuring solution opalescence. LLPS of the protein was confirmed by equilibrium studies and by visually observing under microscope. The protein does not undergo any structural change after phase separation. Protein-protein interactions were measured by light scattering (kD) and Tcloud (temperature that marks the onset of phase separation). There is a good agreement between kD measured in dilute solution with Tcloud measured in the critical concentration range. Results indicate that the increased complexity of the molecule (with respect to size, shape, and charge distribution on the molecule) increases contribution of specific and nonspecific interactions in solution, which are affected by formulation factors, resulting in LLPS for DVD-Ig protein.
Theofilatos, Konstantinos; Pavlopoulou, Niki; Papasavvas, Christoforos; Likothanassis, Spiros; Dimitrakopoulos, Christos; Georgopoulos, Efstratios; Moschopoulos, Charalampos; Mavroudi, Seferina
2015-03-01
Proteins are considered to be the most important individual components of biological systems and they combine to form physical protein complexes which are responsible for certain molecular functions. Despite the large availability of protein-protein interaction (PPI) information, not much information is available about protein complexes. Experimental methods are limited in terms of time, efficiency, cost and performance constraints. Existing computational methods have provided encouraging preliminary results, but they phase certain disadvantages as they require parameter tuning, some of them cannot handle weighted PPI data and others do not allow a protein to participate in more than one protein complex. In the present paper, we propose a new fully unsupervised methodology for predicting protein complexes from weighted PPI graphs. The proposed methodology is called evolutionary enhanced Markov clustering (EE-MC) and it is a hybrid combination of an adaptive evolutionary algorithm and a state-of-the-art clustering algorithm named enhanced Markov clustering. EE-MC was compared with state-of-the-art methodologies when applied to datasets from the human and the yeast Saccharomyces cerevisiae organisms. Using public available datasets, EE-MC outperformed existing methodologies (in some datasets the separation metric was increased by 10-20%). Moreover, when applied to new human datasets its performance was encouraging in the prediction of protein complexes which consist of proteins with high functional similarity. In specific, 5737 protein complexes were predicted and 72.58% of them are enriched for at least one gene ontology (GO) function term. EE-MC is by design able to overcome intrinsic limitations of existing methodologies such as their inability to handle weighted PPI networks, their constraint to assign every protein in exactly one cluster and the difficulties they face concerning the parameter tuning. This fact was experimentally validated and moreover, new
Haque, Enamul; Bhandari, Bhesh R; Gidley, Michael J; Deeth, Hilton C; Møller, Sandie M; Whittaker, Andrew K
2010-07-14
Protein conformational modifications and water-protein interactions are two major factors believed to induce instability of protein and eventually affect the solubility of milk protein concentrate (MPC) powder. To test these hypotheses, MPC was stored at different water activities (a(w) 0.0-0.85) and temperatures (25 and 45 degrees C) for up to 12 weeks. Samples were examined periodically to determine solubility, change in protein conformation by Fourier transform infrared (FTIR) spectroscopy and principal component analysis (PCA), and water status (interaction of water with the protein molecule/surface) by measuring the transverse relaxation time (T(2)) with proton nuclear magnetic resonance ((1)H NMR). The solubility of MPC decreased significantly with aging, and this process was enhanced by increasing water activity (a(w)) and storage temperature. Minor changes in protein secondary structure were observed with FTIR, which indicated some degree of unfolding of protein molecules. PCA of the FTIR data was able to discriminate samples according to moisture content and storage period. Partial least-squares (PLS) analysis showed some correlation between FTIR spectral feature and solubility. The NMR T(2) results indicated the presence of three distinct populations of water molecules, and the proton signal intensity and T(2) values of proton fractions varied with storage conditions (humidity, temperature) and aging. Results suggest that protein/protein interactions may be initiated by unfolding of protein molecules that eventually affects solubility.
A selection that reports on protein-protein interactions within a thermophilic bacterium.
Nguyen, Peter Q; Silberg, Jonathan J
2010-07-01
Many proteins can be split into fragments that exhibit enhanced function upon fusion to interacting proteins. While this strategy has been widely used to create protein-fragment complementation assays (PCAs) for discovering protein-protein interactions within mesophilic organisms, similar assays have not yet been developed for studying natural and engineered protein complexes at the temperatures where thermophilic microbes grow. We describe the development of a selection for protein-protein interactions within Thermus thermophilus that is based upon growth complementation by fragments of Thermotoga neapolitana adenylate kinase (AK(Tn)). Complementation studies with an engineered thermophile (PQN1) that is not viable above 75 degrees C because its adk gene has been replaced by a Geobacillus stearothermophilus ortholog revealed that growth could be restored at 78 degrees C by a vector that coexpresses polypeptides corresponding to residues 1-79 and 80-220 of AK(Tn). In contrast, PQN1 growth was not complemented by AK(Tn) fragments harboring a C156A mutation within the zinc-binding tetracysteine motif unless these fragments were fused to Thermotoga maritima chemotaxis proteins that heterodimerize (CheA and CheY) or homodimerize (CheX). This enhanced complementation is interpreted as arising from chemotaxis protein-protein interactions, since AK(Tn)-C156A fragments having only one polypeptide fused to a chemotaxis protein did not complement PQN1 to the same extent. This selection increases the maximum temperature where a PCA can be used to engineer thermostable protein complexes and to map protein-protein interactions.
Escherichia coli cell-free protein synthesis and isotope labeling of mammalian proteins.
Terada, Takaho; Yokoyama, Shigeyuki
2015-01-01
This chapter describes the cell-free protein synthesis method, using an Escherichia coli cell extract. This is a cost-effective method for milligram-scale protein production and is particularly useful for the production of mammalian proteins, protein complexes, and membrane proteins that are difficult to synthesize by recombinant expression methods, using E. coli and eukaryotic cells. By adjusting the conditions of the cell-free method, zinc-binding proteins, disulfide-bonded proteins, ligand-bound proteins, etc., may also be produced. Stable isotope labeling of proteins can be accomplished by the cell-free method, simply by using stable isotope-labeled amino acid(s) in the cell-free reaction. Moreover, the cell-free protein synthesis method facilitates the avoidance of stable isotope scrambling and dilution over the recombinant expression methods and is therefore advantageous for amino acid-selective stable isotope labeling. Site-specific stable isotope labeling is also possible with a tRNA molecule specific to the UAG codon. By the cell-free protein synthesis method, coupled transcription-translation is performed from a plasmid vector or a PCR-amplified DNA fragment encoding the protein. A milligram quantity of protein can be produced with a milliliter-scale reaction solution in the dialysis mode. More than a thousand solution structures have been determined by NMR spectroscopy for uniformly labeled samples of human and mouse functional domain proteins, produced by the cell-free method. Here, we describe the practical aspects of mammalian protein production by the cell-free method for NMR spectroscopy. © 2015 Elsevier Inc. All rights reserved.
Tan, Dan; Li, Qiang; Zhang, Mei-Jun; Liu, Chao; Ma, Chengying; Zhang, Pan; Ding, Yue-He; Fan, Sheng-Bo; Tao, Li; Yang, Bing; Li, Xiangke; Ma, Shoucai; Liu, Junjie; Feng, Boya; Liu, Xiaohui; Wang, Hong-Wei; He, Si-Min; Gao, Ning; Ye, Keqiong; Dong, Meng-Qiu; Lei, Xiaoguang
2016-01-01
To improve chemical cross-linking of proteins coupled with mass spectrometry (CXMS), we developed a lysine-targeted enrichable cross-linker containing a biotin tag for affinity purification, a chemical cleavage site to separate cross-linked peptides away from biotin after enrichment, and a spacer arm that can be labeled with stable isotopes for quantitation. By locating the flexible proteins on the surface of 70S ribosome, we show that this trifunctional cross-linker is effective at attaining structural information not easily attainable by crystallography and electron microscopy. From a crude Rrp46 immunoprecipitate, it helped identify two direct binding partners of Rrp46 and 15 protein-protein interactions (PPIs) among the co-immunoprecipitated exosome subunits. Applying it to E. coli and C. elegans lysates, we identified 3130 and 893 inter-linked lysine pairs, representing 677 and 121 PPIs. Using a quantitative CXMS workflow we demonstrate that it can reveal changes in the reactivity of lysine residues due to protein-nucleic acid interaction. DOI: http://dx.doi.org/10.7554/eLife.12509.001 PMID:26952210
A PDB-wide, evolution-based assessment of protein-protein interfaces.
Baskaran, Kumaran; Duarte, Jose M; Biyani, Nikhil; Bliven, Spencer; Capitani, Guido
2014-10-18
Thanks to the growth in sequence and structure databases, more than 50 million sequences are now available in UniProt and 100,000 structures in the PDB. Rich information about protein-protein interfaces can be obtained by a comprehensive study of protein contacts in the PDB, their sequence conservation and geometric features. An automated computational pipeline was developed to run our Evolutionary Protein-Protein Interface Classifier (EPPIC) software on the entire PDB and store the results in a relational database, currently containing > 800,000 interfaces. This allows the analysis of interface data on a PDB-wide scale. Two large benchmark datasets of biological interfaces and crystal contacts, each containing about 3000 entries, were automatically generated based on criteria thought to be strong indicators of interface type. The BioMany set of biological interfaces includes NMR dimers solved as crystal structures and interfaces that are preserved across diverse crystal forms, as catalogued by the Protein Common Interface Database (ProtCID) from Xu and Dunbrack. The second dataset, XtalMany, is derived from interfaces that would lead to infinite assemblies and are therefore crystal contacts. BioMany and XtalMany were used to benchmark the EPPIC approach. The performance of EPPIC was also compared to classifications from the Protein Interfaces, Surfaces, and Assemblies (PISA) program on a PDB-wide scale, finding that the two approaches give the same call in about 88% of PDB interfaces. By comparing our safest predictions to the PDB author annotations, we provide a lower-bound estimate of the error rate of biological unit annotations in the PDB. Additionally, we developed a PyMOL plugin for direct download and easy visualization of EPPIC interfaces for any PDB entry. Both the datasets and the PyMOL plugin are available at http://www.eppic-web.org/ewui/\\#downloads. Our computational pipeline allows us to analyze protein-protein contacts and their sequence
Protein-protein interface analysis and hot spots identification for chemical ligand design.
Chen, Jing; Ma, Xiaomin; Yuan, Yaxia; Pei, Jianfeng; Lai, Luhua
2014-01-01
Rational design for chemical compounds targeting protein-protein interactions has grown from a dream to reality after a decade of efforts. There are an increasing number of successful examples, though major challenges remain in the field. In this paper, we will first give a brief review of the available methods that can be used to analyze protein-protein interface and predict hot spots for chemical ligand design. New developments of binding sites detection, ligandability and hot spots prediction from the author's group will also be described. Pocket V.3 is an improved program for identifying hot spots in protein-protein interface using only an apo protein structure. It has been developed based on Pocket V.2 that can derive receptor-based pharmacophore model for ligand binding cavity. Given similarities and differences between the essence of pharmacophore and hot spots for guiding design of chemical compounds, not only energetic but also spatial properties of protein-protein interface are used in Pocket V.3 for dealing with protein-protein interface. In order to illustrate the capability of Pocket V.3, two datasets have been used. One is taken from ASEdb and BID having experimental alanine scanning results for testing hot spots prediction. The other is taken from the 2P2I database containing complex structures of protein-ligand binding at the original protein-protein interface for testing hot spots application in ligand design.
Hexahistidine (6xHis) fusion-based assays for protein-protein interactions.
Puckett, Mary C
2015-01-01
Fusion-protein tags provide a useful method to study protein-protein interactions. One widely used fusion tag is hexahistidine (6xHis). This tag has unique advantages over others due to its small size and the relatively low abundance of naturally occurring consecutive histidine repeats. 6xHis tags can interact with immobilized metal cations to provide for the capture of proteins and protein complexes of interest. In this chapter, a description of the benefits and uses of 6xHis-fusion proteins as well as a detailed method for performing a 6xHis-pulldown assay are described.
Surface Mediated Protein Disaggregation
NASA Astrophysics Data System (ADS)
Radhakrishna, Mithun; Kumar, Sanat K.
2014-03-01
Preventing protein aggregation is of both biological and industrial importance. Biologically these aggregates are known to cause amyloid type diseases like Alzheimer's and Parkinson's disease. Protein aggregation leads to reduced activity of the enzymes in industrial applications. Inter-protein interactions between the hydrophobic residues of the protein are known to be the major driving force for protein aggregation. In the current paper we show how surface chemistry and curvature can be tuned to mitigate these inter-protein interactions. Our results calculated in the framework of the Hydrophobic-Polar (HP) lattice model show that, inter-protein interactions can be drastically reduced by increasing the surface hydrophobicity to a critical value corresponding to the adsorption transition of the protein. At this value of surface hydrophobicity, proteins lose inter-protein contacts to gain surface contacts and thus the surface helps in reducing the inter-protein interactions. Further, we show that the adsorption of the proteins inside hydrophobic pores of optimal sizes are most efficient both in reducing inter-protein contacts and simultaneously retaining most of the native-contacts due to strong protein-surface interactions coupled with stabilization due to the confinement. Department of Energy (Grant No DE-FG02-11ER46811).
Towards a map of the Populus biomass protein-protein interaction network
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beers, Eric; Brunner, Amy; Helm, Richard
Biofuels can be produced from a variety of plant feedstocks. The value of a particular feedstock for biofuels production depends in part on the degree of difficulty associated with the extraction of fermentable sugars from the plant biomass. The wood of trees is potentially a rich source fermentable sugars. However, the sugars in wood exist in a tightly cross-linked matrix of cellulose, hemicellulose, and lignin, making them largely recalcitrant to release and fermentation for biofuels production. Before breeders and genetic engineers can effectively develop plants with reduced recalcitrance to fermentation, it is necessary to gain a better understanding of themore » fundamental biology of the mechanisms responsible for wood formation. Regulatory, structural, and enzymatic proteins are required for the complicated process of wood formation. To function properly, proteins must interact with other proteins. Yet, very few of the protein-protein interactions necessary for wood formation are known. The main objectives of this project were to 1) identify new protein-protein interactions relevant to wood formation, and 2) perform in-depth characterizations of selected protein-protein interactions. To identify relevant protein-protein interactions, we cloned a set of approximately 400 genes that were highly expressed in the wood-forming tissue (known as secondary xylem) of poplar (Populus trichocarpa). We tested whether the proteins encoded by these biomass genes interacted with each other in a binary matrix design using the yeast two-hybrid (Y2H) method for protein-protein interaction discovery. We also tested a subset of the 400 biomass proteins for interactions with all proteins present in wood-forming tissue of poplar in a biomass library screen design using Y2H. Together, these two Y2H screens yielded over 270 interactions involving over 75 biomass proteins. For the second main objective we selected several interacting pairs or groups of interacting proteins for in
Fluorescence-based assay probing regulator of G protein signaling partner proteins.
Huang, Po-Shiun; Yeh, Hsin-Sung; Yi, Hsiu-Ping; Lin, Chain-Jia; Yang, Chii-Shen
2012-04-01
The regulator of G protein signaling (RGS) proteins are one of the essential modulators for the G protein system. Besides regulating G protein signaling by accelerating the GTPase activity of Gα subunits, RGS proteins are implicated in exerting other functions; they are also known to be involved in several diseases. Moreover, the existence of a single RGS protein in plants and its seven-transmembrane domain found in 2003 triggered efforts to unveil detailed structural and functional information of RGS proteins. We present a method for real-time examination of the protein-protein interactions between RGS and Gα subunits. AtRGS1 from plants and RGS4 from mammals were site-directedly labeled with the fluorescent probe Lucifer yellow on engineered cysteine residues and used to interact with different Gα subunits. The physical interactions can be revealed by monitoring the real-time fluorescence changes (8.6% fluorescence increase in mammals and 27.6% in plants); their correlations to functional exertion were shown with a GTPase accelerating activity assay and further confirmed by measurement of K(d). We validate the effectiveness of this method and suggest its application to the exploration of more RGS signaling partner proteins in physiological and pathological studies. Copyright © 2012 Elsevier Inc. All rights reserved.
The Protein Interactome of Mycobacteriophage Giles Predicts Functions for Unknown Proteins.
Mehla, Jitender; Dedrick, Rebekah M; Caufield, J Harry; Siefring, Rachel; Mair, Megan; Johnson, Allison; Hatfull, Graham F; Uetz, Peter
2015-08-01
Mycobacteriophages are viruses that infect mycobacterial hosts and are prevalent in the environment. Nearly 700 mycobacteriophage genomes have been completely sequenced, revealing considerable diversity and genetic novelty. Here, we have determined the protein complement of mycobacteriophage Giles by mass spectrometry and mapped its genome-wide protein interactome to help elucidate the roles of its 77 predicted proteins, 50% of which have no known function. About 22,000 individual yeast two-hybrid (Y2H) tests with four different Y2H vectors, followed by filtering and retest screens, resulted in 324 reproducible protein-protein interactions, including 171 (136 nonredundant) high-confidence interactions. The complete set of high-confidence interactions among Giles proteins reveals new mechanistic details and predicts functions for unknown proteins. The Giles interactome is the first for any mycobacteriophage and one of just five known phage interactomes so far. Our results will help in understanding mycobacteriophage biology and aid in development of new genetic and therapeutic tools to understand Mycobacterium tuberculosis. Mycobacterium tuberculosis causes over 9 million new cases of tuberculosis each year. Mycobacteriophages, viruses of mycobacterial hosts, hold considerable potential to understand phage diversity, evolution, and mycobacterial biology, aiding in the development of therapeutic tools to control mycobacterial infections. The mycobacteriophage Giles protein-protein interaction network allows us to predict functions for unknown proteins and shed light on major biological processes in phage biology. For example, Giles gp76, a protein of unknown function, is found to associate with phage packaging and maturation. The functions of mycobacteriophage-derived proteins may suggest novel therapeutic approaches for tuberculosis. Our ORFeome clone set of Giles proteins and the interactome data will be useful resources for phage interactomics. Copyright © 2015
Mapping hydration dynamics and coupled water-protein fluctuations around a protein surface
NASA Astrophysics Data System (ADS)
Zhang, Luyuan; Wang, Lijuan; Kao, Ya-Ting; Qiu, Weihong; Yang, Yi; Okobiah, Oghaghare; Zhong, Dongping
2009-03-01
Elucidation of the molecular mechanism of water-protein interactions is critical to understanding many fundamental aspects of protein science, such as protein folding and misfolding and enzyme catalysis. We recently carried out a global mapping of protein-surface hydration dynamics around a globular α-helical protein apomyoglobin. The intrinsic optical probe tryptophan was employed to scan the protein surface one at a time by site-specific mutagenesis. With femtosecond resolution, we mapped out the dynamics of water-protein interactions with more than 20 mutants and for two states, native and molten globular. A robust bimodal distribution of time scales was observed, representing two types of water motions: local relaxation and protein-coupled fluctuations. The time scales show a strong correlation with the local protein structural rigidity and chemical identity. We also resolved two distinct contributions to the overall Stokes-shifts from the two time scales. These results are significant to understanding the role of hydration water on protein structural stability, dynamics and function.
Hoffman, Jay R; Falvo, Michael J
2004-09-01
Protein intake that exceeds the recommended daily allowance is widely accepted for both endurance and power athletes. However, considering the variety of proteins that are available much less is known concerning the benefits of consuming one protein versus another. The purpose of this paper is to identify and analyze key factors in order to make responsible recommendations to both the general and athletic populations. Evaluation of a protein is fundamental in determining its appropriateness in the human diet. Proteins that are of inferior content and digestibility are important to recognize and restrict or limit in the diet. Similarly, such knowledge will provide an ability to identify proteins that provide the greatest benefit and should be consumed. The various techniques utilized to rate protein will be discussed. Traditionally, sources of dietary protein are seen as either being of animal or vegetable origin. Animal sources provide a complete source of protein (i.e. containing all essential amino acids), whereas vegetable sources generally lack one or more of the essential amino acids. Animal sources of dietary protein, despite providing a complete protein and numerous vitamins and minerals, have some health professionals concerned about the amount of saturated fat common in these foods compared to vegetable sources. The advent of processing techniques has shifted some of this attention and ignited the sports supplement marketplace with derivative products such as whey, casein and soy. Individually, these products vary in quality and applicability to certain populations. The benefits that these particular proteins possess are discussed. In addition, the impact that elevated protein consumption has on health and safety issues (i.e. bone health, renal function) are also reviewed. Key PointsHigher protein needs are seen in athletic populations.Animal proteins is an important source of protein, however potential health concerns do exist from a diet of protein
Controlled assembly of artificial protein-protein complexes via DNA duplex formation.
Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J
2015-03-18
DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.
Frenkel-Morgenstern, Milana; Gorohovski, Alessandro; Tagore, Somnath; Sekar, Vaishnovi; Vazquez, Miguel; Valencia, Alfonso
2017-07-07
Fusion proteins, comprising peptides deriving from the translation of two parental genes, are produced in cancer by chromosomal aberrations. The expressed fusion protein incorporates domains of both parental proteins. Using a methodology that treats discrete protein domains as binding sites for specific domains of interacting proteins, we have cataloged the protein interaction networks for 11 528 cancer fusions (ChiTaRS-3.1). Here, we present our novel method, chimeric protein-protein interactions (ChiPPI) that uses the domain-domain co-occurrence scores in order to identify preserved interactors of chimeric proteins. Mapping the influence of fusion proteins on cell metabolism and pathways reveals that ChiPPI networks often lose tumor suppressor proteins and gain oncoproteins. Furthermore, fusions often induce novel connections between non-interactors skewing interaction networks and signaling pathways. We compared fusion protein PPI networks in leukemia/lymphoma, sarcoma and solid tumors finding distinct enrichment patterns for each disease type. While certain pathways are enriched in all three diseases (Wnt, Notch and TGF β), there are distinct patterns for leukemia (EGFR signaling, DNA replication and CCKR signaling), for sarcoma (p53 pathway and CCKR signaling) and solid tumors (FGFR and EGFR signaling). Thus, the ChiPPI method represents a comprehensive tool for studying the anomaly of skewed cellular networks produced by fusion proteins in cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Dirks, Marlou L; Groen, Bart B L; Franssen, Rinske; van Kranenburg, Janneau; van Loon, Luc J C
2017-01-01
Short periods of muscle disuse result in substantial skeletal muscle atrophy. Recently, we showed that both neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. In this study, we test our hypothesis that NMES can augment the use of presleep protein-derived amino acids for overnight muscle protein synthesis in older men. Twenty healthy, older [69 ± 1 (SE) yr] men were subjected to 24 h of bed rest, starting at 8:00 AM. In the evening, volunteers were subjected to 70-min 1-legged NMES, while the other leg served as nonstimulated control (CON). Immediately following NMES, 40 g of intrinsically l-[1- 13 C]-phenylalanine labeled protein was ingested prior to sleep. Blood samples were taken throughout the night, and muscle biopsies were obtained from both legs in the evening and the following morning (8 h after protein ingestion) to assess dietary protein-derived l-[1- 13 C]-phenylalanine enrichments in myofibrillar protein. Plasma phenylalanine concentrations and plasma l-[1- 13 C]-phenylalanine enrichments increased significantly following protein ingestion and remained elevated for up to 6 h after protein ingestion (P < 0.05). During overnight sleep, myofibrillar protein-bound l-[1- 13 C]-phenylalanine enrichments (MPE) increased to a greater extent in the stimulated compared with the control leg (0.0344 ± 0.0019 vs. 0.0297 ± 0.0016 MPE, respectively; P < 0.01), representing 18 ± 6% greater incorporation of presleep protein-derived amino acids in the NMES compared with CON leg. In conclusion, application of NMES prior to presleep protein feeding stimulates the use of dietary protein-derived amino acids for overnight muscle protein synthesis in older men. Neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. Here we demonstrate that in older
Quantitation of proteins using a dye-metal-based colorimetric protein assay.
Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A
2009-02-15
We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.
Simple and rapid staining for detection of Entamoeba cysts and other protozoans with fluorochromes.
Kawamoto, F; Mizuno, S; Fujioka, H; Kumada, N; Sugiyama, E; Takeuchi, T; Kobayashi, S; Iseki, M; Yamada, M; Matsumoto, Y
1987-02-01
Three fluorochromes were applied to stain various parasitic protozoans. By double staining with 4',6-diamidino-2-phenylindole and propidium iodide, differentiation of the nuclei from the cytoplasm can easily be achieved within several seconds. The chromatoid bodies in Entamoeba cysts were stained bright red. Plasmodium yoelii at all stages except late trophozoites and young gametocytes was easily identified. In the oocysts of Cryptosporidium sp., the nuclei and cytoplasm of the sporozoites fluoresced bluish white and red, respectively, whereas the residual body appeared blue or green. The third fluorochrome, Calcofluor white M2R, was suitable for detecting the cysts of Entamoeba spp. and Chilomastix mesnili.
Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J
2015-05-15
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.
Mitchell, Cameron J.; McGregor, Robin A.; D’Souza, Randall F.; Thorstensen, Eric B.; Markworth, James F.; Fanning, Aaron C.; Poppitt, Sally D.; Cameron-Smith, David
2015-01-01
The differential ability of various milk protein fractions to stimulate muscle protein synthesis (MPS) has been previously described, with whey protein generally considered to be superior to other fractions. However, the relative ability of a whole milk protein to stimulate MPS has not been compared to whey. Sixteen healthy middle-aged males ingested either 20 g of milk protein (n = 8) or whey protein (n = 8) while undergoing a primed constant infusion of ring 13C6 phenylalanine. Muscle biopsies were obtained 120 min prior to consumption of the protein and 90 and 210 min afterwards. Resting myofibrillar fractional synthetic rates (FSR) were 0.019% ± 0.009% and 0.021% ± 0.018% h−1 in the milk and whey groups respectively. For the first 90 min after protein ingestion the FSR increased (p < 0.001) to 0.057% ± 0.018% and 0.052% ± 0.024% h−1 in the milk and whey groups respectively with no difference between groups (p = 0.810). FSR returned to baseline in both groups between 90 and 210 min after protein ingestion. Despite evidence of increased rate of digestion and leucine availability following the ingestion of whey protein, there was similar activation of MPS in middle-aged men with either 20 g of milk protein or whey protein. PMID:26506377
Cardiotonic Steroids Stabilize Regulator of G Protein Signaling 2 Protein Levels
Sjögren, Benita; Parra, Sergio; Heath, Lauren J.; Atkins, Kevin B.; Xie, Zie-Jian
2012-01-01
Regulator of G protein signaling 2 (RGS2), a Gq-specific GTPase-activating protein, is strongly implicated in cardiovascular function. RGS2(−/−) mice are hypertensive and prone to heart failure, and several rare human mutations that accelerate RGS2 degradation have been identified among patients with hypertension. Therefore, pharmacological up-regulation of RGS2 protein levels might be beneficial. We used a β-galactosidase complementation method to screen several thousand compounds with known pharmacological functions for those that increased RGS2 protein levels. Several cardiotonic steroids (CTSs), including ouabain and digoxin, increased RGS2 but not RGS4 protein levels. CTSs increased RGS2 protein levels through a post-transcriptional mechanism, by slowing protein degradation. RGS2 mRNA levels in primary vascular smooth muscle cells were unaffected by CTS treatment, whereas protein levels were increased 2- to 3-fold. Na+/K+-ATPase was required for the increase in RGS2 protein levels, because the effect was lost in Na+/K+-ATPase-knockdown cells. Furthermore, we demonstrated that CTS-induced increases in RGS2 levels were functional and reduced receptor-stimulated, Gq-dependent, extracellular signal-regulated kinase phosphorylation. Finally, we showed that in vivo treatment with digoxin led to increased RGS2 protein levels in heart and kidney. CTS-induced increases in RGS2 protein levels and function might modify several deleterious mechanisms in hypertension and heart failure. This novel CTS mechanism might contribute to the beneficial actions of low-dose digoxin treatment in heart failure. Our results support the concept of small-molecule modulation of RGS2 protein levels as a new strategy for cardiovascular therapy. PMID:22695717
Protein degradation and protection against misfolded or damaged proteins
NASA Astrophysics Data System (ADS)
Goldberg, Alfred L.
2003-12-01
The ultimate mechanism that cells use to ensure the quality of intracellular proteins is the selective destruction of misfolded or damaged polypeptides. In eukaryotic cells, the large ATP-dependent proteolytic machine, the 26S proteasome, prevents the accumulation of non-functional, potentially toxic proteins. This process is of particular importance in protecting cells against harsh conditions (for example, heat shock or oxidative stress) and in a variety of diseases (for example, cystic fibrosis and the major neurodegenerative diseases). A full understanding of the pathogenesis of the protein-folding diseases will require greater knowledge of how misfolded proteins are recognized and selectively degraded.
Fong, Jiunn N C; Yildiz, Fitnat H
2015-04-01
Proteinaceous components of the biofilm matrix include secreted extracellular proteins, cell surface adhesins, and protein subunits of cell appendages such as flagella and pili. Biofilm matrix proteins play diverse roles in biofilm formation and dissolution. They are involved in attaching cells to surfaces, stabilizing the biofilm matrix via interactions with exopolysaccharide and nucleic acid components, developing three-dimensional biofilm architectures, and dissolving biofilm matrix via enzymatic degradation of polysaccharides, proteins, and nucleic acids. In this article, we will review functions of matrix proteins in a selected set of microorganisms, studies of the matrix proteomes of Vibrio cholerae and Pseudomonas aeruginosa, and roles of outer membrane vesicles and of nucleoid-binding proteins in biofilm formation.
Zhang, Yaoyang; Xu, Tao; Shan, Bing; Hart, Jonathan; Aslanian, Aaron; Han, Xuemei; Zong, Nobel; Li, Haomin; Choi, Howard; Wang, Dong; Acharya, Lipi; Du, Lisa; Vogt, Peter K; Ping, Peipei; Yates, John R
2015-11-03
Shotgun proteomics generates valuable information from large-scale and target protein characterizations, including protein expression, protein quantification, protein post-translational modifications (PTMs), protein localization, and protein-protein interactions. Typically, peptides derived from proteolytic digestion, rather than intact proteins, are analyzed by mass spectrometers because peptides are more readily separated, ionized and fragmented. The amino acid sequences of peptides can be interpreted by matching the observed tandem mass spectra to theoretical spectra derived from a protein sequence database. Identified peptides serve as surrogates for their proteins and are often used to establish what proteins were present in the original mixture and to quantify protein abundance. Two major issues exist for assigning peptides to their originating protein. The first issue is maintaining a desired false discovery rate (FDR) when comparing or combining multiple large datasets generated by shotgun analysis and the second issue is properly assigning peptides to proteins when homologous proteins are present in the database. Herein we demonstrate a new computational tool, ProteinInferencer, which can be used for protein inference with both small- or large-scale data sets to produce a well-controlled protein FDR. In addition, ProteinInferencer introduces confidence scoring for individual proteins, which makes protein identifications evaluable. This article is part of a Special Issue entitled: Computational Proteomics. Copyright © 2015. Published by Elsevier B.V.
Understanding protein evolution: from protein physics to Darwinian selection.
Zeldovich, Konstantin B; Shakhnovich, Eugene I
2008-01-01
Efforts in whole-genome sequencing and structural proteomics start to provide a global view of the protein universe, the set of existing protein structures and sequences. However, approaches based on the selection of individual sequences have not been entirely successful at the quantitative description of the distribution of structures and sequences in the protein universe because evolutionary pressure acts on the entire organism, rather than on a particular molecule. In parallel to this line of study, studies in population genetics and phenomenological molecular evolution established a mathematical framework to describe the changes in genome sequences in populations of organisms over time. Here, we review both microscopic (physics-based) and macroscopic (organism-level) models of protein-sequence evolution and demonstrate that bridging the two scales provides the most complete description of the protein universe starting from clearly defined, testable, and physiologically relevant assumptions.
NASA Astrophysics Data System (ADS)
Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.
2016-11-01
Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.
Quantitative study of protein-protein interactions by quartz nanopipettes.
Tiwari, Purushottam Babu; Astudillo, Luisana; Miksovska, Jaroslava; Wang, Xuewen; Li, Wenzhi; Darici, Yesim; He, Jin
2014-09-07
In this report, protein-modified quartz nanopipettes were used to quantitatively study protein-protein interactions in attoliter sensing volumes. As shown by numerical simulations, the ionic current through the conical-shaped nanopipette is very sensitive to the surface charge variation near the pore mouth. With the appropriate modification of negatively charged human neuroglobin (hNgb) onto the inner surface of a nanopipette, we were able to detect concentration-dependent current change when the hNgb-modified nanopipette tip was exposed to positively charged cytochrome c (Cyt c) with a series of concentrations in the bath solution. Such current change is due to the adsorption of Cyt c to the inner surface of the nanopipette through specific interactions with hNgb. In contrast, a smaller current change with weak concentration dependence was observed when Cyt c was replaced with lysozyme, which does not specifically bind to hNgb. The equilibrium dissociation constant (KD) for the Cyt c-hNgb complex formation was derived and the value matched very well with the result from surface plasmon resonance measurement. This is the first quantitative study of protein-protein interactions by a conical-shaped nanopore based on charge sensing. Our results demonstrate that nanopipettes can potentially be used as a label-free analytical tool to quantitatively characterize protein-protein interactions.
NASA Technical Reports Server (NTRS)
Agena, S. M.; Pusey, M. L.; Bogle, I. D.
1999-01-01
A thermodynamic framework (UNIQUAC model with temperature dependent parameters) is applied to model the salt-induced protein crystallization equilibrium, i.e., protein solubility. The framework introduces a term for the solubility product describing protein transfer between the liquid and solid phase and a term for the solution behavior describing deviation from ideal solution. Protein solubility is modeled as a function of salt concentration and temperature for a four-component system consisting of a protein, pseudo solvent (water and buffer), cation, and anion (salt). Two different systems, lysozyme with sodium chloride and concanavalin A with ammonium sulfate, are investigated. Comparison of the modeled and experimental protein solubility data results in an average root mean square deviation of 5.8%, demonstrating that the model closely follows the experimental behavior. Model calculations and model parameters are reviewed to examine the model and protein crystallization process. Copyright 1999 John Wiley & Sons, Inc.
The role of electrostatics in protein-protein interactions of a monoclonal antibody.
Roberts, D; Keeling, R; Tracka, M; van der Walle, C F; Uddin, S; Warwicker, J; Curtis, R
2014-07-07
Understanding how protein-protein interactions depend on the choice of buffer, salt, ionic strength, and pH is needed to have better control over protein solution behavior. Here, we have characterized the pH and ionic strength dependence of protein-protein interactions in terms of an interaction parameter kD obtained from dynamic light scattering and the osmotic second virial coefficient B22 measured by static light scattering. A simplified protein-protein interaction model based on a Baxter adhesive potential and an electric double layer force is used to separate out the contributions of longer-ranged electrostatic interactions from short-ranged attractive forces. The ionic strength dependence of protein-protein interactions for solutions at pH 6.5 and below can be accurately captured using a Deryaguin-Landau-Verwey-Overbeek (DLVO) potential to describe the double layer forces. In solutions at pH 9, attractive electrostatics occur over the ionic strength range of 5-275 mM. At intermediate pH values (7.25 to 8.5), there is a crossover effect characterized by a nonmonotonic ionic strength dependence of protein-protein interactions, which can be rationalized by the competing effects of long-ranged repulsive double layer forces at low ionic strength and a shorter ranged electrostatic attraction, which dominates above a critical ionic strength. The change of interactions from repulsive to attractive indicates a concomitant change in the angular dependence of protein-protein interaction from isotropic to anisotropic. In the second part of the paper, we show how the Baxter adhesive potential can be used to predict values of kD from fitting to B22 measurements, thus providing a molecular basis for the linear correlation between the two protein-protein interaction parameters.
Characterization of essential proteins based on network topology in proteins interaction networks
NASA Astrophysics Data System (ADS)
Bakar, Sakhinah Abu; Taheri, Javid; Zomaya, Albert Y.
2014-06-01
The identification of essential proteins is theoretically and practically important as (1) it is essential to understand the minimal surviving requirements for cellular lives, and (2) it provides fundamental for development of drug. As conducting experimental studies to identify essential proteins are both time and resource consuming, here we present a computational approach in predicting them based on network topology properties from protein-protein interaction networks of Saccharomyces cerevisiae. The proposed method, namely EP3NN (Essential Proteins Prediction using Probabilistic Neural Network) employed a machine learning algorithm called Probabilistic Neural Network as a classifier to identify essential proteins of the organism of interest; it uses degree centrality, closeness centrality, local assortativity and local clustering coefficient of each protein in the network for such predictions. Results show that EP3NN managed to successfully predict essential proteins with an accuracy of 95% for our studied organism. Results also show that most of the essential proteins are close to other proteins, have assortativity behavior and form clusters/sub-graph in the network.
Scoring functions for protein-protein interactions.
Moal, Iain H; Moretti, Rocco; Baker, David; Fernández-Recio, Juan
2013-12-01
The computational evaluation of protein-protein interactions will play an important role in organising the wealth of data being generated by high-throughput initiatives. Here we discuss future applications, report recent developments and identify areas requiring further investigation. Many functions have been developed to quantify the structural and energetic properties of interacting proteins, finding use in interrelated challenges revolving around the relationship between sequence, structure and binding free energy. These include loop modelling, side-chain refinement, docking, multimer assembly, affinity prediction, affinity change upon mutation, hotspots location and interface design. Information derived from models optimised for one of these challenges can be used to benefit the others, and can be unified within the theoretical frameworks of multi-task learning and Pareto-optimal multi-objective learning. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Jennings, Patricia
Entanglement and knots are naturally occurring, where, in the microscopic world, knots in DNA and homopolymers are well characterized. The most complex knots are observed in proteins which are harder to investigate, as proteins are heteropolymers composed of a combination of 20 different amino acids with different individual biophysical properties. As new-knotted topologies and new proteins containing knots continue to be discovered and characterized, the investigation of knots in proteins has gained intense interest. Thus far, the principle focus has been on the evolutionary origin of tying a knot, with questions of how a protein chain `self-ties' into a knot, what the mechanism(s) are that contribute to threading, and the biological relevance and functional implication of a knotted topology in vivo gaining the most insight. Efforts to study the fully untied and unfolded chain indicate that the knot is highly stable, remaining intact in the unfolded state orders of magnitude longer than first anticipated. The persistence of ``stable'' knots in the unfolded state, together with the challenge of defining an unfolded and untied chain from an unfolded and knotted chain, complicates the study of fully untied protein in vitro. Our discovery of a new class of knotted proteins, the Pierced Lassos (PL) loop topology, simplifies the knotting approach. While PLs are not easily recognizable by the naked eye, they have now been identified in many proteins in the PDB through the use of computation tools. PL topologies are diverse proteins found in all kingdoms of life, performing a large variety of biological responses such as cell signaling, immune responses, transporters and inhibitors (http://lassoprot.cent.uw.edu.pl/). Many of these PL topologies are secreted proteins, extracellular proteins, as well as, redox sensors, enzymes and metal and co-factor binding proteins; all of which provide a favorable environment for the formation of the disulphide bridge. In the PL
Sudarshan, Sanjana; Kodathala, Sasi B; Mahadik, Amruta C; Mehta, Isha; Beck, Brian W
2014-01-01
Specific protein interactions are responsible for most biological functions. Distinguishing Functionally Linked Interfaces of Proteins (FLIPs), from Functionally uncorrelated Contacts (FunCs), is therefore important to characterizing these interactions. To achieve this goal, we have created a database of protein structures called FLIPdb, containing proteins belonging to various functional sub-categories. Here, we use geometric features coupled with Kortemme and Baker's computational alanine scanning method to calculate the energetic sensitivity of each amino acid at the interface to substitution, identify hotspots, and identify other factors that may contribute towards an interface being FLIP or FunC. Using Principal Component Analysis and K-means clustering on a training set of 160 interfaces, we could distinguish FLIPs from FunCs with an accuracy of 76%. When these methods were applied to two test sets of 18 and 170 interfaces, we achieved similar accuracies of 78% and 80%. We have identified that FLIP interfaces have a stronger central organizing tendency than FunCs, due, we suggest, to greater specificity. We also observe that certain functional sub-categories, such as enzymes, antibody-heavy-light, antibody-antigen, and enzyme-inhibitors form distinct sub-clusters. The antibody-antigen and enzyme-inhibitors interfaces have patterns of physical characteristics similar to those of FunCs, which is in agreement with the fact that the selection pressures of these interfaces is differently evolutionarily driven. As such, our ECR model also successfully describes the impact of evolution and natural selection on protein-protein interfaces. Finally, we indicate how our ECR method may be of use in reducing the false positive rate of docking calculations.
Sudarshan, Sanjana; Kodathala, Sasi B.; Mahadik, Amruta C.; Mehta, Isha; Beck, Brian W.
2014-01-01
Specific protein interactions are responsible for most biological functions. Distinguishing Functionally Linked Interfaces of Proteins (FLIPs), from Functionally uncorrelated Contacts (FunCs), is therefore important to characterizing these interactions. To achieve this goal, we have created a database of protein structures called FLIPdb, containing proteins belonging to various functional sub-categories. Here, we use geometric features coupled with Kortemme and Baker's computational alanine scanning method to calculate the energetic sensitivity of each amino acid at the interface to substitution, identify hotspots, and identify other factors that may contribute towards an interface being FLIP or FunC. Using Principal Component Analysis and K-means clustering on a training set of 160 interfaces, we could distinguish FLIPs from FunCs with an accuracy of 76%. When these methods were applied to two test sets of 18 and 170 interfaces, we achieved similar accuracies of 78% and 80%. We have identified that FLIP interfaces have a stronger central organizing tendency than FunCs, due, we suggest, to greater specificity. We also observe that certain functional sub-categories, such as enzymes, antibody-heavy-light, antibody-antigen, and enzyme-inhibitors form distinct sub-clusters. The antibody-antigen and enzyme-inhibitors interfaces have patterns of physical characteristics similar to those of FunCs, which is in agreement with the fact that the selection pressures of these interfaces is differently evolutionarily driven. As such, our ECR model also successfully describes the impact of evolution and natural selection on protein-protein interfaces. Finally, we indicate how our ECR method may be of use in reducing the false positive rate of docking calculations. PMID:24830938
Re-visiting protein-centric two-tier classification of existing DNA-protein complexes.
Malhotra, Sony; Sowdhamini, Ramanathan
2012-07-16
Precise DNA-protein interactions play most important and vital role in maintaining the normal physiological functioning of the cell, as it controls many high fidelity cellular processes. Detailed study of the nature of these interactions has paved the way for understanding the mechanisms behind the biological processes in which they are involved. Earlier in 2000, a systematic classification of DNA-protein complexes based on the structural analysis of the proteins was proposed at two tiers, namely groups and families. With the advancement in the number and resolution of structures of DNA-protein complexes deposited in the Protein Data Bank, it is important to revisit the existing classification. On the basis of the sequence analysis of DNA binding proteins, we have built upon the protein centric, two-tier classification of DNA-protein complexes by adding new members to existing families and making new families and groups. While classifying the new complexes, we also realised the emergence of new groups and families. The new group observed was where β-propeller was seen to interact with DNA. There were 34 SCOP folds which were observed to be present in the complexes of both old and new classifications, whereas 28 folds are present exclusively in the new complexes. Some new families noticed were NarL transcription factor, Z-α DNA binding proteins, Forkhead transcription factor, AP2 protein, Methyl CpG binding protein etc. Our results suggest that with the increasing number of availability of DNA-protein complexes in Protein Data Bank, the number of families in the classification increased by approximately three fold. The folds present exclusively in newly classified complexes is suggestive of inclusion of proteins with new function in new classification, the most populated of which are the folds responsible for DNA damage repair. The proposed re-visited classification can be used to perform genome-wide surveys in the genomes of interest for the presence of DNA
Variation in Protein and Calorie Consumption Following Protein Malnutrition in Rattus norvegicus
Jones, Donna C.; German, Rebecca Z.
2013-01-01
Simple Summary Catch-up growth following malnutrition is likely influenced by available protein and calories. We measured calorie and protein consumption following the removal of protein malnutrition after 40, 60 and 90 days, in laboratory rats. Following the transition in diet, animals self-selected fewer calories, implying elevated protein is sufficient to fuel catch-up growth, eventually resulting in body weights and bone lengths greater or equal to those of control animals. Rats rehabilitated at younger ages, had more drastic alterations in consumption. Variable responses in different ages and sex highlight the plasticity of growth and how nutrition affects body form. This work furthers our understanding of how humans and livestock can recover from protein-restriction malnutrition, which seems to employ different biological responses. Abstract Catch-up growth rates, following protein malnutrition, vary with timing and duration of insult, despite unlimited access to calories. Understanding changing patterns of post-insult consumption, relative rehabilitation timing, can provide insight into the mechanisms driving those differences. We hypothesize that higher catch-up growth rates will be correlated with increased protein consumption, while calorie consumption could remain stable. As catch-up growth rates decrease with age/malnutrition duration, we predict a dose effect in protein consumption with rehabilitation timing. We measured total and protein consumption, body mass, and long bone length, following an increase of dietary protein at 40, 60 and 90 days, with two control groups (chronic reduced protein or standard protein) for 150+ days. Immediately following rehabilitation, rats’ food consumption decreased significantly, implying that elevated protein intake is sufficient to fuel catch-up growth rates that eventually result in body weights and long bone lengths greater or equal to final measures of chronically fed standard (CT) animals. The duration of
Neutron protein crystallography: A complementary tool for locating hydrogens in proteins.
O'Dell, William B; Bodenheimer, Annette M; Meilleur, Flora
2016-07-15
Neutron protein crystallography is a powerful tool for investigating protein chemistry because it directly locates hydrogen atom positions in a protein structure. The visibility of hydrogen and deuterium atoms arises from the strong interaction of neutrons with the nuclei of these isotopes. Positions can be unambiguously assigned from diffraction at resolutions typical of protein crystals. Neutrons have the additional benefit to structural biology of not inducing radiation damage in protein crystals. The same crystal could be measured multiple times for parametric studies. Here, we review the basic principles of neutron protein crystallography. The information that can be gained from a neutron structure is presented in balance with practical considerations. Methods to produce isotopically-substituted proteins and to grow large crystals are provided in the context of neutron structures reported in the literature. Available instruments for data collection and software for data processing and structure refinement are described along with technique-specific strategies including joint X-ray/neutron structure refinement. Examples are given to illustrate, ultimately, the unique scientific value of neutron protein crystal structures. Copyright © 2015 Elsevier Inc. All rights reserved.
Metamorphic Proteins: Emergence of Dual Protein Folds from One Primary Sequence.
Lella, Muralikrishna; Mahalakshmi, Radhakrishnan
2017-06-20
Every amino acid exhibits a different propensity for distinct structural conformations. Hence, decoding how the primary amino acid sequence undergoes the transition to a defined secondary structure and its final three-dimensional fold is presently considered predictable with reasonable certainty. However, protein sequences that defy the first principles of secondary structure prediction (they attain two different folds) have recently been discovered. Such proteins, aptly named metamorphic proteins, decrease the conformational constraint by increasing flexibility in the secondary structure and thereby result in efficient functionality. In this review, we discuss the major factors driving the conformational switch related both to protein sequence and to structure using illustrative examples. We discuss the concept of an evolutionary transition in sequence and structure, the functional impact of the tertiary fold, and the pressure of intrinsic and external factors that give rise to metamorphic proteins. We mainly focus on the major components of protein architecture, namely, the α-helix and β-sheet segments, which are involved in conformational switching within the same or highly similar sequences. These chameleonic sequences are widespread in both cytosolic and membrane proteins, and these folds are equally important for protein structure and function. We discuss the implications of metamorphic proteins and chameleonic peptide sequences in de novo peptide design.
Detecting protein-protein interactions in the intact cell of Bacillus subtilis (ATCC 6633).
Winters, Michael S; Day, R A
2003-07-01
The salt bridge, paired group-specific reagent cyanogen (ethanedinitrile; C(2)N(2)) converts naturally occurring pairs of functional groups into covalently linked products. Cyanogen readily permeates cell walls and membranes. When the paired groups are shared between associated proteins, isolation of the covalently linked proteins allows their identity to be assigned. Examination of organisms of known genome sequence permits identification of the linked proteins by mass spectrometric techniques applied to peptides derived from them. The cyanogen-linked proteins were isolated by polyacrylamide gel electrophoresis. Digestion of the isolated proteins with proteases of known specificity afforded sets of peptides that could be analyzed by mass spectrometry. These data were compared with those derived theoretically from the Swiss Protein Database by computer-based comparisons (Protein Prospector; http://prospector.ucsf.edu). Identification of associated proteins in the ribosome of Bacillus subtilis strain ATCC 6633 showed that there is an association homology with the association patterns of the ribosomal proteins of Haloarcula marismortui and Thermus thermophilus. In addition, other proteins involved in protein biosynthesis were shown to be associated with ribosomal proteins.
Detecting Protein-Protein Interactions in the Intact Cell of Bacillus subtilis (ATCC 6633)
Winters, Michael S.; Day, R. A.
2003-01-01
The salt bridge, paired group-specific reagent cyanogen (ethanedinitrile; C2N2) converts naturally occurring pairs of functional groups into covalently linked products. Cyanogen readily permeates cell walls and membranes. When the paired groups are shared between associated proteins, isolation of the covalently linked proteins allows their identity to be assigned. Examination of organisms of known genome sequence permits identification of the linked proteins by mass spectrometric techniques applied to peptides derived from them. The cyanogen-linked proteins were isolated by polyacrylamide gel electrophoresis. Digestion of the isolated proteins with proteases of known specificity afforded sets of peptides that could be analyzed by mass spectrometry. These data were compared with those derived theoretically from the Swiss Protein Database by computer-based comparisons (Protein Prospector; http://prospector.ucsf.edu). Identification of associated proteins in the ribosome of Bacillus subtilis strain ATCC 6633 showed that there is an association homology with the association patterns of the ribosomal proteins of Haloarcula marismortui and Thermus thermophilus. In addition, other proteins involved in protein biosynthesis were shown to be associated with ribosomal proteins. PMID:12837803
Urine Protein and Urine Protein to Creatinine Ratio
... Less Common Questions Related Content On This Site Tests: Urinalysis ; Albumin ; Urine Albumin ; Protein Electrophoresis ; Total Protein , BUN , Creatinine , Creatinine Clearance , eGFR Conditions: Kidney Disease , Proteinuria , Pre-eclampsia , Diabetes , Hypertension , Multiple Myeloma , Urinary Tract Infection ...
... this page: //medlineplus.gov/ency/article/007338.htm Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...
The Protein Information Resource: an integrated public resource of functional annotation of proteins
Wu, Cathy H.; Huang, Hongzhan; Arminski, Leslie; Castro-Alvear, Jorge; Chen, Yongxing; Hu, Zhang-Zhi; Ledley, Robert S.; Lewis, Kali C.; Mewes, Hans-Werner; Orcutt, Bruce C.; Suzek, Baris E.; Tsugita, Akira; Vinayaka, C. R.; Yeh, Lai-Su L.; Zhang, Jian; Barker, Winona C.
2002-01-01
The Protein Information Resource (PIR) serves as an integrated public resource of functional annotation of protein data to support genomic/proteomic research and scientific discovery. The PIR, in collaboration with the Munich Information Center for Protein Sequences (MIPS) and the Japan International Protein Information Database (JIPID), produces the PIR-International Protein Sequence Database (PSD), the major annotated protein sequence database in the public domain, containing about 250 000 proteins. To improve protein annotation and the coverage of experimentally validated data, a bibliography submission system is developed for scientists to submit, categorize and retrieve literature information. Comprehensive protein information is available from iProClass, which includes family classification at the superfamily, domain and motif levels, structural and functional features of proteins, as well as cross-references to over 40 biological databases. To provide timely and comprehensive protein data with source attribution, we have introduced a non-redundant reference protein database, PIR-NREF. The database consists of about 800 000 proteins collected from PIR-PSD, SWISS-PROT, TrEMBL, GenPept, RefSeq and PDB, with composite protein names and literature data. To promote database interoperability, we provide XML data distribution and open database schema, and adopt common ontologies. The PIR web site (http://pir.georgetown.edu/) features data mining and sequence analysis tools for information retrieval and functional identification of proteins based on both sequence and annotation information. The PIR databases and other files are also available by FTP (ftp://nbrfa.georgetown.edu/pir_databases). PMID:11752247
Interplay between Chaperones and Protein Disorder Promotes the Evolution of Protein Networks
Pechmann, Sebastian; Frydman, Judith
2014-01-01
Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the importance of the cellular
Genome-Wide Protein Interaction Screens Reveal Functional Networks Involving Sm-Like Proteins
Fromont-Racine, Micheline; Mayes, Andrew E.; Brunet-Simon, Adeline; Rain, Jean-Christophe; Colley, Alan; Dix, Ian; Decourty, Laurence; Joly, Nicolas; Ricard, Florence; Beggs, Jean D.
2000-01-01
A set of seven structurally related Sm proteins forms the core of the snRNP particles containing the spliceosomal U1, U2, U4 and U5 snRNAs. A search of the genomic sequence of Saccharomyces cerevisiae has identified a number of open reading frames that potentially encode structurally similar proteins termed Lsm (Like Sm) proteins. With the aim of analysing all possible interactions between the Lsm proteins and any protein encoded in the yeast genome, we performed exhaustive and iterative genomic two-hybrid screens, starting with the Lsm proteins as baits. Indeed, extensive interactions amongst eight Lsm proteins were found that suggest the existence of a Lsm complex or complexes. These Lsm interactions apparently involve the conserved Sm domain that also mediates interactions between the Sm proteins. The screens also reveal functionally significant interactions with splicing factors, in particular with Prp4 and Prp24, compatible with genetic studies and with the reported association of Lsm proteins with spliceosomal U6 and U4/U6 particles. In addition, interactions with proteins involved in mRNA turnover, such as Mrt1, Dcp1, Dcp2 and Xrn1, point to roles for Lsm complexes in distinct RNA metabolic processes, that are confirmed in independent functional studies. These results provide compelling evidence that two-hybrid screens yield functionally meaningful information about protein–protein interactions and can suggest functions for uncharacterized proteins, especially when they are performed on a genome-wide scale. PMID:10900456
The Shape of Protein Crowders is a Major Determinant of Protein Diffusion
Balbo, Jessica; Mereghetti, Paolo; Herten, Dirk-Peter; Wade, Rebecca C.
2013-01-01
As a model for understanding how molecular crowding influences diffusion and transport of proteins in cellular environments, we combined experimental and theoretical approaches to study the diffusion of proteins in highly concentrated protein solutions. Bovine serum albumin and γ-Globulin were chosen as molecular crowders and as tracers. These two proteins are representatives of the main types of plasma protein and have different shapes and sizes. Solutions consisting of one or both proteins were studied. The self-diffusion coefficients of the fluorescently labeled tracer proteins were measured by means of fluorescence correlation spectroscopy at a total protein concentration of up to 400 g/L. γ-Globulin is found to have a stronger influence as a crowder on the tracer self-diffusion coefficient than Bovine serum albumin. Brownian dynamics simulations show that the excluded volume and the shape of the crowding protein have a significantly stronger influence on translational and rotational diffusion coefficients, as well as transient oligomerization, than hydrodynamic or direct interactions. Anomalous subdiffusion, which is not observed at the experimental fluorescence correlation spectroscopy timescales (>100 μs), appears only at very short timescales (<1 μs) in the simulations due to steric effects of the proteins. We envision that the combined experimental and computational approach employed here can be developed to unravel the different biophysical contributions to protein motion and interaction in cellular environments by systematically varying protein properties such as molecular weight, size, shape, and electrostatic interactions. PMID:23561534
Direct Calculation of Protein Fitness Landscapes through Computational Protein Design
Au, Loretta; Green, David F.
2016-01-01
Naturally selected amino-acid sequences or experimentally derived ones are often the basis for understanding how protein three-dimensional conformation and function are determined by primary structure. Such sequences for a protein family comprise only a small fraction of all possible variants, however, representing the fitness landscape with limited scope. Explicitly sampling and characterizing alternative, unexplored protein sequences would directly identify fundamental reasons for sequence robustness (or variability), and we demonstrate that computational methods offer an efficient mechanism toward this end, on a large scale. The dead-end elimination and A∗ search algorithms were used here to find all low-energy single mutant variants, and corresponding structures of a G-protein heterotrimer, to measure changes in structural stability and binding interactions to define a protein fitness landscape. We established consistency between these algorithms with known biophysical and evolutionary trends for amino-acid substitutions, and could thus recapitulate known protein side-chain interactions and predict novel ones. PMID:26745411
Inhibition of Protein-Protein Interactions and Signaling by Small Molecules
NASA Astrophysics Data System (ADS)
Freire, Ernesto
2010-03-01
Protein-protein interactions are at the core of cell signaling pathways as well as many bacterial and viral infection processes. As such, they define critical targets for drug development against diseases such as cancer, arthritis, obesity, AIDS and many others. Until now, the clinical inhibition of protein-protein interactions and signaling has been accomplished with the use of antibodies or soluble versions of receptor molecules. Small molecule replacements of these therapeutic agents have been extremely difficult to develop; either the necessary potency has been hard to achieve or the expected biological effect has not been obtained. In this presentation, we show that a rigorous thermodynamic approach that combines differential scanning calorimetry (DSC) and isothermal titration calorimetry (ITC) provides a unique platform for the identification and optimization of small molecular weight inhibitors of protein-protein interactions. Recent advances in the development of cell entry inhibitors of HIV-1 using this approach will be discussed.
Protein electrophoresis - serum
... digestive tract to absorb proteins ( protein-losing enteropathy ) Malnutrition Kidney disorder called nephrotic syndrome Scarring of the ... may indicate: Abnormally low level of LDL cholesterol Malnutrition Increased gamma globulin proteins may indicate: Bone marrow ...
The Unique Protein-to-Protein Carotenoid Transfer Mechanism.
Maksimov, Eugene G; Sluchanko, Nikolai N; Slonimskiy, Yury B; Mironov, Kirill S; Klementiev, Konstantin E; Moldenhauer, Marcus; Friedrich, Thomas; Los, Dmitry A; Paschenko, Vladimir Z; Rubin, Andrew B
2017-07-25
Orange Carotenoid Protein (OCP) is known as an effector and regulator of cyanobacterial photoprotection. This 35 kDa water-soluble protein provides specific environment for blue-green light absorbing keto-carotenoids, which excitation causes dramatic but fully reversible rearrangements of the OCP structure, including carotenoid translocation and separation of C- and N-terminal domains upon transition from the basic orange to photoactivated red OCP form. Although recent studies greatly improved our understanding of the OCP photocycle and interaction with phycobilisomes and the fluorescence recovery protein, the mechanism of OCP assembly remains unclear. Apparently, this process requires targeted delivery and incorporation of a highly hydrophobic carotenoid molecule into the water-soluble apoprotein of OCP. Recently, we introduced, to our knowledge, a novel carotenoid carrier protein, COCP, which consists of dimerized C-domain(s) of OCP and can combine with the isolated N-domain to form transient OCP-like species. Here, we demonstrate that in vitro COCP efficiently transfers otherwise tightly bound carotenoid to the full-length OCP apoprotein, resulting in formation of photoactive OCP from completely photoinactive species. We accurately analyze the peculiarities of this process that, to the best of our knowledge, appears unique, a previously uncharacterized protein-to-protein carotenoid transfer mechanism. We hypothesize that a similar OCP assembly can occur in vivo, substantiating specific roles of the COCP carotenoid carrier in cyanobacterial photoprotection. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
The modular architecture of protein-protein binding interfaces.
Reichmann, D; Rahat, O; Albeck, S; Meged, R; Dym, O; Schreiber, G
2005-01-04
Protein-protein interactions are essential for life. Yet, our understanding of the general principles governing binding is not complete. In the present study, we show that the interface between proteins is built in a modular fashion; each module is comprised of a number of closely interacting residues, with few interactions between the modules. The boundaries between modules are defined by clustering the contact map of the interface. We show that mutations in one module do not affect residues located in a neighboring module. As a result, the structural and energetic consequences of the deletion of entire modules are surprisingly small. To the contrary, within their module, mutations cause complex energetic and structural consequences. Experimentally, this phenomenon is shown on the interaction between TEM1-beta-lactamase and beta-lactamase inhibitor protein (BLIP) by using multiple-mutant analysis and x-ray crystallography. Replacing an entire module of five interface residues with Ala created a large cavity in the interface, with no effect on the detailed structure of the remaining interface. The modular architecture of binding sites, which resembles human engineering design, greatly simplifies the design of new protein interactions and provides a feasible view of how these interactions evolved.
Uhart, Marina; Flores, Gabriel; Bustos, Diego M.
2016-01-01
Posttranslational regulation of protein function is an ubiquitous mechanism in eukaryotic cells. Here, we analyzed biological properties of nodes and edges of a human protein-protein interaction phosphorylation-based network, especially of those nodes critical for the network controllability. We found that the minimal number of critical nodes needed to control the whole network is 29%, which is considerably lower compared to other real networks. These critical nodes are more regulated by posttranslational modifications and contain more binding domains to these modifications than other kinds of nodes in the network, suggesting an intra-group fast regulation. Also, when we analyzed the edges characteristics that connect critical and non-critical nodes, we found that the former are enriched in domain-to-eukaryotic linear motif interactions, whereas the later are enriched in domain-domain interactions. Our findings suggest a possible structure for protein-protein interaction networks with a densely interconnected and self-regulated central core, composed of critical nodes with a high participation in the controllability of the full network, and less regulated peripheral nodes. Our study offers a deeper understanding of complex network control and bridges the controllability theorems for complex networks and biological protein-protein interaction phosphorylation-based networked systems. PMID:27195976
Ren, Jun; Zhou, Wei; Wang, Jianxin
2014-01-01
Many evidences have demonstrated that protein complexes are overlapping and hierarchically organized in PPI networks. Meanwhile, the large size of PPI network wants complex detection methods have low time complexity. Up to now, few methods can identify overlapping and hierarchical protein complexes in a PPI network quickly. In this paper, a novel method, called MCSE, is proposed based on λ-module and “seed-expanding.” First, it chooses seeds as essential PPIs or edges with high edge clustering values. Then, it identifies protein complexes by expanding each seed to a λ-module. MCSE is suitable for large PPI networks because of its low time complexity. MCSE can identify overlapping protein complexes naturally because a protein can be visited by different seeds. MCSE uses the parameter λ_th to control the range of seed expanding and can detect a hierarchical organization of protein complexes by tuning the value of λ_th. Experimental results of S. cerevisiae show that this hierarchical organization is similar to that of known complexes in MIPS database. The experimental results also show that MCSE outperforms other previous competing algorithms, such as CPM, CMC, Core-Attachment, Dpclus, HC-PIN, MCL, and NFC, in terms of the functional enrichment and matching with known protein complexes. PMID:25143945
Protein Crystal Based Nanomaterials
NASA Technical Reports Server (NTRS)
Bell, Jeffrey A.; VanRoey, Patrick
2001-01-01
This is the final report on a NASA Grant. It concerns a description of work done, which includes: (1) Protein crystals cross-linked to form fibers; (2) Engineering of protein to favor crystallization; (3) Better knowledge-based potentials for protein-protein contacts; (4) Simulation of protein crystallization.
Ohoka, Nobumichi; Okuhira, Keiichiro; Ito, Masahiro; Nagai, Katsunori; Shibata, Norihito; Hattori, Takayuki; Ujikawa, Osamu; Shimokawa, Kenichiro; Sano, Osamu; Koyama, Ryokichi; Fujita, Hisashi; Teratani, Mika; Matsumoto, Hirokazu; Imaeda, Yasuhiro; Nara, Hiroshi; Cho, Nobuo; Naito, Mikihiko
2017-03-17
Many diseases, especially cancers, result from aberrant or overexpression of pathogenic proteins. Specific inhibitors against these proteins have shown remarkable therapeutic effects, but these are limited mainly to enzymes. An alternative approach that may have utility in drug development relies on selective degradation of pathogenic proteins via small chimeric molecules linking an E3 ubiquitin ligase to the targeted protein for proteasomal degradation. To this end, we recently developed a protein knockdown system based on hybrid small molecule SNIPERs ( S pecific and N ongenetic I AP-dependent P rotein Er asers) that recruit inhibitor of the apoptosis protein (IAP) ubiquitin ligases to specifically degrade targeted proteins. Here, we extend our previous study to show a proof of concept of the SNIPER technology in vivo By incorporating a high affinity IAP ligand, we developed a novel SNIPER against estrogen receptor α (ERα), SNIPER(ER)-87, that has a potent protein knockdown activity. The SNIPER(ER) reduced ERα levels in tumor xenografts and suppressed the growth of ERα-positive breast tumors in mice. Mechanistically, it preferentially recruits X-linked IAP (XIAP) rather than cellular IAP1, to degrade ERα via the ubiquitin-proteasome pathway. With this IAP ligand, potent SNIPERs against other pathogenic proteins, BCR-ABL, bromodomain-containing protein 4 (BRD4), and phosphodiesterase-4 (PDE4) could also be developed. These results indicate that forced ubiquitylation by SNIPERs is a useful method to achieve efficient protein knockdown with potential therapeutic activities and could also be applied to study the role of ubiquitylation in many cellular processes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Mapping protein-protein interactions with phage-displayed combinatorial peptide libraries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kay, B. K.; Castagnoli, L.; Biosciences Division
This unit describes the process and analysis of affinity selecting bacteriophage M13 from libraries displaying combinatorial peptides fused to either a minor or major capsid protein. Direct affinity selection uses target protein bound to a microtiter plate followed by purification of selected phage by ELISA. Alternatively, there is a bead-based affinity selection method. These methods allow one to readily isolate peptide ligands that bind to a protein target of interest and use the consensus sequence to search proteomic databases for putative interacting proteins.
Free energy decomposition of protein-protein interactions.
Noskov, S Y; Lim, C
2001-08-01
A free energy decomposition scheme has been developed and tested on antibody-antigen and protease-inhibitor binding for which accurate experimental structures were available for both free and bound proteins. Using the x-ray coordinates of the free and bound proteins, the absolute binding free energy was computed assuming additivity of three well-defined, physical processes: desolvation of the x-ray structures, isomerization of the x-ray conformation to a nearby local minimum in the gas-phase, and subsequent noncovalent complex formation in the gas phase. This free energy scheme, together with the Generalized Born model for computing the electrostatic solvation free energy, yielded binding free energies in remarkable agreement with experimental data. Two assumptions commonly used in theoretical treatments; viz., the rigid-binding approximation (which assumes no conformational change upon complexation) and the neglect of vdW interactions, were found to yield large errors in the binding free energy. Protein-protein vdW and electrostatic interactions between complementary surfaces over a relatively large area (1400--1700 A(2)) were found to drive antibody-antigen and protease-inhibitor binding.
Protein profile and protein interaction network of Moniliophthora perniciosa basidiospores.
Mares, Joise Hander; Gramacho, Karina Peres; Dos Santos, Everton Cruz; Santiago, André da Silva; Silva, Edson Mário de Andrade; Alvim, Fátima Cerqueira; Pirovani, Carlos Priminho
2016-06-24
Witches' broom, a disease caused by the basidiomycete Moniliophthora perniciosa, is considered to be the most important disease of the cocoa crop in Bahia, an area in the Brazilian Amazon, and also in the other countries where it is found. M. perniciosa germ tubes may penetrate into the host through intact or natural openings in the cuticle surface, in epidermis cell junctions, at the base of trichomes, or through the stomata. Despite its relevance to the fungal life cycle, basidiospore biology has not been extensively investigated. In this study, our goal was to optimize techniques for producing basidiospores for protein extraction, and to produce the first proteomics analysis map of ungerminated basidiospores. We then presented a protein interaction network by using Ustilago maydis as a model. The average pileus area ranged from 17.35 to 211.24 mm(2). The minimum and maximum productivity were 23,200 and 6,666,667 basidiospores per basidiome, respectively. The protein yield in micrograms per million basidiospores were approximately 0.161; 2.307, and 3.582 for germination times of 0, 2, and 4 h after germination, respectively. A total of 178 proteins were identified through mass spectrometry. These proteins were classified according to their molecular function and their involvement in biological processes such as cellular energy production, oxidative metabolism, stress, protein synthesis, and protein folding. Furthermore, to better understand the expression pattern, signaling, and interaction events of spore proteins, we presented an interaction network using orthologous proteins from Ustilago maydis as a model. Most of the orthologous proteins that were identified in this study were not clustered in the network, but several of them play a very important role in hypha development and branching. The quantities of basidiospores 7 × 10(9); 5.2 × 10(8), and 6.7 × 10(8) were sufficient to obtain enough protein mass for the three 2D-PAGE replicates, for
The ClusPro web server for protein-protein docking
Kozakov, Dima; Hall, David R.; Xia, Bing; Porter, Kathryn A.; Padhorny, Dzmitry; Yueh, Christine; Beglov, Dmitri; Vajda, Sandor
2017-01-01
The ClusPro server (https://cluspro.org) is a widely used tool for protein-protein docking. The server provides a simple home page for basic use, requiring only two files in Protein Data Bank format. However, ClusPro also offers a number of advanced options to modify the search that include the removal of unstructured protein regions, applying attraction or repulsion, accounting for pairwise distance restraints, constructing homo-multimers, considering small angle X-ray scattering (SAXS) data, and finding heparin binding sites. Six different energy functions can be used depending on the type of proteins. Docking with each energy parameter set results in ten models defined by centers of highly populated clusters of low energy docked structures. This protocol describes the use of the various options, the construction of auxiliary restraints files, the selection of the energy parameters, and the analysis of the results. Although the server is heavily used, runs are generally completed in < 4 hours. PMID:28079879
A Protein Standard That Emulates Homology for the Characterization of Protein Inference Algorithms.
The, Matthew; Edfors, Fredrik; Perez-Riverol, Yasset; Payne, Samuel H; Hoopmann, Michael R; Palmblad, Magnus; Forsström, Björn; Käll, Lukas
2018-05-04
A natural way to benchmark the performance of an analytical experimental setup is to use samples of known composition and see to what degree one can correctly infer the content of such a sample from the data. For shotgun proteomics, one of the inherent problems of interpreting data is that the measured analytes are peptides and not the actual proteins themselves. As some proteins share proteolytic peptides, there might be more than one possible causative set of proteins resulting in a given set of peptides and there is a need for mechanisms that infer proteins from lists of detected peptides. A weakness of commercially available samples of known content is that they consist of proteins that are deliberately selected for producing tryptic peptides that are unique to a single protein. Unfortunately, such samples do not expose any complications in protein inference. Hence, for a realistic benchmark of protein inference procedures, there is a need for samples of known content where the present proteins share peptides with known absent proteins. Here, we present such a standard, that is based on E. coli expressed human protein fragments. To illustrate the application of this standard, we benchmark a set of different protein inference procedures on the data. We observe that inference procedures excluding shared peptides provide more accurate estimates of errors compared to methods that include information from shared peptides, while still giving a reasonable performance in terms of the number of identified proteins. We also demonstrate that using a sample of known protein content without proteins with shared tryptic peptides can give a false sense of accuracy for many protein inference methods.
Protein Corona in Response to Flow: Effect on Protein Concentration and Structure.
Jayaram, Dhanya T; Pustulka, Samantha M; Mannino, Robert G; Lam, Wilbur A; Payne, Christine K
2018-04-09
Nanoparticles used in cellular applications encounter free serum proteins that adsorb onto the surface of the nanoparticle, forming a protein corona. This protein layer controls the interaction of nanoparticles with cells. For nanomedicine applications, it is important to consider how intravenous injection and the subsequent shear flow will affect the protein corona. Our goal was to determine if shear flow changed the composition of the protein corona and if these changes affected cellular binding. Colorimetric assays of protein concentration and gel electrophoresis demonstrate that polystyrene nanoparticles subjected to flow have a greater concentration of serum proteins adsorbed on the surface, especially plasminogen. Plasminogen, in the absence of nanoparticles, undergoes changes in structure in response to flow, characterized by fluorescence and circular dichroism spectroscopy. The protein-nanoparticle complexes formed from fetal bovine serum after flow had decreased cellular binding, as measured with flow cytometry. In addition to the relevance for nanomedicine, these results also highlight the technical challenges of protein corona studies. The composition of the protein corona was highly dependent on the initial mixing step: rocking, vortexing, or flow. Overall, these results reaffirm the importance of the protein corona in nanoparticle-cell interactions and point toward the challenges of predicting corona composition based on nanoparticle properties. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Re-visiting protein-centric two-tier classification of existing DNA-protein complexes
2012-01-01
Background Precise DNA-protein interactions play most important and vital role in maintaining the normal physiological functioning of the cell, as it controls many high fidelity cellular processes. Detailed study of the nature of these interactions has paved the way for understanding the mechanisms behind the biological processes in which they are involved. Earlier in 2000, a systematic classification of DNA-protein complexes based on the structural analysis of the proteins was proposed at two tiers, namely groups and families. With the advancement in the number and resolution of structures of DNA-protein complexes deposited in the Protein Data Bank, it is important to revisit the existing classification. Results On the basis of the sequence analysis of DNA binding proteins, we have built upon the protein centric, two-tier classification of DNA-protein complexes by adding new members to existing families and making new families and groups. While classifying the new complexes, we also realised the emergence of new groups and families. The new group observed was where β-propeller was seen to interact with DNA. There were 34 SCOP folds which were observed to be present in the complexes of both old and new classifications, whereas 28 folds are present exclusively in the new complexes. Some new families noticed were NarL transcription factor, Z-α DNA binding proteins, Forkhead transcription factor, AP2 protein, Methyl CpG binding protein etc. Conclusions Our results suggest that with the increasing number of availability of DNA-protein complexes in Protein Data Bank, the number of families in the classification increased by approximately three fold. The folds present exclusively in newly classified complexes is suggestive of inclusion of proteins with new function in new classification, the most populated of which are the folds responsible for DNA damage repair. The proposed re-visited classification can be used to perform genome-wide surveys in the genomes of
Alvarez-Ponce, David; Feyertag, Felix; Chakraborty, Sandip
2017-06-01
The proteins of any organism evolve at disparate rates. A long list of factors affecting rates of protein evolution have been identified. However, the relative importance of each factor in determining rates of protein evolution remains unresolved. The prevailing view is that evolutionary rates are dominantly determined by gene expression, and that other factors such as network centrality have only a marginal effect, if any. However, this view is largely based on analyses in yeasts, and accurately measuring the importance of the determinants of rates of protein evolution is complicated by the fact that the different factors are often correlated with each other, and by the relatively poor quality of available functional genomics data sets. Here, we use correlation, partial correlation and principal component regression analyses to measure the contributions of several factors to the variability of the rates of evolution of human proteins. For this purpose, we analyzed the entire human protein-protein interaction data set and the human signal transduction network-a network data set of exceptionally high quality, obtained by manual curation, which is expected to be virtually free from false positives. In contrast with the prevailing view, we observe that network centrality (measured as the number of physical and nonphysical interactions, betweenness, and closeness) has a considerable impact on rates of protein evolution. Surprisingly, the impact of centrality on rates of protein evolution seems to be comparable, or even superior according to some analyses, to that of gene expression. Our observations seem to be independent of potentially confounding factors and from the limitations (biases and errors) of interactomic data sets. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
A new protein-protein interaction sensor based on tripartite split-GFP association.
Cabantous, Stéphanie; Nguyen, Hau B; Pedelacq, Jean-Denis; Koraïchi, Faten; Chaudhary, Anu; Ganguly, Kumkum; Lockard, Meghan A; Favre, Gilles; Terwilliger, Thomas C; Waldo, Geoffrey S
2013-10-04
Monitoring protein-protein interactions in living cells is key to unraveling their roles in numerous cellular processes and various diseases. Previously described split-GFP based sensors suffer from poor folding and/or self-assembly background fluorescence. Here, we have engineered a micro-tagging system to monitor protein-protein interactions in vivo and in vitro. The assay is based on tripartite association between two twenty amino-acids long GFP tags, GFP10 and GFP11, fused to interacting protein partners, and the complementary GFP1-9 detector. When proteins interact, GFP10 and GFP11 self-associate with GFP1-9 to reconstitute a functional GFP. Using coiled-coils and FRB/FKBP12 model systems we characterize the sensor in vitro and in Escherichia coli. We extend the studies to mammalian cells and examine the FK-506 inhibition of the rapamycin-induced association of FRB/FKBP12. The small size of these tags and their minimal effect on fusion protein behavior and solubility should enable new experiments for monitoring protein-protein association by fluorescence.
A New Protein-Protein Interaction Sensor Based on Tripartite Split-GFP Association
Cabantous, Stéphanie; Nguyen, Hau B.; Pedelacq, Jean-Denis; Koraïchi, Faten; Chaudhary, Anu; Ganguly, Kumkum; Lockard, Meghan A.; Favre, Gilles; Terwilliger, Thomas C.; Waldo, Geoffrey S.
2013-01-01
Monitoring protein-protein interactions in living cells is key to unraveling their roles in numerous cellular processes and various diseases. Previously described split-GFP based sensors suffer from poor folding and/or self-assembly background fluorescence. Here, we have engineered a micro-tagging system to monitor protein-protein interactions in vivo and in vitro. The assay is based on tripartite association between two twenty amino-acids long GFP tags, GFP10 and GFP11, fused to interacting protein partners, and the complementary GFP1-9 detector. When proteins interact, GFP10 and GFP11 self-associate with GFP1-9 to reconstitute a functional GFP. Using coiled-coils and FRB/FKBP12 model systems we characterize the sensor in vitro and in Escherichia coli. We extend the studies to mammalian cells and examine the FK-506 inhibition of the rapamycin-induced association of FRB/FKBP12. The small size of these tags and their minimal effect on fusion protein behavior and solubility should enable new experiments for monitoring protein-protein association by fluorescence. PMID:24092409
Computational Approaches for Designing Protein/Inhibitor Complexes and Membrane Protein Variants
NASA Astrophysics Data System (ADS)
Vijayendran, Krishna Gajan
Drug discovery of small-molecule protein inhibitors is a vast enterprise that involves several scientific disciplines (i.e. genomics, cell biology, x-ray crystallography, chemistry, computer science, statistics), with each discipline focusing on a particular aspect of the process. In this thesis, I use computational and experimental approaches to explore the most fundamental aspect of drug discovery: the molecular interactions of small-molecules inhibitors with proteins. In Part I (Chapters I and II), I describe how computational docking approaches can be used to identify structurally diverse molecules that can inhibit multiple protein targets in the brain. I illustrate this approach using the examples of microtubule-stabilizing agents and inhibitors of cyclooxygenase(COX)-I and 5-lipoxygenase (5-LOX). In Part II (Chapters III and IV), I focus on membrane proteins, which are notoriously difficult to work with due to their low natural abundances, low yields for heterologous over expression, and propensities toward aggregation. I describe a general approach for designing water-soluble variants of membrane proteins, for the purpose of developing cell-free, label-free, detergent-free, solution-phase studies of protein structure and small-molecule binding. I illustrate this approach through the design of a water-soluble variant of the membrane protein Smoothened, wsSMO. This wsSMO stands to serve as a first-step towards developing membrane protein analogs of this important signaling protein and drug target.
Factor VII and protein C are phosphatidic acid-binding proteins.
Tavoosi, Narjes; Smith, Stephanie A; Davis-Harrison, Rebecca L; Morrissey, James H
2013-08-20
Seven proteins in the human blood clotting cascade bind, via their GLA (γ-carboxyglutamate-rich) domains, to membranes containing exposed phosphatidylserine (PS), although with membrane binding affinities that vary by 3 orders of magnitude. Here we employed nanodiscs of defined phospholipid composition to quantify the phospholipid binding specificities of these seven clotting proteins. All bound preferentially to nanobilayers in which PS headgroups contained l-serine versus d-serine. Surprisingly, however, nanobilayers containing phosphatidic acid (PA) bound substantially more of two of these proteins, factor VIIa and activated protein C, than did equivalent bilayers containing PS. Consistent with this finding, liposomes containing PA supported higher proteolytic activity by factor VIIa and activated protein C toward their natural substrates (factors X and Va, respectively) than did PS-containing liposomes. Moreover, treating activated human platelets with phospholipase D enhanced the rates of factor X activation by factor VIIa in the presence of soluble tissue factor. We hypothesize that factor VII and protein C bind preferentially to the monoester phosphate of PA because of its accessibility and higher negative charge compared with the diester phosphates of most other phospholipids. We further found that phosphatidylinositol 4-phosphate, which contains a monoester phosphate attached to its myo-inositol headgroup, also supported enhanced enzymatic activity of factor VIIa and activated protein C. We conclude that factor VII and protein C bind preferentially to monoester phosphates, which may have implications for the function of these proteases in vivo.
High Dietary Protein Intake and Protein-Related Acid Load on Bone Health.
Cao, Jay J
2017-12-01
Consumption of high-protein diets is increasingly popular due to the benefits of protein on preserving lean mass and controlling appetite and satiety. The paper is to review recent clinical research assessing dietary protein on calcium metabolism and bone health. Epidemiological studies show that long-term, high-protein intake is positively associated with bone mineral density and reduced risk of bone fracture incidence. Short-term interventional studies demonstrate that a high-protein diet does not negatively affect calcium homeostasis. Existing evidence supports that the negative effects of the acid load of protein on urinary calcium excretion are offset by the beneficial skeletal effects of high-protein intake. Future research should focus on the role and the degree of contribution of other dietary and physiological factors, such as intake of fruits and vegetables, in reducing the acid load and further enhancing the anabolic effects of protein on the musculoskeletal system.
Relevance of protein-protein interactions on the biological identity of nanoparticles.
Vasti, Cecilia; Bonnet, Laura V; Galiano, Mauricio R; Rojas, Ricardo; Giacomelli, Carla E
2018-06-01
Considering that the use of nanoparticles (NPs) as carriers of therapeutic or theranostic agents has increased in the last years, it is mandatory to understand the interaction between NPs and living systems. In contact with biological fluids, the NPs (synthetic identity) are covered with biomolecules that form a protein corona, which defines the biological identity. It is well known that the protein corona formation is mediated by non-specific physical interactions, but protein-protein interactions (PPI), involving specific recognition sites of the polypeptides, are also involved. This work explores the relationship between the synthetic and biological identities of layered double hydroxides nanoparticles (LDH-NPs) and the effect of the protein corona on the cellular response. With such a purpose, the synthetic identity was modified by coating LDH-NPs with either a single protein or a complex mixture of them, followed by the characterization of the protein corona formed in a commonly used cell culture medium. A proteomic approach was used to identify the protein corona molecules and the PPI network was constructed with a novel bioinformatic tool. The coating on LDH-NPs defines the biological identity in such a way that the composition of the protein corona as well as PPI are changed. Electrostatic interactions appear not to be the only driving force regulating the interactions between NPs, proteins and cells since the specific recognition also play a fundamental role. However, the biological identity of LDH-NPs does not affect the interactions with cells that shows negligible cytotoxicity and high internalization levels. Copyright © 2018 Elsevier B.V. All rights reserved.
Witkowski, Benoit; Lelièvre, Joel; Nicolau-Travers, Marie-Laure; Iriart, Xavier; Njomnang Soh, Patrice; Bousejra-Elgarah, Fatima; Meunier, Bernard; Berry, Antoine; Benoit-Vical, Françoise
2012-01-01
Plasmodium falciparum malaria is a major global health problem, causing approximately 780,000 deaths each year. In response to the spreading of P. falciparum drug resistance, WHO recommended in 2001 to use artemisinin derivatives in combination with a partner drug (called ACT) as first-line treatment for uncomplicated falciparum malaria, and most malaria-endemic countries have since changed their treatment policies accordingly. Currently, ACT are often the last treatments that can effectively and rapidly cure P. falciparum infections permitting to significantly decrease the mortality and the morbidity due to malaria. However, alarming signs of emerging resistance to artemisinin derivatives along the Thai-Cambodian border are of major concern. Through long-term in vivo pressures, we have been able to select a murine malaria model resistant to artemisinins. We demonstrated that the resistance of Plasmodium to artemisinin-based compounds depends on alterations of heme metabolism and on a loss of hemozoin formation linked to the down-expression of the recently identified Heme Detoxification Protein (HDP). These artemisinins resistant strains could be able to detoxify the free heme by an alternative catabolism pathway involving glutathione (GSH)-mediation. Finally, we confirmed that artemisinins act also like quinolines against Plasmodium via hemozoin production inhibition. The work proposed here described the mechanism of action of this class of molecules and the resistance to artemisinins of this model. These results should help both to reinforce the artemisinins activity and avoid emergence and spread of endoperoxides resistance by focusing in adequate drug partners design. Such considerations appear crucial in the current context of early artemisinin resistance in Asia.