Gliding Motility of Babesia bovis Merozoites Visualized by Time-Lapse Video Microscopy

PubMed Central

Asada, Masahito; Goto, Yasuyuki; Yahata, Kazuhide; Yokoyama, Naoaki; Kawai, Satoru; Inoue, Noboru; Kaneko, Osamu; Kawazu, Shin-ichiro

2012-01-01

Background Babesia bovis is an apicomplexan intraerythrocytic protozoan parasite that induces babesiosis in cattle after transmission by ticks. During specific stages of the apicomplexan parasite lifecycle, such as the sporozoites of Plasmodium falciparum and tachyzoites of Toxoplasma gondii, host cells are targeted for invasion using a unique, active process termed “gliding motility”. However, it is not thoroughly understood how the merozoites of B. bovis target and invade host red blood cells (RBCs), and gliding motility has so far not been observed in the parasite. Methodology/Principal Findings Gliding motility of B. bovis merozoites was revealed by time-lapse video microscopy. The recorded images revealed that the process included egress of the merozoites from the infected RBC, gliding motility, and subsequent invasion into new RBCs. The gliding motility of B. bovis merozoites was similar to the helical gliding of Toxoplasma tachyzoites. The trails left by the merozoites were detected by indirect immunofluorescence assay using antiserum against B. bovis merozoite surface antigen 1. Inhibition of gliding motility by actin filament polymerization or depolymerization indicated that the gliding motility was driven by actomyosin dependent process. In addition, we revealed the timing of breakdown of the parasitophorous vacuole. Time-lapse image analysis of membrane-stained bovine RBCs showed formation and breakdown of the parasitophorous vacuole within ten minutes of invasion. Conclusions/Significance This is the first report of the gliding motility of B. bovis. Since merozoites of Plasmodium parasites do not glide on a substrate, the gliding motility of B. bovis merozoites is a notable finding. PMID:22506073

Antibodies against multiple merozoite surface antigens of the human malaria parasite Plasmodium falciparum inhibit parasite maturation and red blood cell invasion.

PubMed

Woehlbier, Ute; Epp, Christian; Hackett, Fiona; Blackman, Michael J; Bujard, Hermann

2010-03-18

Plasmodium falciparum merozoites expose at their surface a large protein complex, which is composed of fragments of merozoite surface protein 1 (MSP-1; called MSP-183, MSP-130, MSP-138, and MSP-142) plus associated processing products of MSP-6 and MSP-7. During erythrocyte invasion this complex, as well as an integral membrane protein called apical membrane antigen-1 (AMA-1), is shed from the parasite surface following specific proteolysis. Components of the MSP-1/6/7 complex and AMA-1 are presently under development as malaria vaccines. The specificities and effects of antibodies directed against MSP-1, MSP-6, MSP-7 on the growth of blood stage parasites were studied using ELISA and the pLDH-assay. To understand the mode of action of these antibodies, their effects on processing of MSP-1 and AMA-1 on the surface of merozoites were investigated. Antibodies targeting epitopes located throughout the MSP-1/6/7 complex interfere with shedding of MSP-1, and as a consequence prevent erythrocyte invasion. Antibodies targeting the MSP-1/6/7 complex have no effect on the processing and shedding of AMA-1 and, similarly, antibodies blocking the shedding of AMA-1 do not affect cleavage of MSP-1, suggesting completely independent functions of these proteins during invasion. Furthermore, some epitopes, although eliciting highly inhibitory antibodies, are only poorly recognized by the immune system when presented in the structural context of the intact antigen. The findings reported provide further support for the development of vaccines based on MSP-1/6/7 and AMA-1, which would possibly include a combination of these antigens.

Penetration of equine leukocytes by merozoites of Sarcocystis neurona.

PubMed

Lindsay, David S; Mitchell, Sheila M; Yang, Jibing; Dubey, J P; Gogal, Robert M; Witonsky, Sharon G

2006-06-15

Horses are considered accidental hosts for Sarcocystis neurona and they often develop severe neurological disease when infected with this parasite. Schizont stages develop in the central nervous system (CNS) and cause the neurological lesions associated with equine protozoal myeloencephalitis. The present study was done to examine the ability of S. neurona merozoites to penetrate and develop in equine peripheral blood leukocytes. These infected host cells might serve as a possible transport mechanism into the CNS. S. neurona merozoites penetrated equine leukocytes within 5 min of co-culture. Infected leukocytes were usually monocytes. Infected leukocytes were present up to the final day of examination at 3 days. Up to three merozoites were present in an infected monocyte. No development to schizont stages was observed. All stages observed were in the host cell cytoplasm. We postulate that S. neurona merozoites may cross the blood brain barrier hidden inside leukocytes. Once inside the CNS these merozoites can egress and invade additional cells and cause encephalitis.

Apoptosis of non-parasitised red blood cells in Plasmodium yoelii malaria

PubMed Central

Totino, Paulo Renato Rivas; Pinna, Raquel Alves; De-Oliveira, Ana Cecilia Amado Xavier; Banic, Dalma Maria; Daniel-Ribeiro, Cláudio Tadeu; Ferreira-da-Cruz, Maria de Fátima

2013-01-01

Recently, while studying erythrocytic apoptosis during Plasmodium yoelii infection, we observed an increase in the levels of non-parasitised red blood cell (nRBC) apoptosis, which could be related to malarial anaemia. Therefore, in the present study, we attempted to investigate whether nRBC apoptosis is associated with the peripheral RBC count, parasite load or immune response. To this end, BALB/c mice were infected with P. yoelii 17XL and nRBC apoptosis, number of peripheral RBCs, parasitaemia and plasmatic levels of cytokines, nitric oxide and anti-RBC antibodies were evaluated at the early and late stages of anaemia. The apoptosis of nRBCs increased at the late stage and was associated with parasitaemia, but not with the intensity of the immune response. The increased percentage of nRBC apoptosis that was observed when anaemia was accentuated was not related to a reduction in peripheral RBCs. We conclude that nRBC apoptosis in P. yoelii malaria appears to be induced in response to a high parasite load. Further studies on malaria models in which acute anaemia develops during low parasitaemia are needed to identify the potential pathogenic role of nRBC apoptosis. PMID:24037189

Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

PubMed

Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

2016-10-21

An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

Genome-wide polymorphisms and development of a microarray platform to detect genetic variations in Plasmodium yoelii.

PubMed

Nair, Sethu C; Pattaradilokrat, Sittiporn; Zilversmit, Martine M; Dommer, Jennifer; Nagarajan, Vijayaraj; Stephens, Melissa T; Xiao, Wenming; Tan, John C; Su, Xin-Zhuan

2014-01-01

The rodent malaria parasite Plasmodium yoelii is an important model for studying malaria immunity and pathogenesis. One approach for studying malaria disease phenotypes is genetic mapping, which requires typing a large number of genetic markers from multiple parasite strains and/or progeny from genetic crosses. Hundreds of microsatellite (MS) markers have been developed to genotype the P. yoelii genome; however, typing a large number of MS markers can be labor intensive, time consuming, and expensive. Thus, development of high-throughput genotyping tools such as DNA microarrays that enable rapid and accurate large-scale genotyping of the malaria parasite will be highly desirable. In this study, we sequenced the genomes of two P. yoelii strains (33X and N67) and obtained a large number of single nucleotide polymorphisms (SNPs). Based on the SNPs obtained, we designed sets of oligonucleotide probes to develop a microarray that could interrogate ∼11,000 SNPs across the 14 chromosomes of the parasite in a single hybridization. Results from hybridizations of DNA samples of five P. yoelii strains or cloned lines (17XNL, YM, 33X, N67 and N67C) and two progeny from a genetic cross (N67×17XNL) to the microarray showed that the array had a high call rate (∼97%) and accuracy (99.9%) in calling SNPs, providing a simple and reliable tool for typing the P. yoelii genome. Our data show that the P. yoelii genome is highly polymorphic, although isogenic pairs of parasites were also detected. Additionally, our results indicate that the 33X parasite is a progeny of 17XNL (or YM) and an unknown parasite. The highly accurate and reliable microarray developed in this study will greatly facilitate our ability to study the genetic basis of important traits and the disease it causes. Published by Elsevier B.V.

Allelic Diversity and Geographical Distribution of the Gene Encoding Plasmodium falciparum Merozoite Surface Protein-3 in Thailand.

PubMed

Sawaswong, Vorthon; Simpalipan, Phumin; Siripoon, Napaporn; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2015-04-01

Merozoite surface proteins (MSPs) of malaria parasites play critical roles during the erythrocyte invasion and so are potential candidates for malaria vaccine development. However, because MSPs are often under strong immune selection, they can exhibit extensive genetic diversity. The gene encoding the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum displays 2 allelic types, K1 and 3D7. In Thailand, the allelic frequency of the P. falciparum msp-3 gene was evaluated in a single P. falciparum population in Tak at the Thailand and Myanmar border. However, no study has yet looked at the extent of genetic diversity of the msp-3 gene in P. falciparum populations in other localities. Here, we genotyped the msp-3 alleles of 63 P. falciparum samples collected from 5 geographical populations along the borders of Thailand with 3 neighboring countries (Myanmar, Laos, and Cambodia). Our study indicated that the K1 and 3D7 alleles coexisted, but at different proportions in different Thai P. falciparum populations. K1 was more prevalent in populations at the Thailand-Myanmar and Thailand-Cambodia borders, whilst 3D7 was more prevalent at the Thailand-Laos border. Global analysis of the msp-3 allele frequencies revealed that proportions of K1 and 3D7 alleles of msp-3 also varied in different continents, suggesting the divergence of malaria parasite populations. In conclusion, the variation in the msp-3 allelic patterns of P. falciparum in Thailand provides fundamental knowledge for inferring the P. falciparum population structure and for the best design of msp-3 based malaria vaccines.

A Cas9 transgenic Plasmodium yoelii parasite for efficient gene editing.

PubMed

Qian, Pengge; Wang, Xu; Yang, Zhenke; Li, Zhenkui; Gao, Han; Su, Xin-Zhuan; Cui, Huiting; Yuan, Jing

2018-06-01

The RNA-guided endonuclease Cas9 has applied as an efficient gene-editing method in malaria parasite Plasmodium. However, the size (4.2 kb) of the commonly used Cas9 from Streptococcus pyogenes (SpCas9) limits its utility for genome editing in the parasites only introduced with cas9 plasmid. To establish the endogenous and constitutive expression of Cas9 protein in the rodent malaria parasite P. yoelii, we replaced the coding region of an endogenous gene sera1 with the intact SpCas9 coding sequence using the CRISPR/Cas9-mediated genome editing method, generating the cas9-knockin parasite (PyCas9ki) of the rodent malaria parasite P. yoelii. The resulted PyCas9ki parasite displays normal progression during the whole life cycle and possesses the Cas9 protein expression in asexual blood stage. By introducing the plasmid (pYCs) containing only sgRNA and homologous template elements, we successfully achieved both deletion and tagging modifications for different endogenous genes in the genome of PyCas9ki parasite. This cas9-knockin PyCas9ki parasite provides a new platform facilitating gene functions study in the rodent malaria parasite P. yoelii. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic Diversity of Plasmodium falciparum Merozoite Surface Protein-1 Block 2 in Sites of Contrasting Altitudes and Malaria Endemicities in the Mount Cameroon Region

PubMed Central

Wanji, Samuel; Kengne-Ouafo, Arnaud J.; Joan Eyong, Ebanga E.; Kimbi, Helen K.; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L.; Nana-Djeunga, Hugues C.; Bourguinat, Catherine; Sofeu-Feugaing, David D.; Charvet, Claude L.

2012-01-01

The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein–enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction–based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms. PMID:22556072

Genetic diversity of Plasmodium falciparum merozoite surface protein-1 block 2 in sites of contrasting altitudes and malaria endemicities in the Mount Cameroon region.

PubMed

Wanji, Samuel; Kengne-Ouafo, Arnaud J; Eyong, Ebanga E Joan; Kimbi, Helen K; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L; Nana-Djeunga, Hugues C; Bourguinat, Catherine; Sofeu-Feugaing, David D; Charvet, Claude L

2012-05-01

The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein-enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction-based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms.

Allelic Diversity and Geographical Distribution of the Gene Encoding Plasmodium falciparum Merozoite Surface Protein-3 in Thailand

PubMed Central

Sawaswong, Vorthon; Simpalipan, Phumin; Siripoon, Napaporn; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2015-01-01

Merozoite surface proteins (MSPs) of malaria parasites play critical roles during the erythrocyte invasion and so are potential candidates for malaria vaccine development. However, because MSPs are often under strong immune selection, they can exhibit extensive genetic diversity. The gene encoding the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum displays 2 allelic types, K1 and 3D7. In Thailand, the allelic frequency of the P. falciparum msp-3 gene was evaluated in a single P. falciparum population in Tak at the Thailand and Myanmar border. However, no study has yet looked at the extent of genetic diversity of the msp-3 gene in P. falciparum populations in other localities. Here, we genotyped the msp-3 alleles of 63 P. falciparum samples collected from 5 geographical populations along the borders of Thailand with 3 neighboring countries (Myanmar, Laos, and Cambodia). Our study indicated that the K1 and 3D7 alleles coexisted, but at different proportions in different Thai P. falciparum populations. K1 was more prevalent in populations at the Thailand-Myanmar and Thailand-Cambodia borders, whilst 3D7 was more prevalent at the Thailand-Laos border. Global analysis of the msp-3 allele frequencies revealed that proportions of K1 and 3D7 alleles of msp-3 also varied in different continents, suggesting the divergence of malaria parasite populations. In conclusion, the variation in the msp-3 allelic patterns of P. falciparum in Thailand provides fundamental knowledge for inferring the P. falciparum population structure and for the best design of msp-3 based malaria vaccines. PMID:25925176

Genetic polymorphism of merozoite surface protein-1 and merozoite surface protein-2 in Plasmodium falciparum isolates from Brazzaville, Republic of Congo

PubMed Central

2011-01-01

Background The characterization of malaria parasite populations circulating in an area is part of site characterization, as a basis for evaluating the impact of malaria interventions on genetic diversity, parasite species, and multiplicity of infection. The present study was aimed at analysing genetic diversity of Plasmodium falciparum merozoite surface proteins 1 and 2 (MSP-1 and MSP-2) and to determine the multiplicity of infection in clinical isolates collected from children living in the Southern district of Brazzaville in the Republic of Congo. Methods A total of 125 isolates from patients with uncomplicated malaria attending Terinkyo and Madibou health centres were collected between January and June 2005 while evaluating the therapeutic efficacy of amodiaquine-artesunate combination. DNA was extracted and msp-1 and msp-2 genes were genotyped using allele-specific nested-PCR. Results Out of 468 distinct fragments detected, 15 msp-1 and 20 msp-2 genotypes were identified. For the msp-1 gene, K1 family was the predominant allelic type carried alone or in association with RO33 and Mad20 types, whereas the 3D7 family was the most prevalent in the msp-2 gene. Overall, the mean multiplicity of infection was 2.2. Out of 125 samples, 104 (83%) harboured more than one parasite genotype. There was no statistical significant difference in the multiplicity of infection by either sex or age of patients. However, a statistically significant correlation was found between parasite densities and the number of genotypes. Conclusion Polymorphism in P. falciparum clinical isolates from Brazzaville was high and mainly of multiple clones. The basis for the positive association between parasite densities and multiplicity of infection is discussed. PMID:21936949

Patterns of protective associations differ for antibodies to P. falciparum-infected erythrocytes and merozoites in immunity against malaria in children.

PubMed

Chan, Jo-Anne; Stanisic, Danielle I; Duffy, Michael F; Robinson, Leanne J; Lin, Enmoore; Kazura, James W; King, Christopher L; Siba, Peter M; Fowkes, Freya Ji; Mueller, Ivo; Beeson, James G

2017-12-01

Acquired antibodies play an important role in immunity to P. falciparum malaria and are typically directed towards surface antigens expressed by merozoites and infected erythrocytes (IEs). The importance of specific IE surface antigens as immune targets remains unclear. We evaluated antibodies and protective associations in two cohorts of children in Papua New Guinea. We used genetically-modified P. falciparum to evaluate the importance of PfEMP1 and a P. falciparum isolate with a virulent phenotype. Our findings suggested that PfEMP1 was the dominant target of antibodies to the IE surface, including functional antibodies that promoted opsonic phagocytosis by monocytes. Antibodies were associated with increasing age and concurrent parasitemia, and were higher among children exposed to a higher force-of-infection as determined using molecular detection. Antibodies to IE surface antigens were consistently associated with reduced risk of malaria in both younger and older children. However, protective associations for antibodies to merozoite surface antigens were only observed in older children. This suggests that antibodies to IE surface antigens, particularly PfEMP1, play an earlier role in acquired immunity to malaria, whereas greater exposure is required for protective antibodies to merozoite antigens. These findings have implications for vaccine design and serosurveillance of malaria transmission and immunity. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Longitudinal evaluation of humoral immune response and merozoite surface antigen diversity in calves naturally infected with Babesia bovis, in São Paulo, Brazil.

PubMed

Matos, Carlos António; Gonçalves, Luiz Ricardo; Alvarez, Dasiel Obregón; Freschi, Carla Roberta; Silva, Jenevaldo Barbosa da; Val-Moraes, Silvana Pompeia; Mendes, Natalia Serra; André, Marcos Rogério; Machado, Rosangela Zacarias

2017-01-01

Babesiosis is an economically important infectious disease affecting cattle worldwide. In order to longitudinally evaluate the humoral immune response against Babesia bovis and the merozoite surface antigen diversity of B. bovis among naturally infected calves in Taiaçu, Brazil, serum and DNA samples from 15 calves were obtained quarterly, from their birth to 12 months of age. Anti-B. bovis IgG antibodies were detected by means of the indirect fluorescent antibody test (IFAT) and enzyme-linked immunosorbent assay (ELISA). The polymerase chain reaction (PCR) was used to investigate the genetic diversity of B. bovis, based on the genes that encode merozoite surface antigens (MSA-1, MSA-2b and MSA-2c). The serological results demonstrated that up to six months of age, all the calves developed active immunity against B. bovis. Among the 75 DNA samples evaluated, 2, 4 and 5 sequences of the genes msa-1, msa-2b and msa-2c were obtained. The present study demonstrated that the msa-1 and msa-2b genes sequences amplified from blood DNA of calves positive to B. bovis from Taiaçu were genetically distinct, and that msa-2c was conserved. All animals were serologically positive to ELISA and IFAT, which used full repertoire of parasite antigens in despite of the genetic diversity of MSAs.

A Plasmodium yoelii HECT-like E3 ubiquitin ligase regulates parasite growth and virulence.

PubMed

Nair, Sethu C; Xu, Ruixue; Pattaradilokrat, Sittiporn; Wu, Jian; Qi, Yanwei; Zilversmit, Martine; Ganesan, Sundar; Nagarajan, Vijayaraj; Eastman, Richard T; Orandle, Marlene S; Tan, John C; Myers, Timothy G; Liu, Shengfa; Long, Carole A; Li, Jian; Su, Xin-Zhuan

2017-08-09

Infection of mice with strains of Plasmodium yoelii parasites can result in different pathology, but molecular mechanisms to explain this variation are unclear. Here we show that a P. yoelii gene encoding a HECT-like E3 ubiquitin ligase (Pyheul) influences parasitemia and host mortality. We genetically cross two lethal parasites with distinct disease phenotypes, and identify 43 genetically diverse progeny by typing with microsatellites and 9230 single-nucleotide polymorphisms. A genome-wide quantitative trait loci scan links parasite growth and host mortality to two major loci on chromosomes 1 and 7 with LOD (logarithm of the odds) scores = 6.1 and 8.1, respectively. Allelic exchange of partial sequences of Pyheul in the chromosome 7 locus and modification of the gene expression alter parasite growth and host mortality. This study identifies a gene that may have a function in parasite growth, virulence, and host-parasite interaction, and therefore could be a target for drug or vaccine development.Many strains of Plasmodium differ in virulence, but factors that control these distinctions are not known. Here the authors comparatively map virulence loci using the offspring from a P. yoelii YM and N67 genetic cross, and identify a putative HECT E3 ubiquitin ligase that may explain the variance.

Experimental inoculation of domestic cats (Felis domesticus) with Sarcocystis neurona or S. neurona-like merozoites.

PubMed

Butcher, M; Lakritz, J; Halaney, A; Branson, K; Gupta, G D; Kreeger, J; Marsh, A E

2002-07-29

Sarcocystis neurona is the parasite most commonly associated with equine protozoal myeloencephalitis (EPM). Recently, cats (Felis domesticus) have been demonstrated to be an experimental intermediate host in the life cycle of S. neurona. This study was performed to determine if cats experimentally inoculated with culture-derived S. neurona merozoites develop tissue sarcocysts infectious to opossums (Didelphis virginiana), the definitive host of S. neurona. Four cats were inoculated with S. neurona or S. neurona-like merozoites and all developed antibodies reacting to S. neurona merozoite antigens, but tissue sarcocysts were detected in only two cats. Muscle tissues from the experimentally inoculated cats with and without detectable sarcocysts were fed to laboratory-reared opossums. Sporocysts were detected in gastrointestinal (GI) scrapings of one opossum fed experimentally infected feline tissues. The study results suggest that cats can develop tissue cysts following inoculation with culture-derived Sarcocystis sp. merozoites in which the particular isolate was originally derived from a naturally infected cat with tissue sarcocysts. This is in contrast to cats which did not develop tissue cysts when inoculated with S. neurona merozoites originally derived from a horse with EPM. These results indicate present biological differences between the culture-derived merozoites of two Sarcocystis isolates, Sn-UCD 1 and Sn-Mucat 2.

Polymorphism at the merozoite surface protein-3alpha locus of Plasmodium vivax: global and local diversity.

PubMed

Bruce, M C; Galinski, M R; Barnwell, J W; Snounou, G; Day, K P

1999-10-01

Allelic diversity at the Plasmodium vivax merozoite surface protein-3alpha (PvMsp-3alpha) locus was investigated using a combined polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) protocol. Symptomatic patient isolates from global geographic origins showed a high level of polymorphism at the nucleotide level. These samples were used to validate the sensitivity, specificity, and reproducibility of the PCR/RFLP method. It was then used to investigate PvMsp3alpha diversity in field samples from children living in a single village in a malaria-endemic region of Papua New Guinea, with the aim of assessing the usefulness of this locus as an epidemiologic marker of P. vivax infections. Eleven PvMsp-3alpha alleles were distinguishable in 16 samples with single infections, revealing extensive parasite polymorphism within this restricted area. Multiple infections were easily detected and accounted for 5 (23%) of 22 positive samples. Pairs of samples from individual children provided preliminary evidence for high turnover of P. vivax populations.

Immunogenicity and Protective Efficacy of a Plasmodium yoelii Hsp60 DNA Vaccine in BALB/c Mice

PubMed Central

Sanchez, Gloria I.; Sedegah, Martha; Rogers, William O.; Jones, Trevor R.; Sacci, John; Witney, Adam; Carucci, Daniel J.; Kumar, Nirbhay; Hoffman, Stephen L.

2001-01-01

The gene encoding the 60-kDa heat shock protein of Plasmodium yoelii (PyHsp60) was cloned into the VR1012 and VR1020 mammalian expression vectors. Groups of 10 BALB/c mice were immunized intramuscularly at 0, 3, and 9 weeks with 100 μg of PyHsp60 DNA vaccine alone or in combination with 30 μg of pmurGMCSF. Sera from immunized mice but not from vector control groups recognized P. yoelii sporozoites, liver stages, and infected erythrocytes in an indirect fluorescent antibody test. Two weeks after the last immunization, mice were challenged with 50 P. yoelii sporozoites. In one experiment the vaccine pPyHsp60-VR1012 used in combination with pmurGMCSF gave 40% protection (Fisher's exact test; P = 0.03, vaccinated versus control groups). In a second experiment this vaccine did not protect any of the immunized mice but induced a delay in the onset of parasitemia. In neither experiment was there any evidence of a protective effect against the asexual erythrocytic stage of the life cycle. In a third experiment mice were primed with PyHsp60 DNA, were boosted 2 weeks later with 2 × 103 irradiated P. yoelii sporozoites, and were challenged several weeks later. The presence of PyHsp60 in the immunization regimen did not lead to reduced blood-stage infection or development of parasites in hepatocytes. PyHsp60 DNA vaccines were immunogenic in BALB/c mice but did not consistently, completely protect against sporozoite challenge. The observation that in some of the PyHsp60 DNA vaccine-immunized mice there was protection against infection or a delay in the onset of parasitemia after sporozoite challenge deserves further evaluation. PMID:11349057

Evaluation of Recombinant Plasmodium knowlesi Merozoite Surface Protein-133 for Detection of Human Malaria

PubMed Central

Cheong, Fei Wen; Lau, Yee Ling; Fong, Mun Yik; Mahmud, Rohela

2013-01-01

Plasmodium knowlesi is now known as the fifth Plasmodium species that can cause human malaria. The Plasmodium merozoite surface protein (MSP) has been reported to be potential target for vaccination and diagnosis of malaria. MSP-133 has been shown to be immunogenic and its T cell epitopes could mediate cellular immune protection. However, limited studies have focused on P. knowlesi MSP-133. In this study, an approximately 28-kDa recombinant P. knowlesi MSP-133 (pkMSP-133) was expressed by using an Escherichia coli system. The purified pkMSP-133 reacted with serum samples of patients infected with P. knowlesi (31 of 31, 100%) and non-P. knowlesi malaria (27 of 28, 96.43%) by Western blotting. The pkMSP-133 also reacted with P. knowlesi (25 of 31, 80.65%) and non-P. knowlesi malaria sera (20 of 28, 71.43%) in an enzyme-linked immunosorbent assay (ELISA). Most of the non-malarial infection (49 of 52 in by Western blotting and 46 of 52 in the ELISA) and healthy donor serum samples (65 of 65 by Western blotting and ELISA) did not react with recombinant pkMSP-133. PMID:23509118

An automated live imaging platform for studying merozoite egress-invasion in malaria cultures.

PubMed

Crick, Alex J; Tiffert, Teresa; Shah, Sheel M; Kotar, Jurij; Lew, Virgilio L; Cicuta, Pietro

2013-03-05

Most cases of severe and fatal malaria are caused by the intraerythrocytic asexual reproduction cycle of Plasmodium falciparum. One of the most intriguing and least understood stages in this cycle is the brief preinvasion period during which dynamic merozoite-red-cell interactions align the merozoite apex in preparation for penetration. Studies of the molecular mechanisms involved in this process face formidable technical challenges, requiring multiple observations of merozoite egress-invasion sequences in live cultures under controlled experimental conditions, using high-resolution microscopy and a variety of fluorescent imaging tools. Here we describe a first successful step in the development of a fully automated, robotic imaging platform to enable such studies. Schizont-enriched live cultures of P. falciparum were set up on an inverted stage microscope with software-controlled motorized functions. By applying a variety of imaging filters and selection criteria, we identified infected red cells that were likely to rupture imminently, and recorded their coordinates. We developed a video-image analysis to detect and automatically record merozoite egress events in 100% of the 40 egress-invasion sequences recorded in this study. We observed a substantial polymorphism of the dynamic condition of pre-egress infected cells, probably reflecting asynchronies in the diversity of confluent processes leading to merozoite release. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Genetic diversity in the C-terminus of merozoite surface protein 1 among Plasmodium knowlesi isolates from Selangor and Sabah Borneo, Malaysia.

PubMed

Yap, Nan Jiun; Goh, Xiang Ting; Koehler, Anson V; William, Timothy; Yeo, Tsin Wen; Vythilingam, Indra; Gasser, Robin B; Lim, Yvonne A L

2017-10-01

Plasmodium knowlesi, a malaria parasite of macaques, has emerged as an important parasite of humans. Despite the significance of P. knowlesi malaria in parts of Southeast Asia, very little is known about the genetic variation in this parasite. Our aim here was to explore sequence variation in a molecule called the 42kDa merozoite surface protein-1 (MSP-1), which is found on the surface of blood stages of Plasmodium spp. and plays a key role in erythrocyte invasion. Several studies of P. falciparum have reported that the C-terminus (a 42kDa fragment) of merozoite surface protein-1 (MSP-1 42 ; consisting of MSP-1 19 and MSP-1 33 ) is a potential candidate for a malaria vaccine. However, to date, no study has yet investigated the sequence diversity of the gene encoding P. knowlesi MSP-1 42 (comprising Pk-msp-1 19 and Pk-msp-1 33 ) among isolates in Malaysia. The present study explored this aspect. Twelve P. knowlesi isolates were collected from patients from hospitals in Selangor and Sabah Borneo, Malaysia, between 2012 and 2014. The Pk-msp-1 42 gene was amplified by PCR and directly sequenced. Haplotype diversity (Hd) and nucleotide diversity (л) were studied among the isolates. There was relatively high genetic variation among P. knowlesi isolates; overall Hd and л were 1±0.034 and 0.01132±0.00124, respectively. A total of nine different haplotypes related to amino acid alterations at 13 positions, and the Pk-MSP-1 19 sequence was found to be more conserved than Pk-msp-1 33 . We have found evidence for negative selection in Pk-msp- 42 as well as the 33kDa and 19kDa fragments by comparing the rate of non-synonymous versus synonymous substitutions. Future investigations should study large numbers of samples from disparate geographical locations to critically assess whether this molecule might be a potential vaccine target for P. knowlesi. Copyright © 2017 Elsevier B.V. All rights reserved.

Sequence diversity of the C-terminal region of Plasmodium falciparum merozoite surface protein 1 in southern Iran.

PubMed

Zamani, Zahra; Razavi, Mohammad Reza; Sadeghi, Sedigheh; Naddaf, Saeed; Pourfallah, Fatemeh; Mirkhani, Fatemeh; Arjmand, Mohammad; Feizhaddad, Hossein; Rad, Mina Ebrahimi; Ebrahimi Rad, Mina; Tameemi, Marzieh; Assmar, Mehdi

2009-01-01

The C-terminal region of the merozoite surface protein 1 (MSP-1) of Plasmodium falciparum is a strong vaccine candidate as it is associated with immunity to the parasite. This corresponds approximately to the conserved 17th block of the gene and is composed of two EGF- like domains. These domains exhibit only four single amino acid substitutions which show several potential variants in this region of the gene. As the variations might be important for a regional vaccine design, a study was carried out to determine the variations present in P. falciparum isolates from southern Iran. Besides the usual E-T-S-R-L and the Q-K-N-G-F types, we found Q-T-S-R-L, E-K-N-G-F, E-T-S-G-L, Z-T-S-G-L and Z-T-S-R-L types, where Z was E or Q signifying the presence of mixed clones in single isolates.

Inhibitory and blocking monoclonal antibody epitopes on merozoite surface protein 1 of the malaria parasite Plasmodium falciparum.

PubMed

Uthaipibull, C; Aufiero, B; Syed, S E; Hansen, B; Guevara Patiño, J A; Angov, E; Ling, I T; Fegeding, K; Morgan, W D; Ockenhouse, C; Birdsall, B; Feeney, J; Lyon, J A; Holder, A A

2001-04-13

Merozoite surface protein 1 (MSP-1) is a precursor to major antigens on the surface of Plasmodium spp. merozoites, which are involved in erythrocyte binding and invasion. MSP-1 is initially processed into smaller fragments; and at the time of erythrocyte invasion one of these of 42 kDa (MSP-1(42)) is subjected to a second processing, producing 33 kDa and 19 kDa fragments (MSP-1(33) and MSP-1(19)). Certain MSP-1-specific monoclonal antibodies (mAbs) react with conformational epitopes contained within the two epidermal growth factor domains that comprise MSP-1(19), and are classified as either inhibitory (inhibit processing of MSP-1(42) and erythrocyte invasion), blocking (block the binding and function of the inhibitory mAb), or neutral (neither inhibitory nor blocking). We have mapped the epitopes for inhibitory mAbs 12.8 and 12.10, and blocking mAbs such as 1E1 and 7.5 by using site-directed mutagenesis to change specific amino acid residues in MSP-1(19) and abolish antibody binding, and by using PEPSCAN to measure the reaction of the antibodies with every octapeptide within MSP-1(42). Twenty-six individual amino acid residue changes were made and the effect of each on the binding of mAbs was assessed by Western blotting and BIAcore analysis. Individual changes had either no effect, or reduced, or completely abolished the binding of individual mAbs. No two antibodies had an identical pattern of reactivity with the modified proteins. Using PEPSCAN each mAb reacted with a number of octapeptides, most of which were derived from within the first epidermal growth factor domain, although 1E1 also reacted with peptides spanning the processing site. When the single amino acid changes and the reactive peptides were mapped onto the three-dimensional structure of MSP-1(19), it was apparent that the epitopes for the mAbs could be defined more fully by using a combination of both mutagenesis and PEPSCAN than by either method alone, and differences in the fine specificity of

Limited variation in vaccine candidate Plasmodium falciparum Merozoite Surface Protein-6 over multiple transmission seasons.

PubMed

Neal, Aaron T; Jordan, Stephen J; Oliveira, Ana L; Hernandez, Jean N; Branch, Oralee H; Rayner, Julian C

2010-05-24

Plasmodium falciparum Merozoite Surface Protein-6 (PfMSP6) is a component of the complex proteinacious coat that surrounds P. falciparum merozoites. This location, and the presence of anti-PfMSP6 antibodies in P. falciparum-exposed individuals, makes PfMSP6 a potential blood stage vaccine target. However, genetic diversity has proven to be a major hurdle for vaccines targeting other blood stage P. falciparum antigens, and few endemic field studies assessing PfMSP6 gene diversity have been conducted. This study follows PfMSP6 diversity in the Peruvian Amazon from 2003 to 2006 and is the first longitudinal assessment of PfMSP6 sequence dynamics. Parasite DNA was extracted from 506 distinct P. falciparum infections spanning the transmission seasons from 2003 to 2006 as part of the Malaria Immunology and Genetics in the Amazon (MIGIA) cohort study near Iquitos, Peru. PfMSP6 was amplified from each sample using a nested PCR protocol, genotyped for allele class by agarose gel electrophoresis, and sequenced to detect diversity. Allele frequencies were analysed using JMP v.8.0.1.0 and correlated with clinical and epidemiological data collected as part of the MIGIA project. Both PfMSP6 allele classes, K1-like and 3D7-like, were detected at the study site, confirming that both are globally distributed. Allele frequencies varied significantly between transmission seasons, with 3D7-class alleles dominating and K1-class alleles nearly disappearing in 2005 and 2006. There was a significant association between allele class and village location (p-value = 0.0008), but no statistically significant association between allele class and age, sex, or symptom status. No intra-allele class sequence diversity was detected. Both PfMSP6 allele classes are globally distributed, and this study shows that allele frequencies can fluctuate significantly between communities separated by only a few kilometres, and over time in the same community. By contrast, PfMSP6 was highly stable at the

Diversity of Babesia bovis merozoite surface antigen genes in the Philippines.

PubMed

Tattiyapong, Muncharee; Sivakumar, Thillaiampalam; Ybanez, Adrian Patalinghug; Ybanez, Rochelle Haidee Daclan; Perez, Zandro Obligado; Guswanto, Azirwan; Igarashi, Ikuo; Yokoyama, Naoaki

2014-02-01

Babesia bovis is the causative agent of fatal babesiosis in cattle. In the present study, we investigated the genetic diversity of B. bovis among Philippine cattle, based on the genes that encode merozoite surface antigens (MSAs). Forty-one B. bovis-positive blood DNA samples from cattle were used to amplify the msa-1, msa-2b, and msa-2c genes. In phylogenetic analyses, the msa-1, msa-2b, and msa-2c gene sequences generated from Philippine B. bovis-positive DNA samples were found in six, three, and four different clades, respectively. All of the msa-1 and most of the msa-2b sequences were found in clades that were formed only by Philippine msa sequences in the respective phylograms. While all the msa-1 sequences from the Philippines showed similarity to those formed by Australian msa-1 sequences, the msa-2b sequences showed similarity to either Australian or Mexican msa-2b sequences. In contrast, msa-2c sequences from the Philippines were distributed across all the clades of the phylogram, although one clade was formed exclusively by Philippine msa-2c sequences. Similarities among the deduced amino acid sequences of MSA-1, MSA-2b, and MSA-2c from the Philippines were 62.2-100, 73.1-100, and 67.3-100%, respectively. The present findings demonstrate that B. bovis populations are genetically diverse in the Philippines. This information will provide a good foundation for the future design and implementation of improved immunological preventive methodologies against bovine babesiosis in the Philippines. The study has also generated a set of data that will be useful for futher understanding of the global genetic diversity of this important parasite. © 2013.

Tricomponent Immunopotentiating System as a Novel Molecular Design Strategy for Malaria Vaccine Development ▿

PubMed Central

Miyata, Takeshi; Harakuni, Tetsuya; Tsuboi, Takafumi; Sattabongkot, Jetsumon; Ikehara, Ayumu; Tachibana, Mayumi; Torii, Motomi; Matsuzaki, Goro; Arakawa, Takeshi

2011-01-01

The creation of subunit vaccines to prevent malaria infection has been hampered by the intrinsically weak immunogenicity of the recombinant antigens. We have developed a novel strategy to increase immune responses by creating genetic fusion proteins to target specific antigen-presenting cells (APCs). The fusion complex was composed of three physically linked molecular entities: (i) a vaccine antigen, (ii) a multimeric α-helical coiled-coil core, and (iii) an APC-targeting ligand linked to the core via a flexible linker. The vaccine efficacy of the tricomponent complex was evaluated using an ookinete surface protein of Plasmodium vivax, Pvs25, and merozoite surface protein-1 of Plasmodium yoelii. Immunization of mice with the tricomponent complex induced a robust antibody response and conferred substantial levels of P. vivax transmission blockade as evaluated by a membrane feed assay, as well as protection from lethal P. yoelii infection. The observed effect was strongly dependent on the presence of all three components physically integrated as a fusion complex. This system, designated the tricomponent immunopotentiating system (TIPS), onto which any recombinant protein antigens or nonproteinaceous substances could be loaded, may be a promising strategy for devising subunit vaccines or adjuvants against various infectious diseases, including malaria. PMID:21807905

Evidence that Surface Proteins Sn14 and Sn16 of Sarcocystis neurona Merozoites Are Involved in Infection and Immunity†

PubMed Central

Liang, Fang Ting; Granstrom, David E.; Zhao, Xiao Min; Timoney, John F.

1998-01-01

Sarcocystis neurona is the etiologic agent of equine protozoal myeloencephalitis (EPM). Based on an analysis of 25,000 equine serum and cerebrospinal fluid (CSF) samples, including samples from horses with neurologic signs typical of EPM or with histologically or parasitologically confirmed EPM, four major immunoblot band patterns have been identified. Twenty-three serum and CSF samples representing each of the four immunoblot patterns were selected from 220 samples from horses with neurologic signs resembling EPM and examined for inhibitory effects on the infectivity of S. neurona by an in vitro neutralization assay. A high correlation between immunoblot band pattern and neutralizing activity was detected. Two proteins, Sn14 and Sn16 (14 and 16 kDa, respectively), appeared to be important for in vitro infection. A combination of the results of surface protein labeling, immunoprecipitation, Western blotting, and trypsin digestion suggests that these molecules are surface proteins and may be useful components of a vaccine against S. neurona infection. Although S. neurona is an obligate intracellular parasite, it is potentially a target for specific antibodies which may lyse merozoites via complement or inhibit their attachment and penetration to host cells. PMID:9573058

Sarcocystis neurona Merozoites Express a Family of Immunogenic Surface Antigens That Are Orthologues of the Toxoplasma gondii Surface Antigens (SAGs) and SAG-Related Sequences†

PubMed Central

Howe, Daniel K.; Gaji, Rajshekhar Y.; Mroz-Barrett, Meaghan; Gubbels, Marc-Jan; Striepen, Boris; Stamper, Shelby

2005-01-01

Sarcocystis neurona is a member of the Apicomplexa that causes myelitis and encephalitis in horses but normally cycles between the opossum and small mammals. Analysis of an S. neurona expressed sequence tag (EST) database revealed four paralogous proteins that exhibit clear homology to the family of surface antigens (SAGs) and SAG-related sequences of Toxoplasma gondii. The primary peptide sequences of the S. neurona proteins are consistent with the two-domain structure that has been described for the T. gondii SAGs, and each was predicted to have an amino-terminal signal peptide and a carboxyl-terminal glycolipid anchor addition site, suggesting surface localization. All four proteins were confirmed to be membrane associated and displayed on the surface of S. neurona merozoites. Due to their surface localization and homology to T. gondii surface antigens, these S. neurona proteins were designated SnSAG1, SnSAG2, SnSAG3, and SnSAG4. Consistent with their homology, the SnSAGs elicited a robust immune response in infected and immunized animals, and their conserved structure further suggests that the SnSAGs similarly serve as adhesins for attachment to host cells. Whether the S. neurona SAG family is as extensive as the T. gondii SAG family remains unresolved, but it is probable that additional SnSAGs will be revealed as more S. neurona ESTs are generated. The existence of an SnSAG family in S. neurona indicates that expression of multiple related surface antigens is not unique to the ubiquitous organism T. gondii. Instead, the SAG gene family is a common trait that presumably has an essential, conserved function(s). PMID:15664946

Sarcocystis neurona merozoites express a family of immunogenic surface antigens that are orthologues of the Toxoplasma gondii surface antigens (SAGs) and SAG-related sequences.

PubMed

Howe, Daniel K; Gaji, Rajshekhar Y; Mroz-Barrett, Meaghan; Gubbels, Marc-Jan; Striepen, Boris; Stamper, Shelby

2005-02-01

Sarcocystis neurona is a member of the Apicomplexa that causes myelitis and encephalitis in horses but normally cycles between the opossum and small mammals. Analysis of an S. neurona expressed sequence tag (EST) database revealed four paralogous proteins that exhibit clear homology to the family of surface antigens (SAGs) and SAG-related sequences of Toxoplasma gondii. The primary peptide sequences of the S. neurona proteins are consistent with the two-domain structure that has been described for the T. gondii SAGs, and each was predicted to have an amino-terminal signal peptide and a carboxyl-terminal glycolipid anchor addition site, suggesting surface localization. All four proteins were confirmed to be membrane associated and displayed on the surface of S. neurona merozoites. Due to their surface localization and homology to T. gondii surface antigens, these S. neurona proteins were designated SnSAG1, SnSAG2, SnSAG3, and SnSAG4. Consistent with their homology, the SnSAGs elicited a robust immune response in infected and immunized animals, and their conserved structure further suggests that the SnSAGs similarly serve as adhesins for attachment to host cells. Whether the S. neurona SAG family is as extensive as the T. gondii SAG family remains unresolved, but it is probable that additional SnSAGs will be revealed as more S. neurona ESTs are generated. The existence of an SnSAG family in S. neurona indicates that expression of multiple related surface antigens is not unique to the ubiquitous organism T. gondii. Instead, the SAG gene family is a common trait that presumably has an essential, conserved function(s).

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Deletion of the rodent malaria ortholog for falcipain-1 highlights differences between hepatic and blood stage merozoites

PubMed Central

Lehmann, Christine; Hanson, Kirsten K.; Lin, Jing-wen; Rousseau, Kimberly; Carvalho, Filomena A.; van der Linden, Wouter A.; Santos, Nuno C.; Sinnis, Photini

2017-01-01

Proteases have been implicated in a variety of developmental processes during the malaria parasite lifecycle. In particular, invasion and egress of the parasite from the infected hepatocyte and erythrocyte, critically depend on protease activity. Although falcipain-1 was the first cysteine protease to be characterized in P. falciparum, its role in the lifecycle of the parasite has been the subject of some controversy. While an inhibitor of falcipain-1 blocked erythrocyte invasion by merozoites, two independent studies showed that falcipain-1 disruption did not affect growth of blood stage parasites. To shed light on the role of this protease over the entire Plasmodium lifecycle, we disrupted berghepain-1, its ortholog in the rodent parasite P. berghei. We found that this mutant parasite displays a pronounced delay in blood stage infection after inoculation of sporozoites. Experiments designed to pinpoint the defect of berghepain-1 knockout parasites found that it was not due to alterations in gliding motility, hepatocyte invasion or liver stage development and that injection of berghepain-1 knockout merosomes replicated the phenotype of delayed blood stage growth after sporozoite inoculation. We identified an additional role for berghepain-1 in preparing blood stage merozoites for infection of erythrocytes and observed that berghepain-1 knockout parasites exhibit a reticulocyte restriction, suggesting that berghepain-1 activity broadens the erythrocyte repertoire of the parasite. The lack of berghepain-1 expression resulted in a greater reduction in erythrocyte infectivity in hepatocyte-derived merozoites than it did in erythrocyte-derived merozoites. These observations indicate a role for berghepain-1 in processing ligands important for merozoite infectivity and provide evidence supporting the notion that hepatic and erythrocytic merozoites, though structurally similar, are not identical. PMID:28922424

Immunogenicity and protective efficacy of a recombinant yellow fever vaccine against the murine malarial parasite Plasmodium yoelii.

PubMed

Stoyanov, Cristina T; Boscardin, Silvia B; Deroubaix, Stephanie; Barba-Spaeth, Giovanna; Franco, David; Nussenzweig, Ruth S; Nussenzweig, Michel; Rice, Charles M

2010-06-23

The live-attenuated yellow fever vaccine (YF17D) is one of the safest and most effective vaccines available today. Here, YF17D was genetically altered to express the circumsporozoite protein (CSP) from the murine malarial parasite Plasmodium yoelii. Reconstituted recombinant virus was viable and exhibited robust CSP expression. Immunization of naïve mice resulted in extensive proliferation of adoptively transferred CSP-specific transgenic CD8(+) T-cells. A single immunization of naïve mice with recombinant YF17D resulted in robust production of IFN-gamma by CD8(+) T-cells and IFN-gamma and IL-2 by CD4(+) T-cells. A prime-boost regimen consisting of recombinant virus followed by a low-dose of irradiated sporozoites conferred protection against challenge with P. yoelii. Taken together, these results show that recombinant YF17D can efficiently express CSP in culture, and prime a protective immune response in vivo. (c) 2010 Elsevier Ltd. All rights reserved.

A Library of Plasmodium vivax Recombinant Merozoite Proteins Reveals New Vaccine Candidates and Protein-Protein Interactions

PubMed Central

Hostetler, Jessica B.; Sharma, Sumana; Bartholdson, S. Josefin; Wright, Gavin J.; Fairhurst, Rick M.; Rayner, Julian C.

2015-01-01

Background A vaccine targeting Plasmodium vivax will be an essential component of any comprehensive malaria elimination program, but major gaps in our understanding of P. vivax biology, including the protein-protein interactions that mediate merozoite invasion of reticulocytes, hinder the search for candidate antigens. Only one ligand-receptor interaction has been identified, that between P. vivax Duffy Binding Protein (PvDBP) and the erythrocyte Duffy Antigen Receptor for Chemokines (DARC), and strain-specific immune responses to PvDBP make it a complex vaccine target. To broaden the repertoire of potential P. vivax merozoite-stage vaccine targets, we exploited a recent breakthrough in expressing full-length ectodomains of Plasmodium proteins in a functionally-active form in mammalian cells and initiated a large-scale study of P. vivax merozoite proteins that are potentially involved in reticulocyte binding and invasion. Methodology/Principal Findings We selected 39 P. vivax proteins that are predicted to localize to the merozoite surface or invasive secretory organelles, some of which show homology to P. falciparum vaccine candidates. Of these, we were able to express 37 full-length protein ectodomains in a mammalian expression system, which has been previously used to express P. falciparum invasion ligands such as PfRH5. To establish whether the expressed proteins were correctly folded, we assessed whether they were recognized by antibodies from Cambodian patients with acute vivax malaria. IgG from these samples showed at least a two-fold change in reactivity over naïve controls in 27 of 34 antigens tested, and the majority showed heat-labile IgG immunoreactivity, suggesting the presence of conformation-sensitive epitopes and native tertiary protein structures. Using a method specifically designed to detect low-affinity, extracellular protein-protein interactions, we confirmed a predicted interaction between P. vivax 6-cysteine proteins P12 and P41, further

Longitudinal and Cross-Sectional Genetic Diversity in the Korean Peninsula Based on the P vivax Merozoite Surface Protein Gene.

PubMed

Kim, Jung-Yeon; Suh, Eun-Jung; Yu, Hyo-Soon; Jung, Hyun-Sik; Park, In-Ho; Choi, Yien-Kyeoug; Choi, Kyoung-Mi; Cho, Shin-Hyeong; Lee, Won-Ja

2011-12-01

Vivax malaria has reemerged and become endemic in Korea. Our study aimed to analyze by both longitudinal and cross-sectional genetic diversity of this malaria based on the P vivax Merozoite Surface Protein (PvMSP) gene parasites recently found in the Korean peninsula. PvMSP-1 gene sequence analysis from P vivax isolates (n = 835) during the 1996-2010 period were longitudinally analyzed and the isolates from the Korean peninsula through South Korea, the demilitarized zone and North Korea collected in 2008-2010 were enrolled in an overall analysis of MSP-1 gene diversity. New recombinant subtypes and severe multiple-cloneinfection rates were observed in recent vivax parasites. Regional variation was also observed in the study sites. This study revealed the great complexity of genetic variation and rapid dissemination of genes in P vivax. It also showed interesting patterns of diversity depending, on the region in the Korean Peninsula. Understanding the parasiteninsula. Under genetic variation may help to analyze trends and assess the extent of endemic malaria in Korea.

Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal.

PubMed

Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth; Alifrangis, Michael; Imwong, Mallika; Bhatta, Dwij Raj; Banjara, Megha Raj

2012-03-01

In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within the country or between Nepal and India. Similar prevalence of the three genotypes of Pvmsp-3alpha between the two countries likely supports the latter explanation.

The Central Role of cAMP in Regulating Plasmodium falciparum Merozoite Invasion of Human Erythrocytes

PubMed Central

More, Kunal R.; Siddiqui, Faiza Amber; Pachikara, Niseema; Ramdani, Ghania; Langsley, Gordon; Chitnis, Chetan E.

2014-01-01

All pathogenesis and death associated with Plasmodium falciparum malaria is due to parasite-infected erythrocytes. Invasion of erythrocytes by P. falciparum merozoites requires specific interactions between host receptors and parasite ligands that are localized in apical organelles called micronemes. Here, we identify cAMP as a key regulator that triggers the timely secretion of microneme proteins enabling receptor-engagement and invasion. We demonstrate that exposure of merozoites to a low K+ environment, typical of blood plasma, activates a bicarbonate-sensitive cytoplasmic adenylyl cyclase to raise cytosolic cAMP levels and activate protein kinase A, which regulates microneme secretion. We also show that cAMP regulates merozoite cytosolic Ca2+ levels via induction of an Epac pathway and demonstrate that increases in both cAMP and Ca2+ are essential to trigger microneme secretion. Our identification of the different elements in cAMP-dependent signaling pathways that regulate microneme secretion during invasion provides novel targets to inhibit blood stage parasite growth and prevent malaria. PMID:25522250

C-terminal polymorphism of Plasmodium falciparium merozoite surface protein-1 (MSP-1) from Tak Province, Thailand.

PubMed

Viputtigul, Kwanjai; Tungpukdee, Noppadon; Ruangareerate, Toon; Luplertlop, Natthanej; Wilairatana, Polrat; Gaywee, Jariyanart; Krudsood, Srivicha

2013-01-01

This study was undertaken to ascertain the extent of polymorphism in the C-terminal region of Plasmodium falciparum merozoite surface protein (MSP-1) from 119 malaria patients in Tak Province on the western border of Thailand, who were admitted to the Bangkok Hospital for Tropical Diseases, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand. P. falciparum infection was confirmed by microscopic examination of peripheral blood smears. Clinical manifestations were categorized into 2 groups: uncomplicated (94 cases) and complicated/severe (25 cases). A 1,040 basepair fragment of P. falciparum MSP-1 gene was compared with MSP-1 of reference strains retrieved from GenBank. The consensus sequences of MSP-1 block 16 showed it belonged to MAD20 genotype, which is the major allele of falciparum malaria from the western border of Thailand. MSP-1 block 16 amino acid fragment could be separated into 2 groups: similar and dissimilar to reference sequence. Four variations in MSP-1 block 16 were -1494K, D1510G, D1556N, and K1696I. MSP-1 block 16 diversity is not significantly associated with clinical manifestation although MAD 20 genotype is the predominant genotype in this area. The genetic data of MSP1 gene of faciparum malaria isolated from western Thai border contribute to the existing genetic database of Thai P. falciparum strain.

MAPK phosphotase 5 deficiency contributes to protection against blood-stage Plasmodium yoelii 17XL infection in mice.

PubMed

Cheng, Qianqian; Zhang, Qingfeng; Xu, Xindong; Yin, Lan; Sun, Lin; Lin, Xin; Dong, Chen; Pan, Weiqing

2014-04-15

Cell-mediated immunity plays a crucial role in the development of host resistance to asexual blood-stage malaria infection. However, little is known of the regulatory factors involved in this process. In this study, we investigated the impact of MAPK phosphotase 5 (MKP5) on protective immunity against a lethal Plasmodium yoelii 17XL blood-stage infection using MKP5 knockout C57BL/6 mice. Compared with wild-type control mice, MKP5 knockout mice developed significantly lower parasite burdens with prolonged survival times. We found that this phenomenon correlated with a rapid and strong IFN-γ-dependent cellular immune response during the acute phase of infection. Inactivation of IFN-γ by the administration of a neutralizing Ab significantly reduced the protective effects in MKP5 knockout mice. By analyzing IFN-γ production in innate and adaptive lymphocyte subsets, we observed that MKP5 deficiency specifically enhanced the IFN-γ response mediated by CD4+ T cells, which was attributable to the increased stimulatory capacity of splenic CD11c+ dendritic cells. Furthermore, following vaccination with whole blood-stage soluble plasmodial Ag, MKP5 knockout mice acquired strongly enhanced Ag-specific immune responses and a higher level of protection against subsequent P. yoelii 17XL challenge. Finally, we found the enhanced response mediated by MKP5 deficiency resulted in a lethal consequence in mice when infected with nonlethal P. yoelii 17XNL. Thus, our data indicate that MKP5 is a potential regulator of immune resistance against Plasmodium infection in mice, and that an understanding of the role of MKP5 in manipulating anti-malaria immunity may provide valuable information on the development of better control strategies for human malaria.

Design of magnetic polyplexes taken up efficiently by dendritic cell for enhanced DNA vaccine delivery.

PubMed

Nawwab Al-Deen, F M; Selomulya, C; Kong, Y Y; Xiang, S D; Ma, C; Coppel, R L; Plebanski, M

2014-02-01

Dendritic cells (DC) targeting vaccines require high efficiency for uptake, followed by DC activation and maturation. We used magnetic vectors comprising polyethylenimine (PEI)-coated superparamagnetic iron oxide nanoparticles, with hyaluronic acid (HA) of different molecular weights (<10 and 900 kDa) to reduce cytotoxicity and to facilitate endocytosis of particles into DCs via specific surface receptors. DNA encoding Plasmodium yoelii merozoite surface protein 1-19 and a plasmid encoding yellow fluorescent gene were added to the magnetic complexes with various % charge ratios of HA: PEI. The presence of magnetic fields significantly enhanced DC transfection and maturation. Vectors containing a high-molecular-weight HA with 100% charge ratio of HA: PEI yielded a better transfection efficiency than others. This phenomenon was attributed to their longer molecular chains and higher mucoadhesive properties aiding DNA condensation and stability. Insights gained should improve the design of more effective DNA vaccine delivery systems.

Analyses of Interactions Between Heparin and the Apical Surface Proteins of Plasmodium falciparum

NASA Astrophysics Data System (ADS)

Kobayashi, Kyousuke; Takano, Ryo; Takemae, Hitoshi; Sugi, Tatsuki; Ishiwa, Akiko; Gong, Haiyan; Recuenco, Frances C.; Iwanaga, Tatsuya; Horimoto, Taisuke; Akashi, Hiroomi; Kato, Kentaro

2013-11-01

Heparin, a sulfated glycoconjugate, reportedly inhibits the blood-stage growth of the malaria parasite Plasmodium falciparum. Elucidation of the inhibitory mechanism is valuable for developing novel invasion-blocking treatments based on heparin. Merozoite surface protein 1 has been reported as a candidate target of heparin; however, to better understand the molecular mechanisms involved, we characterized the molecules that bind to heparin during merozoite invasion. Here, we show that heparin binds only at the apical tip of the merozoite surface and that multiple heparin-binding proteins localize preferentially in the apical organelles. To identify heparin-binding proteins, parasite proteins were fractionated by means of heparin affinity chromatography and subjected to immunoblot analysis with ligand-specific antibodies. All tested members of the Duffy and reticulocyte binding-like families bound to heparin with diverse affinities. These findings suggest that heparin masks the apical surface of merozoites and blocks interaction with the erythrocyte membrane after initial attachment.

Plasmodium yoelii: induction of attenuated mutants by irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waki, S.; Yonome, I.; Suzuki, M.

When erythrocytic forms of Plasmodium yoelii nigeriensis, which is invariably fatal in mice, were exposed to X rays, the dose to reduce surviving parasites to one millionth was 100 gray (10 Krad). A suspension of 5 X 10(6) per ml of parasitized erythrocyte was irradiated at 100 gray, and 0.2 ml aliquots were inoculated into 22 mice. Eleven mice showed patent parasitemia, and in these the growth curves were less steep than that found in nonirradiated parasites. The infections of 8 mice of the 11 were self-resolving, and the attenuated feature of the parasites maintained following a limited number ofmore » blood passages. The parasites were slowly growing even in nude mice and cause self-resolving infections in intact mice. BALB/c mice immunized with the attenuated parasites were protected against subsequent challenge infections with the original virulent erythrocytic and sporogonic forms. These findings indicate that attenuated mutants of malaria parasites can be readily induced by this method.« less

Genotypic diversity of merozoite surface antigen 1 of Babesia bovis within an endemic population.

PubMed

Lau, Audrey O T; Cereceres, Karla; Palmer, Guy H; Fretwell, Debbie L; Pedroni, Monica J; Mosqueda, Juan; McElwain, Terry F

2010-08-01

Multiple genetically distinct strains of a pathogen circulate and compete for dominance within populations of animal reservoir hosts. Understanding the basis for genotypic strain structure is critical for predicting how pathogens respond to selective pressures and how shifts in pathogen population structure can lead to disease outbreaks. Evidence from related Apicomplexans such as Plasmodium, Toxoplasma, Cryptosporidium and Theileria suggests that various patterns of population dynamics exist, including but not limited to clonal, oligoclonal, panmictic and epidemic genotypic strain structures. In Babesia bovis, genetic diversity of variable merozoite surface antigen (VMSA) genes has been associated with disease outbreaks, including in previously vaccinated animals. However, the extent of VMSA diversity within a defined population in an endemic area has not been examined. We analyzed genotypic diversity and temporal change of MSA-1, a member of the VMSA family, in individual infected animals within a reservoir host population. Twenty-eight distinct MSA-1 genotypes were identified within the herd. All genotypically distinct MSA-1 sequences clustered into three groups based on sequence similarity. Two thirds of the animals tested changed their dominant MSA-1 genotypes during a 6-month period. Five animals within the population contained multiple genotypes. Interestingly, the predominant genotypes within those five animals also changed over the 6-month sampling period, suggesting ongoing transmission or emergence of variant MSA-1 genotypes within the herd. This study demonstrated an unexpected level of diversity for a single copy gene in a haploid genome, and illustrates the dynamic genotype structure of B. bovis within an individual animal in an endemic region. Co-infection with multiple diverse MSA-1 genotypes provides a basis for more extensive genotypic shifts that characterizes outbreak strains.

Plasmodium vivax merozoite surface protein-3 alpha: a high-resolution marker for genetic diversity studies.

PubMed

Prajapati, Surendra Kumar; Joshi, Hema; Valecha, Neena

2010-06-01

Malaria, an ancient human infectious disease caused by five species of Plasmodium, among them Plasmodium vivax is the most widespread human malaria species and causes huge morbidity to its host. Identification of genetic marker to resolve higher genetic diversity for an ancient origin organism is a crucial task. We have analyzed genetic diversity of P. vivax field isolates using highly polymorphic antigen gene merozoite surface protein-3 alpha (msp-3 alpha) and assessed its suitability as high-resolution genetic marker for population genetic studies. 27 P. vivax field isolates collected during chloroquine therapeutic efficacy study at Chennai were analyzed for genetic diversity. PCR-RFLP was employed to assess the genetic variations using highly polymorphic antigen gene msp-3 alpha. We observed three distinct PCR alleles at msp-3 alpha, and among them allele A showed significantly high frequency (53%, chi2 = 8.22, p = 0.001). PCR-RFLP analysis revealed 14 and 17 distinct RFLP patterns for Hha1 and Alu1 enzymes respectively. Further, RFLP analysis revealed that allele A at msp-3 alpha is more diverse in the population compared with allele B and C. Combining Hha1 and Alu1 RFLP patterns revealed 21 distinct genotypes among 22 isolates reflects higher diversity resolution power of msp-3 alpha in the field isolates. P. vivax isolates from Chennai region revealed substantial amount of genetic diversity and comparison of allelic diversity with other antigen genes and microsatellites suggesting that msp-3 alpha could be a high-resolution marker for genetic diversity studies among P. vivax field isolates.

Differing rates of antibody acquisition to merozoite antigens in malaria: implications for immunity and surveillance.

PubMed

McCallum, Fiona J; Persson, Kristina E M; Fowkes, Freya J I; Reiling, Linda; Mugyenyi, Cleopatra K; Richards, Jack S; Simpson, Julie A; Williams, Thomas N; Gilson, Paul R; Hodder, Anthony N; Sanders, Paul R; Anders, Robin F; Narum, David L; Chitnis, Chetan; Crabb, Brendan S; Marsh, Kevin; Beeson, James G

2017-04-01

Antibodies play a key role in acquired human immunity to Plasmodium falciparum (Pf) malaria and target merozoites to reduce or prevent blood-stage replication and the development of disease. Merozoites present a complex array of antigens to the immune system, and currently, there is only a partial understanding of the targets of protective antibodies and how responses to different antigens are acquired and boosted. We hypothesized that there would be differences in the rate of acquisition of antibodies to different antigens and how well they are boosted by infection, which impacts the acquisition of immunity. We examined responses to a range of merozoite antigens in 2 different cohorts of children and adults with different age structures and levels of malaria exposure. Overall, antibodies were associated with age, exposure, and active infection, and the repertoire of responses increased with age and active infection. However, rates of antibody acquisition varied between antigens and different regions within an antigen following exposure to malaria, supporting our hypothesis. Antigen-specific responses could be broadly classified into early response types in which antibodies were acquired early in childhood exposure and late response types that appear to require substantially more exposure for the development of substantial levels. We identified antigen-specific responses that were effectively boosted after recent infection, whereas other responses were not. These findings advance our understanding of the acquisition of human immunity to malaria and are relevant to the development of malaria vaccines targeting merozoite antigens and the selection of antigens for use in malaria surveillance. © Society for Leukocyte Biology.

Systematic CRISPR-Cas9-Mediated Modifications of Plasmodium yoelii ApiAP2 Genes Reveal Functional Insights into Parasite Development

PubMed Central

Zhang, Cui; Li, Zhenkui; Cui, Huiting; Jiang, Yuanyuan; Yang, Zhenke; Wang, Xu; Gao, Han; Liu, Cong; Zhang, Shujia

2017-01-01

ABSTRACT Malaria parasites have a complex life cycle with multiple developmental stages in mosquito and vertebrate hosts, and different developmental stages express unique sets of genes. Unexpectedly, many transcription factors (TFs) commonly found in eukaryotic organisms are absent in malaria parasites; instead, a family of genes encoding proteins similar to the plant Apetala2 (ApiAP2) transcription factors is expanded in the parasites. Several malaria ApiAP2 genes have been shown to play a critical role in parasite development; however, the functions of the majority of the ApiAP2 genes remain to be elucidated. In particular, no study on the Plasmodium yoelii ApiAP2 (PyApiAP2) gene family has been reported so far. This study systematically investigated the functional roles of PyApiAP2 genes in parasite development. Twenty-four of the 26 PyApiAP2 genes were selected for disruption, and 12 were successfully knocked out using the clustered regularly interspaced short palindromic repeat–CRISPR-associated protein 9 (CRISPR-Cas9) method. The effects of gene knockout (KO) on parasite development in mouse and mosquito stages were evaluated. Ten of 12 successfully disrupted genes, including two genes that have not been functionally characterized in any Plasmodium species previously, were shown to be critical for P. yoelii development of sexual and mosquito stages. Additionally, seven of the genes were labeled for protein expression analysis, revealing important information supporting their functions. This study represents the first systematic functional characterization of the P. yoelii ApiAP2 gene family and discovers important insights on the roles of the ApiAP2 genes in parasite development. PMID:29233900

CRISPR/Cas9 mediated sequential editing of genes critical for ookinete motility in Plasmodium yoelii.

PubMed

Zhang, Cui; Gao, Han; Yang, Zhenke; Jiang, Yuanyuan; Li, Zhenkui; Wang, Xu; Xiao, Bo; Su, Xin-Zhuan; Cui, Huiting; Yuan, Jing

2017-03-01

CRISPR/Cas9 has been successfully adapted for gene editing in malaria parasites including Plasmodium falciparum and Plasmodium yoelii. However, the reported methods were limited to editing one gene at a time. In practice, it is often desired to modify multiple genetic loci in a parasite genome. Here we describe a CRISPR/Cas9 mediated genome editing method that allows successive modification of more than one gene in the genome of P. yoelii using an improved single-vector system (pYCm) we developed previously. Drug resistant genes encoding human dihydrofolate reductase (hDHFR) and a yeast bifunctional protein (yFCU), with cytosine deaminase (CD) and uridyl phosphoribosyl transferase (UPRT) activities in the plasmid, allowed sequential positive (pyrimethamine, Pyr) and negative (5-fluorocytosine, 5FC) selections and generation of transgenic parasites free of the episomal plasmid after genetic modification. Using this system, we were able to efficiently tag a gene of interest (Pyp28) and subsequently disrupted two genes (Pyctrp and Pycdpk3) that are individually critical for ookinete motility. Disruption of the genes either eliminated (Pyctrp) or greatly reduced (Pycdpk3) ookinete forward motility in matrigel in vitro and completely blocked oocyst development in mosquito midgut. The method will greatly facilitate studies of parasite gene function, development, and disease pathogenesis. Copyright © 2016 Elsevier B.V. All rights reserved.

Merozoite surface protein-1 genetic diversity in Plasmodium malariae and Plasmodium brasilianum from Brazil.

PubMed

Guimarães, Lilian O; Wunderlich, Gerhard; Alves, João M P; Bueno, Marina G; Röhe, Fabio; Catão-Dias, José L; Neves, Amanda; Malafronte, Rosely S; Curado, Izilda; Domingues, Wilson; Kirchgatter, Karin

2015-11-16

The merozoite surface protein 1 (MSP1) gene encodes the major surface antigen of invasive forms of the Plasmodium erythrocytic stages and is considered a candidate vaccine antigen against malaria. Due to its polymorphisms, MSP1 is also useful for strain discrimination and consists of a good genetic marker. Sequence diversity in MSP1 has been analyzed in field isolates of three human parasites: P. falciparum, P. vivax, and P. ovale. However, the extent of variation in another human parasite, P. malariae, remains unknown. This parasite shows widespread, uneven distribution in tropical and subtropical regions throughout South America, Asia, and Africa. Interestingly, it is genetically indistinguishable from P. brasilianum, a parasite known to infect New World monkeys in Central and South America. Specific fragments (1 to 5) covering 60 % of the MSP1 gene (mainly the putatively polymorphic regions), were amplified by PCR in isolates of P. malariae and P. brasilianum from different geographic origin and hosts. Sequencing of the PCR-amplified products or cloned PCR fragments was performed and the sequences were used to construct a phylogenetic tree by the maximum likelihood method. Data were computed to give insights into the evolutionary and phylogenetic relationships of these parasites. Except for fragment 4, sequences from all other fragments consisted of unpublished sequences. The most polymorphic gene region was fragment 2, and in samples where this region lacks polymorphism, all other regions are also identical. The low variability of the P. malariae msp1 sequences of these isolates and the identification of the same haplotype in those collected many years apart at different locations is compatible with a low transmission rate. We also found greater diversity among P. brasilianum isolates compared with P. malariae ones. Lastly, the sequences were segregated according to their geographic origins and hosts, showing a strong genetic and geographic structure. Our data

Analytical modeling of the mechanics of early invasion of a merozoite into a human erythrocyte.

PubMed

Abdalrahman, Tamer; Franz, Thomas

2017-12-01

In this study, we used a continuum model based on contact mechanics to understand the mechanics of merozoite invasion into human erythrocytes. This model allows us to evaluate the indentation force and work as well as the contact pressure between the merozoite and erythrocyte for an early stage of invasion (γ = 10%). The model predicted an indentation force of 1.3e -11 N and an indentation work of 1e -18 J. The present analytical model can be considered as a useful tool not only for investigations in mechanobiology and biomechanics but also to explore novel therapeutic targets for malaria and other parasite infections.

Protein-protein interaction studies reveal the Plasmodium falciparum merozoite surface protein-1 region involved in a complex formation that binds to human erythrocytes.

PubMed

Paul, Gourab; Deshmukh, Arunaditya; Kumar Chourasia, Bishwanath; Kalamuddin, Md; Panda, Ashutosh; Kumar Singh, Susheel; Gupta, Puneet K; Mohmmed, Asif; Chauhan, Virender S; Theisen, Michael; Malhotra, Pawan

2018-03-29

Plasmodium falciparum merozoite surface protein (PfMSP) 1 has been studied extensively as a vaccine candidate antigen. PfMSP-1 undergoes proteolytic processing into four major products, such as p83, p30, p38, and p42, that are associated in the form of non-covalent complex(s) with other MSPs. To delineate MSP1 regions involved in the interaction with other MSPs, here we expressed recombinant proteins (PfMSP-1 65 ) encompassing part of p38 and p42 regions and PfMSP-1 19 PfMSP-1 65 interacted strongly with PfMSP-3, PfMSP-6, PfMSP-7, and PfMSP-9, whereas PfMSP-1 19 did not interact with any of these proteins. Since MSP-1 complex binds human erythrocytes, we examined the ability of these proteins to bind human erythrocyte. Among the proteins of MSP-1 complex, PfMSP-6 and PfMSP-9 bound to human erythrocytes. Serological studies showed that PfMSP-1 65 was frequently recognized by sera from malaria endemic regions, whereas this was not the case for PfMSP-1 19 In contrast, antibodies against PfMSP-1 19 showed much higher inhibition of merozoite invasion compared with antibodies against the larger PfMSP-1 65 fragment. Importantly, anti-PfMSP-1 19 antibodies recognized both recombinant proteins, PfMSP-1 19 and PfMSP-1 65 ; however, anti-PfMSP-1 65 antibody failed to recognize the PfMSP-1 19 protein. Taken together, these results demonstrate that PfMSP-1 sequences upstream of the 19 kDa C-terminal region are involved in molecular interactions with other MSPs, and these sequences may probably serve as a smoke screen to evade antibody response to the membrane-bound C-terminal 19 kDa region. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Arrest of Nuclear Division in Plasmodium through Blockage of Erythrocyte Surface Exposed Ribosomal Protein P2

PubMed Central

Das, Sudipta; Basu, Himanish; Korde, Reshma; Tewari, Rita; Sharma, Shobhona

2012-01-01

Malaria parasites reside inside erythrocytes and the disease manifestations are linked to the growth inside infected erythrocytes (IE). The growth of the parasite is mostly confined to the trophozoite stage during which nuclear division occurs followed by the formation of cell bodies (schizogony). The mechanism and regulation of schizogony are poorly understood. Here we show a novel role for a Plasmodium falciparum 60S stalk ribosomal acidic protein P2 (PfP2) (PFC0400w), which gets exported to the IE surface for 6–8 hrs during early schizogony, starting around 26–28 hrs post-merozoite invasion. The surface exposure is demonstrated using multiple PfP2-specific monoclonal antibodies, and is confirmed through transfection using PfP2-GFP. The IE surface-exposed PfP2-protein occurs mainly as SDS-resistant P2-homo-tetramers. Treatment with anti-PfP2 monoclonals causes arrest of IEs at the first nuclear division. Upon removal of the antibodies, about 80–85% of synchronized parasites can be released even after 24 hrs of antibody treatment. It has been reported that a tubovesicular network (TVN) is set up in early trophozoites which is used for nutrient import. Anti-P2 monoclonal antibodies cause a complete fragmentation of TVN by 36 hrs, and impairs lipid import in IEs. These may be downstream causes for the cell-cycle arrest. Upon antibody removal, the TVN is reconstituted, and the cell division progresses. Each of the above properties is observed in the rodent malaria parasite species P. yoelii and P. berghei. The translocation of the P2 protein to the IE surface is therefore likely to be of fundamental importance in Plasmodium cell division. PMID:22912579

Rapid identification of genes controlling virulence and immunity in malaria parasites

PubMed Central

Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab

2017-01-01

Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525

Passive transfer of growth-inhibitory antibodies raised against yeast-expressed recombinant Plasmodium falciparum merozoite surface protein-1(19).

PubMed

Gozalo, A; Lucas, C; Cachay, M; Wellde, B T; Hall, T; Bell, B; Wood, J; Watts, D; Wooster, M; Lyon, J A; Moch, J K; Haynes, J D; Williams, J S; Holland, C; Watson, E; Kester, K E; Kaslow, D C; Ballou, W R

1998-12-01

Purified rabbit immunoglobulin raised against yeast-expressed recombinant FVO or 3D7 Plasmodium falciparum merozoite surface protein-1 (MSP-1) 19k-D C terminal fragment (MSP-1(19)) was transfused into malaria-naive Aotus nancymai monkeys that were immediately challenged with FVO asexual stage malaria parasites. Control monkeys received rabbit immunoglobulin raised against the sexual stage antigen Pfs25 or Aotus hyperimmune serum obtained from monkeys immunized by P. falciparum infection and drug cure. Passive transfer of rabbit anti-MSP-1(19) failed to protect against homologous or heterologous challenge and, when compared with negative controls, there were no differences in prepatent periods or time to treatment. Interestingly, rabbit anti-MSP-1(19), but not anti-Pfs25, immunoglobulin, and immune monkey serum prevented the development of antibodies directed against MSP-1(19) fragment by infected monkeys, indicating that the antibodies were reactive with native MSP-1(19) antigen in vivo. The prepatent period and time to treatment was greatly delayed in the two monkeys that received Aotus immune serum, both of which developed a chronic intermittent low level infection. In vitro parasite growth inhibition assays (GIAs) confirmed the presence of inhibitory activity (40% maximum inhibition) in concentrated anti-MSP-1(19) immunoglobulin (4.8 mg/ml), but the peak concentrations we achieved in vivo (1 mg/ml) were not inhibitory in vitro. Subinhibitory levels of anti-MSP-1(19) antibodies achieved by passive transfer were not protective against P. falciparum challenge.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the

Genetic Diversity and Natural Selection in 42 kDa Region of Plasmodium vivax Merozoite Surface Protein-1 from China-Myanmar Endemic Border.

PubMed

Zhou, Xia; Tambo, Ernest; Su, Jing; Fang, Qiang; Ruan, Wei; Chen, Jun-Hu; Yin, Ming-Bo; Zhou, Xiao-Nong

2017-10-01

Plasmodium vivax merozoite surface protein-1 (PvMSP1) gene codes for a major malaria vaccine candidate antigen. However, its polymorphic nature represents an obstacle to the design of a protective vaccine. In this study, we analyzed the genetic polymorphism and natural selection of the C-terminal 42 kDa fragment within PvMSP1 gene (Pv MSP142) from 77 P. vivax isolates, collected from imported cases of China-Myanmar border (CMB) areas in Yunnan province and the inland cases from Anhui, Yunnan, and Zhejiang province in China during 2009-2012. Totally, 41 haplotypes were identified and 30 of them were new haplotypes. The differences between the rates of non-synonymous and synonymous mutations suggest that PvMSP142 has evolved under natural selection, and a high selective pressure preferentially acted on regions identified of PvMSP133. Our results also demonstrated that PvMSP142 of P. vivax isolates collected on China-Myanmar border areas display higher genetic polymorphisms than those collected from inland of China. Such results have significant implications for understanding the dynamic of the P. vivax population and may be useful information towards China malaria elimination campaign strategies.

Genetic diversity and antigenicity variation of Babesia bovis merozoite surface antigen-1 (MSA-1) in Thailand.

PubMed

Tattiyapong, Muncharee; Sivakumar, Thillaiampalam; Takemae, Hitoshi; Simking, Pacharathon; Jittapalapong, Sathaporn; Igarashi, Ikuo; Yokoyama, Naoaki

2016-07-01

Babesia bovis, an intraerythrocytic protozoan parasite, causes severe clinical disease in cattle worldwide. The genetic diversity of parasite antigens often results in different immune profiles in infected animals, hindering efforts to develop immune control methodologies against the B. bovis infection. In this study, we analyzed the genetic diversity of the merozoite surface antigen-1 (msa-1) gene using 162 B. bovis-positive blood DNA samples sourced from cattle populations reared in different geographical regions of Thailand. The identity scores shared among 93 msa-1 gene sequences isolated by PCR amplification were 43.5-100%, and the similarity values among the translated amino acid sequences were 42.8-100%. Of 23 total clades detected in our phylogenetic analysis, Thai msa-1 gene sequences occurred in 18 clades; seven among them were composed of sequences exclusively from Thailand. To investigate differential antigenicity of isolated MSA-1 proteins, we expressed and purified eight recombinant MSA-1 (rMSA-1) proteins, including an rMSA-1 from B. bovis Texas (T2Bo) strain and seven rMSA-1 proteins based on the Thai msa-1 sequences. When these antigens were analyzed in a western blot assay, anti-T2Bo cattle serum strongly reacted with the rMSA-1 from T2Bo, as well as with three other rMSA-1 proteins that shared 54.9-68.4% sequence similarity with T2Bo MSA-1. In contrast, no or weak reactivity was observed for the remaining rMSA-1 proteins, which shared low sequence similarity (35.0-39.7%) with T2Bo MSA-1. While demonstrating the high genetic diversity of the B. bovis msa-1 gene in Thailand, the present findings suggest that the genetic diversity results in antigenicity variations among the MSA-1 antigens of B. bovis in Thailand. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymorphism of the Pv200L Fragment of Merozoite Surface Protein-1 of Plasmodium vivax in Clinical Isolates from the Pacific Coast of Colombia

PubMed Central

Valderrama-Aguirre, Augusto; Zúñiga-Soto, Evelin; Mariño-Ramírez, Leonardo; Moreno, Luz Ángela; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Merozoite surface protein 1 (MSP-1) is a polymorphic malaria protein with functional domains involved in parasite erythrocyte interaction. Plasmodium vivax MSP-1 has a fragment (Pv200L) that has been identified as a potential subunit vaccine because it is highly immunogenic and induces partial protection against infectious parasite challenge in vaccinated monkeys. To determine the extent of genetic polymorphism and its effect on the translated protein, we sequenced the Pv200L coding region from isolates of 26 P. vivax-infected patients in a malaria-endemic area of Colombia. The extent of nucleotide diversity (π) in these isolates (0.061 ± 0.004) was significantly lower (P ≤ 0.001) than that observed in Thai and Brazilian isolates; 0.083 ± 0.006 and 0.090 ± 0.006, respectively. We found two new alleles and several previously unidentified dimorphic substitutions and significant size polymorphism. The presence of highly conserved blocks in this fragment has important implications for the development of Pv200L as a subunit vaccine candidate. PMID:21292880

A polyvalent hybrid protein elicits antibodies against the diverse allelic types of block 2 in Plasmodium falciparum merozoite surface protein 1.

PubMed

Tetteh, Kevin K A; Conway, David J

2011-10-13

Merozoite surface protein 1 (MSP1) of Plasmodium falciparum has been implicated as an important target of acquired immunity, and candidate components for a vaccine include polymorphic epitopes in the N-terminal polymorphic block 2 region. We designed a polyvalent hybrid recombinant protein incorporating sequences of the three major allelic types of block 2 together with a composite repeat sequence of one of the types and N-terminal flanking T cell epitopes, and compared this with a series of recombinant proteins containing modular sub-components and similarly expressed in Escherichia coli. Immunogenicity of the full polyvalent hybrid protein was tested in both mice and rabbits, and comparative immunogenicity studies of the sub-component modules were performed in mice. The full hybrid protein induced high titre antibodies against each of the major block 2 allelic types expressed as separate recombinant proteins and against a wide range of allelic types naturally expressed by a panel of diverse P. falciparum isolates, while the sub-component modules had partial antigenic coverage as expected. This encourages further development and evaluation of the full MSP1 block 2 polyvalent hybrid protein as a candidate blood-stage component of a malaria vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

Comparison of allele frequencies of Plasmodium falciparum merozoite antigens in malaria infections sampled in different years in a Kenyan population.

PubMed

Ochola-Oyier, Lynette Isabella; Okombo, John; Wagatua, Njoroge; Ochieng, Jacob; Tetteh, Kevin K; Fegan, Greg; Bejon, Philip; Marsh, Kevin

2016-05-06

Plasmodium falciparum merozoite antigens elicit antibody responses in malaria-endemic populations, some of which are clinically protective, which is one of the reasons why merozoite antigens are the focus of malaria vaccine development efforts. Polymorphisms in several merozoite antigen-encoding genes are thought to arise as a result of selection by the human immune system. The allele frequency distribution of 15 merozoite antigens over a two-year period, 2007 and 2008, was examined in parasites obtained from children with uncomplicated malaria. In the same population, allele frequency changes pre- and post-anti-malarial treatment were also examined. Any gene which showed a significant shift in allele frequencies was also assessed longitudinally in asymptomatic and complicated malaria infections. Fluctuating allele frequencies were identified in codons 147 and 148 of reticulocyte-binding homologue (Rh) 5, with a shift from HD to YH haplotypes over the two-year period in uncomplicated malaria infections. However, in both the asymptomatic and complicated malaria infections YH was the dominant and stable haplotype over the two-year and ten-year periods, respectively. A logistic regression analysis of all three malaria infection populations between 2007 and 2009 revealed, that the chance of being infected with the HD haplotype decreased with time from 2007 to 2009 and increased in the uncomplicated and asymptomatic infections. Rh5 codons 147 and 148 showed heterogeneity at both an individual and population level and may be under some degree of immune selection.

Genetic diversity of merozoite surface antigens in Babesia bovis detected from Sri Lankan cattle.

PubMed

Sivakumar, Thillaiampalam; Okubo, Kazuhiro; Igarashi, Ikuo; de Silva, Weligodage Kumarawansa; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Vimalakumar, Singarayar Caniciyas; Meewewa, Asela Sanjeewa; Yokoyama, Naoaki

2013-10-01

Babesia bovis, the causative agent of severe bovine babesiosis, is endemic in Sri Lanka. The live attenuated vaccine (K-strain), which was introduced in the early 1990s, has been used to immunize cattle populations in endemic areas of the country. The present study was undertaken to determine the genetic diversity of merozoite surface antigens (MSAs) in B. bovis isolates from Sri Lankan cattle, and to compare the gene sequences obtained from such isolates against those of the K-strain. Forty-four bovine blood samples isolated from different geographical regions of Sri Lanka and judged to be B. bovis-positive by PCR screening were used to amplify MSAs (MSA-1, MSA-2c, MSA-2a1, MSA-2a2, and MSA-2b), AMA-1, and 12D3 genes from parasite DNA. Although the AMA-1 and 12D3 gene sequences were highly conserved among the Sri Lankan isolates, the MSA gene sequences from the same isolates were highly diverse. Sri Lankan MSA-1, MSA-2c, MSA-2a1, MSA-2a2, and MSA-2b sequences clustered within 5, 2, 4, 1, and 9 different clades in the gene phylograms, respectively, while the minimum similarity values among the deduced amino acid sequences of these genes were 36.8%, 68.7%, 80.3%, 100%, and 68.3%, respectively. In the phylograms, none of the Sri Lankan sequences fell within clades containing the respective K-strain sequences. Additionally, the similarity values for MSA-1 and MSA-2c were 40-61.8% and 90.9-93.2% between the Sri Lankan isolates and the K-strain, respectively, while the K-strain MSA-2a/b sequence shared 64.5-69.8%, 69.3%, and 70.5-80.3% similarities with the Sri Lankan MSA-2a1, MSA-2a2, and MSA-2b sequences, respectively. The present study has shown that genetic diversity among MSAs of Sri Lankan B. bovis isolates is very high, and that the sequences of field isolates diverged genetically from the K-strain. Copyright © 2013 Elsevier B.V. All rights reserved.

Interactions between the intestinal flagellates Giardia muris and Spironucleus muris and the blood parasites Babesia microti, Plasmodium yoelii and Plasmodium berghei in mice.

PubMed

Brett, S J; Cox, F E

1982-08-01

In mice infected with the intestinal flagellates Giardia muris or Spironucleus muris, together with the blood parasites Babesia microti or Plasmodium yoelii, there is a temporary decrease of flagellate cyst output coincident with the peak of the blood parasite infections, followed by a rapid return to normal levels. This decrease in cyst output is correlated with decreased numbers of trophozoites in the small intestine. The effect on S. muris is more marked than that on G. muris. Neither blood parasites has any effect on the total duration of the flagellate infection and the flagellates do not affect the blood parasites. In mice infected with G. muris or S. muris and P. berghei there is also a decrease in cyst output but this is less apparent than in infections with B. microti or P. yoelii because of the fatal nature of the P. berghei infection. It is suggested that the decrease in cyst output is probably due to changes in the contents of the small intestine or to non-specific immunological factors rather than to specific immunological changes.

Sarcocyst Development in Raccoons (Procyon lotor) Inoculated with Different Strains of Sarcocystis neurona Culture-Derived Merozoites.

PubMed

Dryburgh, E L; Marsh, A E; Dubey, J P; Howe, D K; Reed, S M; Bolten, K E; Pei, W; Saville, W J A

2015-08-01

Sarcocystis neurona is considered the major etiologic agent of equine protozoal myeloencephalitis (EPM), a neurological disease in horses. Raccoon ( Procyon lotor ) is considered the most important intermediate host in the life cycle of S. neurona in the United States; S. neurona sarcocysts do mature in raccoon muscles, and raccoons also develop clinical signs simulating EPM. The focus of this study was to determine if sarcocysts would develop in raccoons experimentally inoculated with different host-derived strains of in vitro-cultivated S. neurona merozoites. Four raccoons were inoculated with strains derived from a raccoon, a sea otter, a cat, and a horse. Raccoon tissues were fed to laboratory-raised opossums ( Didelphis virginiana ), the definitive host of S. neurona . Intestinal scraping revealed sporocysts in opossums who received muscle tissue from raccoons inoculated with the raccoon-derived or the sea otter-derived isolates. These results demonstrate that sarcocysts can mature in raccoons inoculated with in vitro-derived S. neurona merozoites. In contrast, the horse and cat-derived isolates did not produce microscopically or biologically detected sarcocysts. Immunoblot analysis revealed both antigenic and antibody differences when testing the inoculated raccoons. Immunohistochemical staining indicated differences in staining between the merozoite and sarcocyst stages. The successful infections achieved in this study indicates that the life cycle can be manipulated in the laboratory without affecting subsequent stage development, thereby allowing further purification of strains and artificial maintenance of the life cycle.

Identification and characterization of epitopes on Plasmodium knowlesi merozoite surface protein-142 (MSP-142) using synthetic peptide library and phage display library.

PubMed

Cheong, Fei Wen; Fong, Mun Yik; Lau, Yee Ling

2016-02-01

Plasmodium knowlesi can cause potentially life threatening human malaria. The Plasmodium merozoite surface protein-142 (MSP-142) is a potential target for malaria blood stage vaccine, and for diagnosis of malaria. Two epitope mapping techniques were used to identify the potential epitopes within P. knowlesi MSP-142. Nine and 14 potential epitopes were identified using overlapping synthetic peptide library and phage display library, respectively. Two regions on P. knowlesi MSP-142 (amino acid residues 37-95 and residues 240-289) were identified to be the potential dominant epitope regions. Two of the prominent epitopes, P10 (TAKDGMEYYNKMGELYKQ) and P31 (RCLLGFKEVGGKCVPASI), were evaluated using mouse model. P10- and P31-immunized mouse sera reacted with recombinant P. knowlesi MSP-142, with the IgG isotype distribution of IgG2b>IgG1>IgG2a>IgG3. Significant higher level of cytokines interferon-gamma and interleukin-2 was detected in P31-immunized mice. Both P10 and P31 could be the suitable epitope candidates to be used in malaria vaccine designs and immunodiagnostic assays, provided further evaluation is needed to validate the potential uses of these epitopes. Copyright © 2015 Elsevier B.V. All rights reserved.

CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

PubMed Central

Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

1999-01-01

Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

Genetic Diversity of Plasmodium falciparum Field Isolates in Central Sudan Inferred by PCR Genotyping of Merozoite Surface Protein 1 and 2.

PubMed

Hamid, Muzamil M Abdel; Mohammed, Sara B; El Hassan, Ibrahim M

2013-02-01

Characterization of Plasmodium falciparum diversity is commonly achieved by amplification of the polymorphic regions of the merozoite surface proteins 1 (MSP1) and 2 (MSP2) genes. The present study aimed to determine the allelic variants distribution of MSP1 and MSP2 and multiplicity of infection in P. falciparum field isolates from Kosti, central Sudan, an area characterized by seasonal malaria transmission. Total 121 samples (N = 121) were collected during a cross-sectional survey between March and April 2003. DNA was extracted and MSP1 and MSP2 polymorphic loci were genotyped. The total number of alleles identified in MSP1 block 2 was 11, while 16 alleles were observed in MSP2 block 3. In MSP1, RO33 was found to be the predominant allelic type, carried alone or in combination with MAD20 and K1 types, whereas FC27 family was the most prevalent in MSP2. Sixty two percent of isolates had multiple genotypes and the overall mean multiplicity of infection was 1.93 (CI 95% 1.66-2.20). Age correlated with parasite density (P = 0.017). In addition, a positive correlation was observed between parasite densities and the number of alleles (P = 0.022). Genetic diversity in P. falciparum field isolates in central Sudan was high and consisted of multiple clones.

Genetic diversity in the merozoite surface protein 1 and 2 genes of Plasmodium falciparum from the Artibonite Valley of Haiti.

PubMed

Londono-Renteria, Berlin; Eisele, Thomas P; Keating, Joseph; Bennett, Adam; Krogstad, Donald J

2012-01-01

Describing genetic diversity of the Plasmodium falciparum parasite provides important information about the local epidemiology of malaria. In this study, we examined the genetic diversity of P. falciparum isolates from the Artibonite Valley in Haiti using the allelic families of merozoite surface protein 1 and 2 genes (msp-1 and msp-2). The majority of study subjects infected with P. falciparum had a single parasite genotype (56% for msp-1 and 69% for msp-2: n=79); 9 distinct msp-1 genotypes were identified by size differences on agarose gels. K1 was the most polymorphic allelic family with 5 genotypes (amplicons from 100 to 300 base pairs [bp]); RO33 was the least polymorphic, with a single genotype (120-bp). Although both msp-2 alleles (3D7/IC1, FC27) had similar number of genotypes (n=4), 3D7/IC1 was more frequent (85% vs. 26%). All samples were screened for the presence of the K76T mutation on the P. falciparum chloroquine resistance transporter (pfcrt) gene with 10 of 79 samples positive. Of the 2 (out of 10) samples from individuals follow-up for 21 days, P. falciparum parasites were present through day 7 after treatment with chloroquine. No parasites were found on day 21. Our results suggest that the level of genetic diversity is low in this area of Haiti, which is consistent with an area of low transmission. Copyright © 2011 Elsevier B.V. All rights reserved.

Diversity and population structure of Plasmodium falciparum in Thailand based on the spatial and temporal haplotype patterns of the C-terminal 19-kDa domain of merozoite surface protein-1.

PubMed

Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Siripoon, Napaporn; Seugorn, Aree; Kaewthamasorn, Morakot; Butcher, Robert D J; Harnyuttanakorn, Pongchai

2014-02-12

The 19-kDa C-terminal region of the merozoite surface protein-1 of the human malaria parasite Plasmodium falciparum (PfMSP-119) constitutes the major component on the surface of merozoites and is considered as one of the leading candidates for asexual blood stage vaccines. Because the protein exhibits a level of sequence variation that may compromise the effectiveness of a vaccine, the global sequence diversity of PfMSP-119 has been subjected to extensive research, especially in malaria endemic areas. In Thailand, PfMSP-119 sequences have been derived from a single parasite population in Tak province, located along the Thailand-Myanmar border, since 1995. However, the extent of sequence variation and the spatiotemporal patterns of the MSP-119 haplotypes along the Thai borders with Laos and Cambodia are unknown. Sixty-three isolates of P. falciparum from five geographically isolated populations along the Thai borders with Myanmar, Laos and Cambodia in three transmission seasons between 2002 and 2008 were collected and culture-adapted. The msp-1 gene block 17 was sequenced and analysed for the allelic diversity, frequency and distribution patterns of PfMSP-119 haplotypes in individual populations. The PfMSP-119 haplotype patterns were then compared between parasite populations to infer the population structure and genetic differentiation of the malaria parasite. Five conserved polymorphic positions, which accounted for five distinct haplotypes, of PfMSP-119 were identified. Differences in the prevalence of PfMSP-119 haplotypes were detected in different geographical regions, with the highest levels of genetic diversity being found in the Kanchanaburi and Ranong provinces along the Thailand-Myanmar border and Trat province located at the Thailand-Cambodia border. Despite this variability, the distribution patterns of individual PfMSP-119 haplotypes seemed to be very similar across the country and over the three malarial transmission seasons, suggesting that gene flow

Susceptibility to Plasmodium yoelii Preerythrocytic Infection in BALB/c Substrains Is Determined at the Point of Hepatocyte Invasion

PubMed Central

Kaushansky, Alexis; Austin, Laura S.; Mikolajczak, Sebastian A.; Lo, Fang Y.; Miller, Jessica L.; Douglass, Alyse N.; Arang, Nadia; Vaughan, Ashley M.; Gardner, Malcolm J.

2014-01-01

After transmission by Anopheles mosquitoes, Plasmodium sporozoites travel to the liver, infect hepatocytes, and rapidly develop as intrahepatocytic liver stages (LS). Rodent models of malaria exhibit large differences in the magnitude of liver infection, both between parasite species and between strains of mice. This has been mainly attributed to differences in innate immune responses and parasite infectivity. Here, we report that BALB/cByJ mice are more susceptible to Plasmodium yoelii preerythrocytic infection than BALB/cJ mice. This difference occurs at the level of early hepatocyte infection, but expression levels of reported host factors that are involved in infection do not correlate with susceptibility. Interestingly, BALB/cByJ hepatocytes are more frequently polyploid; thus, their susceptibility converges on the previously observed preference of sporozoites to infect polyploid hepatocytes. Gene expression analysis demonstrates hepatocyte-specific differences in mRNA abundance for numerous genes between BALB/cByJ and BALB/cJ mice, some of which encode hepatocyte surface molecules. These data suggest that a yet-unknown receptor for sporozoite infection, present at elevated levels on BALB/cByJ hepatocytes and also polyploid hepatocytes, might facilitate Plasmodium liver infection. PMID:25312960

New malaria vaccine candidates based on the Plasmodium vivax Merozoite Surface Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC flagellin.

PubMed

Bargieri, Daniel Y; Rosa, Daniela S; Braga, Catarina J M; Carvalho, Bruna O; Costa, Fabio T M; Espíndola, Noeli Maria; Vaz, Adelaide José; Soares, Irene S; Ferreira, Luis C S; Rodrigues, Mauricio M

2008-11-11

The present study evaluated the immunogenicity of new malaria vaccine formulations based on the 19kDa C-terminal fragment of Plasmodium vivax Merozoite Surface Protein-1 (MSP1(19)) and the Salmonella enterica serovar Typhimurium flagellin (FliC), a Toll-like receptor 5 (TLR5) agonist. FliC was used as an adjuvant either admixed or genetically linked to the P. vivax MSP1(19) and administered to C57BL/6 mice via parenteral (s.c.) or mucosal (i.n.) routes. The recombinant fusion protein preserved MSP1(19) epitopes recognized by sera collected from P. vivax infected humans and TLR5 agonist activity. Mice parenterally immunized with recombinant P. vivax MSP1(19) in the presence of FliC, either admixed or genetically linked, elicited strong and long-lasting MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass response. Incorporation of another TLR agonist, CpG ODN 1826, resulted in a more balanced response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response measured by interferon-gamma secretion. Finally, we show that MSP1(19)-specific antibodies recognized the native protein expressed on the surface of P. vivax parasites harvested from infected humans. The present report proposes a new class of malaria vaccine formulation based on the use of malarial antigens and the innate immunity agonist FliC. It contains intrinsic adjuvant properties and enhanced ability to induce specific humoral and cellular immune responses when administered alone or in combination with other adjuvants.

The genetic diversity of merozoite surface antigen 1 (MSA-1) among Babesia bovis detected from cattle populations in Thailand, Brazil and Ghana.

PubMed

Nagano, Daisuke; Sivakumar, Thillaiampalam; De De Macedo, Alane Caine Costa; Inpankaew, Tawin; Alhassan, Andy; Igarashi, Ikuo; Yokoyama, Naoaki

2013-11-01

In the present study, we screened blood DNA samples obtained from cattle bred in Brazil (n=164) and Ghana (n=80) for Babesia bovis using a diagnostic PCR assay and found prevalences of 14.6% and 46.3%, respectively. Subsequently, the genetic diversity of B. bovis in Thailand, Brazil and Ghana was analyzed, based on the DNA sequence of merozoite surface antigen-1 (MSA-1). In Thailand, MSA-1 sequences were relatively conserved and found in a single clade of the phylogram, while Brazilian MSA-1 sequences showed high genetic diversity and were dispersed across three different clades. In contrast, the sequences from Ghanaian samples were detected in two different clades, one of which contained only a single Ghanaian sequence. The identities among the MSA-1 sequences from Thailand, Brazil and Ghana were 99.0-100%, 57.5-99.4% and 60.3-100%, respectively, while the similarities among the deduced MSA-1 amino acid sequences within the respective countries were 98.4-100%, 59.4-99.7% and 58.7-100%, respectively. These observations suggested that the genetic diversity of B. bovis based on MSA-1 sequences was higher in Brazil and Ghana than in Thailand. The current data highlight the importance of conducting extensive studies on the genetic diversity of B. bovis before designing immune control strategies in each surveyed country.

Antibody Responses to a Novel Plasmodium falciparum Merozoite Surface Protein Vaccine Correlate with Protection against Experimental Malaria Infection in Aotus Monkeys

PubMed Central

Cavanagh, David R.; Kocken, Clemens H. M.; White, John H.; Cowan, Graeme J. M.; Samuel, Kay; Dubbeld, Martin A.; der Wel, Annemarie Voorberg-van; Thomas, Alan W.; McBride, Jana S.; Arnot, David E.

2014-01-01

The Block 2 region of the merozoite surface protein-1 (MSP-1) of Plasmodium falciparum has been identified as a target of protective immunity by a combination of seroepidemiology and parasite population genetics. Immunogenicity studies in small animals and Aotus monkeys were used to determine the efficacy of recombinant antigens derived from this region of MSP-1 as a potential vaccine antigen. Aotus lemurinus griseimembra monkeys were immunized three times with a recombinant antigen derived from the Block 2 region of MSP-1 of the monkey-adapted challenge strain, FVO of Plasmodium falciparum, using an adjuvant suitable for use in humans. Immunofluorescent antibody assays (IFA) against erythrocytes infected with P. falciparum using sera from the immunized monkeys showed that the MSP-1 Block 2 antigen induced significant antibody responses to whole malaria parasites. MSP-1 Block 2 antigen-specific enzyme-linked immunosorbent assays (ELISA) showed no significant differences in antibody titers between immunized animals. Immunized animals were challenged with the virulent P. falciparum FVO isolate and monitored for 21 days. Two out of four immunized animals were able to control their parasitaemia during the follow-up period, whereas two out of two controls developed fulminating parasitemia. Parasite-specific serum antibody titers measured by IFA were four-fold higher in protected animals than in unprotected animals. In addition, peptide-based epitope mapping of serum antibodies from immunized Aotus showed distinct differences in epitope specificities between protected and unprotected animals. PMID:24421900

Genetic variations in merozoite surface antigen genes of Babesia bovis detected in Vietnamese cattle and water buffaloes.

PubMed

Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Tuvshintulga, Bumduuren; Hayashida, Kyoko; Igarashi, Ikuo; Inoue, Noboru; Long, Phung Thang; Lan, Dinh Thi Bich

2015-03-01

The genes that encode merozoite surface antigens (MSAs) in Babesia bovis are genetically diverse. In this study, we analyzed the genetic diversity of B. bovis MSA-1, MSA-2b, and MSA-2c genes in Vietnamese cattle and water buffaloes. Blood DNA samples from 258 cattle and 49 water buffaloes reared in the Thua Thien Hue province of Vietnam were screened with a B. bovis-specific diagnostic PCR assay. The B. bovis-positive DNA samples (23 cattle and 16 water buffaloes) were then subjected to PCR assays to amplify the MSA-1, MSA-2b, and MSA-2c genes. Sequencing analyses showed that the Vietnamese MSA-1 and MSA-2b sequences are genetically diverse, whereas MSA-2c is relatively conserved. The nucleotide identity values for these MSA gene sequences were similar in the cattle and water buffaloes. Consistent with the sequencing data, the Vietnamese MSA-1 and MSA-2b sequences were dispersed across several clades in the corresponding phylogenetic trees, whereas the MSA-2c sequences occurred in a single clade. Cattle- and water-buffalo-derived sequences also often clustered together on the phylogenetic trees. The Vietnamese MSA-1, MSA-2b, and MSA-2c sequences were then screened for recombination with automated methods. Of the seven recombination events detected, five and two were associated with the MSA-2b and MSA-2c recombinant sequences, respectively, whereas no MSA-1 recombinants were detected among the sequences analyzed. Recombination between the sequences derived from cattle and water buffaloes was very common, and the resultant recombinant sequences were found in both host animals. These data indicate that the genetic diversity of the MSA sequences does not differ between cattle and water buffaloes in Vietnam. They also suggest that recombination between the B. bovis MSA sequences in both cattle and water buffaloes might contribute to the genetic variation in these genes in Vietnam. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic diversity of Plasmodium falciparum isolates from naturally infected children in north-central Nigeria using the merozoite surface protein-2 as molecular marker.

PubMed

Oyedeji, Segun Isaac; Awobode, Henrietta Oluwatoyin; Anumudu, Chiaka; Kun, Jürgen

2013-08-01

To characterize the genetic diversity of Plasmodium falciparum (P. falciparum) field isolates in children from Lafia, North-central Nigeria, using the highly polymorphic P. falciparum merozoite surface protein 2 (MSP-2) gene as molecular marker. Three hundred and twenty children were enrolled into the study between 2005 and 2006. These included 140 children who presented with uncomplicated malaria at the Dalhatu Araf Specialist Hospital, Lafia and another 180 children from the study area with asymptomatic infection. DNA was extracted from blood spot on filter paper and MSP-2 genes were genotyped using allele-specific nested PCR in order to analyze the genetic diversity of parasite isolates. A total of 31 and 34 distinct MSP-2 alleles were identified in the asymptomatic and uncomplicated malaria groups respectively. No difference was found between the multiplicity of infection in the asymptomatic group and that of the uncomplicated malaria group (P>0.05). However, isolates of the FC27 allele type were dominant in the asymptomatic group whereas isolates of the 3D7 allele type were dominant in the uncomplicated malaria group. This study showed a high genetic diversity of P. falciparum isolates in North-central Nigeria and is comparable to reports from similar areas with high malaria transmission intensity. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Binding of aldolase and glyceraldehyde-3-phosphate dehydrogenase to the cytoplasmic tails of Plasmodium falciparum merozoite duffy binding-like and reticulocyte homology ligands.

PubMed

Pal-Bhowmick, Ipsita; Andersen, John; Srinivasan, Prakash; Narum, David L; Bosch, Jürgen; Miller, Louis H

2012-01-01

Invasion of erythrocytes by Plasmodium falciparum requires a connection between the cytoplasmic tail of the parasite's ligands for its erythrocyte receptors and the actin-myosin motor of the parasite. For the thromobospondin-related anonymous protein (TRAP) ligand on Plasmodium sporozoites, aldolase forms this connection and requires tryptophan and negatively charged amino acids in the ligand's cytoplasmic tail. Because of the importance of the Duffy binding-like (DBL) and the reticulocyte homology (RH) ligand families in erythrocyte binding and merozoite invasion, we characterized the ability of their cytoplasmic tails to bind aldolase and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), both of which bind actin. We tested the binding of the cytoplasmic peptides of the two ligand families to aldolase and GAPDH. Only the cytoplasmic peptides of some RH ligands showed strong binding to aldolase, and the binding depended on the presence of an aromatic amino acid (phenylalanine or tyrosine), rather than tryptophan, in the context of negatively charged amino acids. The binding was confirmed by surface plasmon resonance analysis and was found to represent affinity similar to that seen with TRAP. An X-ray crystal structure of aldolase at 2.5 Å in the presence of RH2b peptide suggested that the binding site location was near the TRAP-binding site. GAPDH bound to some of the cytoplasmic tails of certain RH and DBL ligands in an aromatic amino acid-dependent manner. Thus, the connection between Plasmodium merozoite ligands and erythrocyte receptors and the actin motor can be achieved through the activity of either aldolase or GAPDH by mechanisms that do not require tryptophan but, rather, other aromatic amino acids. IMPORTANCE The invasion of the Plasmodium merozoite into erythrocytes is a critical element in malaria pathogenesis. It is important to understand the molecular details of this process, as this machinery can be a target for both vaccine and drug development

Evolution of the merozoite surface protein 7 (msp7) family in Plasmodium vivax and P. falciparum: A comparative approach.

PubMed

Castillo, Andreína I; Andreína Pacheco, M; Escalante, Ananias A

2017-06-01

Malaria parasites (genus Plasmodium) are a diverse group found in many species of vertebrate hosts. These parasites invade red blood cells in a complex process comprising several proteins, many encoded by multigene families, one of which is merozoite surface protein 7 (msp7). In the case of Plasmodium vivax, the most geographically widespread human-infecting species, differences in the number of paralogs within multigene families have been previously explained, at least in part, as potential adaptations to the human host. To explore this in msp7, we studied its orthologs in closely related nonhuman primate parasites; investigating both paralog evolutionary history and genetic polymorphism. The emerging patterns were then compared with the human parasite Plasmodium falciparum. We found that the evolution of the msp7 family is consistent with a birth-and-death model, where duplications, pseudogenizations, and gene loss events are common. However, all paralogs in P. vivax and P. falciparum had orthologs in their closely related species in non-human primates indicating that the ancestors of those paralogs precede the events leading to their origins as human parasites. Thus, the number of paralogs cannot be explained as an adaptation to human hosts. Although there is no functional information for msp7 in P. vivax, we found evidence for purifying selection in the genetic polymorphism of some of its paralogs as well as their orthologs in closely related non-human primate parasites. We also found evidence indicating that a few of P. vivax's paralogs may have diverged from their orthologs in non-human primates by episodic positive selection. Hence, they may had been under selection when the lineage leading to P. vivax diverged from the Asian non-human primates and switched into Homininae. All these lines of evidence suggest that msp7 is functionally important in P. vivax. Copyright © 2017 Elsevier B.V. All rights reserved.

Susceptibility to Plasmodium yoelii preerythrocytic infection in BALB/c substrains is determined at the point of hepatocyte invasion.

PubMed

Kaushansky, Alexis; Austin, Laura S; Mikolajczak, Sebastian A; Lo, Fang Y; Miller, Jessica L; Douglass, Alyse N; Arang, Nadia; Vaughan, Ashley M; Gardner, Malcolm J; Kappe, Stefan H I

2015-01-01

After transmission by Anopheles mosquitoes, Plasmodium sporozoites travel to the liver, infect hepatocytes, and rapidly develop as intrahepatocytic liver stages (LS). Rodent models of malaria exhibit large differences in the magnitude of liver infection, both between parasite species and between strains of mice. This has been mainly attributed to differences in innate immune responses and parasite infectivity. Here, we report that BALB/cByJ mice are more susceptible to Plasmodium yoelii preerythrocytic infection than BALB/cJ mice. This difference occurs at the level of early hepatocyte infection, but expression levels of reported host factors that are involved in infection do not correlate with susceptibility. Interestingly, BALB/cByJ hepatocytes are more frequently polyploid; thus, their susceptibility converges on the previously observed preference of sporozoites to infect polyploid hepatocytes. Gene expression analysis demonstrates hepatocyte-specific differences in mRNA abundance for numerous genes between BALB/cByJ and BALB/cJ mice, some of which encode hepatocyte surface molecules. These data suggest that a yet-unknown receptor for sporozoite infection, present at elevated levels on BALB/cByJ hepatocytes and also polyploid hepatocytes, might facilitate Plasmodium liver infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Evidence that antibodies against recombinant SnSAG1 of Sarcocystis neurona merozoites are involved in infection and immunity in equine protozoal myeloencephalitis.

PubMed

Ellison, Siobhan; Witonsky, Sharon

2009-07-01

Sarcocystis neurona is the principal etiologic agent of equine protozoal myeloencephalitis (EPM). An immunodominant protein of S. neurona, SnSAG-1, is expressed by the majority of S. neurona merozoites isolated from spinal tissues of horses diagnosed with EPM and may be a candidate for diagnostic tests and prophylaxis for EPM. Five horses were vaccinated with adjuvanted recombinant SnSAG1 (rSnSAG1) and 5 control (sham vaccinated) horses were vaccinated with adjuvant only. Serum was evaluated pre- and post-vaccination, prior to challenge, for antibodies against rSnSAG1 and inhibitory effects on the infectivity of S. neurona by an in vitro serum neutralization assay. The effect of vaccination with rSnSAG1 on in vivo infection by S. neurona was evaluated by challenging all the horses with S. neurona merozoites. Blinded daily examinations and 4 blinded neurological examinations were used to evaluate the presence of clinical signs of EPM. The 5 vaccinated horses developed serum and cerebrospinal fluid (CSF) titers of SnSAG1, detected by enzyme-linked immunosorbent assay (ELISA), post-vaccination. Post-vaccination serum from vaccinated horses was found to have an inhibitory effect on merozoites, demonstrated by in vitro bioassay. Following the challenge, the 5 control horses displayed clinical signs of EPM, including ataxia. While 4 of the 5 vaccinated horses did not become ataxic. One rSnSAG-1 vaccinated horse showed paresis in 1 limb with muscle atrophy. All horses showed mild, transient, cranial nerve deficits; however, disease did not progress to ataxia in rSnSAG-1 vaccinated horses. The study showed that vaccination with rSnSAG-1 produced antibodies in horses that neutralized merozoites when tested by in vitro culture and significantly reduced clinical signs demonstrated by in vivo challenge.

Evidence that antibodies against recombinant SnSAG1 of Sarcocystis neurona merozoites are involved in infection and immunity in equine protozoal myeloencephalitis

PubMed Central

Ellison, Siobhan; Witonsky, Sharon

2009-01-01

Sarcocystis neurona is the principal etiologic agent of equine protozoal myeloencephalitis (EPM). An immunodominant protein of S. neurona, SnSAG-1, is expressed by the majority of S. neurona merozoites isolated from spinal tissues of horses diagnosed with EPM and may be a candidate for diagnostic tests and prophylaxis for EPM. Five horses were vaccinated with adjuvanted recombinant SnSAG1 (rSnSAG1) and 5 control (sham vaccinated) horses were vaccinated with adjuvant only. Serum was evaluated pre- and post-vaccination, prior to challenge, for antibodies against rSnSAG1 and inhibitory effects on the infectivity of S. neurona by an in vitro serum neutralization assay. The effect of vaccination with rSnSAG1 on in vivo infection by S. neurona was evaluated by challenging all the horses with S. neurona merozoites. Blinded daily examinations and 4 blinded neurological examinations were used to evaluate the presence of clinical signs of EPM. The 5 vaccinated horses developed serum and cerebrospinal fluid (CSF) titers of SnSAG1, detected by enzyme-linked immunosorbent assay (ELISA), post-vaccination. Post-vaccination serum from vaccinated horses was found to have an inhibitory effect on merozoites, demonstrated by in vitro bioassay. Following the challenge, the 5 control horses displayed clinical signs of EPM, including ataxia. While 4 of the 5 vaccinated horses did not become ataxic. One rSnSAG-1 vaccinated horse showed paresis in 1 limb with muscle atrophy. All horses showed mild, transient, cranial nerve deficits; however, disease did not progress to ataxia in rSnSAG-1 vaccinated horses. The study showed that vaccination with rSnSAG-1 produced antibodies in horses that neutralized merozoites when tested by in vitro culture and significantly reduced clinical signs demonstrated by in vivo challenge. PMID:19794889

Determination of multiple-clone infection at allelic dimorphism site of Plasmodium vivax merozoite surface protein-1 in the Republic of Korea by pyrosequencing assay.

PubMed

Dinzouna-Boutamba, Sylvatrie-Danne; Lee, Sanghyun; Son, Ui-Han; Yun, Hae Soo; Joo, So-Young; Jeong, Sookwan; Rhee, Man Hee; Kwak, Dongmi; Xuan, Xuenan; Hong, Yeonchul; Chung, Dong-Il; Goo, Youn-Kyoung

2017-12-01

Allelic diversity leading to multiple gene polymorphisms of vivax malaria parasites has been shown to greatly contribute to antigenic variation and drug resistance, increasing the potential for multiple-clone infections within the host. Therefore, to identify multiple-clone infections and the predominant haplotype of Plasmodium vivax in a South Korean population, P. vivax merozoite surface protein-1 (PvMSP-1) was analyzed by pyrosequencing. Pyrosequencing of 156 vivax malaria-infected samples yielded 97 (62.18%) output pyrograms showing two main types of peak patterns of the dimorphic allele for threonine and alanine (T1476A). Most of the samples evaluated (88.66%) carried multiple-clone infections (wild- and mutant-types), whereas 11.34% of the same population carried only the mutant-type (1476A). In addition, each allele showed a high frequency of guanine (G) base substitution at both the first and third positions (86.07% and 81.13%, respectively) of the nucleotide combinations. Pyrosequencing of the PvMSP-1 42-kDa fragment revealed a heterogeneous parasite population, with the mutant-type dominant compared to the wild-type. Understanding the genetic diversity and multiple-clone infection rates may lead to improvements in vivax malaria prevention and strategic control plans. Further studies are needed to improve the efficacy of the pyrosequencing assay with large sample sizes and additional nucleotide positions. Copyright © 2017 Elsevier B.V. All rights reserved.

Pro-inflammatory Cytokine Response and Genetic Diversity in Merozoite Surface Protein 2 of Plasmodium falciparum Isolates from Nigeria.

PubMed

Ajibaye, Olusola; Osuntoki, Akinniyi A; Ebuehi, Albert Ot; Iwalokun, Bamidele A; Balogun, Emmanuel O; Egbuna, Kathleen N

2017-01-01

Polymorphisms in Plasmodium falciparum merozoite surface protein-2 ( msp -2) and associated parasite genetic diversity which varies between malaria-endemic regions remain a limitation in malaria vaccine development. Pro-inflammatory cytokines are important in immunity against malaria, understanding the influence of genetic diversity on cytokine response is important for effective vaccine design. P. falciparum isolates obtained from 300 Nigerians with uncomplicated falciparum malaria at Ijede General Hospital, Ijede (IJE), General Hospital Ajeromi, Ajeromi (AJE) and Saint Kizito Mission Hospital, Lekki, were genotyped by nested polymerase chain reaction of msp -2 block 3 while ELISA was used to determine the pro-inflammatory cytokine response to describe the genetic diversity of P. falciparum . Eighteen alleles were observed for msp -2 loci. Of the 195 isolates, 61 (31.0%) had only FC27-type alleles, 38 (19.7%) had only 3D7-type alleles, and 49.3% had multiple parasite lines with both alleles. Band sizes were 275-625 bp for FC27 and 150-425 bp for 3D7. Four alleles were observed from LEK, 2 (375-425 bp) and 2 (275-325 bp) of FC27-and 3D7-types, respectively; 12 alleles from AJE, 9 (275-625 bp) and 3 (325-425 bp) of FC27-types and 3D7-types, respectively; while IJE had a total of 12 alleles, 9 (275-625 bp) and 3 (325-425 bp) of FC27-types and 3D7-types, respectively. Mean multiplicity of infection (MOI) was 1.54. Heterozygosity ( H E ) ranged from 0.77 to 0.87 and was highest for IJE (0.87). Cytokine response was higher among <5 years and was significantly associated with MOI ( P > 0.05) but with neither parasite density nor infection type. P. falciparum genetic diversity is extensive in Nigeria, protection via pro-inflammatory cytokines have little or no interplay with infection multiplicity.

Genetic clustering and polymorphism of the merozoite surface protein-3 of Plasmodium knowlesi clinical isolates from Peninsular Malaysia.

PubMed

De Silva, Jeremy Ryan; Lau, Yee Ling; Fong, Mun Yik

2017-01-03

The simian malaria parasite Plasmodium knowlesi has been reported to cause significant numbers of human infection in South East Asia. Its merozoite surface protein-3 (MSP3) is a protein that belongs to a multi-gene family of proteins first found in Plasmodium falciparum. Several studies have evaluated the potential of P. falciparum MSP3 as a potential vaccine candidate. However, to date no detailed studies have been carried out on P. knowlesi MSP3 gene (pkmsp3). The present study investigates the genetic diversity, and haplotypes groups of pkmsp3 in P. knowlesi clinical samples from Peninsular Malaysia. Blood samples were collected from P. knowlesi malaria patients within a period of 4 years (2008-2012). The pkmsp3 gene of the isolates was amplified via PCR, and subsequently cloned and sequenced. The full length pkmsp3 sequence was divided into Domain A and Domain B. Natural selection, genetic diversity, and haplotypes of pkmsp3 were analysed using MEGA6 and DnaSP ver. 5.10.00 programmes. From 23 samples, 48 pkmsp3 sequences were successfully obtained. At the nucleotide level, 101 synonymous and 238 non-synonymous mutations were observed. Tests of neutrality were not significant for the full length, Domain A or Domain B sequences. However, the dN/dS ratio of Domain B indicates purifying selection for this domain. Analysis of the deduced amino acid sequences revealed 42 different haplotypes. Neighbour Joining phylogenetic tree and haplotype network analyses revealed that the haplotypes clustered into two distinct groups. A moderate level of genetic diversity was observed in the pkmsp3 and only the C-terminal region (Domain B) appeared to be under purifying selection. The separation of the pkmsp3 into two haplotype groups provides further evidence of the existence of two distinct P. knowlesi types or lineages. Future studies should investigate the diversity of pkmsp3 among P. knowlesi isolates in North Borneo, where large numbers of human knowlesi malaria infection

Primary structure of the 175K Plasmodium falciparum erythrocyte binding antigen and identification of a peptide which elicits antibodies that inhibit malaria merozoite invasion.

PubMed

Sim, B K; Orlandi, P A; Haynes, J D; Klotz, F W; Carter, J M; Camus, D; Zegans, M E; Chulay, J D

1990-11-01

The Plasmodium falciparum gene encoding erythrocyte binding antigen-175 (EBA-175), a putative receptor for red cell invasion (Camus, D., and T. J. Hadley. 1985. Science (Wash. DC). 230:553-556.), has been isolated and characterized. DNA sequencing demonstrated a single open reading frame encoding a translation product of 1,435 amino acid residues. Peptides corresponding to regions on the deduced amino acid sequence predicted to be B cell epitopes were assessed for immunogenicity. Immunization of mice and rabbits with EBA-peptide 4, a synthetic peptide encompassing amino acid residues 1,062-1,103, produced antibodies that recognized P. falciparum merozoites in an indirect fluorescent antibody assay. When compared to sera from rabbits immunized with the same adjuvant and carrier protein, sera from rabbits immunized with EBA-peptide 4 inhibited merozoite invasion of erythrocytes in vitro by 80% at a 1:5 dilution. Furthermore, these sera inhibited the binding of purified, authentic EBA-175 to erythrocytes, suggesting that their activity in inhibiting merozoite invasion of erythrocytes is mediated by blocking the binding of EBA-175 to erythrocytes. Since the nucleotide sequence of EBA-peptide 4 is conserved among seven strains of P. falciparum from throughout the world (Sim, B. K. L. 1990. Mol. Biochem. Parasitol. 41:293-296.), these data identify a region of the protein that should be a focus of vaccine development efforts.

Prediction of merozoite surface protein 1 and apical membrane antigen 1 vaccine efficacies against Plasmodium chabaudi malaria based on prechallenge antibody responses.

PubMed

Lynch, Michelle M; Cernetich-Ott, Amy; Weidanz, William P; Burns, James M

2009-03-01

For the development of blood-stage malaria vaccines, there is a clear need to establish in vitro measures of the antibody-mediated and the cell-mediated immune responses that correlate with protection. In this study, we focused on establishing correlates of antibody-mediated immunity induced by immunization with apical membrane antigen 1 (AMA1) and merozoite surface protein 1(42) (MSP1(42)) subunit vaccines. To do so, we exploited the Plasmodium chabaudi rodent model, with which we can immunize animals with both protective and nonprotective vaccine formulations and allow the parasitemia in the challenged animals to peak. Vaccine formulations were varied with regard to the antigen dose, the antigen conformation, and the adjuvant used. Prechallenge antibody responses were evaluated by enzyme-linked immunosorbent assay and were tested for a correlation with protection against nonlethal P. chabaudi malaria, as measured by a reduction in the peak level of parasitemia. The analysis showed that neither the isotype profile nor the avidity of vaccine-induced antibodies correlated with protective efficacy. However, high titers of antibodies directed against conformation-independent epitopes were associated with poor vaccine performance and may limit the effectiveness of protective antibodies that recognize conformation-dependent epitopes. We were able to predict the efficacies of the P. chabaudi AMA1 (PcAMA1) and P. chabaudi MSP1(42) (PcMSP1(42)) vaccines only when the prechallenge antibody titers to both refolded and reduced/alkylated antigens were considered in combination. The relative importance of these two measures of vaccine-induced responses as predictors of protection differed somewhat for the PcAMA1 and the PcMSP1(42) vaccines, a finding confirmed in our final immunization and challenge study. A similar approach to the evaluation of vaccine-induced antibody responses may be useful during clinical trials of Plasmodium falciparum AMA1 and MSP1(42) vaccines.

Prediction of Merozoite Surface Protein 1 and Apical Membrane Antigen 1 Vaccine Efficacies against Plasmodium chabaudi Malaria Based on Prechallenge Antibody Responses▿

PubMed Central

Lynch, Michelle M.; Cernetich-Ott, Amy; Weidanz, William P.; Burns, James M.

2009-01-01

For the development of blood-stage malaria vaccines, there is a clear need to establish in vitro measures of the antibody-mediated and the cell-mediated immune responses that correlate with protection. In this study, we focused on establishing correlates of antibody-mediated immunity induced by immunization with apical membrane antigen 1 (AMA1) and merozoite surface protein 142 (MSP142) subunit vaccines. To do so, we exploited the Plasmodium chabaudi rodent model, with which we can immunize animals with both protective and nonprotective vaccine formulations and allow the parasitemia in the challenged animals to peak. Vaccine formulations were varied with regard to the antigen dose, the antigen conformation, and the adjuvant used. Prechallenge antibody responses were evaluated by enzyme-linked immunosorbent assay and were tested for a correlation with protection against nonlethal P. chabaudi malaria, as measured by a reduction in the peak level of parasitemia. The analysis showed that neither the isotype profile nor the avidity of vaccine-induced antibodies correlated with protective efficacy. However, high titers of antibodies directed against conformation-independent epitopes were associated with poor vaccine performance and may limit the effectiveness of protective antibodies that recognize conformation-dependent epitopes. We were able to predict the efficacies of the P. chabaudi AMA1 (PcAMA1) and P. chabaudi MSP142 (PcMSP142) vaccines only when the prechallenge antibody titers to both refolded and reduced/alkylated antigens were considered in combination. The relative importance of these two measures of vaccine-induced responses as predictors of protection differed somewhat for the PcAMA1 and the PcMSP142 vaccines, a finding confirmed in our final immunization and challenge study. A similar approach to the evaluation of vaccine-induced antibody responses may be useful during clinical trials of Plasmodium falciparum AMA1 and MSP142 vaccines. PMID:19116303

Overexpression of Plasmodium berghei ATG8 by Liver Forms Leads to Cumulative Defects in Organelle Dynamics and to Generation of Noninfectious Merozoites

PubMed Central

Voss, Christiane; Ehrenman, Karen; Mlambo, Godfree; Mishra, Satish; Kumar, Kota Arun; Sacci, John B.; Sinnis, Photini

2016-01-01

ABSTRACT Plasmodium parasites undergo continuous cellular renovation to adapt to various environments in the vertebrate host and insect vector. In hepatocytes, Plasmodium berghei discards unneeded organelles for replication, such as micronemes involved in invasion. Concomitantly, intrahepatic parasites expand organelles such as the apicoplast that produce essential metabolites. We previously showed that the ATG8 conjugation system is upregulated in P. berghei liver forms and that P. berghei ATG8 (PbATG8) localizes to the membranes of the apicoplast and cytoplasmic vesicles. Here, we focus on the contribution of PbATG8 to the organellar changes that occur in intrahepatic parasites. We illustrated that micronemes colocalize with PbATG8-containing structures before expulsion from the parasite. Interference with PbATG8 function by overexpression results in poor development into late liver stages and production of small merosomes that contain immature merozoites unable to initiate a blood infection. At the cellular level, PbATG8-overexpressing P. berghei exhibits a delay in microneme compartmentalization into PbATG8-containing autophagosomes and elimination compared to parasites from the parental strain. The apicoplast, identifiable by immunostaining of the acyl carrier protein (ACP), undergoes an abnormally fast proliferation in mutant parasites. Over time, the ACP staining becomes diffuse in merosomes, indicating a collapse of the apicoplast. PbATG8 is not incorporated into the progeny of mutant parasites, in contrast to parental merozoites in which PbATG8 and ACP localize to the apicoplast. These observations reveal that Plasmodium ATG8 is a key effector in the development of merozoites by controlling microneme clearance and apicoplast proliferation and that dysregulation in ATG8 levels is detrimental for malaria infectivity. PMID:27353755

Chemically Attenuated Blood-Stage Plasmodium yoelii Parasites Induce Long-Lived and Strain-Transcending Protection

PubMed Central

Raja, Amber I.; Cai, Yeping; Reiman, Jennifer M.; Groves, Penny; Chakravarty, Sumana; McPhun, Virginia; Doolan, Denise L.; Cockburn, Ian; Hoffman, Stephen L.; Stanisic, Danielle I.

2016-01-01

The development of a vaccine is essential for the elimination of malaria. However, despite many years of effort, a successful vaccine has not been achieved. Most subunit vaccine candidates tested in clinical trials have provided limited efficacy, and thus attenuated whole-parasite vaccines are now receiving close scrutiny. Here, we test chemically attenuated Plasmodium yoelii 17X and demonstrate significant protection following homologous and heterologous blood-stage challenge. Protection against blood-stage infection persisted for at least 9 months. Activation of both CD4+ and CD8+ T cells was shown after vaccination; however, in vivo studies demonstrated a pivotal role for both CD4+ T cells and B cells since the absence of either cell type led to loss of vaccine-induced protection. In spite of significant activation of circulating CD8+ T cells, liver-stage immunity was not evident. Neither did vaccine-induced CD8+ T cells contribute to blood-stage protection; rather, these cells contributed to pathogenesis, since all vaccinated mice depleted of both CD4+ and CD8+ T cells survived a challenge infection. This study provides critical insight into whole-parasite vaccine-induced immunity and strong support for testing whole-parasite vaccines in humans. PMID:27245410

In vivo selection of populations of Plasmodium chabaudi chabaudi AS resistant to a monoclonal antibody that reacts with the precursor to the major merozoite surface antigen.

PubMed Central

Wood, J C; Sales de Aguiar, J C; Jarra, W; Ogun, S A; Snounou, G; Brown, K N

1989-01-01

Mice bearing a hybridoma secreting a monoclonal antibody (MAb), MAb-3, which significantly delays the onset of a Plasmodium chabaudi chabaudi AS, but not P. chabaudi chabaudi CB, challenge parasitemia in a passive transfer assay and which is specific for the precursor to the major merozoite surface antigen (PMMSA) of P. chabaudi chabaudi AS, were challenged intravenously with 10(3) P. chabaudi chabaudi AS-parasitized erythrocytes. The resultant parasitemia was very similar to that in normal mice except that initially the parasitemia was sometimes slightly delayed. Parasites derived from cryopreserved stabilates isolated from MAb-3 hybridoma mice with an unmodified parasitemia, or with a delayed parasitemia, were found to have lost their susceptibility to MAb-3 in the passive transfer assay. A number of anti-PMMSA MAb were used to immunoprecipitate lysates of parasite populations isolated directly from hybridoma-bearing mice. In some instances and with certain of the MAb, immunoprecipitation patterns were modified, but other isolates were not detectably different when compared with unselected P. chabaudi chabaudi AS parasites. Using a panel of MAb reacting with the PMMSA of P. chabaudi chabaudi AS, immunoprecipitation patterns of parasites derived from cryopreserved stabilates isolated from hybridoma-bearing mice were determined at 2-h intervals through the appropriate part of the parasite maturation cycle. In these derived populations, resistance to MAb-3 was not associated with a change in the immunoprecipitation reaction with the MAb used. These results are discussed in the context of current knowledge of genotypic and phenotypic antigenic diversity of malaria parasites and other protozoa. Images PMID:2731986

Low level of sequence diversity at merozoite surface protein-1 locus of Plasmodium ovale curtisi and P. ovale wallikeri from Thai isolates.

PubMed

Putaporntip, Chaturong; Hughes, Austin L; Jongwutiwes, Somchai

2013-01-01

The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (p<0.0001), suggesting that purifying selection has shaped diversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at this locus.

Low Level of Sequence Diversity at Merozoite Surface Protein-1 Locus of Plasmodium ovale curtisi and P. ovale wallikeri from Thai Isolates

PubMed Central

Putaporntip, Chaturong; Hughes, Austin L.; Jongwutiwes, Somchai

2013-01-01

Background The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Methodology/Principal Findings Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (p<0.0001), suggesting that purifying selection has shaped diversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. Conclusion/Significance The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at

Strain-specific spleen remodelling in Plasmodium yoelii infections in Balb/c mice facilitates adherence and spleen macrophage-clearance escape

PubMed Central

Martin-Jaular, Lorena; Ferrer, Mireia; Calvo, Maria; Rosanas-Urgell, Anna; Kalko, Susana; Graewe, Stefanie; Soria, Guadalupe; Cortadellas, Núria; Ordi, Jaume; Planas, Anna; Burns, James; Heussler, Volker; del Portillo, Hernando A

2011-01-01

Knowledge of the dynamic features of the processes driven by malaria parasites in the spleen is lacking. To gain insight into the function and structure of the spleen in malaria, we have implemented intravital microscopy and magnetic resonance imaging of the mouse spleen in experimental infections with non-lethal (17X) and lethal (17XL) Plasmodium yoelii strains. Noticeably, there was higher parasite accumulation, reduced motility, loss of directionality, increased residence time and altered magnetic resonance only in the spleens of mice infected with 17X. Moreover, these differences were associated with the formation of a strain-specific induced spleen tissue barrier of fibroblastic origin, with red pulp macrophage-clearance evasion and with adherence of infected red blood cells to this barrier. Our data suggest that in this reticulocyte-prone non-lethal rodent malaria model, passage through the spleen is different from what is known in other Plasmodium species and open new avenues for functional/structural studies of this lymphoid organ in malaria. PMID:20923452

Effects of transmission-blocking vaccines simultaneously targeting pre- and post-fertilization antigens in the rodent malaria parasite Plasmodium yoelii.

PubMed

Zheng, Li; Pang, Wei; Qi, Zanmei; Luo, Enjie; Cui, Liwang; Cao, Yaming

2016-08-08

Transmission-blocking vaccine (TBV) is a promising strategy for interrupting the malaria transmission cycle. Current TBV candidates include both pre- and post-fertilization antigens expressed during sexual development of the malaria parasites. We tested whether a TBV design combining two sexual-stage antigens has better transmission-blocking activity. Using the rodent malaria model Plasmodium yoelii, we pursued a DNA vaccination strategy with genes encoding the gametocyte antigen Pys48/45 and the major ookinete surface protein Pys25. Immunization of mice with DNA constructs expression either Pys48/45 or Pys25 elicited strong antibody responses, which specifically recognized a ~45 and ~25 kDa protein from gametocyte and ookinete lysates, respectively. Immune sera from mice immunized with DNA constructs expressing Pys48/45 and Pys25 individually and in combination displayed evident transmission-blocking activity in in vitro ookinete culture and direct mosquito feeding experiments. With both assays, the Pys25 sera had higher transmission-blocking activity than the Pys48/45 sera. Intriguingly, compared with the immunization with the individual DNA vaccines, immunization with both DNA constructs produced lower antibody responses against individual antigens. The resultant immune sera from the composite vaccination had significantly lower transmission-blocking activity than those from Pys25 DNA immunization group, albeit the activity was substantially higher than that from the Pys48 DNA vaccination group. This result suggested that vaccination with the two DNA constructs did not achieve a synergistic effect, but rather caused interference in inducing antigen-specific antibody responses. This result has important implications for future design of composite vaccines targeting different sexual antigens.

Depletion of Phagocytic Cells during Nonlethal Plasmodium yoelii Infection Causes Severe Malaria Characterized by Acute Renal Failure in Mice

PubMed Central

Terkawi, Mohamad Alaa; Nishimura, Maki; Furuoka, Hidefumi

2016-01-01

In the current study, we examined the effects of depletion of phagocytes on the progression of Plasmodium yoelii 17XNL infection in mice. Strikingly, the depletion of phagocytic cells, including macrophages, with clodronate in the acute phase of infection significantly reduced peripheral parasitemia but increased mortality. Moribund mice displayed severe pathological damage, including coagulative necrosis in liver and thrombi in the glomeruli, fibrin deposition, and tubular necrosis in kidney. The severity of infection was coincident with the increased sequestration of parasitized erythrocytes, the systematic upregulation of inflammation and coagulation, and the disruption of endothelial integrity in the liver and kidney. Aspirin was administered to the mice to minimize the risk of excessive activation of the coagulation response and fibrin deposition in the renal tissue. Interestingly, treatment with aspirin reduced the parasite burden and pathological lesions in the renal tissue and improved survival of phagocyte-depleted mice. Our data imply that the depletion of phagocytic cells, including macrophages, in the acute phase of infection increases the severity of malarial infection, typified by multiorgan failure and high mortality. PMID:26755155

Poly(I:C) adjuvant strongly enhances parasite-inhibitory antibodies and Th1 response against Plasmodium falciparum merozoite surface protein-1 (42-kDa fragment) in BALB/c mice.

PubMed

Mehrizi, Akram Abouie; Rezvani, Niloufar; Zakeri, Sedigheh; Gholami, Atefeh; Babaeekhou, Laleh

2018-04-01

Malaria vaccine development has been confronted with various challenges such as poor immunogenicity of malaria vaccine candidate antigens, which is considered as the main challenge. However, this problem can be managed using appropriate formulations of antigens and adjuvants. Poly(I:C) is a potent Th1 inducer and a human compatible adjuvant capable of stimulating both B- and T-cell immunity. Plasmodium falciparum merozoite surface protein 1 42 (PfMSP-1 42 ) is a promising vaccine candidate for blood stage of malaria that has faced several difficulties in clinical trials, mainly due to improper adjuvants. Therefore, in the current study, poly(I:C), as a potent Th1 inducer adjuvant, was evaluated to improve the immunogenicity of recombinant PfMSP-1 42 , when compared to CFA/IFA, as reference adjuvant. Poly(I:C) produced high level and titers of anti-PfMSP-1 42 IgG antibodies in which was comparable to CFA/IFA adjuvant. In addition, PfMSP-1 42 formulated with poly(I:C) elicited a higher ratio of IFN-γ/IL-4 (23.9) and IgG2a/IgG1 (3.77) with more persistent, higher avidity, and titer of IgG2a relative to CFA/IFA, indicating a potent Th1 immune response. Poly(I:C) could also help to induce anti-PfMSP-1 42 antibodies with higher growth-inhibitory activity than CFA/IFA. Altogether, the results of the current study demonstrated that poly(I:C) is a potent adjuvant that can be appropriate for being used in PfMSP-1 42 -based vaccine formulations.

Immunogenic properties of a recombinant fusion protein containing the C-terminal 19 kDa of Plasmodium falciparum merozoite surface protein-1 and the innate immunity agonist FliC flagellin of Salmonella typhimurium.

PubMed

Bargieri, Daniel Y; Leite, Juliana A; Lopes, Stefanie C P; Sbrogio-Almeida, Maria Elisabete; Braga, Catarina J M; Ferreira, Luis C S; Soares, Irene S; Costa, Fabio T M; Rodrigues, Mauricio M

2010-04-01

In a recent study, we demonstrated the immunogenic properties of a new malaria vaccine polypeptide based on a 19 kDa C-terminal fragment of the merozoite surface protein-1 (MSP1(19)) from Plasmodium vivax and an innate immunity agonist, the Salmonella enterica serovar Typhimurium flagellin (FliC). Herein, we tested whether the same strategy, based on the MSP1(19) component of the deadly malaria parasite Plasmodium falciparum, could also generate a fusion polypeptide with enhanced immunogenicity. The His(6)FliC-MSP1(19) fusion protein was expressed from a recombinant Escherichia coli and showed preserved in vitro TLR5-binding activity. In contrast to animals injected with His(6)MSP1(19), mice subcutaneously immunised with the recombinant His(6)FliC-MSP1(19) developed strong MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass. Incorporation of other adjuvants, such as CpG ODN 1826, complete and incomplete Freund's adjuvants or Quil-A, improved the IgG responses after the second, but not the third, immunising dose. It also resulted in a more balanced IgG subclass response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response, as determined by the detection of antigen-specific interferon-gamma secretion by immune spleen cells. MSP1(19)-specific antibodies recognised not only the recombinant protein, but also the native protein expressed on the surface of P. falciparum parasites. Finally, sera from rabbits immunised with the fusion protein alone inhibited the in vitro growth of three different P. falciparum strains. In summary, these results extend our previous observations and further demonstrate that fusion of the innate immunity agonist FliC to Plasmodium antigens is a promising alternative to improve their immunogenicity. (c) 2010 Elsevier Ltd. All rights reserved.

Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

PubMed

Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

2014-12-13

The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

Extensive diversity in the allelic frequency of Plasmodium falciparum merozoite surface proteins and glutamate-rich protein in rural and urban settings of southwestern Nigeria.

PubMed

Funwei, Roland I; Thomas, Bolaji N; Falade, Catherine O; Ojurongbe, Olusola

2018-01-02

Nigeria carries a high burden of malaria which makes continuous surveillance for current information on genetic diversity imperative. In this study, the merozoite surface proteins (msp-1, msp-2) and glutamate-rich protein (glurp) of Plasmodium falciparum collected from two communities representing rural and urban settings in Ibadan, southwestern Nigeria were analysed. A total of 511 febrile children, aged 3-59 months, whose parents/guardians provided informed consent, were recruited into the study. Capillary blood was obtained for malaria rapid diagnostic test, thick blood smears for parasite count and blood spots on filter paper for molecular analysis. Three-hundred and nine samples were successfully genotyped for msp-1, msp-2 and glurp genes. The allelic distribution of the three genes was not significantly different in the rural and urban communities. R033 and 3D7 were the most prevalent alleles in both rural and urban communities for msp-1 and msp-2, respectively. Eleven of glurp RII region genotypes, coded I-XII, with sizes ranging from 500 to 1100 base pairs were detected in the rural setting. Genotype XI (1000-1050 bp) had the highest prevalence of 41.5 and 38.5% in rural and urban settings, respectively. Overall, 82.1 and 70.0% of samples had multiclonal infection with msp-1 gene resulting in a mean multiplicity of infection (MOI) of 2.8 and 2.6 for rural and urban samples, respectively. Msp-1 and msp-2 genes displayed higher levels of diversity and higher MOI rates than the glurp gene. Significant genetic diversity was observed between rural and urban parasite populations in Ibadan, southwestern Nigeria. The results of this study show that malaria transmission intensity in these regions is still high. No significant difference was observed between rural and urban settings, except for a completely different msp-1 allele, compared to previous reports, thereby confirming the changing face of malaria transmission in these communities. This study provides

A systematic analysis of the early transcribed membrane protein family throughout the life cycle of Plasmodium yoelii.

PubMed

MacKellar, Drew C; Vaughan, Ashley M; Aly, Ahmed S I; DeLeon, Sasha; Kappe, Stefan H I

2011-11-01

The early transcribed membrane proteins (ETRAMPs) are a family of small, highly charged transmembrane proteins unique to malaria parasites. Some members of the ETRAMP family have been localized to the parasitophorous vacuole membrane that separates the intracellular parasite from the host cell and thus presumably have a role in host-parasite interactions. Although it was previously shown that two ETRAMPs are critical for rodent malaria parasite liver-stage development, the importance of most ETRAMPs during the parasite life cycle remains unknown. Here, we comprehensively identify nine new etramps in the genome of the rodent malaria parasite Plasmodium yoelii, and elucidate their conservation in other malaria parasites. etramp expression profiles are diverse throughout the parasite life cycle as measured by RT-PCR. Epitope tagging of two ETRAMPs demonstrates protein expression in blood and liver stages, and reveals differences in both their timing of expression and their subcellular localization. Gene targeting studies of each of the nine uncharacterized etramps show that two are refractory to deletion and thus likely essential for blood-stage replication. Seven etramps are not essential for any life cycle stage. Systematic characterization of the members of the ETRAMP family reveals the diversity in importance of each family member at the interface between host and parasite throughout the developmental cycle of the malaria parasite. © 2011 Blackwell Publishing Ltd.

TLR4 and TLR9 signals stimulate protective immunity against blood-stage Plasmodium yoelii infection in mice.

PubMed

Zhang, Yanjun; Zhu, Xiaotong; Feng, Yonghui; Pang, Wei; Qi, Zanmei; Cui, Liwang; Cao, Yaming

2016-11-01

The mechanisms regulating the induction of protective immunity against blood-stage malaria remain unclear. Resistant DBA/2 mouse develops a higher Th1 response compared with a susceptible BALB/c strain during Plasmodium yoelii (Py) infection. It is known that the T helper cell response is initiated and polarized by dendritic cells (DCs) of the innate immune system, during which TLR4 and TLR9 are important receptors for the innate recognition of the malaria parasite and its products. We hypothesized that TLR4/9 may play critical roles in the induction of protective immunity against Py infection. We used TLR4/9 antagonists and agonists to study their effects on mouse resistance to Py infection. We found that the administration of an antagonist prior to infection aggravated disease outcomes, impaired DC functions and suppressed the pro-inflammatory response to Py infection in resistant DBA/2 mice. Treatment with the TLR4 agonist lipopolysaccharide (LPS) but not TLR9 agonist significantly improved the survival rate of susceptible Py-infected BALB/c mice. LPS administration promoted the activation and expansion of DCs and drove a Th1-biased response. Our data demonstrate the important roles of TLR4/9 signals in inducing resistance to malaria parasites and provide evidence for the rational use of TLR agonists to potentiate protective immunity against Plasmodium infection. Copyright © 2016 Elsevier Inc. All rights reserved.

Neutralization of Plasmodium falciparum merozoites by antibodies against PfRH5

PubMed Central

Douglas, Alexander D.; Williams, Andrew R.; Knuepfer, Ellen; Illingworth, Joseph J.; Furze, Julie M.; Crosnier, Cécile; Choudhary, Prateek; Bustamante, Leyla Y.; Zakutansky, Sara E.; Awuah, Dennis K.; Alanine, Daniel G. W.; Theron, Michel; Worth, Andrew; Shimkets, Richard; Rayner, Julian C.; Holder, Anthony A.; Wright, Gavin J.; Draper, Simon J.

2013-01-01

There is intense interest in induction and characterization of strain-transcending neutralizing antibody against antigenically variable human pathogens. We have recently identified the human malaria parasite Plasmodium falciparum reticulocyte-binding protein homologue 5 (PfRH5) as a target of broadly-neutralizing antibodies, but there is little information regarding the functional mechanism(s) of antibody-mediated neutralization. Here, we report that vaccine-induced polyclonal anti-PfRH5 antibodies inhibit the tight attachment of merozoites to erythrocytes, and are capable of blocking the interaction of PfRH5 with its receptor basigin. Furthermore, by developing anti-PfRH5 monoclonal antibodies (mAbs), we provide evidence that i) the ability to block the PfRH5-basigin interaction in vitro is predictive of functional activity, but absence of blockade does not predict absence of functional activity; ii) neutralizing mAbs bind spatially-related epitopes on the folded protein, involving at least two defined regions of the PfRH5 primary sequence; iii) a brief exposure window of PfRH5 is likely to necessitate rapid binding of antibody to neutralize parasites; and iv) intact bivalent IgG contributes to but is not necessary for parasite neutralization. These data provide important insight into the mechanisms of broadly-neutralizing anti-malaria antibodies and further encourage anti-PfRH5 based malaria prevention efforts. PMID:24293631

The malaria parasite RhopH protein complex interacts with erythrocyte calmyrin identified from a comprehensive erythrocyte protein library.

PubMed

Miura, Toyokazu; Takeo, Satoru; Ntege, Edward H; Otsuki, Hitoshi; Sawasaki, Tatsuya; Ishino, Tomoko; Takashima, Eizo; Tsuboi, Takafumi

2018-06-02

Malaria merozoite apical organelles; microneme and rhoptry secreted proteins play functional roles during and following invasion of host erythrocytes. Among numerous proteins, the rhoptries discharge high molecular weight proteins known as RhopH complex. Recent reports suggest that the RhopH complex is essential for growth and survival of the malaria parasite within erythrocytes. However, an in-depth understanding of the host-parasite molecular interactions is indispensable. Here we utilized a comprehensive mouse erythrocyte protein library consisting of 443 proteins produced by a wheat germ cell-free system, combined with AlphaScreen technology to identify mouse erythrocyte calmyrin as an interacting molecule of the rodent malaria parasite Plasmodium yoelii RhopH complex (PyRhopH). The PyRhopH interaction was dependent on the calmyrin N-terminus and divalent cation capacity. The finding unveils a recommendable and invaluable usefulness of our comprehensive mouse erythrocyte protein library together with the AlphaScreen technology in investigating a wide-range of host-parasite molecular interactions. Copyright © 2018 Elsevier Inc. All rights reserved.

Sarcocystis neurona manipulation using culture-derived merozoites for bradyzoite and sporocyst production.

PubMed

Chaney, Sarah B; Marsh, Antoinette E; Lewis, Stephanie; Carman, Michelle; Howe, Daniel K; Saville, William J; Reed, Stephen M

2017-04-30

Equine protozoal myeloencephalitis (EPM) remains a significant central nervous system disease of horses in the American continents. Sarcocystis neurona is considered the primary causative agent and its intermediate life stages are carried by a wide host-range including raccoons (Procyon lotor) in North America. S. neurona sarcocysts mature in raccoon skeletal muscle and can produce central nervous system disease in raccoons, mirroring the clinical presentation in horses. The study aimed to develop laboratory tools whereby the life cycle and various life stages of S. neurona could be better studied and manipulated using in vitro and in vivo systems and compare the biology of two independent isolates. This study utilized culture-derived parasites from S. neurona strains derived from a raccoon or from a horse to initiate raccoon infections. Raccoon tissues, including fresh and cryopreserved tissues, were used to establish opossum (Didelphis virginiana) infections, which then shed sporocyts with retained biological activity to cause encephalitis in mice. These results demonstrate that sarcocysts can be generated using in vitro-derived S. neurona merozoites, including an isolate originally derived from a naturally infected horse with clinical EPM. This study indicates the life cycle can be significantly manipulated in the laboratory without affecting subsequent stage development, allowing further purification of strains and artificial maintenance of the life cycle. Published by Elsevier B.V.

Acquired Antibodies to Merozoite Antigens in Children from Uganda with Uncomplicated or Severe Plasmodium falciparum Malaria

PubMed Central

Ahmed Ismail, Hodan; Ribacke, Ulf; Reiling, Linda; Normark, Johan; Egwang, Tom; Kironde, Fred; Beeson, James G.; Wahlgren, Mats

2013-01-01

Malaria can present itself as an uncomplicated or severe disease. We have here studied the quantity and quality of antibody responses against merozoite antigens, as well as multiplicity of infection (MOI), in children from Uganda. We found higher levels of IgG antibodies toward erythrocyte-binding antigen EBA181, MSP2 of Plasmodium falciparum 3D7 and FC27 (MSP2-3D7/FC27), and apical membrane antigen 1 (AMA1) in patients with uncomplicated malaria by enzyme-linked immunosorbent assay (ELISA) but no differences against EBA140, EBA175, MSP1, and reticulocyte-binding protein homologues Rh2 and Rh4 or for IgM against MSP2-3D7/FC27.Patients with uncomplicated malaria were also shown to have higher antibody affinities for AMA1 by surface plasmon resonance (SPR). Decreased invasion of two clinical P. falciparum isolates in the presence of patient plasma correlated with lower initial parasitemia in the patients, in contrast to comparisons of parasitemia to ELISA values or antibody affinities, which did not show any correlations. Analysis of the heterogeneity of the infections revealed a higher MOI in patients with uncomplicated disease, with the P. falciparum K1 MSP1 (MSP1-K1) and MSP2-3D7 being the most discriminative allelic markers. Higher MOIs also correlated positively with higher antibody levels in several of the ELISAs. In conclusion, certain antibody responses and MOIs were associated with differences between uncomplicated and severe malaria. When different assays were combined, some antibodies, like those against AMA1, seemed particularly discriminative. However, only decreased invasion correlated with initial parasitemia in the patient, signaling the importance of functional assays in understanding development of immunity against malaria and in evaluating vaccine candidates. PMID:23740926

Exposure to Sarcocystis spp. in horses from Spain determined by Western blot analysis using Sarcocystis neurona merozoites as heterologous antigen.

PubMed

Arias, M; Yeargan, M; Francisco, I; Dangoudoubiyam, S; Becerra, P; Francisco, R; Sánchez-Andrade, R; Paz-Silva, A; Howe, D K

2012-04-30

Horses serve as an intermediate host for several species of Sarcocystis, all of which utilize canids as the definitive host. Sarcocystis spp. infection and formation of latent sarcocysts in horses often appears to be subclinical, but morbidity can occur, especially when the parasite burden is large. A serological survey was conducted to determine the presence of antibodies against Sarcocystis spp. in seemingly healthy horses from the Galicia region of Spain. Western blot analyses using Sarcocystis neurona merozoites as heterologous antigen suggested greater than 80% seroprevalance of Sarcocystis spp. in a sample set of 138 horses. The serum samples were further tested with enzyme-linked immunosorbent assays (ELISAs) based on recombinant S. neurona-specific surface antigens (rSnSAGs). As expected for horses from the Eastern Hemisphere, less than 4% of the serum samples were positive when analyzed with either the rSnSAG2 or the rSnSAG4/3 ELISAs. An additional 246 horses were tested using the rSnSAG2 ELISA, which revealed that less than 3% of the 384 samples were seropositive. Collectively, the results of this serologic study suggested that a large proportion of horses from this region of Spain are exposed to Sarcocystis spp. Furthermore, the anti-Sarcocystis seroreactivity in these European horses could be clearly distinguished from anti-S. neurona antibodies using the rSnSAG2 and rSnSAG4/3 ELISAs. Copyright © 2011 Elsevier B.V. All rights reserved.

Natural antibody response to Plasmodium falciparum merozoite antigens MSP5, MSP9 and EBA175 is associated to clinical protection in the Brazilian Amazon

PubMed Central

2013-01-01

Background Antibodies have an essential role in the acquired immune response against blood stage P. falciparum infection. Although several antigens have been identified as important antibody targets, it is still elusive which antigens have to be recognized for clinical protection. Herein, we analyzed antibodies from plasmas from symptomatic or asymptomatic individuals living in the same geographic area in the Western Amazon, measuring their recognition of multiple merozoite antigens. Methods Specific fragments of genes encoding merozoite proteins AMA1 and members of MSP and EBL families from circulating P. falciparum field isolates present in asymptomatic and symptomatic patients were amplified by PCR. After cloning and expression of different versions of the antigens as recombinant GST-fusion peptides, we tested the reactivity of patients’ plasmas by ELISA and the presence of IgG subclasses in the most reactive plasmas. Results 11 out of 24 recombinant antigens were recognized by plasmas from either symptomatic or asymptomatic infections. Antibodies to MSP9 (X2DF=1 = 9.26/p = 0.0047) and MSP5 (X2DF=1 = 8.29/p = 0.0069) were more prevalent in asymptomatic individuals whereas the opposite was observed for MSP1 block 2-MAD20 (X2DF=1 = 6.41/p = 0.0206, Fisher’s exact test). Plasmas from asymptomatic individuals reacted more intensely against MSP4 (U = 210.5, p < 0.03), MSP5 (U = 212, p < 0.004), MSP9 (U = 189.5, p < 0.002) and EBA175 (U = 197, p < 0.014, Mann-Whitney’s U test). IgG1 and IgG3 were predominant for all antigens, but some patients also presented with IgG2 and IgG4. The recognition of MSP5 (OR = 0.112, IC95% = 0.021-0.585) and MSP9 (OR = 0.125, IC95% = 0.030-0.529, cross tab analysis) predicted 8.9 and 8 times less chances, respectively, to present symptoms. Higher antibody levels against MSP5 and EBA175 were associated by odds ratios of 9.4 (IC95% = 1.29-69.25) and 5.7 (IC95

In Vitro Alterations Do Not Reflect a Requirement for Host Cell Cycle Progression during Plasmodium Liver Stage Infection

PubMed Central

Hanson, Kirsten K.; March, Sandra; Ng, Shengyong; Bhatia, Sangeeta N.

2014-01-01

Prior to invading nonreplicative erythrocytes, Plasmodium parasites undergo their first obligate step in the mammalian host inside hepatocytes, where each sporozoite replicates to generate thousands of merozoites. While normally quiescent, hepatocytes retain proliferative capacity and can readily reenter the cell cycle in response to diverse stimuli. Many intracellular pathogens, including protozoan parasites, manipulate the cell cycle progression of their host cells for their own benefit, but it is not known whether the hepatocyte cell cycle plays a role during Plasmodium liver stage infection. Here, we show that Plasmodium parasites can be observed in mitotic hepatoma cells throughout liver stage development, where they initially reduce the likelihood of mitosis and ultimately lead to significant acquisition of a binucleate phenotype. However, hepatoma cells pharmacologically arrested in S phase still support robust and complete Plasmodium liver stage development, which thus does not require cell cycle progression in the infected cell in vitro. Furthermore, murine hepatocytes remain quiescent throughout in vivo infection with either Plasmodium berghei or Plasmodium yoelii, as do Plasmodium falciparum-infected primary human hepatocytes, demonstrating that the rapid and prodigious growth of liver stage parasites is accomplished independent of host hepatocyte cell cycle progression during natural infection. PMID:25416236

Plasmodium vivax Tryptophan Rich Antigen PvTRAg36.6 Interacts with PvETRAMP and PvTRAg56.6 Interacts with PvMSP7 during Erythrocytic Stages of the Parasite

PubMed Central

Tyagi, Kriti; Hossain, Mohammad Enayet; Thakur, Vandana; Aggarwal, Praveen; Malhotra, Pawan; Mohmmed, Asif; Sharma, Yagya Dutta

2016-01-01

Plasmodium vivax is most wide spread and a neglected malaria parasite. There is a lack of information on parasite biology of this species. Genome of this parasite encodes for the largest number of tryptophan-rich proteins belonging to ‘Pv-fam-a’ family and some of them are potential drug/vaccine targets but their functional role(s) largely remains unexplored. Using bacterial and yeast two hybrid systems, we have identified the interacting partners for two of the P. vivax tryptophan-rich antigens called PvTRAg36.6 and PvTRAg56.2. The PvTRAg36.6 interacts with early transcribed membrane protein (ETRAMP) of P.vivax. It is apically localized in merozoites but in early stages it is seen in parasite periphery suggesting its likely involvement in parasitophorous vacuole membrane (PVM) development or maintenance. On the other hand, PvTRAg56.2 interacts with P.vivax merozoite surface protein7 (PvMSP7) and is localized on merozoite surface. Co-localization of PvTRAg56.2 with PvMSP1 and its molecular interaction with PvMSP7 probably suggest that, PvTRAg56.2 is part of MSP-complex, and might assist or stabilize the protein complex at the merozoite surface. In conclusion, the PvTRAg proteins have different sub cellular localizations and specific associated functions during intra-erythrocytic developmental cycle. PMID:26954579

Effect of chloroquine on gene expression of Plasmodium yoelii nigeriensis during its sporogonic development in the mosquito vector

PubMed Central

Silveira, Henrique; Ramos, Susana; Abrantes, Patrícia; Lopes, Luís Filipe; do Rosario, Virgílio E; Abrahamsen, Mitchell S

2007-01-01

Background The anti-malarial chloroquine can modulate the outcome of infection during the Plasmodium sporogonic development, interfering with Plasmodium gene expression and subsequently, with transmission. The present study sets to identify Plasmodium genes that might be regulated by chloroquine in the mosquito vector. Methods Differential display RT-PCR (DDRT-PCR) was used to identify genes expressed during the sporogonic cycle that are regulated by exposure to chloroquine. Anopheles stephensi mosquitoes were fed on Plasmodium yoelii nigeriensis-infected mice. Three days post-infection, mosquitoes were fed a non-infectious blood meal from mice treated orally with 50 mg/kg chloroquine. Two differentially expressed Plasmodium transcripts (Pyn_chl091 and Pyn_chl055) were further characterized by DNA sequencing and real-time PCR analysis. Results Both transcripts were represented in Plasmodium EST databases, but displayed no homology with any known genes. Pyn_chl091 was upregulated by day 18 post infection when the mosquito had a second blood meal. However, when the effect of chloroquine on that transcript was investigated during the erythrocytic cycle, no significant differences were observed. Although slightly upregulated by chloroquine exposure the expression of Pyn_chl055 was more affected by development, increasing towards the end of the sporogonic cycle. Transcript abundance of Pyn_chl055 was reduced when erythrocytic stages were treated with chloroquine. Conclusion Chloroquine increased parasite load in mosquito salivary glands and interferes with the expression of at least two Plasmodium genes. The transcripts identified contain putative signal peptides and transmembrane domains suggesting that these proteins, due to their location, are targets of chloroquine (not as an antimalarial) probably through cell trafficking and recycling. PMID:17605769

Effect of malaria transmission reduction by insecticide-treated bed nets (ITNs) on the genetic diversity of Plasmodium falciparum merozoite surface protein (MSP-1) and circumsporozoite (CSP) in western Kenya.

PubMed

Kariuki, Simon K; Njunge, James; Muia, Ann; Muluvi, Geofrey; Gatei, Wangeci; Ter Kuile, Feiko; Terlouw, Dianne J; Hawley, William A; Phillips-Howard, Penelope A; Nahlen, Bernard L; Lindblade, Kim A; Hamel, Mary J; Slutsker, Laurence; Shi, Ya Ping

2013-08-27

Although several studies have investigated the impact of reduced malaria transmission due to insecticide-treated bed nets (ITNs) on the patterns of morbidity and mortality, there is limited information on their effect on parasite diversity. Sequencing was used to investigate the effect of ITNs on polymorphisms in two genes encoding leading Plasmodium falciparum vaccine candidate antigens, the 19 kilodalton blood stage merozoite surface protein-1 (MSP-1(19kDa)) and the Th2R and Th3R T-cell epitopes of the pre-erythrocytic stage circumsporozoite protein (CSP) in a large community-based ITN trial site in western Kenya. The number and frequency of haplotypes as well as nucleotide and haplotype diversity were compared among parasites obtained from children <5 years old prior to the introduction of ITNs (1996) and after 5 years of high coverage ITN use (2001). A total of 12 MSP-1(19kDa) haplotypes were detected in 1996 and 2001. The Q-KSNG-L and E-KSNG-L haplotypes corresponding to the FVO and FUP strains of P. falciparum were the most prevalent (range 32-37%), with an overall haplotype diversity of > 0.7. No MSP-1(19kDa) 3D7 sequence-types were detected in 1996 and the frequency was less than 4% in 2001. The CSP Th2R and Th3R domains were highly polymorphic with a total of 26 and 14 haplotypes, respectively detected in 1996 and 34 and 13 haplotypes in 2001, with an overall haplotype diversity of > 0.9 and 0.75 respectively. The frequency of the most predominant Th2R and Th3R haplotypes was 14 and 36%, respectively. The frequency of Th2R and Th3R haplotypes corresponding to the 3D7 parasite strain was less than 4% at both time points. There was no significant difference in nucleotide and haplotype diversity in parasite isolates collected at both time points. High diversity in these two genes has been maintained overtime despite marked reductions in malaria transmission due to ITNs use. The frequency of 3D7 sequence-types was very low in this area. These findings provide

Sarcocystis neurona infection in gamma interferon gene knockout (KO) mice: comparative infectivity of sporocysts in two strains of KO mice, effect of trypsin digestion on merozoite viability, and infectivity of bradyzoites to KO mice and cell culture.

PubMed

Dubey, J P; Sundar, N; Kwok, O C H; Saville, W J A

2013-09-01

The protozoan Sarcocystis neurona is the primary cause of Equine Protozoal Myeloencephalitis (EPM). EPM or EPM-like illness has been reported in horses, sea otters, and several other mammals. The gamma interferon gene knockout (KO) mouse is often used as a model to study biology and discovery of new therapies against S. neurona because it is difficult to induce clinical EPM in other hosts, including horses. In the present study, infectivity of three life cycle stages (merozoites, bradyzoites, sporozoites) to KO mice and cell culture was studied. Two strains of KO mice (C57-black, and BALB/c-derived, referred here as black or white) were inoculated orally graded doses of S. neurona sporocysts; 12 sporocysts were infective to both strains of mice and all infected mice died or became ill within 70 days post-inoculation. Although there was no difference in infectivity of sporocysts to the two strains of KO mice, the disease was more severe in black mice. S. neurona bradyzoites were not infectious to KO mice and cell culture. S. neurona merozoites survived 120 min incubation in 0.25% trypsin, indicating that trypsin digestion can be used to recover S. neurona from tissues of acutely infected animals. Published by Elsevier B.V.

STING-Licensed Macrophages Prime Type I IFN Production by Plasmacytoid Dendritic Cells in the Bone Marrow during Severe Plasmodium yoelii Malaria

PubMed Central

Fooksman, David; Moore, Jamie M.; Saidi, Alex; Feintuch, Catherine M.; Reizis, Boris; Chorro, Laurent; Daily, Johanna; Lauvau, Grégoire

2016-01-01

Malaria remains a global health burden causing significant morbidity, yet the mechanisms underlying disease outcomes and protection are poorly understood. Herein, we analyzed the peripheral blood of a unique cohort of Malawian children with severe malaria, and performed a comprehensive overview of blood leukocytes and inflammatory mediators present in these patients. We reveal robust immune cell activation, notably of CD14+ inflammatory monocytes, NK cells and plasmacytoid dendritic cells (pDCs) that is associated with very high inflammation. Using the Plasmodium yoelii 17X YM surrogate mouse model of lethal malaria, we report a comparable pattern of immune cell activation and inflammation and found that type I IFN represents a key checkpoint for disease outcomes. Compared to wild type mice, mice lacking the type I interferon (IFN) receptor exhibited a significant decrease in immune cell activation and inflammatory response, ultimately surviving the infection. We demonstrate that pDCs were the major producers of systemic type I IFN in the bone marrow and the blood of infected mice, via TLR7/MyD88-mediated recognition of Plasmodium parasites. This robust type I IFN production required priming of pDCs by CD169+ macrophages undergoing activation upon STING-mediated sensing of parasites in the bone marrow. pDCs and macrophages displayed prolonged interactions in this compartment in infected mice as visualized by intravital microscopy. Altogether our findings describe a novel mechanism of pDC activation in vivo and precise stepwise cell/cell interactions taking place during severe malaria that contribute to immune cell activation and inflammation, and subsequent disease outcomes. PMID:27792766

A recombinant chimeric Ad5/3 vector expressing a multi-stage Plasmodium antigen induces protective immunity in mice using heterologous prime-boost immunization regimens1

PubMed Central

Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto

2016-01-01

An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299

Human antibodies fix complement to inhibit Plasmodium falciparum invasion of erythrocytes and are associated with protection against malaria.

PubMed

Boyle, Michelle J; Reiling, Linda; Feng, Gaoqian; Langer, Christine; Osier, Faith H; Aspeling-Jones, Harvey; Cheng, Yik Sheng; Stubbs, Janine; Tetteh, Kevin K A; Conway, David J; McCarthy, James S; Muller, Ivo; Marsh, Kevin; Anders, Robin F; Beeson, James G

2015-03-17

Antibodies play major roles in immunity to malaria; however, a limited understanding of mechanisms mediating protection is a major barrier to vaccine development. We have demonstrated that acquired human anti-malarial antibodies promote complement deposition on the merozoite to mediate inhibition of erythrocyte invasion through C1q fixation and activation of the classical complement pathway. Antibody-mediated complement-dependent (Ab-C') inhibition was the predominant invasion-inhibitory activity of human antibodies; most antibodies were non-inhibitory without complement. Inhibitory activity was mediated predominately via C1q fixation, and merozoite surface proteins 1 and 2 were identified as major targets. Complement fixation by antibodies was very strongly associated with protection from both clinical malaria and high-density parasitemia in a prospective longitudinal study of children. Ab-C' inhibitory activity could be induced by human immunization with a candidate merozoite surface-protein vaccine. Our findings demonstrate that human anti-malarial antibodies have evolved to function by fixing complement for potent invasion-inhibitory activity and protective immunity. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Analysis of antibodies to newly described Plasmodium falciparum merozoite antigens supports MSPDBL2 as a predicted target of naturally acquired immunity.

PubMed

Tetteh, Kevin K A; Osier, Faith H A; Salanti, Ali; Kamuyu, Gathoni; Drought, Laura; Failly, Marilyne; Martin, Christophe; Marsh, Kevin; Conway, David J

2013-10-01

Prospective studies continue to identify malaria parasite genes with particular patterns of polymorphism which indicate they may be under immune selection, and the encoded proteins require investigation. Sixteen new recombinant protein reagents were designed to characterize three such polymorphic proteins expressed in Plasmodium falciparum schizonts and merozoites: MSPDBL1 (also termed MSP3.4) and MSPDBL2 (MSP3.8), which possess Duffy binding-like (DBL) domains, and SURFIN4.2, encoded by a member of the surface-associated interspersed (surf) multigene family. After testing the antigenicities of these reagents by murine immunization and parasite immunofluorescence, we analyzed naturally acquired antibody responses to the antigens in two cohorts in coastal Kenya in which the parasite was endemic (Chonyi [n = 497] and Ngerenya [n = 461]). As expected, the prevalence and levels of serum antibodies increased with age. We then investigated correlations with subsequent risk of clinical malaria among children <11 years of age during 6 months follow-up surveillance. Antibodies to the polymorphic central region of MSPDBL2 were associated with reduced risk of malaria in both cohorts, with statistical significance remaining for the 3D7 allelic type after adjustment for individuals' ages in years and antibody reactivity to whole-schizont extract (Chonyi, risk ratio, 0.51, and 95% confidence interval [CI], 0.28 to 0.93; Ngerenya, risk ratio, 0.38, and 95% CI, 0.18 to 0.82). For the MSPDBL1 Palo Alto allelic-type antigen, there was a protective association in one cohort (Ngerenya, risk ratio, 0.53, and 95% CI, 0.32 to 0.89), whereas the other antigens showed no protective associations after adjustment. These findings support the prediction that antibodies to the polymorphic region of MSPDBL2 contribute to protective immunity.

A Subdominant CD8+ Cytotoxic T Lymphocyte (CTL) Epitope from the Plasmodium yoelii Circumsporozoite Protein Induces CTLs That Eliminate Infected Hepatocytes from Culture

PubMed Central

Franke, Eileen D.; Sette, Alessandro; Sacci, John; Southwood, Scott; Corradin, Giampietro; Hoffman, Stephen L.

2000-01-01

Previous studies indicated that the Plasmodium yoelii circumsporozoite protein (PyCSP) 57–70 region elicits T cells capable of eliminating infected hepatocytes in vitro. Herein, we report that the PyCSP58–67 sequence contains an H-2d binding motif, which binds purified Kd molecules in vitro with low affinity (3,267 nM) and encodes an H-2d-restricted cytotoxic T lymphocyte (CTL) epitope. Immunization of BALB/c mice with three doses of a multiple antigen peptide (MAP) construct containing four branches of amino acids 57 to 70 linked to a lysine-glycine core [MAP4(PyCSP57–70)] and Lipofectin as the adjuvant induced both T-cell proliferation and a peptide-specific CTL response that was PyCSP59–67 specific, H-2d restricted, and CD8+ T cell dependent. Immunization with either DNA encoding the PyCSP or irradiated sporozoites demonstrated that this CTL epitope is subdominant since it is not recognized in the context of whole CSP immunization. The biological relevance of this CTL response was underlined by the demonstration that it could mediate genetically restricted, CD8+- and nitric-oxide-dependent elimination of infected hepatocytes in vitro, as well as partial protection of BALB/c mice against sporozoite challenge. These findings indicate that subdominant epitopes with low major histocompatibility complex affinity can be used to engineer epitope-based vaccines and have implications for the selection of epitopes for subunit-based vaccines. PMID:10816491

Variation in the immune responses against Plasmodium falciparum merozoite surface protein-1 and apical membrane antigen-1 in children residing in the different epidemiological strata of malaria in Cameroon.

PubMed

Kwenti, Tebit Emmanuel; Moye, Adzemye Linus; Wiylanyuy, Adzemye Basil; Njunda, Longdoh Anna; Nkuo-Akenji, Theresa

2017-11-09

Studies to assess the immune responses against malaria in Cameroonian children are limited. The purpose of this study was to assess the immune responses against Plasmodium falciparum merozoite surface protein-1 (MSP-1 19 ) and apical membrane antigen-1 (AMA-1) in children residing in the different epidemiological strata of malaria in Cameroon. In a cross-sectional survey performed between April and July 2015, 602 children between 2 and 15 years (mean ± SD = 5.7 ± 3.7), comprising 319 (53%) males were enrolled from five epidemiological strata of malaria in Cameroon including: the sudano-sahelian (SS) strata, the high inland plateau (HIP) strata, the south Cameroonian equatorial forest (SCEF) strata, the high western plateau (HWP) strata, and the coastal (C) strata. The children were screened for clinical malaria (defined by malaria parasitaemia ≥ 5000 parasites/µl plus axillary temperature ≥ 37.5 °C). Their antibody responses were measured against P. falciparum MSP-1 19 and AMA-1 vaccine candidate antigens using standard ELISA technique. A majority of the participants were IgG responders 72.1% (95% CI 68.3-75.6). The proportion of responders was higher in females (p = 0.002) and in children aged 10 years and above (p = 0.005). The proportion of responders was highest in Limbe (C strata) and lowest in Ngaoundere (HIP strata) (p < 0.0001). Similarly, the mean IgG antibody levels were higher in children aged 10 years and above (p < 0.0001) and in Limbe (p = 0.001). The IgG antibody levels against AMA-1 were higher in females (p = 0.028), meanwhile no gender disparity was observed with MSP-1. Furthermore the risk of clinical malaria (p < 0.0001) and the mean parasite density (p = 0.035) were higher in IgG non-responders. A high proportion of IgG responders was observed in this study, suggesting a high degree exposure of the target population to malaria parasites. The immune responses varied considerably across the different strata

Polysaccharides from the Chinese medicinal herb Achyranthes bidentata enhance anti-malarial immunity during Plasmodium yoelii 17XL infection in mice.

PubMed

Zhu, Xiaotong; Pan, Yanyan; Zheng, Li; Cui, Liwang; Cao, Yaming

2012-02-20

Clinical immunity to malaria in human populations is developed after repeated exposure to malaria. Regulation and balance of host immune responses may lead to optimal immunity against malaria parasite infection. Polysaccharides (ABPS) derived from the Chinese herb ox knee Achyranthes bidentata possess immuno-modulatory functions. The aim of this study is to use the rodent malaria model Plasmodium yoelii 17XL (P. y17XL) to examine whether pretreatment with ABPS will modulate host immunity against malaria infection and improve the outcome of the disease. To determine whether ABPS could modulate immunity against malaria, mice were pretreated with ABPS prior to blood-stage infection by P. y17XL. Host survival and parasitaemia were monitored daily. The effect of pretreatment on host immune responses was studied through the quantitation of cytokines, dendritic cell populations, and natural regulatory T cells (Treg). Pretreatment with ABPS prior to infection significantly extended the survival time of mice after P. y17XL infection. At three and five days post-infection, ABPS pretreated mice developed stronger Th1 immune responses against malaria infection with the number of F4/80+CD36+ macrophages and levels of IFN-γ, TNF-α and nitric oxide being significantly higher than in the control group. More importantly, ABPS-treated mice developed more myeloid (CD11c+CD11b+) and plasmacytoid dendritic cells (CD11c+CD45R+/B220+) than control mice. ABPS pretreatment also resulted in modulated expression of MHC-II, CD86, and especially Toll-like receptor 9 by CD11c+ dendritic cells. In comparison, pretreatment with ABPS did not alter the number of natural Treg or the production of the anti-inflammatory cytokine IL-10. Pretreatment with the immuno-modulatory ABPS selectively enhanced Th1 immune responses to control the proliferation of malaria parasites, and prolonged the survival of mice during subsequent malaria infection.

Comparative transcriptome analysis of second- and third-generation merozoites of Eimeria necatrix.

PubMed

Su, Shijie; Hou, Zhaofeng; Liu, Dandan; Jia, Chuanli; Wang, Lele; Xu, Jinjun; Tao, Jianping

2017-08-16

Eimeria is a common genus of apicomplexan parasites that infect diverse vertebrates, most notably poultry, causing serious disease and economic losses. Eimeria species have complex life-cycles consisting of three developmental stages. However, the molecular basis of the Eimeria reproductive mode switch remains an enigma. Total RNA extracted from second- (MZ-2) and third-generation merozoites (MZ-3) of Eimeria necatrix was subjected to transcriptome analysis using RNA sequencing (RNA-seq) followed by qRT-PCR validation. A total of 6977 and 6901 unigenes were obtained from MZ-2 and MZ-3, respectively. Approximately 2053 genes were differentially expressed genes (DEGs) between MZ-2 and MZ-3. Compared with MZ-2, 837 genes were upregulated and 1216 genes were downregulated in MZ-3. Approximately 95 genes in MZ-2 and 48 genes in MZ-3 were further identified to have stage-specific expression. Gene ontology category and KEGG analysis suggested that 216 upregulated genes in MZ-2 were annotated by 70 GO assignments, 242 upregulated genes were associated with 188 signal pathways, while 321 upregulated genes in MZ-3 were annotated by 56 GO assignments, 322 upregulated genes were associated with 168 signal pathways. The molecular functions of upregulated genes in MZ-2 were mainly enriched for protein degradation and amino acid metabolism. The molecular functions of upregulated genes in MZ-3 were mainly enriched for transcriptional activity, cell proliferation and cell differentiation. To the best of our knowledge, this is the first RNA-seq data study of the MZ-2 and MZ-3 stages of E. necatrix; it demonstrates a high number of differentially expressed genes between the MZ-2 and MZ-3 of E. necatrix. This study forms a basis for deciphering the molecular mechanisms underlying the shift from the second to third generation schizogony in Eimeria. It also provides valuable resources for future studies on Eimeria, and provides insight into the understanding of reproductive mode

Ability of TEP1 in intestinal flora to modulate natural resistance of Anopheles dirus.

PubMed

Wang, Yanyan; Wang, Ying; Zhang, Jingru; Xu, Wenyue; Zhang, Jian; Huang, Fu Sheng

2013-08-01

Blocking transmission of malaria is a reliable way to control and eliminate infection. However, in-depth knowledge of the interaction between Plasmodium and mosquito is needed. Studies suggest that innate immunity is the main mechanism inhibiting development of malaria parasites in the mosquito. Recent studies have found that use of antibiotics that inhibit the mosquito gut flora can reduce the immune response of Anopheles gambiae, thereby contributing to the development of malaria parasites. In our study, we used the non susceptible model of Anopheles dirus-Plasmodium yoelii to explore the effect of Anopheles intestinal flora on the natural resistance of A. dirus to P. yoelii. We found that in mosquitoes infected with Plasmodium, the intestinal flora can regulate expression of thioester-containing protein (TEP1) via an RNAi gene-silencing approach. Our results suggest that in the absence of TEP1, the natural microbiota cannot suppress the development of P. yoelii in A. dirus. This suggests that AdTEP1 plays an important role in the resistance of A. dirus to P. yoelii. The intestinal flora may modulate the development of P. yoelii in A. dirus by regulating TEP1 expression. Copyright © 2013 Elsevier Inc. All rights reserved.

Results from tandem Phase 1 studies evaluating the safety, reactogenicity and immunogenicity of the vaccine candidate antigen Plasmodium falciparum FVO merozoite surface protein-1 (MSP142) administered intramuscularly with adjuvant system AS01

PubMed Central

2013-01-01

Background The development of an asexual blood stage vaccine against Plasmodium falciparum malaria based on the major merozoite surface protein-1 (MSP1) antigen is founded on the protective efficacy observed in preclinical studies and induction of invasion and growth inhibitory antibody responses. The 42 kDa C-terminus of MSP1 has been developed as the recombinant protein vaccine antigen, and the 3D7 allotype, formulated with the Adjuvant System AS02A, has been evaluated extensively in human clinical trials. In preclinical rabbit studies, the FVO allele of MSP142 has been shown to have improved immunogenicity over the 3D7 allele, in terms of antibody titres as well as growth inhibitory activity of antibodies against both the heterologous 3D7 and homologous FVO parasites. Methods Two Phase 1 clinical studies were conducted to examine the safety, reactogenicity and immunogenicity of the FVO allele of MSP142 in the adjuvant system AS01 administered intramuscularly at 0-, 1-, and 2-months: one in the USA and, after evaluation of safety data results, one in Western Kenya. The US study was an open-label, dose escalation study of 10 and 50 μg doses of MSP142 in 26 adults, while the Kenya study, evaluating 30 volunteers, was a double-blind, randomized study of only the 50 μg dose with a rabies vaccine comparator. Results In these studies it was demonstrated that this vaccine formulation has an acceptable safety profile and is immunogenic in malaria-naïve and malaria-experienced populations. High titres of anti-MSP1 antibodies were induced in both study populations, although there was a limited number of volunteers whose serum demonstrated significant inhibition of blood-stage parasites as measured by growth inhibition assay. In the US volunteers, the antibodies generated exhibited better cross-reactivity to heterologous MSP1 alleles than a MSP1-based vaccine (3D7 allele) previously tested at both study sites. Conclusions Given that the primary effector mechanism for

Effects of environmental factors on MSP21-25 aggregation indicate the roles of hydrophobic and electrostatic interactions in the aggregation process.

PubMed

Zhang, Xuecheng; Dong, Yuanqiu; Yu, Jigang; Tu, Xiaoming

2014-01-01

Merozoite surface protein 2 (MSP2), one of the most abundant proteins on the merozoite surface of Plasmodium falciparum, is recognized to be important for the parasite's invasion into the host cell and is thus a promising malaria vaccine candidate. However, mediated mainly by its conserved N-terminal 25 residues (MSP21-25), MSP2 readily forms amyloid fibril-like aggregates under physiological conditions in vitro, which impairs its potential as a vaccine component. In addition, there is evidence that MSP2 exists in aggregated forms on the merozoite surface in vivo. To elucidate the aggregation mechanism of MSP21-25 and thereby understand the behavior of MSP2 in vivo and find ways to avoid the aggregation of relevant vaccine in vitro, we investigated the effects of agitation, pH, salts, 1-anilinonaphthalene-8-sulfonic acid (ANS), trimethylamine N-oxide dihydrate (TMAO), urea, and sub-micellar sodium dodecyl sulfate (SDS) on the aggregation kinetics of MSP21-25 using thioflavin T (ThT) fluorescence. The results showed that MSP21-25 aggregation was accelerated by agitation, while repressed by acidic pHs. The salts promoted the aggregation in an anion nature-dependent pattern. Hydrophobic surface-binding agent ANS and detergent urea repressed MSP21-25 aggregation, in contrast to hydrophobic interaction strengthener TMAO, which enhanced the aggregation. Notably, sub-micellar SDS, contrary to its micellar form, promoted MSP21-25 aggregation significantly. Our data indicated that hydrophobic interactions are the predominant driving force of the nucleation of MSP21-25 aggregation, while the elongation is controlled mainly by electrostatic interactions. A kinetic model of MSP21-25 aggregation and its implication were also discussed.

Recognition and invasion of human erythrocytes by malarial parasites: contribution of sialoglycoproteins to attachment and host specificity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, M.J.; Blankenberg, T.; Sensabaugh, G.

1984-05-01

The receptivity of human erythrocytes to invasion by Plasmodium falciparum merozoites can be decreased by neuraminidase or trypsin treatment, an observation that supports a role for the erythrocyte sialoglycoproteins (glycophorins) in invasion. We have found that ..cap alpha../sub 1/-acid glycoprotein (AGP), added to in vitro cultures, can restore invasion of enzyme-treated human erythrocytes. AGP is structurally different from the glycophorins although it does carry 12% sialic acid. Its ability to restore receptivity to desialylated cells is dependent on its sialic acid complement, its concentration, and its binding to the erythrocyte surface. We present evidence that AGP forms a bridge betweenmore » the merozoite and the enzyme-treated erythrocyte that allows the stronger and more complex interactions of invasion to proceed. We suggest that the glycophorins play the same role on the surface of the intact erythrocyte. 31 references, 3 figures, 6 tables.« less

Novel Antigen Identification Method for Discovery of Protective Malaria Antigens by Rapid Testing of DNA Vaccines Encoding Exons from the Parasite Genome

PubMed Central

Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.

2004-01-01

We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966

Human Monoclonal Antibodies to Pf 155, a Major Antigen of Malaria Parasite Plasmodium falciparum

NASA Astrophysics Data System (ADS)

Udomsangpetch, Rachanee; Lundgren, Katarina; Berzins, Klavs; Wahlin, Birgitta; Perlmann, Hedvig; Troye-Blomberg, Marita; Carlsson, Jan; Wahlgren, Mats; Perlmann, Peter; Bjorkman, Anders

1986-01-01

Pf 155, a protein of the human malaria parasite Plasmodium falciparum, is strongly immunogenic in humans and is believed to be a prime candidate for the preparation of a vaccine. Human monoclonal antibodies to Pf 155 were obtained by cloning B cells that had been prepared from an immune donor and transformed with Epstein-Barr virus. When examined by indirect immunofluorescence, these antibodies stained the surface of infected erythrocytes, free merozoites, segmented schizonts, and gametocytes. They bound to a major polypeptide with a relative molecular weight of 155K and to two minor ones (135K and 120K), all having high affinity for human glycophorin. The antibodies strongly inhibited merozoite reinvasion in vitro, suggesting that they might be appropriate reagents for therapeutic administration in vivo.

Strains of Sarcocystis neurona exhibit differences in their surface antigens, including the absence of the major surface antigen SnSAG1.

PubMed

Howe, Daniel K; Gaji, Rajshekhar Y; Marsh, Antoinette E; Patil, Bhagyashree A; Saville, William J; Lindsay, David S; Dubey, J P; Granstrom, David E

2008-05-01

A gene family of surface antigens is expressed by merozoites of Sarcocystis neurona, the primary cause of equine protozoal myeloencephalitis (EPM). These surface proteins, designated SnSAGs, are immunodominant and therefore excellent candidates for development of EPM diagnostics or vaccines. Prior work had identified an EPM isolate lacking the major surface antigen SnSAG1, thus suggesting there may be some diversity in the SnSAGs expressed by different S. neurona isolates. Therefore, a bioinformatic, molecular and immunological study was conducted to assess conservation of the SnSAGs. Examination of an expressed sequence tag (EST) database revealed several notable SnSAG polymorphisms. In particular, the EST information implied that the EPM strain SN4 lacked the major surface antigen SnSAG1. The absence of this surface antigen from the SN4 strain was confirmed by both Western blot and Southern blot. To evaluate SnSAG polymorphisms in the S. neurona population, 14 strains were examined by Western blots using monospecific polyclonal antibodies against the four described SnSAGs. The results of these analyses demonstrated that SnSAG2, SnSAG3, and SnSAG4 are present in all 14 S. neurona strains tested, although some variance in SnSAG4 was observed. Importantly, SnSAG1 was not detected in seven of the strains, which included isolates from four cases of EPM and a case of fatal meningoencephalitis in a sea otter. Genetic analyses by PCR using gene-specific primers confirmed the absence of the SnSAG1 locus in six of these seven strains. Collectively, the data indicated that there is heterogeneity in the surface antigen composition of different S. neurona isolates, which is an important consideration for development of serological tests and prospective vaccines for EPM. Furthermore, the diversity reported herein likely extends to other phenotypes, such as strain virulence, and may have implications for the phylogeny of the various Sarcocystis spp. that undergo sexual stages

T Cell Responses Induced by Adenoviral Vectored Vaccines Can Be Adjuvanted by Fusion of Antigen to the Oligomerization Domain of C4b-Binding Protein

PubMed Central

Forbes, Emily K.; de Cassan, Simone C.; Llewellyn, David; Biswas, Sumi; Goodman, Anna L.; Cottingham, Matthew G.; Long, Carole A.; Pleass, Richard J.; Hill, Adrian V. S.; Hill, Fergal; Draper, Simon J.

2012-01-01

Viral vectored vaccines have been shown to induce both T cell and antibody responses in animals and humans. However, the induction of even higher level T cell responses may be crucial in achieving vaccine efficacy against difficult disease targets, especially in humans. Here we investigate the oligomerization domain of the α-chain of C4b-binding protein (C4 bp) as a candidate T cell “molecular adjuvant” when fused to malaria antigens expressed by human adenovirus serotype 5 (AdHu5) vectored vaccines in BALB/c mice. We demonstrate that i) C-terminal fusion of an oligomerization domain can enhance the quantity of antigen-specific CD4+ and CD8+ T cell responses induced in mice after only a single immunization of recombinant AdHu5, and that the T cells maintain similar functional cytokine profiles; ii) an adjuvant effect is observed for AdHu5 vectors expressing either the 42 kDa C-terminal domain of Plasmodium yoelii merozoite surface protein 1 (PyMSP142) or the 83 kDa ectodomain of P. falciparum strain 3D7 apical membrane antigen 1 (PfAMA1), but not a candidate 128kDa P. falciparum MSP1 biallelic fusion antigen; iii) following two homologous immunizations of AdHu5 vaccines, antigen-specific T cell responses are further enhanced, however, in both BALB/c mice and New Zealand White rabbits no enhancement of functional antibody responses is observed; and iv) that the T cell adjuvant activity of C4 bp is not dependent on a functional Fc-receptor γ-chain in the host, but is associated with the oligomerization of small (<80 kDa) antigens expressed by recombinant AdHu5. The oligomerization domain of C4 bp can thus adjuvant T cell responses induced by AdHu5 vectors against selected antigens and its clinical utility as well as mechanism of action warrant further investigation. PMID:22984589

Correlation between in vitro and in vivo antimalarial activity of compounds using CQ-sensitive and CQ-resistant strains of Plasmodium falciparum and CQ-resistant strain of P. yoelii.

PubMed

Srivastava, Kumkum; Agarwal, Pooja; Soni, Awakash; Puri, S K

2017-07-01

Present efforts have been made to establish a correlation between in vitro and in vivo antimalarial activity using MIC, IC 50 and IC 90 values against CQ-sensitive (3D7) and CQ-resistant (K1) strains of Plasmodium falciparum and in vivo activity against Plasmodium yoelii. The method of discriminant function analysis (DFA) was applied to analyze the data. It was observed that in vitro IC 90 values against both 3D7 and K1 strains (p < 0.001) have strong correlation with in vivo curative activity. The respective IC 50 and IC 90 values of compounds, which cured mice (i.e., animals did not show recrudescence of parasitemia even after 60 days posttreatment), ranged between 3 and 14 nM and 14 and 186 nM against 3D7 and between 9 and 65 nM and 24 and 359 nM against the K1 strain of P. falciparum. Whereas the IC 50 and IC 90 values of compounds which exhibited in vivo suppressive activity in mice ranged between 10 and 307 nm and 61 and >965 nM, respectively, against 3D7 and 75 and >806 nm and 241 and >1232 nM against the K1 strain of P. falciparum. The findings suggest that IC 90 values against both 3D7 and K1 strains (p < 0.02) are the main contributors for the prediction of in vivo curative activity of a new molecule. Apart from this, a reasonable correlation between MIC and IC 50 values of compounds has also been established.

Antibody responses to P. falciparum blood stage antigens and incidence of clinical malaria in children living in endemic area in Burkina Faso.

PubMed

Cherif, Mariama K; Ouédraogo, Oumarou; Sanou, Guillaume S; Diarra, Amidou; Ouédraogo, Alphonse; Tiono, Alfred; Cavanagh, David R; Michael, Theisen; Konaté, Amadou T; Watson, Nora L; Sanza, Megan; Dube, Tina J T; Sirima, Sodiomon B; Nebié, Issa

2017-09-08

High parasite-specific antibody levels are generally associated with low susceptibility to Plasmodium falciparum malaria. This has been supported by several studies in which clinical malaria cases of P. falciparum malaria were reported to be associated with low antibody avidities. This study was conducted to evaluate the role of age, malaria transmission intensity and incidence of clinical malaria in the induction of protective humoral immune response against P. falciparum malaria in children living in Burkina Faso. We combined levels of IgG and IgG subclasses responses to P. falciparum antigens: Merozoite Surface Protein 3 (MSP3), Merozoite Surface Protein 2a (MSP2a), Merozoite Surface Protein 2b (MSP2b), Glutamate Rich Protein R0 (GLURP R0) and Glutamate Rich Protein R2 (GLURP R2) in plasma samples from 325 children under five (05) years with age, malaria transmission season and malaria incidence. We notice higher prevalence of P. falciparum infection in low transmission season compared to high malaria transmission season. While, parasite density was lower in low transmission than high transmission season. IgG against all antigens investigated increased with age. High levels of IgG and IgG subclasses to all tested antigens except for GLURP R2 were associated with the intensity of malaria transmission. IgG to MSP3, MSP2b, GLURP R2 and GLURP R0 were associated with low incidence of malaria. All IgG subclasses were associated with low incidence of P. falciparum malaria, but these associations were stronger for cytophilic IgGs. On the basis of the data presented in this study, we conclude that the induction of humoral immune response to tested malaria antigens is related to age, transmission season level and incidence of clinical malaria.

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

PubMed Central

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-01-01

INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

PubMed

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-12-01

Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

Molecular characterisation and the protective immunity evaluation of Eimeria maxima surface antigen gene.

PubMed

Liu, Tingqi; Huang, Jingwei; Li, Yanlin; Ehsan, Muhammad; Wang, Shuai; Zhou, Zhouyang; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

2018-05-30

Coccidiosis is recognised as a major parasitic disease in chickens. Eimeria maxima is considered as a highly immunoprotective species within the Eimeria spp. family that infects chickens. In the present research, the surface antigen gene of E. maxima (EmSAG) was cloned, and the ability of EmSAG to stimulate protection against E. maxima was evaluated. Prokaryotic and eukaryotic plasmids expressing EmSAG were constructed. The EmSAG transcription and expression in vivo was performed based on the RT-PCR and immunoblot analysis. The expression of EmSAG in sporozoites and merozoites was detected through immunofluorescence analyses. The immune protection was assessed based on challenge experiments. Flow cytometry assays were used to determine the T cell subpopulations. The serum antibody and cytokine levels were evaluated by ELISA. The open reading frame (ORF) of EmSAG gene contained 645 bp encoding 214 amino acid residues. The immunoblot and RT-PCR analyses indicated that the EmSAG gene were transcribed and expressed in vivo. The EmSAG proteins were expressed in sporozoite and merozoite stages of E. maxima by the immunofluorescence assay. Challenge experiments showed that both pVAX1-SAG and the recombinant EmSAG (rEmSAG) proteins were successful in alleviating jejunal lesions, decreasing loss of body weight and the oocyst ratio. Additionally, these experiments possessed anticoccidial indices (ACI) of more than 170. Higher percentages of CD4 + and CD8 + T cells were detected in both EmSAG-inoculated birds than those of the negative control groups (P < 0.05). The EmSAG-specific antibody concentrations of both the rEmSAG and pVAX1-EmSAG groups were much higher than those of the negative controls (P < 0.05). Higher concentrations of IL-4, IFN-γ, TGF-β1 and IL-17 were observed more in both the rEmSAG protein and pVAX1-SAG inoculated groups than those of negative controls (P < 0.05). Our findings suggest that EmSAG is capable of eliciting a moderate immune

The Plasmodium gaboni genome illuminates allelic dimorphism of immunologically important surface antigens in P. falciparum.

PubMed

Roy, Scott William

2015-12-01

In the deadly human malaria parasite Plasmodium falciparum, several major merozoite surface proteins (MSPs) show a striking pattern of allelic diversity called allelic dimorphism (AD). In AD, the vast majority of observed alleles fall into two highly divergent allelic classes, with recombinant alleles being rare or not observed, presumably due to repression by natural selection (recombination suppression, or RS). The three AD loci, merozoite surface proteins (MSPs) 1, 2, and 6, along with MSP3, which also exhibits RS among four allelic classes, can be collectively called AD/RS. The causes of AD/RS and the evolutionary history of allelic diversity at these loci remain mysterious. The few available sequences from a single closely related chimpanzee parasite, P. reichenowi, have suggested that for 3/4 loci, AD/RS is an ancient state that has been retained in P. falciparum since well before the P. falciparum-P. reichenowi ancestor. On the other hand, based on comparative sequence analysis, we recently suggested that (i) AD/RS P. falciparum loci have undergone interallelic recombination over longer evolutionary times (on the timescale of recent speciation events), and thus (ii) AD/RS may be a recent phenomenon. The recent publication of genomic sequencing efforts for P. gaboni, an outgroup to P. falciparum and P. reichenowi, allows for improved reconstruction of the evolutionary history of these loci. In this work, I report genic sequence for P. gaboni for all four AD/RS P. falciparum loci (MSP1, 2, 3, and 6). Comparison of these sequences with available P. falciparum and P. reichenowi data strengthens the evidence for interallelic recombination over the evolutionary history of these species and also strengthens the case that AD/RS at these loci is ancient. Combined with previous results, these data provide evidence that AD/RS at different loci has evolved at several different times in the evolutionary history of P. falciparum: (i) before the P. gaboni-P. falciparum

Plasmodium falciparum Genetic Diversity in Bangladesh Does Not Suggest a Hypoendemic Population Structure

PubMed Central

Alam, Mohammad Shafiul; Elahi, Rubayet; Mohon, Abu Naser; Al-Amin, Hasan Mohammad; Kibria, Mohammad Golam; Khan, Wasif A.; Khanum, Hamida; Haque, Rashidul

2016-01-01

Despite the recommendation for the use of merozoite surface protein 1 (msp1), merozoite surface protein 2 (msp2), and glutamate-rich protein (glurp) genes as markers in drug efficacy studies by World Health Organization and their limited use in Bangladesh, the circulating Plasmodium falciparum population genetic structure has not yet been assessed in Bangladesh. This study presents a comprehensive report on the circulating P. falciparum population structure based on msp1, msp2, and glurp polymorphic gene markers in Bangladesh. Among the 130 pretreatment (day 0) P. falciparum samples from seven malaria-endemic districts, 14 distinct genotypes were observed for msp1, 20 for msp2, and 13 for glurp. Polyclonal infection was reported in 94.6% (N = 123) of the samples. Multiplicity of infection (MOI) for msp1 was the highest (1.5) among the MOIs of the markers. The heterozygosity for msp1, msp2, and glurp was 0.89, 0.93, and 0.83, respectively. Data according to different malaria-endemic areas are also presented and discussed. Bangladesh is considered as a malaria-hypoendemic country. However, the prevalence of polyclonal infection and the genetic diversity of P. falciparum do not represent hypoendemicity. PMID:27139455

Differential requirement for cathepsin D for processing of the full length and C-terminal fragment of the malaria antigen MSP1.

PubMed

Tulone, Calogero; Sponaas, Anne-Marit; Raiber, Eun-Ang; Tabor, Alethea B; Langhorne, Jean; Chain, Benny M

2011-01-01

Merozoite Surface Protein 1 is expressed on the surface of malaria merozoites and is important for invasion of the malaria parasite into erythrocytes. MSP1-specific CD4 T cell responses and antibody can confer protective immunity in experimental models of malaria. In this study we explore the contributions of cathepsins D and E, two aspartic proteinases previously implicated in antigen processing, to generating MSP1 CD4 T-cell epitopes for presentation. The absence of cathepsin D, a late endosome/lysosomal enzyme, is associated with a reduced presentation of MSP1 both following in vitro processing of the epitope MSP1 from infected erythrocytes by bone marrow-derived dendritic cells, and following in vivo processing by splenic CD11c+ dendritic cells. By contrast, processing and presentation of the soluble recombinant protein fragment of MSP1 is unaffected by the absence of cathepsin D, but is inhibited when both cathepsin D and E are absent. The role of different proteinases in generating the CD4 T cell repertoire, therefore, depends on the context in which an antigen is introduced to the immune system.

Differential Requirement for Cathepsin D for Processing of the Full Length and C-Terminal Fragment of the Malaria Antigen MSP1

PubMed Central

Raiber, Eun-Ang; Tabor, Alethea B.; Langhorne, Jean; Chain, Benny M.

2011-01-01

Merozoite Surface Protein 1 is expressed on the surface of malaria merozoites and is important for invasion of the malaria parasite into erythrocytes. MSP1-specific CD4 T cell responses and antibody can confer protective immunity in experimental models of malaria. In this study we explore the contributions of cathepsins D and E, two aspartic proteinases previously implicated in antigen processing, to generating MSP1 CD4 T-cell epitopes for presentation. The absence of cathepsin D, a late endosome/lysosomal enzyme, is associated with a reduced presentation of MSP1 both following in vitro processing of the epitope MSP1 from infected erythrocytes by bone marrow-derived dendritic cells, and following in vivo processing by splenic CD11c+ dendritic cells. By contrast, processing and presentation of the soluble recombinant protein fragment of MSP1 is unaffected by the absence of cathepsin D, but is inhibited when both cathepsin D and E are absent. The role of different proteinases in generating the CD4 T cell repertoire, therefore, depends on the context in which an antigen is introduced to the immune system. PMID:22053177

Prevention of recrudescent malaria in nude mice by thymic grafting or by treatment with hyperimmune serum.

PubMed Central

Roberts, D W; Rank, R G; Weidanz, W P; Finerty, J F

1977-01-01

Nude mice died when infected with the normally avirulent malarial parasite Plasmodium berghei yoelii. Furthermore, malaria recrudesced in Nu/Nu mice after the termination of acute disease by treatment with clindamycin. Recrudescence was not observed in Nu/Nu mice that had been grafted with thymic tissue or treated with hyperimmune serum. Mice mad B cell deficient by treatment with anti-mu-chain serum also died when infected with P. berghei yoelii. The data suggest that a crucial role of the thymus in preventing recrudescent malaria in this model system is to provide a helper function in the production of protective antibody. PMID:330396

Characterization of the Eimeria maxima sporozoite surface protein IMP1.

PubMed

Jenkins, M C; Fetterer, R; Miska, K; Tuo, W; Kwok, O; Dubey, J P

2015-07-30

The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6-12h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by non-reducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection. Published by Elsevier B.V.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

An analysis of mobile genetic elements in three Plasmodium species and their potential impact on the nucleotide composition of the P. falciparum genome.

PubMed

Durand, Pierre M; Oelofse, Andries J; Coetzer, Theresa L

2006-11-04

The completed genome sequences of the malaria parasites P. falciparum, P. y. yoelii and P. vivax have revealed some unusual features. P. falciparum contains the most AT rich genome sequenced so far--over 90% in some regions. In comparison, P. y. yoelii is approximately 77% and P. vivax is approximately 55% AT rich. The evolutionary reasons for these findings are unknown. Mobile genetic elements have a considerable impact on genome evolution but a thorough investigation of these elements in Plasmodium has not been undertaken. We therefore performed a comprehensive genome analysis of these elements and their derivatives in the three Plasmodium species. Whole genome analysis was performed using bioinformatic methods. Forty potential protein encoding sequences with features of transposable elements were identified in P. vivax, eight in P. y. yoelii and only six in P. falciparum. Further investigation of the six open reading frames in P. falciparum revealed that only one is potentially an active mobile genetic element. Most of the open reading frames identified in all three species are hypothetical proteins. Some represent annotated host proteins such as the putative telomerase reverse transcriptase genes in P. y. yoelii and P. falciparum. One of the P. vivax open reading frames identified in this study demonstrates similarity to telomerase reverse transcriptase and we conclude it to be the orthologue of this gene. There is a divergence in the frequencies of mobile genetic elements in the three Plasmodium species investigated. Despite the limitations of whole genome analytical methods, it is tempting to speculate that mobile genetic elements might have been a driving force behind the compositional bias of the P. falciparum genome.

The GPI transamidase complex subunit PbGPI16 of Plasmodium berghei is important for inducing experimental cerebral malaria.

PubMed

Liu, Qingyang; Zhao, Yan; Zheng, Li; Zhu, Xiaotong; Cui, Liwang; Cao, Yaming

2018-05-21

In animal models of experimental cerebral malaria (ECM), the glycosylphosphatidylinositols (GPIs) and GPI anchors are the major factors that induce nuclear factor kappa B (NF-κB) activation and proinflammatory responses, which contribute to malaria pathogenesis. GPIs and GPI anchors are transported to the cell surface via a process called GPI transamidation, which involves the GPI transamidase (GPI-T) complex. In this study, we showed that GPI16, one of the GPI-T subunits, is highly conserved among Plasmodium species. Genetic knockout of pbgpi16 ( Δpbgpi16 ) in the rodent malaria parasite Plasmodium berghei ANKA strain led to a significant reduction of the amount of GPIs in the membranes of merozoites as well as surface display of several GPI-anchored merozoite surface proteins. Compared with the wild-type parasites, Δpbgpi16 parasites in C57BL/6 mice caused much less NF-κB activation and elicited a substantially attenuated T helper type 1 response. As a result, Δpbgpi16 -infected mice displayed much less severe brain pathology and considerably fewer Δpbgpi16 -infected mice died from ECM. This study corroborated the GPI toxin as a significant inducer of ECM and further suggested that vaccines against parasite GPIs may be a promising strategy to limit the severity of malaria. Copyright © 2018 American Society for Microbiology.

Membrane-Wrapping Contributions to Malaria Parasite Invasion of the Human Erythrocyte

PubMed Central

Dasgupta, Sabyasachi; Auth, Thorsten; Gov, Nir S.; Satchwell, Timothy J.; Hanssen, Eric; Zuccala, Elizabeth S.; Riglar, David T.; Toye, Ashley M.; Betz, Timo; Baum, Jake; Gompper, Gerhard

2014-01-01

The blood stage malaria parasite, the merozoite, has a small window of opportunity during which it must successfully target and invade a human erythrocyte. The process of invasion is nonetheless remarkably rapid. To date, mechanistic models of invasion have focused predominantly on the parasite actomyosin motor contribution to the energetics of entry. Here, we have conducted a numerical analysis using dimensions for an archetypal merozoite to predict the respective contributions of the host-parasite interactions to invasion, in particular the role of membrane wrapping. Our theoretical modeling demonstrates that erythrocyte membrane wrapping alone, as a function of merozoite adhesive and shape properties, is sufficient to entirely account for the first key step of the invasion process, that of merozoite reorientation to its apex and tight adhesive linkage between the two cells. Next, parasite-induced reorganization of the erythrocyte cytoskeleton and release of parasite-derived membrane can also account for a considerable energetic portion of actual invasion itself, through membrane wrapping. Thus, contrary to the prevailing dogma, wrapping by the erythrocyte combined with parasite-derived membrane release can markedly reduce the expected contributions of the merozoite actomyosin motor to invasion. We therefore propose that invasion is a balance between parasite and host cell contributions, evolved toward maximal efficient use of biophysical forces between the two cells. PMID:24988340

Evidence that the Malaria Parasite Plasmodium falciparum Putative Rhoptry Protein 2 Localizes to the Golgi Apparatus throughout the Erythrocytic Cycle.

PubMed

Hallée, Stéphanie; Richard, Dave

2015-01-01

Invasion of a red blood cell by Plasmodium falciparum merozoites is an essential step in the malaria lifecycle. Several of the proteins involved in this process are stored in the apical complex of the merozoite, a structure containing secretory organelles that are released at specific times during invasion. The molecular players involved in erythrocyte invasion thus represent potential key targets for both therapeutic and vaccine-based strategies to block parasite development. In our quest to identify and characterize new effectors of invasion, we investigated the P. falciparum homologue of a P. berghei protein putatively localized to the rhoptries, the Putative rhoptry protein 2 (PbPRP2). We show that in P. falciparum, the protein colocalizes extensively with the Golgi apparatus across the asexual erythrocytic cycle. Furthermore, imaging of merozoites caught at different times during invasion show that PfPRP2 is not secreted during the process instead staying associated with the Golgi apparatus. Our evidence therefore suggests that PfPRP2 is a Golgi protein and that it is likely not a direct effector in the process of merozoite invasion.

Grammomys surdaster, the Natural Host for Plasmodium berghei Parasites, as a Model to Study Whole-Organism Vaccines Against Malaria.

PubMed

Conteh, Solomon; Anderson, Charles; Lambert, Lynn; Orr-Gonzalez, Sachy; Herrod, Jessica; Robbins, Yvette L; Carter, Dariyen; Karhemere, Stomy Bin Shamamba; Pyana, Pati; Büscher, Philippe; Duffy, Patrick E

2017-04-01

AbstractInbred mice are commonly used to test candidate malaria vaccines, but have been unreliable for predicting efficacy in humans. To establish a more rigorous animal model, we acquired African woodland thicket rats of the genus Grammomys , the natural hosts for Plasmodium berghei . Thicket rats were acquired and identified as Grammomys surdaster by skull and teeth measurements and mitochondrial DNA genotyping. Herein, we demonstrate that thicket rats are highly susceptible to infection by P. berghei , and moderately susceptible to Plasmodium yoelii and Plasmodium chabaudi : 1-2 infected mosquito bites or 25-100 sporozoites administered by intravenous injection consistently resulted in patent parasitemia with P. berghei , and resulted in patent parasitemia with P. yoelii and P. chabaudi strains for at least 50% of animals. We then assessed efficacy of whole-organism vaccines to induce sterile immunity, and compared the thicket rat model to conventional mouse models. Using P. berghei ANKA radiation-attenuated sporozoites, and P. berghei ANKA and P. yoelii chemoprophylaxis vaccination approaches, we found that standard doses of vaccine sufficient to protect laboratory mice for a long duration against malaria challenge, are insufficient to protect thicket rats, which require higher doses of vaccine to achieve even short-term sterile immunity. Thicket rats may offer a more stringent and pertinent model for evaluating whole-organism vaccines.

Inflammation-associated alterations to the intestinal microbiota reduce colonization resistance against non-typhoidal Salmonella during concurrent malaria parasite infection.

PubMed

Mooney, Jason P; Lokken, Kristen L; Byndloss, Mariana X; George, Michael D; Velazquez, Eric M; Faber, Franziska; Butler, Brian P; Walker, Gregory T; Ali, Mohamed M; Potts, Rashaun; Tiffany, Caitlin; Ahmer, Brian M M; Luckhart, Shirley; Tsolis, Renée M

2015-10-05

Childhood malaria is a risk factor for disseminated infections with non-typhoidal Salmonella (NTS) in sub-Saharan Africa. While hemolytic anemia and an altered cytokine environment have been implicated in increased susceptibility to NTS, it is not known whether malaria affects resistance to intestinal colonization with NTS. To address this question, we utilized a murine model of co-infection. Infection of mice with Plasmodium yoelii elicited infiltration of inflammatory macrophages and T cells into the intestinal mucosa and increased expression of inflammatory cytokines. These mucosal responses were also observed in germ-free mice, showing that they are independent of the resident microbiota. Remarkably, P. yoelii infection reduced colonization resistance of mice against S. enterica serotype Typhimurium. Further, 16S rRNA sequence analysis of the intestinal microbiota revealed marked changes in the community structure. Shifts in the microbiota increased susceptibility to intestinal colonization by S. Typhimurium, as demonstrated by microbiota reconstitution of germ-free mice. These results show that P. yoelii infection, via alterations to the microbial community in the intestine, decreases resistance to intestinal colonization with NTS. Further they raise the possibility that decreased colonization resistance may synergize with effects of malaria on systemic immunity to increase susceptibility to disseminated NTS infections.

Inflammation-associated alterations to the intestinal microbiota reduce colonization resistance against non-typhoidal Salmonella during concurrent malaria parasite infection

PubMed Central

Mooney, Jason P.; Lokken, Kristen L.; Byndloss, Mariana X.; George, Michael D.; Velazquez, Eric M.; Faber, Franziska; Butler, Brian P.; Walker, Gregory T.; Ali, Mohamed M.; Potts, Rashaun; Tiffany, Caitlin; Ahmer, Brian M. M.; Luckhart, Shirley; Tsolis, Renée M.

2015-01-01

Childhood malaria is a risk factor for disseminated infections with non-typhoidal Salmonella (NTS) in sub-Saharan Africa. While hemolytic anemia and an altered cytokine environment have been implicated in increased susceptibility to NTS, it is not known whether malaria affects resistance to intestinal colonization with NTS. To address this question, we utilized a murine model of co-infection. Infection of mice with Plasmodium yoelii elicited infiltration of inflammatory macrophages and T cells into the intestinal mucosa and increased expression of inflammatory cytokines. These mucosal responses were also observed in germ-free mice, showing that they are independent of the resident microbiota. Remarkably, P. yoelii infection reduced colonization resistance of mice against S. enterica serotype Typhimurium. Further, 16S rRNA sequence analysis of the intestinal microbiota revealed marked changes in the community structure. Shifts in the microbiota increased susceptibility to intestinal colonization by S. Typhimurium, as demonstrated by microbiota reconstitution of germ-free mice. These results show that P. yoelii infection, via alterations to the microbial community in the intestine, decreases resistance to intestinal colonization with NTS. Further they raise the possibility that decreased colonization resistance may synergize with effects of malaria on systemic immunity to increase susceptibility to disseminated NTS infections. PMID:26434367

An outbreak of locally acquired Plasmodium vivax malaria among migrant workers in Oman.

PubMed

Simon, Bruno; Sow, Fatimata; Al Mukhaini, Said K; Al-Abri, Seif; Ali, Osama A M; Bonnot, Guillaume; Bienvenu, Anne-Lise; Petersen, Eskild; Picot, Stéphane

2017-01-01

Plasmodium vivax is the most widely distributed human malaria parasite. Outside sub-Saharan Africa, the proportion of P. vivax malaria is rising. A major cause for concern is the re-emergence of Plasmodium vivax in malaria-free areas. Oman, situated in the south-eastern corner of the Arabian Peninsula, has long been an area of vivax malaria transmission but no locally acquired cases were reported in 2004. However, local transmission has been registered in small outbreaks since 2007. In this study, a local outbreak of 54 cases over 50 days in 2014 was analyzed retrospectively and stained blood slides have been obtained for parasite identification and genotyping. The aim of this study was to identify the geographical origin of these cases, in an attempt to differentiate between imported cases and local transmission. Using circumsporozoite protein (csp), merozoite surface protein 1 (msp1), and merozoite surface protein 3 (msp3) markers for genotyping of parasite DNA obtained by scrapping off the surface of smears, genetic diversity and phylogenetic analysis were performed. The study found that the samples had very low genetic diversity, a temperate genotype, and a high genetic distance, with most of the reference strains coming from endemic countries. We conclude that a small outbreak of imported malaria is not associated with re-emergence of malaria transmission in Oman, as no new cases have been seen since the outbreak ended. © B. Simon et al., published by EDP Sciences, 2017.

An outbreak of locally acquired Plasmodium vivax malaria among migrant workers in Oman

PubMed Central

Simon, Bruno; Sow, Fatimata; Al Mukhaini, Said K.; Al-Abri, Seif; Ali, Osama A.M.; Bonnot, Guillaume; Bienvenu, Anne-Lise; Petersen, Eskild; Picot, Stéphane

2017-01-01

Plasmodium vivax is the most widely distributed human malaria parasite. Outside sub-Saharan Africa, the proportion of P. vivax malaria is rising. A major cause for concern is the re-emergence of Plasmodium vivax in malaria-free areas. Oman, situated in the south-eastern corner of the Arabian Peninsula, has long been an area of vivax malaria transmission but no locally acquired cases were reported in 2004. However, local transmission has been registered in small outbreaks since 2007. In this study, a local outbreak of 54 cases over 50 days in 2014 was analyzed retrospectively and stained blood slides have been obtained for parasite identification and genotyping. The aim of this study was to identify the geographical origin of these cases, in an attempt to differentiate between imported cases and local transmission. Using circumsporozoite protein (csp), merozoite surface protein 1 (msp1), and merozoite surface protein 3 (msp3) markers for genotyping of parasite DNA obtained by scrapping off the surface of smears, genetic diversity and phylogenetic analysis were performed. The study found that the samples had very low genetic diversity, a temperate genotype, and a high genetic distance, with most of the reference strains coming from endemic countries. We conclude that a small outbreak of imported malaria is not associated with re-emergence of malaria transmission in Oman, as no new cases have been seen since the outbreak ended. PMID:28695821

Molecular characterization and analysis of a novel protein disulfide isomerase-like protein of Eimeria tenella.

PubMed

Han, Hongyu; Dong, Hui; Zhu, Shunhai; Zhao, Qiping; Jiang, Lianlian; Wang, Yange; Li, Liujia; Wu, Youlin; Huang, Bing

2014-01-01

Protein disulfide isomerase (PDI) and PDI-like proteins are members of the thioredoxin superfamily. They contain thioredoxin-like domains and catalyze the physiological oxidation, reduction and isomerization of protein disulfide bonds, which are involved in cell function and development in prokaryotes and eukaryotes. In this study, EtPDIL, a novel PDI-like gene of Eimeria tenella, was cloned using rapid amplification of cDNA ends (RACE) according to the expressed sequence tag (EST). The EtPDIL cDNA contained 1129 nucleotides encoding 216 amino acids. The deduced EtPDIL protein belonged to thioredoxin-like superfamily and had a single predicted thioredoxin domain with a non-classical thioredoxin-like motif (SXXC). BLAST analysis showed that the EtPDIL protein was 55-59% identical to PDI-like proteins of other apicomplexan parasites. The transcript and protein levels of EtPDIL at different development stages were investigated by real-time quantitative PCR and western blot. The messenger RNA and protein levels of EtPDIL were higher in sporulated oocysts than in unsporulated oocysts, sporozoites or merozoites. Protein expression was barely detectable in unsporulated oocysts. Western blots showed that rabbit antiserum against recombinant EtPDIL recognized only a native 24 kDa protein from parasites. Immunolocalization with EtPDIL antibody showed that EtPDIL had a disperse distribution in the cytoplasm of whole sporozoites and merozoites. After sporozoites were incubated in complete medium, EtPDIL protein concentrated at the anterior of the sporozoites and appeared on the surface of parasites. Specific staining was more intense and mainly located on the parasite surface after merozoites released from mature schizonts invaded DF-1 cells. After development of parasites in DF-1 cells, staining intensified in trophozoites, immature schizonts and mature schizonts. Antibody inhibition of EtPDIL function reduced the ability of E. tenella to invade DF-1 cells. These results

Molecular Characterization and Analysis of a Novel Protein Disulfide Isomerase-Like Protein of Eimeria tenella

PubMed Central

Han, Hongyu; Dong, Hui; Zhu, Shunhai; Zhao, Qiping; Jiang, Lianlian; Wang, Yange; Li, Liujia; Wu, Youlin; Huang, Bing

2014-01-01

Protein disulfide isomerase (PDI) and PDI-like proteins are members of the thioredoxin superfamily. They contain thioredoxin-like domains and catalyze the physiological oxidation, reduction and isomerization of protein disulfide bonds, which are involved in cell function and development in prokaryotes and eukaryotes. In this study, EtPDIL, a novel PDI-like gene of Eimeria tenella, was cloned using rapid amplification of cDNA ends (RACE) according to the expressed sequence tag (EST). The EtPDIL cDNA contained 1129 nucleotides encoding 216 amino acids. The deduced EtPDIL protein belonged to thioredoxin-like superfamily and had a single predicted thioredoxin domain with a non-classical thioredoxin-like motif (SXXC). BLAST analysis showed that the EtPDIL protein was 55–59% identical to PDI-like proteins of other apicomplexan parasites. The transcript and protein levels of EtPDIL at different development stages were investigated by real-time quantitative PCR and western blot. The messenger RNA and protein levels of EtPDIL were higher in sporulated oocysts than in unsporulated oocysts, sporozoites or merozoites. Protein expression was barely detectable in unsporulated oocysts. Western blots showed that rabbit antiserum against recombinant EtPDIL recognized only a native 24 kDa protein from parasites. Immunolocalization with EtPDIL antibody showed that EtPDIL had a disperse distribution in the cytoplasm of whole sporozoites and merozoites. After sporozoites were incubated in complete medium, EtPDIL protein concentrated at the anterior of the sporozoites and appeared on the surface of parasites. Specific staining was more intense and mainly located on the parasite surface after merozoites released from mature schizonts invaded DF-1 cells. After development of parasites in DF-1 cells, staining intensified in trophozoites, immature schizonts and mature schizonts. Antibody inhibition of EtPDIL function reduced the ability of E. tenella to invade DF-1 cells. These results

Larval nutrition differentially affects adult fitness and Plasmodium development in the malaria vectors Anopheles gambiae and Anopheles stephensi

PubMed Central

2013-01-01

Background Mosquito fitness is determined largely by body size and nutritional reserves. Plasmodium infections in the mosquito and resultant transmission of malaria parasites might be compromised by the vector’s nutritional status. We studied the effects of nutritional stress and malaria parasite infections on transmission fitness of Anopheles mosquitoes. Methods Larvae of Anopheles gambiae sensu stricto and An. stephensi were reared at constant density but with nutritionally low and high diets. Fitness of adult mosquitoes resulting from each dietary class was assessed by measuring body size and lipid, protein and glycogen content. The size of the first blood meal was estimated by protein analysis. Mosquitoes of each dietary class were fed upon a Plasmodium yoelii nigeriensis-infected mouse, and parasite infections were determined 5 d after the infectious blood meal by dissection of the midguts and by counting oocysts. The impact of Plasmodium infections on gonotrophic development was established by dissection. Results Mosquitoes raised under low and high diets emerged as adults of different size classes comparable between An. gambiae and An. stephensi. In both species low-diet females contained less protein, lipid and glycogen upon emergence than high-diet mosquitoes. The quantity of larval diet impacted strongly upon adult blood feeding and reproductive success. The prevalence and intensity of P. yoelii nigeriensis infections were reduced in low-diet mosquitoes of both species, but P. yoelii nigeriensis impacted negatively only on low-diet, small-sized An. gambiae considering survival and egg maturation. There was no measurable fitness effect of P. yoelii nigeriensis on An. stephensi. Conclusions Under the experimental conditions, small-sized An. gambiae expressed high mortality, possibly caused by Plasmodium infections, the species showing distinct physiological concessions when nutrionally challenged in contrast to well-fed, larger siblings. Conversely, An

Neuroimmunological Blood Brain Barrier Opening in Experimental Cerebral Malaria

PubMed Central

Baer, Kerstin; Mikolajczak, Sebastian A.; Kappe, Stefan H. I.; Frevert, Ute

2012-01-01

Plasmodium falciparum malaria is responsible for nearly one million annual deaths worldwide. Because of the difficulty in monitoring the pathogenesis of cerebral malaria in humans, we conducted a study in various mouse models to better understand disease progression in experimental cerebral malaria (ECM). We compared the effect on the integrity of the blood brain barrier (BBB) and the histopathology of the brain of P. berghei ANKA, a known ECM model, P. berghei NK65, generally thought not to induce ECM, P. yoelii 17XL, originally reported to induce human cerebral malaria-like histopathology, and P. yoelii YM. As expected, P. berghei ANKA infection caused neurological signs, cerebral hemorrhages, and BBB dysfunction in CBA/CaJ and Swiss Webster mice, while Balb/c and A/J mice were resistant. Surprisingly, PbNK induced ECM in CBA/CaJ mice, while all other mice were resistant. P. yoelii 17XL and P. yoelii YM caused lethal hyperparasitemia in all mouse strains; histopathological alterations, BBB dysfunction, or neurological signs were not observed. Intravital imaging revealed that infected erythrocytes containing mature parasites passed slowly through capillaries making intimate contact with the endothelium, but did not arrest. Except for relatively rare microhemorrhages, mice with ECM presented no obvious histopathological alterations that would explain the widespread disruption of the BBB. Intravital imaging did reveal, however, that postcapillary venules, but not capillaries or arterioles, from mice with ECM, but not hyperparasitemia, exhibit platelet marginalization, extravascular fibrin deposition, CD14 expression, and extensive vascular leakage. Blockage of LFA-1 mediated cellular interactions prevented leukocyte adhesion, vascular leakage, neurological signs, and death from ECM. The endothelial barrier-stabilizing mediators imatinib and FTY720 inhibited vascular leakage and neurological signs and prolonged survival to ECM. Thus, it appears that neurological

Microvascular hemodynamics and in vivo evidence for the role of intercellular adhesion molecule-1 in the sequestration of infected red blood cells in a mouse model of lethal malaria.

PubMed

Kaul, D K; Liu, X D; Nagel, R L; Shear, H L

1998-02-01

The cytoadherence of infected red blood cells (IRBCs) to the vascular endothelium is the major cause of IRBC sequestration and vessel blockage in the cerebral form of human malaria. Among the rodent models of malaria, Plasmodium yoelii 17XL-infected mice show many similarities with the human cerebral malaria caused by P. falciparum. In both, the sequestration of IRBCs in the brain vessels is secondary to the cytoadherence of IRBCs to the vascular endothelium. Similar to P. falciparum infection in the human but in contrast to P. berghei ANKA infection in mice, P. yoelii 17XL results in little, if any, accumulation of monocytes in the brain. In vivo microcirculatory studies reported here were designed to further understand the hemodynamic aspects and mechanisms underlying cytoadherence of IRBCs in the P. yoelii model using the easily accessible cremaster muscle vasculature. The results show significant decreases in arteriovenous red blood cell velocities (Vrbc) and wall shear rates in the microcirculation of P. yoelii-infected mice, with a maximal decrease occurring in small-diameter postcapillary venules, the main sites of cytoadherence. This reflects contributions from IRBC cytoadherence as well as from increased rigidity of parasitized red blood cells. No cytoadherence is observed in arterioles of the infected mice despite decreased wall shear rates, indicating that endothelial receptors for cytoadherence are restricted to venules. Infusion of a monoclonal antibody (MAb) against the intercellular adhesion molecule-1 (ICAM-1) resulted in significant increases in both arteriolar and venular Vrbc and wall shear rates, accompanied by detachment of adhered IRBCs at some venular sites. The peripheral blood smears taken after the MAb infusion showed a distinct increase in the percentage of schizonts, again indicating detachment and/or prevention of cytoadherence. An MAb against the vascular cell adhesion molecule-1 (VCAM-1) as well as an irrelevant control antibody had

Synthesis of 4-alkyl and 4-(beta-alkylvinyl) derivatives of primaquine as potential antimalarials.

PubMed

Carroll, F I; Berrang, B D; Linn, C P

1979-11-01

4(beta-Alkylvinyl)-6-methoxy-8-nitroquinolines (6) were prepared from 6-methoxy-8-nitroquinoline-4-carboxaldehyde (5) via a Wittig reaction. Stannous chloride reduction of 6 gave 4-(beta-alkylvinyl)-8-amino-6-methoxyquinolines (8), whereas catalytic reduction of 6 using Raney nickel catalyst gave 4-alkyl-8-amino-6-methoxyquinolines (7). Alkylation of 7 and 8 with 4-iodo-1-phthalimidopentane, followed by removal of the phthaloyl-protecting group with hydrazine, gave 4-alkyl and 4-(beta-alkylvinyl) derivatives of primiquine, respectively. These compounds were evaluated for antimalarial activity against P. berghei and P. berghei yoelii in mice and against P. cynomolgi in rhesus monkeys. Several of the compounds were active in the P. bergheii yoelii screen. None of the compounds showed significant activity in the other two screens.

Biological characterisation of Sarcocystis neurona isolated from a Southern sea otter (Enhydra lutris nereis)

USGS Publications Warehouse

Lindsay, D.S.; Thomas, N.J.; Dubey, J.P.

2000-01-01

Sarcocystis neurona was isolated from the brain of a juvenile, male southern sea otter (Enhydra lutris nereis) suffering from CNS disease. Schizonts and merozoites in tissue sections of the otter's brain reacted with anti-S. neurona antiserum immunohistochemically. Development in cell culture was by endopolyogeny and mature schizonts were first observed at 3 days postinoculation. PCR of merozoite DNA using primer pairs JNB33/JNB54 and restriction enzyme digestion of the 1100 bp product with Dra I indicated the organism was S. neurona. Four of four interferon-γ gene knockout mice inoculated with merozoites developed S. neurona-associated encephalitis. Antibodies to S. neurona but not Sarcocystis falcatula, Toxoplasma gondii, or Neospora caninum were present in the serum of inoculated mice. This is the first isolation of S. neurona from the brain of a non-equine host.

Molecular Signaling Involved in Entry and Exit of Malaria Parasites from Host Erythrocytes.

PubMed

Singh, Shailja; Chitnis, Chetan E

2017-10-03

During the blood stage, Plasmodium spp. merozoites invade host red blood cells (RBCs), multiply, exit, and reinvade uninfected RBCs in a continuing cycle that is responsible for all the clinical symptoms associated with malaria. Entry into (invasion) and exit from (egress) RBCs are highly regulated processes that are mediated by an array of parasite proteins with specific functional roles. Many of these parasite proteins are stored in specialized apical secretory vesicles, and their timely release is critical for successful invasion and egress. For example, the discharge of parasite protein ligands to the apical surface of merozoites is required for interaction with host receptors to mediate invasion, and the timely discharge of proteases and pore-forming proteins helps in permeabilization and dismantling of limiting membranes during egress. This review focuses on our understanding of the signaling mechanisms that regulate apical organelle secretion during host cell invasion and egress by malaria parasites. The review also explores how understanding key signaling mechanisms in the parasite can open opportunities to develop novel strategies to target Plasmodium parasites and eliminate malaria. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

Sarcocystis neurona retinochoroiditis in a sea otter (Enhydra lutris kenyoni).

PubMed

Dubey, J P; Thomas, N J

2011-12-29

Sarcocystis neurona is an important cause of fatal disease in sea otters in the USA. Encephalitis is the predominant lesion and parasites are confined to the central nervous system and muscles. Here we report retinochoroiditis in a sea otter (Enhydra lutris kenyoni) found dead on Copalis Beach, WA, USA. Salient lesions were confined to the brain and eye. Multifocal nonsuppurative meningoencephalitis was present in the cerebrum and cerebellum associated with S. neurona schizonts. The retina of one eye had a focus of inflammation that contained numerous S. neurona schizonts and merozoites. The focus extended from the retinal pigment epithelium inward through all layers of the retina, but inflammation was most concentrated at the inner surface of the tapetum and the outer retina. The inner and outer nuclear layers of the retina were disorganized and irregular at the site of inflammation. There was severe congestion and mild hemorrhage in the choroid, and mild hemorrhage into the vitreous body. Immunohistochemistry with S. neurona-specific polyclonal rabbit antibodies stained schizonts and merozoites. To our knowledge this is the first report of S. neurona-associated retinochoroiditis in any naturally infected animal. Copyright © 2011 Elsevier B.V. All rights reserved.

Sarcocystis neurona retinochoroiditis in a sea otter (Enhydra lutris kenyoni)

USGS Publications Warehouse

Dubey, J.P.; Thomas, N.J.

2011-01-01

Sarcocystis neurona is an important cause of fatal disease in sea otters in the USA. Encephalitis is the predominant lesion and parasites are confined to the central nervous system and muscles. Here we report retinochoroiditis in a sea otter (Enhydra lutris kenyoni) found dead on Copalis Beach, WA, USA. Salient lesions were confined to the brain and eye. Multifocal nonsuppurative meningoencephalitis was present in the cerebrum and cerebellum associated with S. neurona schizonts. The retina of one eye had a focus of inflammation that contained numerous S. neurona schizonts and merozoites. The focus extended from the retinal pigment epithelium inward through all layers of the retina, but inflammation was most concentrated at the inner surface of the tapetum and the outer retina. The inner and outer nuclear layers of the retina were disorganized and irregular at the site of inflammation. There was severe congestion and mild hemorrhage in the choroid, and mild hemorrhage into the vitreous body. Immunohistochemistry with S. neurona-specific polyclonal rabbit antibodies stained schizonts and merozoites. To our knowledge this is the first report of S. neurona-associated retinochoroiditis in any naturally infected animal.

Sarcocystis neurona retinochoroiditis in a sea otter (Enhydra lutris kenyoni)

USGS Publications Warehouse

Dubey, J.P.; Thomas, N.J.

2011-01-01

Sarcocystis neurona is an important cause of fatal disease in sea otters in the USA. Encephalitis is the predominant lesion and parasites are confined to the central nervous system and muscles. Here we report retinochoroiditis in a sea otter (Enhydra lutris kenyoni) found dead on Copalis Beach, WA, USA. Salient lesions were confined to the brain and eye. Multifocal nonsuppurative meningoencephalitis was present in the cerebrum and cerebellum associated with S. neurona schizonts. The retina of one eye had a focus of inflammation that contained numerous S. neurona schizonts and merozoites. The focus extended from the retinal pigment epithelium inward through all layers of the retina, but inflammation was most concentrated at the inner surface of the tapetum and the outer retina. The inner and outer nuclear layers of the retina were disorganized and irregular at the site of inflammation. There was severe congestion and mild hemorrhage in the choroid, and mild hemorrhage into the vitreous body. Immunohistochemistry with S. neurona-specific polyclonal rabbit antibodies stained schizonts and merozoites. To our knowledge this is the first report of S. neurona-associated retinochoroiditis in any naturally infected animal. ?? 2011 Elsevier B.V.

Interaction of Plasmodium vivax Tryptophan-rich Antigen PvTRAg38 with Band 3 on Human Erythrocyte Surface Facilitates Parasite Growth*

PubMed Central

Alam, Mohd. Shoeb; Choudhary, Vandana; Zeeshan, Mohammad; Tyagi, Rupesh K.; Rathore, Sumit; Sharma, Yagya D.

2015-01-01

Plasmodium tryptophan-rich proteins are involved in host-parasite interaction and thus potential drug/vaccine targets. Recently, we have described several P. vivax tryptophan-rich antigens (PvTRAgs), including merozoite expressed PvTRAg38, from this noncultivable human malaria parasite. PvTRAg38 is highly immunogenic in humans and binds to host erythrocytes, and this binding is inhibited by the patient sera. This binding is also affected if host erythrocytes were pretreated with chymotrypsin. Here, Band 3 has been identified as the chymotrypsin-sensitive erythrocyte receptor for this parasite protein. Interaction of PvTRAg38 with Band 3 has been mapped to its three different ectodomains (loops 1, 3, and 6) exposed at the surface of the erythrocyte. The binding region of PvTRAg38 to Band3 has been mapped to its sequence, KWVQWKNDKIRSWLSSEW, present at amino acid positions 197–214. The recombinant PvTRAg38 was able to inhibit the parasite growth in in vitro Plasmodium falciparum culture probably by competing with the ligand(s) of this heterologous parasite for the erythrocyte Band 3 receptor. In conclusion, the host-parasite interaction at the molecular level is much more complicated than known so far and should be considered during the development of anti-malarial therapeutics. PMID:26149684

Synthesis of chiral chloroquine and its analogues as antimalarial agents.

PubMed

Sinha, Manish; Dola, Vasanth R; Soni, Awakash; Agarwal, Pooja; Srivastava, Kumkum; Haq, Wahajul; Puri, Sunil K; Katti, Seturam B

2014-11-01

In this investigation, we describe a new approach to chiral synthesis of chloroquine and its analogues. All tested compounds displayed potent activity against chloroquine sensitive as well as chloroquine resistant strains of Plasmodium falciparum in vitro and Plasmodium yoelii in vivo. Compounds S-13 b, S-13c, S-13 d and S-13 i displayed excellent in vitro antimalarial activity with an IC50 value of 56.82, 60.41, 21.82 and 7.94 nM, respectively, in the case of resistant strain. Furthermore, compounds S-13a, S-13c and S-13 d showed in vivo suppression of 100% parasitaemia on day 4 in the mouse model against Plasmodium yoelii when administered orally. These results underscore the application of synthetic methodology and need for further lead optimization. Copyright © 2014 Elsevier Ltd. All rights reserved.

B and T lymphocyte attenuator restricts the protective immune response against experimental malaria.

PubMed

Adler, Guido; Steeg, Christiane; Pfeffer, Klaus; Murphy, Theresa L; Murphy, Kenneth M; Langhorne, Jean; Jacobs, Thomas

2011-11-15

The immune response against the blood stage of malaria has to be tightly regulated to allow for vigorous antiplasmodial activity while restraining potentially lethal immunopathologic damage to the host like cerebral malaria. Coinhibitory cell surface receptors are important modulators of immune activation. B and T lymphocyte attenuator (BTLA) (CD272) is a coinhibitory receptor expressed by most leukocytes, with the highest expression levels on T and B cells, and is involved in the maintenance of peripheral tolerance by dampening the activation of lymphocytes. The function of BTLA is described in several models of inflammatory disorders and autoimmunity, but its function in infectious diseases is less well characterized. Also, little is known about the influence of BTLA on non-T cells. In this study, we analyzed the function of BTLA during blood-stage malaria infection with the nonlethal Plasmodium yoelii strain 17NL. We show that BTLA knockout mice exhibit strongly reduced parasitemia and clear the infection earlier compared with wild-type mice. This increased resistance was seen before the onset of adaptive immune mechanisms and even in the absence of T and B cells but was more pronounced at later time points when activation of T and B cells was observed. We demonstrate that BTLA regulates production of proinflammatory cytokines in a T cell-intrinsic way and B cell intrinsically regulates the production of P. yoelii 17NL-specific Abs. These results indicate that the coinhibitory receptor BTLA plays a critical role during experimental malaria and attenuates the innate as well as the subsequent adaptive immune response.

Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity

PubMed Central

Regis, David P.; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L.; Stefaniak, Maureen E.; Campo, Joseph J.; Carucci, Daniel J.; Roth, David A.; He, Huaping; Felgner, Philip L.; Doolan, Denise L.

2009-01-01

We have evaluated a technology called Transcriptionally Active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data. PMID:18164079

Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity.

PubMed

Regis, David P; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L; Stefaniak, Maureen E; Campo, Joseph J; Carucci, Daniel J; Roth, David A; He, Huaping; Felgner, Philip L; Doolan, Denise L

2008-03-01

We have evaluated a technology called transcriptionally active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data.

The future for blood-stage vaccines against malaria.

PubMed

Richards, Jack S; Beeson, James G

2009-07-01

Malaria is a leading cause of mortality and morbidity globally, and effective vaccines are urgently needed. Malaria vaccine approaches can be broadly grouped as pre-erythrocytic, blood stage and transmission blocking. This review focuses on blood-stage vaccines, and considers the evidence supporting the development of blood-stage vaccines, the advantages and challenges of this approach, potential targets, human vaccine studies and future directions. There is a strong rationale for the development of vaccines based on antigens of blood-stage parasites. Symptomatic malaria is caused by blood-stage parasitemia and acquired immunity in humans largely targets blood-stage antigens. Several candidate vaccines have proved efficacious in animal models and at least one vaccine showed partial efficacy in a clinical trial. At present, all leading candidate blood-stage antigens are merozoite proteins, located on the merozoite surface or within the apical organelles. Major challenges and priorities include overcoming antigenic diversity, identification of protective epitopes, understanding the nature and targets of protective immune responses, and defining antigen combinations that give the greatest efficacy. Additionally, objective criteria and approaches are needed to prioritize the large number of candidate antigens, and strong candidates need to be tested in clinical trials as quickly as possible.

Evolution of the Transmission-Blocking Vaccine Candidates Pvs28 and Pvs25 in Plasmodium vivax: Geographic Differentiation and Evidence of Positive Selection

PubMed Central

Cornejo, Omar E.; Durrego, Ester; Stanley, Craig E.; Castillo, Andreína I.; Herrera, Sócrates; Escalante, Ananias A.

2016-01-01

Transmission-blocking (TB) vaccines are considered an important tool for malaria control and elimination. Among all the antigens characterized as TB vaccines against Plasmodium vivax, the ookinete surface proteins Pvs28 and Pvs25 are leading candidates. These proteins likely originated by a gene duplication event that took place before the radiation of the known Plasmodium species to primates. We report an evolutionary genetic analysis of a worldwide sample of pvs28 and pvs25 alleles. Our results show that both genes display low levels of genetic polymorphism when compared to the merozoite surface antigens AMA-1 and MSP-1; however, both ookinete antigens can be as polymorphic as other merozoite antigens such as MSP-8 and MSP-10. We found that parasite populations in Asia and the Americas are geographically differentiated with comparable levels of genetic diversity and specific amino acid replacements found only in the Americas. Furthermore, the observed variation was mainly accumulated in the EGF2- and EGF3-like domains for P. vivax in both proteins. This pattern was shared by other closely related non-human primate parasites such as Plasmodium cynomolgi, suggesting that it could be functionally important. In addition, examination with a suite of evolutionary genetic analyses indicated that the observed patterns are consistent with positive natural selection acting on Pvs28 and Pvs25 polymorphisms. The geographic pattern of genetic differentiation and the evidence for positive selection strongly suggest that the functional consequences of the observed polymorphism should be evaluated during development of TBVs that include Pvs25 and Pvs28. PMID:27347876

Defining the Timing of Action of Antimalarial Drugs against Plasmodium falciparum

PubMed Central

Langer, Christine; Goodman, Christopher D.; McFadden, Geoffrey I.

2013-01-01

Most current antimalarials for treatment of clinical Plasmodium falciparum malaria fall into two broad drug families and target the food vacuole of the trophozoite stage. No antimalarials have been shown to target the brief extracellular merozoite form of blood-stage malaria. We studied a panel of 12 drugs, 10 of which have been used extensively clinically, for their invasion, schizont rupture, and growth-inhibitory activity using high-throughput flow cytometry and new approaches for the study of merozoite invasion and early intraerythrocytic development. Not surprisingly, given reported mechanisms of action, none of the drugs inhibited merozoite invasion in vitro. Pretreatment of erythrocytes with drugs suggested that halofantrine, lumefantrine, piperaquine, amodiaquine, and mefloquine diffuse into and remain within the erythrocyte and inhibit downstream growth of parasites. Studying the inhibitory activity of the drugs on intraerythrocytic development, schizont rupture, and reinvasion enabled several different inhibitory phenotypes to be defined. All drugs inhibited parasite replication when added at ring stages, but only artesunate, artemisinin, cycloheximide, and trichostatin A appeared to have substantial activity against ring stages, whereas the other drugs acted later during intraerythrocytic development. When drugs were added to late schizonts, only artemisinin, cycloheximide, and trichostatin A were able to inhibit rupture and subsequent replication. Flow cytometry proved valuable for in vitro assays of antimalarial activity, with the free merozoite population acting as a clear marker for parasite growth inhibition. These studies have important implications for further understanding the mechanisms of action of antimalarials, studying and evaluating drug resistance, and developing new antimalarials. PMID:23318799

Genetic diversity of merozoite surface protein-2 in Plasmodium falciparum isolates from Aceh province, Indonesia

NASA Astrophysics Data System (ADS)

Jamil, K. F.; Supargiyono, S.; Syafruddin, D.; Pratama, N.; Silvy, S.

2018-03-01

Estimated 3.3 million Indonesian population were infected with malaria. However, extensive genetic polymorphism of the field isolates MSP-2 of P. falciparum represents a major obstacle for the development of malaria treatment. The aim of this study to investigate the genetic diversity of MSP-2 genotype in field isolates of P. falciparum collected in Aceh Province. A total of 90 patients enrolled in this study who were selected from positive malaria from eleven district Hospitals in Aceh from 2013-2015. Data was collected by anamnesis, complete physical examination and laboratory tests for MSP-2. All protocol to diagnose malaria assigned following the WHO 2010 guideline. All samples were stored in Eijkman Biology Molecular Institute, Jakarta.Among 90 samples were 57.7% male and 42.3% female with the most cases ages between 21-30 years old. Allele typing analysis displayed the polymorphic nature of P. falciparum. The MSP-2 have two alleles, 62.2% (56/90) for FC27 type and 58.9% (53/90) for 3D7 type and 21.2% (19/90) for mixed FC27 and 3D7 infection were identified. Diverse allele types from Aceh Province was identified in MSP-2 P. falciparum patients; there is the almost similar number of patients infected with both allele. A moderate level of the mixed allele was also observed.

Identification of Plasmodium falciparum reticulocyte binding protein homologue 5-interacting protein, PfRipr, as a highly conserved blood-stage malaria vaccine candidate.

PubMed

Ntege, Edward H; Arisue, Nobuko; Ito, Daisuke; Hasegawa, Tomoyuki; Palacpac, Nirianne M Q; Egwang, Thomas G; Horii, Toshihiro; Takashima, Eizo; Tsuboi, Takafumi

2016-11-04

Genetic variability in Plasmodium falciparum malaria parasites hampers current malaria vaccine development efforts. Here, we hypothesize that to address the impact of genetic variability on vaccine efficacy in clinical trials, conserved antigen targets should be selected to achieve robust host immunity across multiple falciparum strains. Therefore, suitable vaccine antigens should be assessed for levels of polymorphism and genetic diversity. Using a total of one hundred and two clinical isolates from a region of high malaria transmission in Uganda, we analyzed extent of polymorphism and genetic diversity in four recently reported novel blood-stage malaria vaccine candidate proteins: Rh5 interacting protein (PfRipr), GPI anchored micronemal antigen (PfGAMA), rhoptry-associated leucine zipper-like protein 1 (PfRALP1) and Duffy binding-like merozoite surface protein 1 (PfMSPDBL1). In addition, utilizing the wheat germ cell-free system, we expressed recombinant proteins for the four candidates based on P. falciparum laboratory strain 3D7 sequences, immunized rabbits to obtain specific antibodies (Abs) and performed functional growth inhibition assay (GIA). The GIA activity of the raised Abs was demonstrated using both homologous 3D7 and heterologous FVO strains in vitro. Both pfripr and pfralp1 are less polymorphic but the latter is comparatively more diverse, with varied number of regions having insertions and deletions, asparagine and 6-mer repeats in the coding sequences. Pfgama and pfmspdbl1 are polymorphic and genetically diverse among the isolates with antibodies against the 3D7-based recombinant PfGAMA and PfMSPDBL1 inhibiting merozoite invasion only in the 3D7 but not FVO strain. Moreover, although Abs against the 3D7-based recombinant PfRipr and PfRALP1 proteins potently inhibited merozoite invasion of both 3D7 and FVO, the GIA activity of anti-PfRipr was much higher than that of anti-PfRALP1. Thus, PfRipr is regarded as a promising blood-stage vaccine

Genome-Scale Protein Microarray Comparison of Human Antibody Responses in Plasmodium vivax Relapse and Reinfection

PubMed Central

Chuquiyauri, Raul; Molina, Douglas M.; Moss, Eli L.; Wang, Ruobing; Gardner, Malcolm J.; Brouwer, Kimberly C.; Torres, Sonia; Gilman, Robert H.; Llanos-Cuentas, Alejandro; Neafsey, Daniel E.; Felgner, Philip; Liang, Xiaowu; Vinetz, Joseph M.

2015-01-01

Large scale antibody responses in Plasmodium vivax malaria remains unexplored in the endemic setting. Protein microarray analysis of asexual-stage P. vivax was used to identify antigens recognized in sera from residents of hypoendemic Peruvian Amazon. Over 24 months, of 106 participants, 91 had two symptomatic P. vivax malaria episodes, 11 had three episodes, 3 had four episodes, and 1 had five episodes. Plasmodium vivax relapse was distinguished from reinfection by a merozoite surface protein-3α restriction fragment length polymorphism polymerase chain reaction (MSP3α PCR-RFLP) assay. Notably, P. vivax reinfection subjects did not have higher reactivity to the entire set of recognized P. vivax blood-stage antigens than relapse subjects, regardless of the number of malaria episodes. The most highly recognized P. vivax proteins were MSP 4, 7, 8, and 10 (PVX_003775, PVX_082650, PVX_097625, and PVX_114145); sexual-stage antigen s16 (PVX_000930); early transcribed membrane protein (PVX_090230); tryptophan-rich antigen (Pv-fam-a) (PVX_092995); apical merozoite antigen 1 (PVX_092275); and proteins of unknown function (PVX_081830, PVX_117680, PVX_118705, PVX_121935, PVX_097730, PVX_110935, PVX_115450, and PVX_082475). Genes encoding reactive proteins exhibited a significant enrichment of non-synonymous nucleotide variation, an observation suggesting immune selection. These data identify candidates for seroepidemiological tools to support malaria elimination efforts in P. vivax-endemic regions. PMID:26149860

PCR/RFLP-based analysis of genetically distinct Plasmodium vivax population of Pvmsp-3α and Pvmsp-3β genes in Pakistan.

PubMed

Khan, Shahid Niaz; Khan, Asif; Khan, Sanaullah; Ayaz, Sultan; Attaullah, Sobia; Khan, Jabbar; Khan, Muhammad Asim; Ali, Ijaz; Shah, Abdul Haleem

2014-09-09

Plasmodium vivax is one of the widespread human malarial parasites accounting for 75% of malaria epidemics. However, there is no baseline information about the status and nature of genetic variation of Plasmodium species circulating in various parts of Pakistan. The present study was aimed at observing the molecular epidemiology and genetic variation of Plasmodium vivax by analysing its merozoite surface protein-3α (msp-3α) and merozoite surface protein-3β (msp-3β) genes, by using suballele, species-specific, combined nested PCR/RFLP detection techniques. A total of 230 blood samples from suspected subjects tested slide positive for vivax malaria were collected from Punjab, Sindh, Khyber Pakhtunkhwa, and Balochistan during the period May 2012 to December 2013. Combined nested PCR/RFLP technique was conducted using Pvmsp-3α and Pvmsp-3β genetic markers to detect extent of genetic variation in clinical isolates of P. vivax in the studied areas of Pakistan. By PCR, P. vivax, 202/230 (87.82%), was found to be widely distributed in the studied areas. PCR/RFLP analysis showed a high range of allelic variations for both msp-3α and msp-3β genetic markers of P. vivax, i.e., 21 alleles for msp-3α and 19 for msp-3β. Statistically a significant difference (p ≤ 0.05) was observed in the genetic diversity of the suballelic variants of msp-3α and msp-3β genes of P. vivax. It is concluded that P. vivax populations are highly polymorphic and diverse allelic variants of Pvmsp-3α and Pvmsp-3β are present in Pakistan.

Allicin enhances host pro-inflammatory immune responses and protects against acute murine malaria infection

PubMed Central

2012-01-01

Background During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. Methods To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Results Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Conclusions Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses. PMID:22873687

Allicin enhances host pro-inflammatory immune responses and protects against acute murine malaria infection.

PubMed

Feng, Yonghui; Zhu, Xiaotong; Wang, Qinghui; Jiang, Yongjun; Shang, Hong; Cui, Liwang; Cao, Yaming

2012-08-08

During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses.

Cerebral malaria in mice: demonstration of cytoadherence of infected red blood cells and microrheologic correlates.

PubMed

Kaul, D K; Nagel, R L; Llena, J F; Shear, H L

1994-04-01

To understand the microcirculatory events during cerebral malaria, we have studied the lethal strain of rodent Plasmodia, Plasmodium yoelii 17XL, originally described by Yoeli and Hargreaves in 1974. The virulence of P. yoelii 17XL is caused by intravascular sequestration of infected red blood cells (IRBCs), especially in the brain vessels and capillaries. This mouse model resembles human P. falciparum infection more closely than P. berghei ANKA infection since it shows little, if any, inflammation of the brain. In vivo microcirculatory studies on cytoadherence of IRBCs were performed using the cremaster muscle preparation, which is an easily accessible vasculature for intravital observations. Ex vivo assay of cytoadherence was carried out in the artificially perfused mesocecum preparation of the rat. The results in either preparation demonstrated cytoadherence of IRBCs that was restricted to postcapillary venules. Furthermore, the in vivo measurements showed the prevalence of cytoadherence in small-diameter (< 40 microns) venules in accordance with the local wall shear rates. The parasitized animals demonstrated significantly reduced red blood cell velocities and wall shear rates in the small-diameter postcapillary venules of the cremaster. The relationship between cytoadherence and venular wall shear rates was also reflected in the inverse correlation between the number of adhered cells and the venular diameter in the ex vivo mesocecum preparation. In the ex vivo preparation, cytoadherence of IRBCs was accompanied by a higher peripheral resistance. Transmission electron microscopy of the cremaster muscle and brain tissues showed a tight association of IRBCs with the endothelium of small venules. These observations demonstrate that cytoadherence of P. yoelii 17XL-infected mouse red blood cells is very similar to that of P. falciparum-infected cells. Thus, this model should allow a detailed analysis of the molecular mechanisms involved in the generation of cerebral

Fine structure of the epicytoplasmic eimerid coccidium Acroeimeria pintoi Lainson & Paperna, 1999, a gut parasite of the lizard Ameiva ameiva in north Brazil.

PubMed

Paperna, L; Lainson, R

1999-12-01

An account is given of the fine structure of Acroeimerio pintoi, an epicytoplasmic coccidium infecting the small intestine of the teiid lizard Ameiva ameiva in north Brazil. The merozoile becomes encircled by outgrowths of the host-cell wall which then merge to form a parasitophorous sack in which the parasite continues to develop when this bulges out above the epithelium surface. The account includes a description of merozoites, young meronts and young and mature macrogamonts. The parasitophorous vacuole has a complex tubular system connected to its junction with the host-cell. The parasites are coated with a droplet-like glycocalyx and covered by a fine filamentous layer.

Motility and infectivity of Plasmodium berghei sporozoites expressing avian Plasmodium gallinaceum circumsporozoite protein.

PubMed

Tewari, Rita; Rathore, Dharmendar; Crisanti, Andrea

2005-05-01

Avian and rodent malaria sporozoites selectively invade different vertebrate cell types, namely macrophages and hepatocytes, and develop in distantly related vector species. To investigate the role of the circumsporozoite (CS) protein in determining parasite survival in different vector species and vertebrate host cell types, we replaced the endogenous CS protein gene of the rodent malaria parasite Plasmodium berghei with that of the avian parasite P. gallinaceum and control rodent parasite P. yoelii. In anopheline mosquitoes, P. berghei parasites carrying P. gallinaceum and rodent parasite P. yoelii CS protein gene developed into oocysts and sporozoites. Plasmodium gallinaceum CS expressing transgenic sporozoites, although motile, failed to invade mosquito salivary glands and to infect mice, which suggests that motility alone is not sufficient for invasion. Notably, a percentage of infected Anopheles stephensi mosquitoes showed melanotic encapsulation of late stage oocysts. This was not observed in control infections or in A. gambiae infections. These findings shed new light on the role of the CS protein in the interaction of the parasite with both the mosquito vector and the rodent host.

Detailed methodology for high resolution scanning electron microscopy (SEM) of murine malaria parasitized-erythrocytes.

PubMed

Hayakawa, Eri H; Matsuoka, Hiroyuki

2016-10-01

Scanning electron microscopy (SEM) is a powerful tool used to investigate object surfaces and has been widely applied in both material science and biology. With respect to the study of malaria, SEM revealed that erythrocytes infected with Plasmodium falciparum, a human parasite, display 'knob-like' structures on their surface comprising parasitized proteins. However, detailed methodology for SEM studies of malaria parasites is lacking in the literature making such studies challenging. Here, we provide a step-by-step guide to preparing Plasmodium-infected erythrocytes from two mouse strains for SEM analysis with minimal structural deterioration. We tested three species of murine malaria parasites, P. berghei, P. yoelii, and P. chabaudi, as well as non-parasitized human erythrocytes and P. falciparum-infected erythrocytes for comparisons. Our data demonstrated that the surface structures of parasitized erythrocytes between the three species of murine parasites in the two different strains of mice were indistinguishable and no surface alterations were observed in P. falciparum-erythrocytes. Our SEM observations contribute towards an understanding of the molecular mechanisms of parasite maturation in the erythrocyte cytoplasm and, along with future studies using our detailed methodology, may help to gain insight into the clinical phenomena of human malaria. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Genetic diversity and natural selection of Plasmodium knowlesi merozoite surface protein 1 paralog gene in Malaysia.

PubMed

Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek

2018-03-14

Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural selection of pkmsp1p. A low level of genetic diversity and strong evidence of negative selection was detected and observed in all the domains of pkmsp1p of P. knowlesi indicating functional constrains. Shared haplotypes were identified within pkmsp1p-19 highlighting further evaluation using larger number of clinical samples from Malaysia.

Genetic diversity of Plasmodium Vivax revealed by the merozoite surface protein-1 icb5-6 fragment.

PubMed

Ruan, Wei; Zhang, Ling-Ling; Feng, Yan; Zhang, Xuan; Chen, Hua-Liang; Lu, Qiao-Yi; Yao, Li-Nong; Hu, Wei

2017-06-05

Plasmodium vivax remains a potential cause of morbidity and mortality for people living in its endemic areas. Understanding the genetic diversity of P. vivax from different regions is valuable for studying population dynamics and tracing the origins of parasites. The PvMSP-1 gene is highly polymorphic and has been used as a marker in many P. vivax population studies. The aim of this study was to investigate the genetic diversity of the PvMSP-1 gene icb5-6 fragment and to provide more genetic polymorphism data for further studies on P. vivax population structure and tracking of the origin of clinical cases. Nested PCR and sequencing of the PvMSP-1 icb5-6 marker were performed to obtain the nucleotide sequences of 95 P. vivax isolates collected from Zhejiang province, China. To investigate the genetic diversity of PvMSP-1, the 95 nucleotide sequences of the PvMSP-1 icb5-6 fragment were genotyped and analyzed using DnaSP v5, MEGA software. The 95 P. vivax isolates collected from Zhejiang province were either indigenous cases or imported cases from different regions around the world. A total of 95 sequences ranging from 390 to 460 bp were obtained. The 95 sequences were genotyped into four allele-types (Sal I, Belem, R-III and R-IV) and 17 unique haplotypes. R-III and Sal I were the predominant allele-types. The haplotype diversity (Hd) and nucleotide diversity (Pi) were estimated to be 0.729 and 0.062, indicating that the PvMSP-1 icb5-6 fragment had the highest level of polymorphism due to frequent recombination processes and single nucleotide polymorphism. The values of dN/dS and Tajima's D both suggested neutral selection for the PvMSP-1icb5-6 fragment. In addition, a rare recombinant style of R-IV type was identified. This study presented high genetic diversity in the PvMSP-1 marker among P. vivax strains from around the world. The genetic data is valuable for expanding the polymorphism information on P. vivax, which could be helpful for further study on population dynamics and tracking the origin of P. vivax.

The genetic polymorphism of merozoite surface protein-1 in Plasmodium falciparum isolates from Aceh province, Indonesia

NASA Astrophysics Data System (ADS)

Jamil, K. F.; Supargiyono, S.; Syafruddin, D.; Pratama, N.; Silvy, S.

2018-03-01

An estimated of 3.3 million Indonesian population were infected with malaria. However, extensive genetic polymorphism of the field isolates msp-1 of P. falciparum represents a major obstacle for the development of malaria treatment. The aim of this study was to investigate the genetic diversity of msp-1 genotype in field isolates of P. falciparum collected in Aceh Province. A total of 90 patients with malaria (+) were selected from eleven district hospitals in Aceh from 2013-2015. Data were collected by anamnesis, complete physical examination and laboratory tests for msp-1. All protocols to diagnose malaria followed the WHO 2010 guideline. All samples were stored in Eijkman Biology Molecular Institute, Jakarta. Among 90 samples, 57.7% were male, and 42.3% were female with the most cases found between 21-30 years old. From the allele typing analysis of P. falciparum from Aceh; K1, MAD20, and RO33 allele types were identified. MAD20 type was the highest allele found in this study (57.9%). It was found in single and mixed infection. A moderate level of the mixed allele was also observed.

Tracking Glideosome-associated protein 50 reveals the development and organization of the inner membrane complex of Plasmodium falciparum.

PubMed

Yeoman, Jeffrey A; Hanssen, Eric; Maier, Alexander G; Klonis, Nectarios; Maco, Bohumil; Baum, Jake; Turnbull, Lynne; Whitchurch, Cynthia B; Dixon, Matthew W A; Tilley, Leann

2011-04-01

The most deadly of the human malaria parasites, Plasmodium falciparum, has different stages specialized for invasion of hepatocytes, erythrocytes, and the mosquito gut wall. In each case, host cell invasion is powered by an actin-myosin motor complex that is linked to an inner membrane complex (IMC) via a membrane anchor called the glideosome-associated protein 50 (PfGAP50). We generated P. falciparum transfectants expressing green fluorescent protein (GFP) chimeras of PfGAP50 (PfGAP50-GFP). Using immunoprecipitation and fluorescence photobleaching, we show that C-terminally tagged PfGAP50-GFP can form a complex with endogenous copies of the linker protein PfGAP45 and the myosin A tail domain-interacting protein (MTIP). Full-length PfGAP50-GFP is located in the endoplasmic reticulum in early-stage parasites and then redistributes to apical caps during the formation of daughter merozoites. In the final stage of schizogony, the PfGAP50-GFP profile extends further around the merozoite surface. Three-dimensional (3D) structured illumination microscopy reveals the early-stage IMC as a doubly punctured flat ellipsoid that separates to form claw-shaped apposed structures. A GFP fusion of PfGAP50 lacking the C-terminal membrane anchor is misdirected to the parasitophorous vacuole. Replacement of the acid phosphatase homology domain of PfGAP50 with GFP appears to allow correct trafficking of the chimera but confers a growth disadvantage.

Genome-Scale Protein Microarray Comparison of Human Antibody Responses in Plasmodium vivax Relapse and Reinfection.

PubMed

Chuquiyauri, Raul; Molina, Douglas M; Moss, Eli L; Wang, Ruobing; Gardner, Malcolm J; Brouwer, Kimberly C; Torres, Sonia; Gilman, Robert H; Llanos-Cuentas, Alejandro; Neafsey, Daniel E; Felgner, Philip; Liang, Xiaowu; Vinetz, Joseph M

2015-10-01

Large scale antibody responses in Plasmodium vivax malaria remains unexplored in the endemic setting. Protein microarray analysis of asexual-stage P. vivax was used to identify antigens recognized in sera from residents of hypoendemic Peruvian Amazon. Over 24 months, of 106 participants, 91 had two symptomatic P. vivax malaria episodes, 11 had three episodes, 3 had four episodes, and 1 had five episodes. Plasmodium vivax relapse was distinguished from reinfection by a merozoite surface protein-3α restriction fragment length polymorphism polymerase chain reaction (MSP3α PCR-RFLP) assay. Notably, P. vivax reinfection subjects did not have higher reactivity to the entire set of recognized P. vivax blood-stage antigens than relapse subjects, regardless of the number of malaria episodes. The most highly recognized P. vivax proteins were MSP 4, 7, 8, and 10 (PVX_003775, PVX_082650, PVX_097625, and PVX_114145); sexual-stage antigen s16 (PVX_000930); early transcribed membrane protein (PVX_090230); tryptophan-rich antigen (Pv-fam-a) (PVX_092995); apical merozoite antigen 1 (PVX_092275); and proteins of unknown function (PVX_081830, PVX_117680, PVX_118705, PVX_121935, PVX_097730, PVX_110935, PVX_115450, and PVX_082475). Genes encoding reactive proteins exhibited a significant enrichment of non-synonymous nucleotide variation, an observation suggesting immune selection. These data identify candidates for seroepidemiological tools to support malaria elimination efforts in P. vivax-endemic regions. © The American Society of Tropical Medicine and Hygiene.

The traditional medicine Spilanthes acmella, and the alkylamides spilanthol and undeca-2E-ene-8,10-diynoic acid isobutylamide, demonstrate in vitro and in vivo anti-malarial activity

PubMed Central

Spelman, Kevin; Depoix, Delphine; McCray, Megan; Mouray, Elisabeth; Grellier, Philippe

2010-01-01

Spilanthes spp. are used as traditional herbal medicines in Africa and India to treat malaria. Yet, to date, there is no data on active constituents or most effective extraction methods for this indication. The isolated alkylamides, spilanthol and undeca-2E-ene-8,10-diynoic acid isobutylamide, found in S. acmella Murr., were shown to have IC50s of 16.5 μg/mL and 41.4 μg/mL on Plasmodium falciparum strain PFB and IC50s of 5.8 μg/mL and 16.3 μg/mL for the chloroquine resistant P. falciparum K1 strain, respectively. Further investigations revealed that at relatively low concentrations, spilanthol and the water extract of S. acmella reduced the parasitemia 59% and 53% in mice infected with P. yoelii yoelii 17XNL at 5 mg/kg and 50 mg/kg, respectively. Unexpectedly, the 95% ethanol extract of S. acmella was less effective (36% reduction in parasitemia) at 50 mg/kg. These results provide the first evidence supporting S. acmella against malaria and demonstrating active constituents in S. acmella against P. falciparum. PMID:22692989

Ovalocytic erythrocytes from Melanesians are resistant to invasion by malaria parasites in culture.

PubMed Central

Kidson, C; Lamont, G; Saul, A; Nurse, G T

1981-01-01

Ovalocytic erythrocytes from Melanesians in Papua New Guinea have been demonstrated to be resistant to infection by malaria parasites (Plasmodium falciparum) in culture by using a double-label fluorescence assay of merozoite invasion. That merozoites do not bind irreversibly to ovalocytes has been demonstrated by an assay that measures competition between ovalocytes and normocytes. Analysis of behavior on thermal deformation has demonstrated that ovalocytes are more more thermostable than normocytes, suggesting that there is a major difference in cytoskeletal structure. These findings with P. falciparum and epidemiological data demonstrating clinical resistance to P. vivax and P. malariae suggest that the membrane alterations(s) in these ovalocytes affect(s) invasion step(s) common to all three species of malaria parasite. Images PMID:7029547

Major surface antigen p190 of Plasmodium falciparum: detection of common epitopes present in a variety of plasmodia isolates.

PubMed Central

Gentz, R; Certa, U; Takacs, B; Matile, H; Döbeli, H; Pink, R; Mackay, M; Bone, N; Scaife, J G

1988-01-01

Plasmodium falciparum merozoites are covered with polymorphic proteins that are processed from a 190 kd (p190) precursor protein. These are candidates for an antimalarial vaccine. We cloned and expressed a number of DNA fragments, comprising almost the entire p190 gene of the K1 isolate, in Escherichia coli. Pooled human endemic-area sera and rabbit antibodies raised against p190 protein isolated from K1 parasites react with only a limited number of the recombinant proteins. From these studies we could select two antigenic polypeptides containing conserved amino acid stretches of the otherwise highly polymorphic protein. Rabbits and mice injected with the purified recombinant proteins produce antibodies reacting differentially with various isolates of P. falciparum. We obtained antibodies detecting all isolates tested and a monoclonal antibody specific for isolates containing a K1 type allele of the p190 gene. Images PMID:2452082

Human Antibodies to a Mr 155,000 Plasmodium falciparum Antigen Efficiently Inhibit Merozoite Invasion

NASA Astrophysics Data System (ADS)

Wahlin, Birgitta; Wahlgren, Mats; Perlmann, Hedvig; Berzins, Klavs; Bjorkman, Anders; Patarroyo, Manuel E.; Perlmann, Peter

1984-12-01

IgG from a donor clinically immune to Plasmodium falciparum malaria strongly inhibited reinvasion in vitro of human erythrocytes by the parasite. When added to monolayers of glutaraldehyde-fixed and air-dried erythrocytes infected with the parasite, this IgG also displayed a characteristic immunofluorescence restricted to the surface of infected erythrocytes. Elution of the IgG adsorbed to such monolayers gave an antibody fraction that was 40 times more efficient in the reinvasion inhibition assay (50% inhibition titer, <1 μ g/ml) than the original IgG preparation. The major antibody in this eluate was directed against a parasite-derived antigen of Mr 155,000 (Pf 155) deposited by the parasite in the erythrocyte membrane in the course of invasion. A detailed study of IgG fractions from 11 donors with acute P. falciparum malaria or clinical immunity revealed the existence of an excellent correlation between their capacities to stain the surface of infected erythrocytes, their titers in reinvasion inhibition, and the presence of antibodies to Pf 155 as detected by immunoblotting. No such correlations were seen when the IgG fractions were analyzed for immunofluorescence of intracellular parasites or for the presence of antibodies to other parasite antigens as detected by immunoprecipitation of [35S]methionine-labeled and NaDodSO4/PAGE-separated parasite extracts. The results suggest that Pf 155 has an important role in the process of erythrocyte infection and that host antibodies to this antigen may efficiently interfere with this process.

Towards a needle-free diagnosis of malaria: in vivo identification and classification of red and white blood cells containing haemozoin.

PubMed

Burnett, Jennifer L; Carns, Jennifer L; Richards-Kortum, Rebecca

2017-11-07

Optical detection of circulating haemozoin has been suggested as a needle free method to diagnose malaria using in vivo microscopy. Haemozoin is generated within infected red blood cells by the malaria parasite, serving as a highly specific, endogenous biomarker of malaria. However, phagocytosis of haemozoin by white blood cells which persist after the infection is resolved presents the potential for false positive diagnosis; therefore, the focus of this work is to identify a feature of the haemozoin signal to discriminate between infected red blood cells and haemozoin-containing white blood cells. Conventional brightfield microscopy of thin film blood smears was used to analyse haemozoin absorbance signal in vitro. Cell type and parasite maturity were morphologically determined using colocalized DAPI staining. The ability of features to discriminate between infected red blood cells and haemozoin-containing white blood cells was evaluated using images of smears from subjects infected with two species of Plasmodium, Plasmodium yoelii and Plasmodium falciparum. Discriminating features identified by blood smear microscopy were characterized in vivo in P. yoelii-infected mice. Two features of the haemozoin signal, haemozoin diameter and normalized intensity difference, were identified as potential parameters to differentiate infected red blood cells and haemozoin-containing white blood cells. Classification performance was evaluated using the area under the receiver operating characteristic curve, with area under the curve values of 0.89 for the diameter parameter and 0.85 for the intensity parameter when assessed in P. yoelii samples. Similar results were obtained from P. falciparum blood smears, showing an AUC of 0.93 or greater for both classification features. For in vivo investigations, the intensity-based metric was the best classifier, with an AUC of 0.91. This work demonstrates that size and intensity features of haemozoin absorbance signal collected by in vivo

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

A malaria protein factor induces IL-4 production by dendritic cells via PI3K-Akt-NF-κB signaling independent of MyD88/TRIF and promotes Th2 response.

PubMed

Wu, Xianzhu; Gowda, Nagaraj M; Kawasawa, Yuka I; Gowda, D Channe

2018-04-17

Dendritic cells (DC) and cytokines produced by DC play crucial roles in inducing and regulating pro-/anti-inflammatory and Th1/Th2 responses. DC are known to produce Th1-promoting cytokine, IL-12, in response to malaria and other pathogenic infections, but it is thought that DC do not produce Th2-promoting cytokine, IL-4. Here, we show that a protein factor of malaria parasites induces IL-4 responses by CD11c hi MHCII hi CD3ε - CD49b - CD19 - FcεRI - DC via PI3K-Akt-NF-κB signaling independent of TLR-MyD88/TRIF. Malaria parasite-activated DC induced IL-4 responses by T cells both in vitro and in vivo , favoring Th2, and il-4 deficient DC were unable to induce IL-4 expression by T cell.  Interestingly, lethal parasites, Plasmodium falciparum and P. berghei ANKA, induced IL-4 response primarily by CD8a - DC, whereas nonlethal P. yoelii induced IL-4 by both CD8α + and CD8α - DC. In both P. berghei ANKA- and P. yoelii -infected mice, IL-4-expressing CD8α - DC did not express IL-12, but a distinct CD8α - DC subset expressed IL-12. In P. berghei ANKA infection, CD8α + DC expressed IL-12 but not IL-4, whereas in P. yoelii infection CD8α + DC expressed IL-4 but not IL-12. This differential IL-4 and IL-12 responses by DC subsets may contribute to different Th1/Th2 development and clinical outcomes in lethal and nonlethal malaria. Our results for the first time demonstrate that a malaria protein factor induces IL-4 production by DC via PI3K-Akt-NF-κB signaling, revealing signaling and molecular mechanisms that initiate and promote Th2 development. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Syk inhibitors interfere with erythrocyte membrane modification during P falciparum growth and suppress parasite egress.

PubMed

Pantaleo, Antonella; Kesely, Kristina R; Pau, Maria Carmina; Tsamesidis, Ioannis; Schwarzer, Evelin; Skorokhod, Oleksii A; Chien, Huynh D; Ponzi, Marta; Bertuccini, Lucia; Low, Philip S; Turrini, Francesco M

2017-08-24

Band 3 (also known as the anion exchanger, SLCA1, AE1) constitutes the major attachment site of the spectrin-based cytoskeleton to the erythrocyte's lipid bilayer and thereby contributes critically to the stability of the red cell membrane. During the intraerythrocytic stage of Plasmodium falciparum 's lifecycle, band 3 becomes tyrosine phosphorylated in response to oxidative stress, leading to a decrease in its affinity for the spectrin/actin cytoskeleton and causing global membrane destabilization. Because this membrane weakening is hypothesized to facilitate parasite egress and the consequent dissemination of released merozoites throughout the bloodstream, we decided to explore which tyrosine kinase inhibitors might block the kinase-induced membrane destabilization. We demonstrate here that multiple Syk kinase inhibitors both prevent parasite-induced band 3 tyrosine phosphorylation and inhibit parasite-promoted membrane destabilization. We also show that the same Syk kinase inhibitors suppress merozoite egress near the end of the parasite's intraerythrocytic lifecycle. Because the entrapped merozoites die when prevented from escaping their host erythrocytes and because some Syk inhibitors have displayed long-term safety in human clinical trials, we suggest Syk kinase inhibitors constitute a promising class of antimalarial drugs that can suppress parasitemia by inhibiting a host target that cannot be mutated by the parasite to evolve drug resistance. © 2017 by The American Society of Hematology.

Endogenous Life Cycle of Eimeria melanomytis (Apicomplexa: Eimeriidae) from the Dusky Rice Rat, Melanomys caliginosus (Rodentia: Cricetidae: Sigmodontinae) in Costa Rica.

PubMed

Chinchilla, Misael; Valerio, Idalia; Sánchez, Ronald; Duszynski, Donald W

2017-02-01

Endogenous stages of the life cycle of Eimeria melanomytis, infecting the peripheral epithelial cells of villi of the small intestine of experimentally infected young dusky rice rats, Melanomys caliginosus , were studied. Giemsa-stained mucosal scrapings and histological sections were examined for all the stages. Eimeria melanomytis has 3 generations of meronts (M), different in size, shape, and number of merozoites (m); and in size, shape, and location of the nuclei within the cytoplasm of the meronts. The 3 meront types, M 1 -M 3 , respectively, had 11-14 (m 1 ), 7-10 (m 2 ), and 20-30 (m 3 ) merozoites. Macrogametocytes and microgametocytes, as well as macrogametes and microgametes, complete the sexual cycle forming the unsporulated oocysts. This parasite's endogenous development produced severe intestinal lesions in experimentally infected dusky rice rats.

Genetic characterization of an epidemic of Plasmodium falciparum malaria among Yanomami Amerindians.

PubMed

Laserson, K F; Petralanda, I; Almera, R; Barker, R H; Spielman, A; Maguire, J H; Wirth, D F

1999-12-01

Malaria parasites are genetically diverse at all levels of endemicity. In contrast, the merozoite surface protein (MSP) alleles in samples from 2 isolated populations of Yanomami Amerindians during an epidemic of Plasmodium falciparum were identical. The nonvariable restriction fragment length polymorphism patterns further suggested that the sequential outbreak comprised only a single P. falciparum genotype. By examination of serial samples from single human infections, the MSP characteristics were found to remain constant throughout the course of infection. An apparent clonal population structure of parasites seemed to cause outbreaks in small isolated villages. The use of standard molecular epidemiologic methods to measure genetic diversity in malaria revealed the occurrence of a genetically monomorphic population of P. falciparum within a human community.

Treatment of Chloroquine-Resistant Malaria with Esters of Cephalotaxine: Homoharringtonine

DTIC Science & Technology

1990-01-01

AD-A233 355 1py Annals of Tropical Medicine and Parasitology, Vol. 84, No. 3,229-237 (1990) E L ECT E MAR 2 91991 Treatment of chloroquine -resistant...growth inhibition of two strains of chloroquine -resistant Plasmodiumfalciparum malaria in vitro. In vivo tests in mice infected with P.yoelii showed...usefulness of homoharringtonine in the treatment of chloroquine -resistant malaria, but also demonstrate the advantage of applying comparative biochemistry

A conserved 19-kDa Eimeria tenella antigen is a profilin-like protein.

PubMed

Fetterer, R H; Miska, K B; Jenkins, M C; Barfield, R C

2004-12-01

A wide range of recombinant proteins from Eimeria species have been reported to offer some degree of protection against infection and disease, but the specific biological function of these proteins is largely unknown. Previous studies have demonstrated a 19-kDa protein of unknown function designated SZ-1 in sporozoites and merozoites of Eimeria acervulina that can be used to confer partial protection against coccidiosis. Reverse transcriptase-polymerase chain reaction indicated that the gene for SZ-1 is expressed by all the asexual stages of Eimeria tenella. Rabbit antisera to recombinant SZ-1 recognized an approximately 19-kDa protein from extracts of E. tenella sporozoites, merozoites, sporulated oocysts, and oocysts in various stages of sporulation. Immunofluorescence antibody staining indicated specific staining of E. tenella sporozoites and merozoites. Staining was most intense in the cytoplasm of the posterior end of the parasite. The primary amino acid sequence of the gene for E. tenella SZ-1 deduced from the E. tenella genome indicated a conserved domain for the actin-regulatory protein profilin. A conserved binding site for poly-L-proline (PLP), characteristic of profilin was also observed. SZ-1 was separated from soluble extract of E. tenella proteins by affinity chromatography using a PLP ligand, confirming the ability of SZ-1 to bind PLP. SZ-1 also partially inhibited the polymerization of actin. The current results are consistent with the classification of SZ-1 as a profilin-related protein.

Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate.

PubMed

Parzych, Elizabeth M; Miura, Kazutoyo; Ramanathan, Aarti; Long, Carole A; Burns, James M

2018-01-01

Challenges with the production and suboptimal immunogenicity of malaria vaccine candidates have slowed the development of a Plasmodium falciparum multiantigen vaccine. Attempting to resolve these issues, we focused on the use of highly immunogenic merozoite surface protein 8 (MSP8) as a vaccine carrier protein. Previously, we showed that a genetic fusion of the C-terminal 19-kDa fragment of merozoite surface protein 1 (MSP1 19 ) to P. falciparum MSP8 ( Pf MSP8) facilitated antigen production and folding and the induction of neutralizing antibodies to conformational B cell epitopes of MSP1 19 Here, using the Pf MSP1/8 construct, we further optimized the recombinant Pf MSP8 (r Pf MSP8) carrier by the introduction of two cysteine-to-serine substitutions (CΔS) to improve the yield of the monomeric product. We then sought to test the broad applicability of this approach using the transmission-blocking vaccine candidate Pf s25. The production of r Pf s25-based vaccines has presented challenges. Antibodies directed against the four highly constrained epidermal growth factor (EGF)-like domains of Pf s25 block sexual-stage development in mosquitoes. The sequence encoding mature Pf s25 was codon harmonized for expression in Escherichia coli We produced a r Pf s25- Pf MSP8 fusion protein [r Pf s25/8(CΔS)] as well as unfused, mature r Pf s25. r Pf s25 was purified with a modest yield but required the incorporation of refolding protocols to obtain a proper conformation. In comparison, chimeric r Pf s25/8(CΔS) was expressed and easily purified, with the Pf s25 domain bearing the proper conformation without renaturation. Both antigens were immunogenic in rabbits, inducing IgG that bound native Pf s25 and exhibited potent transmission-reducing activity. These data further demonstrate the utility of Pf MSP8 as a parasite-specific carrier protein to enhance the production of complex malaria vaccine targets. Copyright © 2017 American Society for Microbiology.

Avidity of anti-malarial antibodies inversely related to transmission intensity at three sites in Uganda.

PubMed

Ssewanyana, Isaac; Arinaitwe, Emmanuel; Nankabirwa, Joaniter I; Yeka, Adoke; Sullivan, Richard; Kamya, Moses R; Rosenthal, Philip J; Dorsey, Grant; Mayanja-Kizza, Harriet; Drakeley, Chris; Greenhouse, Bryan; Tetteh, Kevin K A

2017-02-10

People living in malaria endemic areas acquire protection from severe malaria quickly, but protection from clinical disease and control of parasitaemia is acquired only after many years of repeated infections. Antibodies play a central role in protection from clinical disease; however, protective antibodies are slow to develop. This study sought to investigate the influence of Plasmodium falciparum exposure on the acquisition of high-avidity antibodies to P. falciparum antigens, which may be associated with protection. Cross-sectional surveys were performed in children and adults at three sites in Uganda with varied P. falciparum transmission intensity (entomological inoculation rates; 3.8, 26.6, and 125 infectious bites per person per year). Sandwich ELISA was used to measure antibody responses to two P. falciparum merozoite surface antigens: merozoite surface protein 1-19 (MSP1-19) and apical membrane antigen 1 (AMA1). In individuals with detectable antibody levels, guanidine hydrochloride (GuHCl) was added to measure the relative avidity of antibody responses by ELISA. Within a site, there were no significant differences in median antibody levels between the three age groups. Between sites, median antibody levels were generally higher in the higher transmission sites, with differences more apparent for AMA-1 and in ≥5 year group. Similarly, median avidity index (proportion of high avidity antibodies) showed no significant increase with increasing age but was significantly lower at sites of higher transmission amongst participants ≥5 years of age. Using 5 M GuHCl, the median avidity indices in the ≥5 year group at the highest and lowest transmission sites were 19.9 and 26.8, respectively (p = 0.0002) for MSP1-19 and 12.2 and 17.2 (p = 0.0007) for AMA1. Avidity to two different P. falciparum antigens was lower in areas of high transmission intensity compared to areas with lower transmission. Appreciation of the mechanisms behind these findings as

Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

PubMed

Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

2017-07-01

In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a

Letter to the editor: Identification of Sarcocystis capracanis in cerebrospinal fluid from sheep with neurological disease

USDA-ARS?s Scientific Manuscript database

A recent report (Formisano et al., 2013) identified clinical sacrocystosis in 2 adult sheep. The diagnosis relied primarily on characterization of DNA extracted from cerebrospinal fluid (CSF) and paraffin-embedded heart tissue. Parasites identified as merozoites were identified in CSF smears stained...

Determination of the molecular basis for a limited dimorphism, N417K, in the Plasmodium vivax Duffy-binding protein.

PubMed

McHenry, Amy M; Barnes, Samantha J; Ntumngia, Francis B; King, Christopher L; Adams, John H

2011-01-01

Invasion of human red blood cells by Plasmodium merozoites is vital for replication and survival of the parasite and, as such, is an attractive target for therapeutic intervention. Merozoite invasion is mediated by specific interactions between parasite ligands and host erythrocyte receptors. The P. vivax Duffy-binding protein (PvDBP) is heavily dependent on the interaction with the human Duffy blood group antigen/receptor for chemokines (DARC) for invasion. Region II of PvDBP contains many allelic polymorphisms likely to have arisen by host immune selection. Successful vaccine development necessitates a deeper understanding of the role of these polymorphisms in both parasite function and evasion of host immunity. A 3D structure of the homologous P. knowlesi DBP predicts that most variant residues are surface-exposed, including N417K, which is a dimorphic residue change that has previously been shown to be part of a linked haplotype that alters DBP sensitivity to inhibitory antibody. In natural isolates only two residues are found at this site, asparagine (N) and lysine (K). Site-directed mutagenesis of residue 417 was used to create a panel of 20 amino acid variants that were then examined for their binding phenotype and response to immune sera. Our results suggest that the observed dimorphism likely arose due to both structural requirements and immune selection pressure. To our knowledge, this is the first exhaustive examination of this kind of the role of a single amino acid residue in antigenic character and binding ability. Our results demonstrate that a single amino acid substitution can dramatically alter both the ability of the PvDBP to bind to human erythrocytes and its antigenic character.

The Clinically Tested Gardos Channel Inhibitor Senicapoc Exhibits Antimalarial Activity

PubMed Central

Tubman, Venée N.; Mejia, Pedro; Shmukler, Boris E.; Bei, Amy K.; Alper, Seth L.; Mitchell, James R.

2015-01-01

Senicapoc, a Gardos channel inhibitor, prevented erythrocyte dehydration in clinical trials of patients with sickle cell disease. We tested the hypothesis that senicapoc-induced blockade of the Gardos channel inhibits Plasmodium growth. Senicapoc inhibited in vitro growth of human and primate plasmodia during the clinical blood stage. Senicapoc treatment suppressed P. yoelii parasitemia in vivo in C57BL/6 mice. The reassuring safety and biochemical profile of senicapoc encourage its use in antimalarial development. PMID:26459896

Identification of a dithiol-dependent nucleoside triphosphate hydrolase in Sarcocystis neurona.

PubMed

Zhang, Deqing; Gaji, Rajshekhar Y; Howe, Daniel K

2006-09-01

A putative nucleoside triphosphate hydrolase (NTPase) gene was identified in a database of expressed sequence tags (ESTs) from the apicomplexan parasite Sarcocystis neurona. Analysis of culture-derived S. neurona merozoites demonstrated a dithiol-dependent NTPase activity, consistent with the presence of a homologue to the TgNTPases of Toxoplasma gondii. A complete cDNA was obtained for the S. neurona gene and the predicted amino acid sequence shared 38% identity with the two TgNTPase isoforms from T. gondii. Based on the obvious homology, the S. neurona protein was designated SnNTP1. The SnNTP1 cDNA encodes a polypeptide of 714 amino acids with a predicted 22-residue signal peptide and an estimated mature molecular mass of 70kDa. Southern blot analysis of the SnNTP1 locus revealed that the gene exists as a single copy in the S. neurona genome, unlike the multiple gene copies that have been observed in T. gondii and Neospora caninum. Analyses of the SnNTP1 protein demonstrated that it is soluble and secreted into the culture medium by extracellular merozoites. Surprisingly, indirect immunofluorescence analysis of intracellular S. neurona revealed apical localisation of SnNTP1 and temporal expression characteristics that are comparable with the microneme protein SnMIC10. The absence of SnNTP1 during much of endopolygeny implies that this protein does not serve a function during intracellular growth and development of S. neurona schizonts. Instead, SnNTP1 may play a role in events that occur during or proximal to merozoite egress from and/or invasion into cells.

Rediscovery and redescription of Plasmodium pifanoi and description of two additional Plasmodium parasites of Venezuelan lizards.

PubMed

Telford, Sam R; Telford, Sam R

2003-04-01

Plasmodium pifanoi Scorza and Dagert B., known only from the type host, Ameiva ameiva, is redescribed from Kentropyx calcarata collected in Territorio Amazonas, Venezuela. Schizonts, 6.2 x 4.5 (4-8 x 3-6), produce on average 11.9 (7-16) merozoites. Gametocytes average 12.4 x 6.0 (8-16 x 4-10), with length x width (LW) 72.9 (52-112) and L/W 2.18 (1.1-3.3), and always contain 1-5 prominent vacuoles. Macrogametocytes in active infection are longer than microgametocytes, with greater LW, but gametocytes in chronic infection are not sexually dimorphic in dimension and are slightly smaller. Two additional malarial parasites are described from K. calcarata. Plasmodium lepidoptiformis has small schizonts, 4.6 x 3.2 (3-6 x 2.5-3), that produce 5.1 (4-8) merozoites and commonly resemble a butterfly in appearance. Gametocytes are elongate, 9.0 x 4.3 (7-10 x 3-6), with LW 38.3 (24-51) and L/W 2.2 (1.3-3.3), and sexually dimorphic, with macrogametocytes longer than microgametocytes, with greater LW. Plasmodium minasense calcaratae is characterized by very small, usually fan-shaped, schizonts. 3.4 x 2.6 (2.5-4.5 x 2.0-3.0), that produce 3.9 (3-4) merozoites. Gametocytes are spherical or ovoid, 6.7 x 5.0 (4.5-9.0 x 3.0-7.0), with LW 33.7 (15-54) and L/W 1.4 (1.0-2.3), with no sexual dimorphism in dimensions.

Identification of Novel Pre-Erythrocytic Malaria Antigen Candidates for Combination Vaccines with Circumsporozoite Protein

PubMed Central

Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W.; Garcia, Valentino; Kappe, Stefan H. I.; Krzych, Urszula; Duffy, Patrick E.

2016-01-01

Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP. PMID:27434123

Identification of Novel Pre-Erythrocytic Malaria Antigen Candidates for Combination Vaccines with Circumsporozoite Protein.

PubMed

Speake, Cate; Pichugin, Alexander; Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W; Garcia, Valentino; Kappe, Stefan H I; Krzych, Urszula; Duffy, Patrick E

2016-01-01

Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP.

Thermal behaviour of Anopheles stephensi in response to infection with malaria and fungal entomopathogens

PubMed Central

Blanford, Simon; Read, Andrew F; Thomas, Matthew B

2009-01-01

Background Temperature is a critical determinant of the development of malaria parasites in mosquitoes, and hence the geographic distribution of malaria risk, but little is known about the thermal preferences of Anopheles. A number of other insects modify their thermal behaviour in response to infection. These alterations can be beneficial for the insect or for the infectious agent. Given current interest in developing fungal biopesticides for control of mosquitoes, Anopheles stephensi were examined to test whether mosquitoes showed thermally-mediated behaviour in response to infection with fungal entomopathogens and the rodent malaria, Plasmodium yoelii. Methods Over two experiments, groups of An. stephensi were infected with one of three entomopathogenic fungi, and/or P. yoelii. Infected and uninfected mosquitoes were released on to a thermal gradient (14 – 38°C) for "snapshot" assessments of thermal preference during the first five days post-infection. Mosquito survival was monitored for eight days and, where appropriate, oocyst prevalence and intensity was assessed. Results and conclusion Both infected and uninfected An. stephensi showed a non-random distribution on the gradient, indicating some capacity to behaviourally thermoregulate. However, chosen resting temperatures were not altered by any of the infections. There is thus no evidence that thermally-mediated behaviours play a role in determining malaria prevalence or that they will influence the performance of fungal biopesticides against adult Anopheles. PMID:19379519

Disrupting malaria parasite AMA1-RON2 interaction with a small molecule prevents erythrocyte invasion.

PubMed

Srinivasan, Prakash; Yasgar, Adam; Luci, Diane K; Beatty, Wandy L; Hu, Xin; Andersen, John; Narum, David L; Moch, J Kathleen; Sun, Hongmao; Haynes, J David; Maloney, David J; Jadhav, Ajit; Simeonov, Anton; Miller, Louis H

2013-01-01

Plasmodium falciparum resistance to artemisinin derivatives, the first-line antimalarial drug, drives the search for new classes of chemotherapeutic agents. Current discovery is primarily directed against the intracellular forms of the parasite. However, late schizont-infected red blood cells (RBCs) may still rupture and cause disease by sequestration; consequently targeting invasion may reduce disease severity. Merozoite invasion of RBCs requires interaction between two parasite proteins AMA1 and RON2. Here we identify the first inhibitor of this interaction that also blocks merozoite invasion in genetically distinct parasites by screening a library of over 21,000 compounds. We demonstrate that this inhibition is mediated by the small molecule binding to AMA1 and blocking the formation of AMA1-RON complex. Electron microscopy confirms that the inhibitor prevents junction formation, a critical step in invasion that results from AMA1-RON2 binding. This study uncovers a strategy that will allow for highly effective combination therapies alongside existing antimalarial drugs.

Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

PubMed

Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

2015-12-01

Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. Copyright © 2015 Elsevier Ltd. All rights reserved.

Triggers of key calcium signals during erythrocyte invasion by Plasmodium falciparum

PubMed Central

Gao, Xiaohong; Gunalan, Karthigayan; Yap, Sally Shu Lin; Preiser, Peter R.

2013-01-01

Invasion of erythrocytes by Plasmodium falciparum merozoites is a complex multi-step process mediated by specific interactions between host receptors and parasite ligands. Reticulocyte-binding protein homologues (RHs) and erythrocyte-binding-like (EBL) proteins are discharged from specialized organelles and used in early steps of invasion. Here we show that monoclonal antibodies against PfRH1 (an RH) block merozoite invasion by specifically inhibiting calcium signalling in the parasite, whereas invasion-inhibiting monoclonal antibodies targeting EBA175 (an EBL protein) have no effect on signalling. We further show that inhibition of this calcium signalling prevents EBA175 discharge and thereby formation of the junction between parasite and host cell. Our results indicate that PfRH1 has an initial sensing as well as signal transduction role that leads to the subsequent release of EBA175. They also provide new insights on how RH–host cell interactions lead to essential downstream signalling events in the parasite, suggesting new targets for malaria intervention. PMID:24280897

Compositional and expression analyses of the glideosome during the Plasmodium life cycle reveal an additional myosin light chain required for maximum motility

PubMed Central

Green, Judith L.; Wall, Richard J.; Vahokoski, Juha; Yusuf, Noor A.; Ridzuan, Mohd A. Mohd; Stanway, Rebecca R.; Stock, Jessica; Knuepfer, Ellen; Brady, Declan; Martin, Stephen R.; Howell, Steven A.; Pires, Isa P.; Moon, Robert W.; Molloy, Justin E.; Kursula, Inari; Tewari, Rita

2017-01-01

Myosin A (MyoA) is a Class XIV myosin implicated in gliding motility and host cell and tissue invasion by malaria parasites. MyoA is part of a membrane-associated protein complex called the glideosome, which is essential for parasite motility and includes the MyoA light chain myosin tail domain–interacting protein (MTIP) and several glideosome-associated proteins (GAPs). However, most studies of MyoA have focused on single stages of the parasite life cycle. We examined MyoA expression throughout the Plasmodium berghei life cycle in both mammalian and insect hosts. In extracellular ookinetes, sporozoites, and merozoites, MyoA was located at the parasite periphery. In the sexual stages, zygote formation and initial ookinete differentiation precede MyoA synthesis and deposition, which occurred only in the developing protuberance. In developing intracellular asexual blood stages, MyoA was synthesized in mature schizonts and was located at the periphery of segmenting merozoites, where it remained throughout maturation, merozoite egress, and host cell invasion. Besides the known GAPs in the malaria parasite, the complex included GAP40, an additional myosin light chain designated essential light chain (ELC), and several other candidate components. This ELC bound the MyoA neck region adjacent to the MTIP-binding site, and both myosin light chains co-located to the glideosome. Co-expression of MyoA with its two light chains revealed that the presence of both light chains enhances MyoA-dependent actin motility. In conclusion, we have established a system to study the interplay and function of the three glideosome components, enabling the assessment of inhibitors that target this motor complex to block host cell invasion. PMID:28893907

Assessment of the neutrophilic antibody-dependent respiratory burst (ADRB) response to Plasmodium falciparum

PubMed Central

Kapelski, Stephanie; Klockenbring, Torsten; Fischer, Rainer; Barth, Stefan; Fendel, Rolf

2014-01-01

Semi-immunity against Pf malaria is based on a combination of cellular and humoral immune responses. PMNs and IgGs are considered important components of this process, but the underlying mechanisms are unclear. We investigated the neutrophilic ADRB by analyzing the production of ROS in response to Pf antigen-specific IgGs bound to solid-phase immobilized antigens (sADRB) or whole merozoites (mADRB). We found that the PMN stimulations in each assay were based on different underlying mechanisms, demonstrating the importance of the assay set-up for the evaluation of antibody-triggered PMN responses. In the sADRB assay, ROS were produced externally, and by specific blocking of CD32(a)/FcγRII(a), the immediate neutrophilic response was abolished, whereas the removal of CD16(b)/FcγRIII(b) had no substantial effect. The key role of CD32(a) was confirmed using CD16(b)-deficient PMNs, in which similar changes of neutrophilic ADRB profiles were recorded after treatment. In the mADRB assay, ROS were produced almost exclusively within the cell, suggesting that the underlying mechanism was phagocytosis. This was confirmed using an additional phagocytosis assay, in which PMNs specifically ingested merozoites opsonized with Ghanaian plasma IgGs, seven times more often than merozoites opsonized with European plasma IgGs (P<0.001). Our data show that assay set-ups used to evaluate the responses of PMNs and perhaps other effector cells must be chosen carefully to evaluate the appropriate cellular responses. Our robust, stable, and well-characterized methods could therefore be useful in malaria vaccine studies to analyze the antimalarial effector function of antibodies. PMID:25118179

Plasmodium subtilisin-like protease 1 (SUB1): insights into the active-site structure, specificity and function of a pan-malaria drug target.

PubMed

Withers-Martinez, Chrislaine; Suarez, Catherine; Fulle, Simone; Kher, Samir; Penzo, Maria; Ebejer, Jean-Paul; Koussis, Kostas; Hackett, Fiona; Jirgensons, Aigars; Finn, Paul; Blackman, Michael J

2012-05-15

Release of the malaria merozoite from its host erythrocyte (egress) and invasion of a fresh cell are crucial steps in the life cycle of the malaria pathogen. Subtilisin-like protease 1 (SUB1) is a parasite serine protease implicated in both processes. In the most dangerous human malarial species, Plasmodium falciparum, SUB1 has previously been shown to have several parasite-derived substrates, proteolytic cleavage of which is important both for egress and maturation of the merozoite surface to enable invasion. Here we have used molecular modelling, existing knowledge of SUB1 substrates, and recombinant expression and characterisation of additional Plasmodium SUB1 orthologues, to examine the active site architecture and substrate specificity of P. falciparum SUB1 and its orthologues from the two other major human malaria pathogens Plasmodium vivax and Plasmodium knowlesi, as well as from the rodent malaria species, Plasmodium berghei. Our results reveal a number of unusual features of the SUB1 substrate binding cleft, including a requirement to interact with both prime and non-prime side residues of the substrate recognition motif. Cleavage of conserved parasite substrates is mediated by SUB1 in all parasite species examined, and the importance of this is supported by evidence for species-specific co-evolution of protease and substrates. Two peptidyl alpha-ketoamides based on an authentic PfSUB1 substrate inhibit all SUB1 orthologues examined, with inhibitory potency enhanced by the presence of a carboxyl moiety designed to introduce prime side interactions with the protease. Our findings demonstrate that it should be possible to develop 'pan-reactive' drug-like compounds that inhibit SUB1 in all three major human malaria pathogens, enabling production of broad-spectrum antimalarial drugs targeting SUB1. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

The Clinically Tested Gardos Channel Inhibitor Senicapoc Exhibits Antimalarial Activity.

PubMed

Tubman, Venée N; Mejia, Pedro; Shmukler, Boris E; Bei, Amy K; Alper, Seth L; Mitchell, James R; Brugnara, Carlo; Duraisingh, Manoj T

2016-01-01

Senicapoc, a Gardos channel inhibitor, prevented erythrocyte dehydration in clinical trials of patients with sickle cell disease. We tested the hypothesis that senicapoc-induced blockade of the Gardos channel inhibits Plasmodium growth. Senicapoc inhibited in vitro growth of human and primate plasmodia during the clinical blood stage. Senicapoc treatment suppressed P. yoelii parasitemia in vivo in C57BL/6 mice. The reassuring safety and biochemical profile of senicapoc encourage its use in antimalarial development. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Protocol for production of a genetic cross of the rodent malaria parasites.

PubMed

Pattaradilokrat, Sittiporn; Li, Jian; Su, Xin-zhuan

2011-01-03

Variation in response to antimalarial drugs and in pathogenicity of malaria parasites is of biologic and medical importance. Linkage mapping has led to successful identification of genes or loci underlying various traits in malaria parasites of rodents and humans. The malaria parasite Plasmodium yoelii is one of many malaria species isolated from wild African rodents and has been adapted to grow in laboratories. This species reproduces many of the biologic characteristics of the human malaria parasites; genetic markers such as microsatellite and amplified fragment length polymorphism (AFLP) markers have also been developed for the parasite. Thus, genetic studies in rodent malaria parasites can be performed to complement research on Plasmodium falciparum. Here, we demonstrate the techniques for producing a genetic cross in P. yoelii that were first pioneered by Drs. David Walliker, Richard Carter, and colleagues at the University of Edinburgh. Genetic crosses in P. yoelii and other rodent malaria parasites are conducted by infecting mice Mus musculus with an inoculum containing gametocytes of two genetically distinct clones that differ in phenotypes of interest and by allowing mosquitoes to feed on the infected mice 4 days after infection. The presence of male and female gametocytes in the mouse blood is microscopically confirmed before feeding. Within 48 hrs after feeding, in the midgut of the mosquito, the haploid gametocytes differentiate into male and female gametes, fertilize, and form a diploid zygote (Fig. 1). During development of a zygote into an ookinete, meiosis appears to occur. If the zygote is derived through cross-fertilization between gametes of the two genetically distinct parasites, genetic exchanges (chromosomal reassortment and cross-overs between the non-sister chromatids of a pair of homologous chromosomes; Fig. 2) may occur, resulting in recombination of genetic material at homologous loci. Each zygote undergoes two successive nuclear

Co-expression of Interleukin-15 Enhances the Protective Immune Responses Induced by Immunization with a Murine Malaria MVA-Based Vaccine Encoding the Circumsporozoite Protein.

PubMed

Parra, Marcela; Liu, Xia; Derrick, Steven C; Yang, Amy; Molina-Cruz, Alvaro; Barillas-Mury, Carolina; Zheng, Hong; Thao Pham, Phuong; Sedegah, Martha; Belmonte, Arnel; Litilit, Dianne D; Waldmann, Thomas A; Kumar, Sanjai; Morris, Sheldon L; Perera, Liyanage P

2015-01-01

Malaria remains a major global public health problem with an estimated 200 million cases detected in 2012. Although the most advanced candidate malaria vaccine (RTS,S) has shown promise in clinical trials, its modest efficacy and durability have created uncertainty about the impact of RTS,S immunization (when used alone) on global malaria transmission. Here we describe the development and characterization of a novel modified vaccinia virus Ankara (MVA)-based malaria vaccine which co-expresses the Plasmodium yoelii circumsporozoite protein (CSP) and IL-15. Vaccination/challenge studies showed that C57BL/6 mice immunized with the MVA-CSP/IL15 vaccine were protected significantly better against a P. yoelii 17XNL sporozoite challenge than either mice immunized with an MVA vaccine expressing only CSP or naïve controls. Importantly, the levels of total anti-CSP IgG were elevated about 100-fold for the MVA-CSP/IL15 immunized group compared to mice immunized with the MVA-CSP construct that does not express IL-15. Among the IgG subtypes, the IL-15 expressing MVA-CSP vaccine induced levels of IgG1 (8 fold) and IgG2b (80 fold) higher than the MVA-CSP construct. The significantly enhanced humoral responses and protection detected after immunization with the MVA-CSP/IL15 vaccine suggest that this IL-15 expressing MVA construct could be considered in the development of future malaria immunization strategies.

Transfected Babesia bovis Expressing a Tick GST as a Live Vector Vaccine

PubMed Central

Oldiges, Daiane P.; Laughery, Jacob M.; Tagliari, Nelson Junior; Leite Filho, Ronaldo Viana; Davis, William C.; da Silva Vaz, Itabajara; Termignoni, Carlos; Knowles, Donald P.; Suarez, Carlos E.

2016-01-01

The Rhipicephalus microplus tick is a notorious blood-feeding ectoparasite of livestock, especially cattle, responsible for massive losses in animal production. It is the main vector for transmission of pathogenic bacteria and parasites, including Babesia bovis, an intraerythrocytic apicomplexan protozoan parasite responsible for bovine Babesiosis. This study describes the development and testing of a live B. bovis vaccine expressing the protective tick antigen glutathione-S-transferase from Haemaphysalis longicornis (HlGST). The B. bovis S74-T3B parasites were electroporated with a plasmid containing the bidirectional Ef-1α (elongation factor 1 alpha) promoter of B. bovis controlling expression of two independent genes, the selectable marker GFP-BSD (green fluorescent protein–blasticidin deaminase), and HlGST fused to the MSA-1 (merozoite surface antigen 1) signal peptide from B. bovis. Electroporation followed by blasticidin selection resulted in the emergence of a mixed B. bovis transfected line (termed HlGST) in in vitro cultures, containing parasites with distinct patterns of insertion of both exogenous genes, either in or outside the Ef-1α locus. A B. bovis clonal line termed HlGST-Cln expressing intracellular GFP and HlGST in the surface of merozoites was then derived from the mixed parasite line HlGST using a fluorescent activated cell sorter. Two independent calf immunization trials were performed via intravenous inoculation of the HlGST-Cln and a previously described control consisting of an irrelevant transfected clonal line of B. bovis designated GFP-Cln. The control GFP-Cln line contains a copy of the GFP-BSD gene inserted into the Ef-1α locus of B. bovis in an identical fashion as the HIGST-Cln parasites. All animals inoculated with the HlGST-Cln and GFP-Cln transfected parasites developed mild babesiosis. Tick egg fertility and fully engorged female tick weight was reduced significantly in R. microplus feeding on HlGST-Cln-immunized calves

Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum.

PubMed

Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred

2017-06-29

The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known

Genetic Diversity of Plasmodium falciparum Populations in Malaria Declining Areas of Sabah, East Malaysia

PubMed Central

Mohd Abd Razak, Mohd Ridzuan; Sastu, Umi Rubiah; Norahmad, Nor Azrina; Abdul-Karim, Abass; Muhammad, Amirrudin; Muniandy, Prem Kumar; Jelip, Jenarun; Rundi, Christina; Imwong, Mallika; Mudin, Rose Nani; Abdullah, Noor Rain

2016-01-01

Malaysia has a national goal to eliminate malaria by 2020. Understanding the genetic diversity of malaria parasites in residual transmission foci can provide invaluable information which may inform the intervention strategies used to reach elimination targets. This study was conducted to determine the genetic diversity level of P. falciparum isolates in malaria residual foci areas of Sabah. Malaria active case detection was conducted in Kalabakan and Kota Marudu. All individuals in the study sites were screened for malaria infection by rapid diagnostic test. Blood from P. falciparum-infected individuals were collected on filter paper prior to DNA extraction. Genotyping was performed using merozoite surface protein-1 (MSP-1), merozoite surface protein-2 (MSP-2), glutamate rich protein (GLURP) and 10 neutral microsatellite loci markers. The size of alleles, multiplicity of infection (MOI), mean number of alleles (Na), expected heterozygosity (He), linkage disequilibrium (LD) and genetic differentiation (FST) were determined. In Kalabakan, the MSP-1 and MSP-2 alleles were predominantly K1 and FC27 family types, respectively. The GLURP genotype VI (751–800 bp) was predominant. The MOI for MSP-1 and MSP-2 were 1.65 and 1.20, respectively. The Na per microsatellite locus was 1.70. The He values for MSP-1, MSP-2, GLURP and neutral microsatellites were 0.17, 0.37, 0.70 and 0.33, respectively. In Kota Marudu, the MSP-1 and MSP-2 alleles were predominantly MAD20 and 3D7 family types, respectively. The GLURP genotype IV (651–700 bp) was predominant. The MOI for both MSP-1 and MSP-2 was 1.05. The Na per microsatellite locus was 3.60. The He values for MSP-1, MSP-2, GLURP and neutral microsatellites were 0.24, 0.25, 0.69 and 0.30, respectively. A significant LD was observed in Kalabakan (0.495, p<0.01) and Kota Marudu P. falciparum populations (0.601, p<0.01). High genetic differentiation between Kalabakan and Kota Marudu P. falciparum populations was observed (FST = 0

Plasmodium falciparum msp1 and msp2 genetic diversity and allele frequencies in parasites isolated from symptomatic malaria patients in Bobo-Dioulasso, Burkina Faso.

PubMed

Somé, Anyirékun Fabrice; Bazié, Thomas; Zongo, Issaka; Yerbanga, R Serge; Nikiéma, Frédéric; Neya, Cathérine; Taho, Liz Karen; Ouédraogo, Jean-Bosco

2018-05-30

In Burkina Faso, malaria remains the overall leading cause of morbidity and mortality accounting for 35.12% of consultations, 40.83% of hospitalizations and 37.5% of deaths. Genotyping of malaria parasite populations remains an important tool to determine the types and number of parasite clones in an infection. The present study aimed to evaluate the merozoite surface protein 1 (msp1) and merozoite surface protein 2 (msp2) genetic diversity and allele frequencies in Bobo-Dioulasso, Burkina Faso. Dried blood spots (DBS) were collected at baseline from patients with uncomplicated malaria in urban health centers in Bobo-Dioulasso. Parasite DNA was extracted using chelex-100 and species were identified using nested PCR. Plamodium falciparum msp1 and msp2 genes were amplified by nested polymerase chain reaction (PCR) and PCR products were analyzed by electrophoresis on a 2.5% agarose gel. Alleles were categorized according to their molecular weight. A total of 228 blood samples were analyzed out of which 227 (99.9%) were confirmed as P. falciparum-positive and one sample classified as mixed infection for P. malaria and P. falciparum. In msp1, the K1 allelic family was predominant with 77.4% (162/209) followed respectively by the MAD20 allelic family with 41.3% and R033 allelic family with 36%. In msp2, the 3D7 allelic family was the most frequently detected with 93.1 % compared to FC27 with 41.3%. Twenty-one different alleles were observed in msp1 with 9 alleles for K1, 8 alleles for MAD20 and 4 alleles for R033. In msp2, 25 individual alleles were detected with 10 alleles for FC27 and 15 alleles for 3D7. The mean multiplicity of falciparum infection was 1.95 with respectively 1.8 (1.76-1.83) and 2.1 (2.03-2.16) for msp1 and msp2 (P = 0.01). Our study showed high genetic diversity and allelic frequencies of msp1 and msp2 in Plasmodium falciparum isolates from symptomatic malaria patients in Bobo-Dioulasso.

Parasites and cancers: parasite antigens as possible targets for cancer immunotherapy.

PubMed

Darani, Hossein Yousofi; Yousefi, Morteza

2012-12-01

An adverse relationship between some parasite infections and cancer in the human population has been reported by different research groups. Anticancer activity of some parasites such as Trypanosoma cruzi, Toxoplasma gondii, Toxocara canis, Acantamoeba castellani and Plasmodium yoelii has been shown in experimental animals. Moreover, it has been shown that cancer-associated mucin-type O-glycan compositions are made by parasites, therefore cancers and parasites have common antigens. In this report anticancer activities of some parasites have been reviewed and the possible mechanisms of these actions have also been discussed.

Imaging Plasmodium Immunobiology in Liver, Brain, and Lung

PubMed Central

Frevert, Ute; Nacer, Adéla; Cabrera, Mynthia; Movila, Alexandru; Leberl, Maike

2013-01-01

Plasmodium falciparum malaria is responsible for the deaths of over half a million African children annually. Until a decade ago, dynamic analysis of the malaria parasite was limited to in vitro systems with the typical limitations associated with 2D monocultures or entirely artificial surfaces. Due to extremely low parasite densities, the liver was considered a black box in terms of Plasmodium sporozoite invasion, liver stage development, and merozoite release into the blood. Further, nothing was known about the behavior of blood stage parasites in organs such as brain where clinical signs manifest and the ensuing immune response of the host that may ultimately result in a fatal outcome. The advent of fluorescent parasites, advances in imaging technology, and availability of an ever-increasing number of cellular and molecular probes have helped illuminate many steps along the pathogenetic cascade of this deadly tropical parasite. PMID:24076429

Compositional and expression analyses of the glideosome during the Plasmodium life cycle reveal an additional myosin light chain required for maximum motility.

PubMed

Green, Judith L; Wall, Richard J; Vahokoski, Juha; Yusuf, Noor A; Ridzuan, Mohd A Mohd; Stanway, Rebecca R; Stock, Jessica; Knuepfer, Ellen; Brady, Declan; Martin, Stephen R; Howell, Steven A; Pires, Isa P; Moon, Robert W; Molloy, Justin E; Kursula, Inari; Tewari, Rita; Holder, Anthony A

2017-10-27

Myosin A (MyoA) is a Class XIV myosin implicated in gliding motility and host cell and tissue invasion by malaria parasites. MyoA is part of a membrane-associated protein complex called the glideosome, which is essential for parasite motility and includes the MyoA light chain myosin tail domain-interacting protein (MTIP) and several glideosome-associated proteins (GAPs). However, most studies of MyoA have focused on single stages of the parasite life cycle. We examined MyoA expression throughout the Plasmodium berghei life cycle in both mammalian and insect hosts. In extracellular ookinetes, sporozoites, and merozoites, MyoA was located at the parasite periphery. In the sexual stages, zygote formation and initial ookinete differentiation precede MyoA synthesis and deposition, which occurred only in the developing protuberance. In developing intracellular asexual blood stages, MyoA was synthesized in mature schizonts and was located at the periphery of segmenting merozoites, where it remained throughout maturation, merozoite egress, and host cell invasion. Besides the known GAPs in the malaria parasite, the complex included GAP40, an additional myosin light chain designated essential light chain (ELC), and several other candidate components. This ELC bound the MyoA neck region adjacent to the MTIP-binding site, and both myosin light chains co-located to the glideosome. Co-expression of MyoA with its two light chains revealed that the presence of both light chains enhances MyoA-dependent actin motility. In conclusion, we have established a system to study the interplay and function of the three glideosome components, enabling the assessment of inhibitors that target this motor complex to block host cell invasion. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Efficacy of decoquinate against Sarcocystis neurona in cell cultures.

PubMed

Lindsay, David S; Nazir, M Mudasser; Maqbool, Azhar; Ellison, Siobhan P; Strobl, Jeannine S

2013-09-01

Decoquinate is a quinolone anticoccidial approved for use in the prevention of intestinal coccidiosis in farm animals. This compound has good activity against Toxoplasma gondii and Neospora caninum in cell cultures. The drug acts on the parasites' mitochondria. The activity of decoquinate against developing merozoites of 2 isolates of Sarcocystis neurona was examined in cell culture. Merozoite production at 10 days was completely inhibited when decoquinate was used at 20 or 240 nM. The IC50 of decoquinate was 0.5 ± 0.09nM for the Sn6 isolate of S. neurona from a horse and 1.1 ± 0.6 nM for the SnOP15 isolate of S. neurona from an opossum. Levamisole was toxic at 5 μg/ml and no synergism was observed when decoquinate was combined with levamisole and tested against the Sn3YFP isolate of S. neurona. Decoquinate was cidal for developing schizonts of S. neurona at 240 nM. Copyright © 2013 Elsevier B.V. All rights reserved.

Plasmodium falciparum polypeptides released during in vitro cultivation*

PubMed Central

Da Silva, L. Rodriguez; Loche, M.; Dayal, R.; Perrin, L. H.

1983-01-01

Synchronous cultures of Plasmodium falciparum were successively labelled with (35S)-methionine and both the supernatants and the pellets of infected red blood cells were collected. The release of TCA-precipitable material in the culture supernatants was low during the development of ring forms and trophozoites, increased during schizogony, and was maximum at the time of schizont rupture and merozoite reinvasion. Analysis of the supernatants by SDS — PAGE and autoradiography showed that both polypeptides common to the various developmental stages of the parasite and schizont/merozoite-specific polypeptides were released. Polypeptides of relative molecular mass 140 000, 82 000 and, to a lower degree, 41 000 were present in high amounts in the culture supernatants. These polypeptides have been shown to be the target of monoclonal antibodies that are able to inhibit the growth of P. falciparum cultures, and may be involved in protective immunity. The released polypeptides may also be used as target antigens in immunodiagnostic tests aiming at the detection of malaria infection. ImagesFig. 2AFig. 2BFig. 3 PMID:6340846

Endogenous Life Cycle of Eimeria marmosopos (Apicomplexa: Eimeriidae) from the Opossum, Didelphis marsupialis (Didelphimorphia: Didelphidae) in Costa Rica.

PubMed

Chinchilla, Misael; Valerio, Idalia; Duszynski, Donald

2015-08-01

The endogenous life cycle of Eimeria marmosopos was studied in experimentally infected young opossums, Didelphis marsupialis . All the endogenous stages were located in the epithelial cells of villi in the small intestine. Giemsa-stained mucosal scrapings and histological sections were studied for the diagnosis of all the life cycle stages. Eimeria marmosopos has 3 generations of meronts (M) that differ by size, shape, and number of merozoites (m), which also differ in their size, shape, and location of their nuclei within the cytoplasm of the meronts. The 3 meront types, M(1)-M(3), respectively, had 8-15 (m(1)), 4-9 (m(2)), and 22-30 (m(3)) merozoites. Macrogametocytes and microgametocytes, as well as macrogametes and microgametes, completed the sexual cycle, finishing with the formation of unsporulated oocysts. This parasite's endogenous development produced severe intestinal lesions in experimentally infected opossums. There are 56 Eimeria species known from all marsupials worldwide, but this is the first complete life cycle in which both the asexual and sexual stages have been documented.

Different Regions of the Malaria Merozoite Surface Protein 1 of Plasmodium chabaudi Elicit Distinct T-Cell and Antibody Isotype Responses

PubMed Central

Quin, Stuart J.; Langhorne, Jean

2001-01-01

In this study we have investigated the antibody and CD4 T-cell responses to the well-characterized malaria vaccine candidate MSP-1 during the course of a primary Plasmodium chabaudi chabaudi (AS) infection. Specific antibody responses can be detected within the first week of infection, and CD4 T cells can be detected after 3 weeks of infection. The magnitude of the CD4 T-cell response elicited during a primary infection depended upon the region of MSP-1. In general, the highest precursor frequencies were obtained when a recombinant MSP-1 fragment corresponding to amino acids 900 to 1507 was used as the antigen in vitro. By contrast, proliferative and cytokine responses against amino acids 1508 to 1766 containing the C-terminal 21-kDa region of the molecule were low. The characteristic interleukin 4 (IL-4) switch that occurs in the CD4 T-cell population after an acute blood stage P. c. chabaudi infection was only consistently observed in the response to the amino acid 900 to 1507 MSP1 fragment. A lower frequency of IL-4-producing cells was seen in response to other regions. Although the magnitudes of the immunoglobulin G antibody responses to the different regions of MSP-1 were similar, the isotype composition of each response was distinct, and there was no obvious relationship with the type of T helper cells generated. Interestingly, a relatively high antibody response to the C-terminal region of MSP-1 was observed, suggesting that T-cell epitopes outside of this region may provide the necessary cognate help for specific antibody production. PMID:11254580

Evaluation of indirect TaSP enzyme-linked immunosorbent assay for diagnosis of tropical theileriosis in cattle (Bos indicus) and water buffaloes (Bubalus bubalis) in Egypt.

PubMed

Mohamed, Amr M; Abdel-Rady, Ahmed; Ahmed, Laila S; El-Hosary, Amira

2012-05-25

The aim of the present study was to evaluate the validity of Theileria annulata surface protein (TaSP)-ELISA, in comparison with traditional microscopic test, for the diagnosis of T. annulata infection among Egyptian baladi cattle (Bos taurus) and water buffaloes (Bubalus bubalis). Molecular confirmation of infection using T. annulata merozoite surface (Tams-1) target amplification by PCR was used as a gold standard. A total of 76 clinically suspected animals including 64 baladi cattle and 12 water buffaloes were investigated in the current study by the three methods. Based on the PCR-confirmed results, the evaluation study revealed higher sensitivity of TaSP-ELISA (72.9% and 75%) as compared to microscopic examination (58.3% and 50%) among cattle and buffaloes, respectively. On the other hand, the specificity of TaSP-ELISA in diagnosis of T. annulata infection was higher (87.5%) in baladi cattle as compared to water buffaloes (37.5%). In conclusion, TaSP-ELISA was shown to be suitable for the diagnosis of T. annulata infection in cattle under field conditions. Copyright © 2011 Elsevier B.V. All rights reserved.

Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression

DTIC Science & Technology

2005-04-26

reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al

A prime-boost immunization regimen based on a simian adenovirus 36 vectored multi-stage malaria vaccine induces protective immunity in mice.

PubMed

Fonseca, Jairo A; McCaffery, Jessica N; Kashentseva, Elena; Singh, Balwan; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

2017-05-31

Malaria remains a considerable burden on public health. In 2015, the WHO estimates there were 212 million malaria cases causing nearly 429,000 deaths globally. A highly effective malaria vaccine is needed to reduce the burden of this disease. We have developed an experimental vaccine candidate (PyCMP) based on pre-erythrocytic (CSP) and erythrocytic (MSP1) stage antigens derived from the rodent malaria parasite P. yoelii. Our protein-based vaccine construct induces protective antibodies and CD4 + T cell responses. Based on evidence that viral vectors increase CD8 + T cell-mediated immunity, we also have tested heterologous prime-boost immunization regimens that included human adenovirus serotype 5 vector (Ad5), obtaining protective CD8 + T cell responses. While Ad5 is commonly used for vaccine studies, the high prevalence of pre-existing immunity to Ad5 severely compromises its utility. Here, we report the use of the novel simian adenovirus 36 (SAd36) as a candidate for a vectored malaria vaccine since this virus is not known to infect humans, and it is not neutralized by anti-Ad5 antibodies. Our study shows that the recombinant SAd36PyCMP can enhance specific CD8 + T cell response and elicit similar antibody titers when compared to an immunization regimen including the recombinant Ad5PyCMP. The robust immune responses induced by SAd36PyCMP are translated into a lower parasite load following P. yoelii infectious challenge when compared to mice immunized with Ad5PyCMP. Copyright © 2017 Elsevier Ltd. All rights reserved.

Vaccine efficacy against malaria by the combination of porcine parvovirus-like particles and vaccinia virus vectors expressing CS of Plasmodium.

PubMed

Rodríguez, Dolores; González-Aseguinolaza, Gloria; Rodríguez, Juan R; Vijayan, Aneesh; Gherardi, Magdalena; Rueda, Paloma; Casal, J Ignacio; Esteban, Mariano

2012-01-01

With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs) carrying the CD8(+) T cell epitope (SYVPSAEQI) of the circumsporozoite (CS) protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS), and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8(+) T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV) vectors from the Western Reserve (WR) and modified virus Ankara (MVA) strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria.

Dynamic changes of Plasmodium vivax population structure in South Korea.

PubMed

Kang, Jung-Mi; Lee, Jinyoung; Cho, Pyo-Yun; Kim, Tae Im; Sohn, Woon-Mok; Park, Jae-Won; Kim, Tong-Soo; Na, Byoung-Kuk

2016-11-01

The vivax malaria epidemic has persisted in South Korea since its reemergence in 1993. Although there has been a significant decrease in the number of malaria cases in recent years, vivax malaria is still a major public health concern. To gain in-depth insight into the genetic makeup of Korean Plasmodium vivax, we analyzed polymorphic patterns of two major antigens, merozoite surface protein-1 (MSP-1) and MSP-3α, in 255 Korean P. vivax isolates collected over an extended period from 1998 to 2013. Combinational genetic analysis of polymorphic patterns of MSP-1 and MSP-3α in the isolates suggests that the P. vivax population in South Korea has been diversifying rapidly, with the appearance of parasites with new genotypes, despite the recent reduction of disease incidence. These results highlight the importance of molecular epidemiological investigations to supervise the genetic variation of the parasite in South Korea. Copyright © 2016 Elsevier B.V. All rights reserved.

Plasmodium vivax Isolates from Cambodia and Thailand Show High Genetic Complexity and Distinct Patterns of P. vivax Multidrug Resistance Gene 1 (pvmdr1) Polymorphisms

PubMed Central

Lin, Jessica T.; Patel, Jaymin C.; Kharabora, Oksana; Sattabongkot, Jetsumon; Muth, Sinuon; Ubalee, Ratawan; Schuster, Anthony L.; Rogers, William O.; Wongsrichanalai, Chansuda; Juliano, Jonathan J.

2013-01-01

Plasmodium vivax accounts for an increasing fraction of malaria infections in Thailand and Cambodia. We compared P. vivax genetic complexity and antimalarial resistance patterns in the two countries. Use of a heteroduplex tracking assay targeting the merozoite surface protein 1 gene revealed that vivax infections in both countries are frequently polyclonal (84%), with parasites that are highly diverse (HE = 0.86) but closely related (GST = 0.18). Following a history of different drug policies in Thailand and Cambodia, distinct patterns of antimalarial resistance have emerged: most Cambodian isolates harbor the P. vivax multidrug resistance gene 1 (pvmdr1) 976F mutation associated with chloroquine resistance (89% versus 8%, P < 0.001), whereas Thai isolates more often display increased pvmdr1 copy number (39% versus 4%, P < 0.001). Finally, genotyping of paired isolates from individuals suspected of suffering relapse supports a complex scheme of relapse whereby recurrence of multiple identical variants is sometimes accompanied by the appearance of novel variants. PMID:23509126

In vivo imaging of malaria parasites in the murine liver.

PubMed

Thiberge, Sabine; Blazquez, Samantha; Baldacci, Patricia; Renaud, Olivier; Shorte, Spencer; Ménard, Robert; Amino, Rogerio

2007-01-01

The form of the malaria parasite inoculated by the mosquito, called the sporozoite, transforms inside the host liver into thousands of a new form of the parasite, called the merozoite, which infects erythrocytes. We present here a protocol to visualize in vivo the behavior of Plasmodium berghei parasites in the hepatic tissue of the murine host. The use of GFP-expressing parasites and a high-speed spinning disk confocal microscope allows for the acquisition of four-dimensional images, which provide a time lapse view of parasite displacement and development in tissue volumes. These data can be analyzed to give information on the early events of sporozoite penetration of the hepatic tissue, that is, sporozoite gliding in the liver sinusoids, crossing the sinusoidal barrier, gliding in the parenchyma and traversal of hepatocytes, and invasion of a final hepatocyte, as well as the terminal events of merosome and merozoite release from infected hepatocytes. Combined with the use of mice expressing fluorescent cell types or cell markers, the system will provide useful information not only on the primary infection process, but also on parasite interactions with the host immune cells in the liver.

Total immunoglobulin G and IgG1 subclass levels specific for the MSP-1(19) of Plasmodium falciparum are different in individuals with either processing-inhibitory, blocking or neutral antibodies.

PubMed

Omosun, Y O; Adoro, S; Anumudu, C I; Odaibo, A; Holder, A A; Nwagwu, M; Nwuba, R I

2010-06-01

Some MSP-1(19) specific antibodies that inhibit merozoite invasion also inhibit the secondary processing of MSP-1. However the binding of these inhibitory antibodies can be blocked by another group of antibodies, called blocking antibodies, which recognize adjacent or overlapping epitopes, but themselves have no effect on either MSP-1 processing or merozoite invasion. These antibodies have been reported to be present in individuals living in a malaria endemic area. Blood samples were obtained from children shown to have processing inhibitory, blocking, and neutral antibodies in a previous study. Enzyme linked immunosorbent assay (ELISA), was used to determine the total IgG, IgM and IgG subtypes. There was a significant difference in anti-MSP-1(19) IgG, while there was no significant difference in the anti-MSP-1(19) IgM. Only anti MSP-1(19) IgG1, amongst the IgG subtypes was significantly different between the groups. This study shows that antibodies against MSP-1 are different not only in specificity and function but also in the amount of total IgG and IgG subtype produced.

Plasmodium berghei Δp52&p36 parasites develop independent of a parasitophorous vacuole membrane in Huh-7 liver cells.

PubMed

Ploemen, Ivo H J; Croes, Huib J; van Gemert, Geert-Jan J; Wijers-Rouw, Mietske; Hermsen, Cornelus C; Sauerwein, Robert W

2012-01-01

The proteins P52 and P36 are expressed in the sporozoite stage of the murine malaria parasite Plasmodium berghei. Δp52&p36 sporozoites lacking expression of both proteins are severely compromised in their capability to develop into liver stage parasites and abort development soon after invasion; presumably due to the absence of a parasitophorous vacuole membrane (PVM). However, a small proportion of P. berghei Δp52&p36 parasites is capable to fully mature in hepatocytes causing breakthrough blood stage infections. We have studied the maturation of replicating Δp52&p36 parasites in cultured Huh-7 hepatocytes. Approximately 50% of Δp52&p36 parasites developed inside the nucleus of the hepatocyte but did not complete maturation and failed to produce merosomes. In contrast cytosolic Δp52&p36 parasites were able to fully mature and produced infectious merozoites. These Δp52&p36 parasites developed into mature schizonts in the absence of an apparent parasitophorous vacuole membrane as shown by immunofluorescence and electron microscopy. Merozoites derived from these maturing Δp52&p36 liver stages were infectious for C57BL/6 mice.

The Binding of Plasmodium falciparum Adhesins and Erythrocyte Invasion Proteins to Aldolase Is Enhanced by Phosphorylation.

PubMed

Diaz, Suraya A; Martin, Stephen R; Howell, Steven A; Grainger, Munira; Moon, Robert W; Green, Judith L; Holder, Anthony A

2016-01-01

Aldolase has been implicated as a protein coupling the actomyosin motor and cell surface adhesins involved in motility and host cell invasion in the human malaria parasite Plasmodium falciparum. It binds to the cytoplasmic domain (CTD) of type 1 membrane proteins of the thrombospondin-related anonymous protein (TRAP) family. Other type 1 membrane proteins located in the apical organelles of merozoites, the form of the parasite that invades red blood cells, including apical membrane antigen 1 (AMA1) and members of the erythrocyte binding ligand (EBL) and reticulocyte binding homologue (RH) protein families have been implicated in host cell binding and invasion. Using a direct binding method we confirm that TRAP and merozoite TRAP (MTRAP) bind aldolase and show that the interaction is mediated by more than just the C-terminal six amino acid residues identified previously. Single amino acid substitutions in the MTRAP CTD abolished binding to aldolase. The CTDs of AMA1 and members of the EBL and RH protein families also bound to aldolase. MTRAP competed with AMA1 and RH4 for binding to aldolase, indicating overlapping binding sites. MTRAP CTD was phosphorylated in vitro by both calcium dependent kinase 1 (CDPK1) and protein kinase A, and this modification increased the affinity of binding to aldolase by ten-fold. Phosphorylation of the CTD of members of the EBL and RH protein families also increased their affinity for aldolase in some cases. To examine whether or not MTRAP expressed in asexual blood stage parasites is phosphorylated, it was tagged with GFP, purified and analysed, however no phosphorylation was detected. We propose that CTD binding to aldolase may be dynamically modulated by phosphorylation, and there may be competition for aldolase binding between different CTDs. The use and efficiency of alternate invasion pathways may be determined by the affinity of adhesins and cell invasion proteins for aldolase, in addition to their host ligand specificity.

Plasmodium falciparum: a simplified technique for obtaining singly infected erythrocytes.

PubMed

Puthia, Manoj K; Tan, Kevin S W

2005-02-01

We report the development of a simple technique involving 15 ml polypropylene tubes and a rotatory incubator for obtaining erythrocytes singly infected with Plasmodium falciparum. This technique will be useful for cloning of the parasite. Our finding that P. falciparum merozoite invasion is inhibited during rotation suggests that this method may also be useful for the study of parasite-erythrocyte interactions under dynamic circulatory conditions.

Multiple-clone infections of Plasmodium vivax: definition of a panel of markers for molecular epidemiology.

PubMed

de Souza, Aracele M; de Araújo, Flávia C F; Fontes, Cor J F; Carvalho, Luzia H; de Brito, Cristiana F A; de Sousa, Taís N

2015-08-25

Plasmodium vivax infections commonly contain multiple genetically distinct parasite clones. The detection of multiple-clone infections depends on several factors, such as the accuracy of the genotyping method, and the type and number of the molecular markers analysed. Characterizing the multiplicity of infection has broad implications that range from population genetic studies of the parasite to malaria treatment and control. This study compared and evaluated the efficiency of neutral and non-neutral markers that are widely used in studies of molecular epidemiology to detect the multiplicity of P. vivax infection. The performance of six markers was evaluated using 11 mixtures of DNA with well-defined proportions of two different parasite genotypes for each marker. These mixtures were generated by mixing cloned PCR products or patient-derived genomic DNA. In addition, 51 samples of natural infections from the Brazil were genotyped for all markers. The PCR-capillary electrophoresis-based method was used to permit direct comparisons among the markers. The criteria for differentiating minor peaks from artifacts were also evaluated. The analysis of DNA mixtures showed that the tandem repeat MN21 and the polymorphic blocks 2 (msp1B2) and 10 (msp1B10) of merozoite surface protein-1 allowed for the estimation of the expected ratio of both alleles in the majority of preparations. Nevertheless, msp1B2 was not able to detect the majority of multiple-clone infections in field samples; it identified only 6 % of these infections. The merozoite surface protein-3 alpha and microsatellites (PvMS6 and PvMS7) did not accurately estimate the relative clonal proportions in artificial mixtures, but the microsatellites performed well in detecting natural multiple-clone infections. Notably, the use of a less stringent criterion to score rare alleles significantly increased the sensitivity of the detection of multi-clonal infections. Depending on the type of marker used, a considerable

Surface supported gold-organic hybrids: on-surface synthesis and surface directed orientation.

PubMed

Zhang, Haiming; Franke, Jörn-Holger; Zhong, Dingyong; Li, Yan; Timmer, Alexander; Arado, Oscar Díaz; Mönig, Harry; Wang, Hong; Chi, Lifeng; Wang, Zhaohui; Müllen, Klaus; Fuchs, Harald

2014-04-09

The surface-assisted synthesis of gold-organic hybrids on Au (111) and Au (100) surfaces is repotred by thermally initiated dehalogenation of chloro-substituted perylene-3,4,9,10-tetracarboxylic acid bisimides (PBIs). Structures and surface-directed alignment of the Au-PBI chains are investigated by scanning tunnelling microscopy in ultra high vacuum conditions. Using dichloro-PBI as a model system, the mechanism for the formation of Au-PBI dimer is revealed with scanning tunnelling microscopy studies and density functional theory calculations. A PBI radical generated from the homolytic C-Cl bond dissociation can covalently bind a surface gold atom and partially pull it out of the surface to form stable PBI-Au hybrid species, which also gives rise to the surface-directed alignment of the Au-PBI chains on reconstructed Au (100) surfaces. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Surface Topography Hinders Bacterial Surface Motility.

PubMed

Chang, Yow-Ren; Weeks, Eric R; Ducker, William A

2018-03-21

We demonstrate that the surface motility of the bacterium, Pseudomonas aeruginosa, is hindered by a crystalline hemispherical topography with wavelength in the range of 2-8 μm. The motility was determined by the analysis of time-lapse microscopy images of cells in a flowing growth medium maintained at 37 °C. The net displacement of bacteria over 5 min is much lower on surfaces containing 2-8 μm hemispheres than on flat topography, but displacement on the 1 μm hemispheres is not lower. That is, there is a threshold between 1 and 2 μm for response to the topography. Cells on the 4 μm hemispheres were more likely to travel parallel to the local crystal axis than in other directions. Cells on the 8 μm topography were less likely to travel across the crowns of the hemispheres and were also more likely to make 30°-50° turns than on flat surfaces. These results show that surface topography can act as a significant barrier to surface motility and may therefore hinder surface exploration by bacteria. Because surface exploration can be a part of the process whereby bacteria form colonies and seek nutrients, these results help to elucidate the mechanism by which surface topography hinders biofilm formation.

New molecular settings to support in vivo anti-malarial assays.

PubMed

Bahamontes-Rosa, Noemí; Alejandre, Ane Rodriguez; Gomez, Vanesa; Viera, Sara; Gomez-Lorenzo, María G; Sanz-Alonso, Laura María; Mendoza-Losana, Alfonso

2016-03-08

Quantitative real-time PCR (qPCR) is now commonly used as a method to confirm diagnosis of malaria and to differentiate recrudescence from re-infection, especially in clinical trials and in reference laboratories where precise quantification is critical. Although anti-malarial drug discovery is based on in vivo murine efficacy models, use of molecular analysis has been limited. The aim of this study was to develop qPCR as a valid methodology to support pre-clinical anti-malarial models by using filter papers to maintain material for qPCR and to compare this with traditional methods. FTA technology (Whatman) is a rapid and safe method for extracting nucleic acids from blood. Peripheral blood samples from mice infected with Plasmodium berghei, P. yoelii, or P. falciparum were kept as frozen samples or as spots on FTA cards. The extracted genetic material from both types of samples was assessed for quantification by qPCR using sets of specific primers specifically designed for Plasmodium 18S rRNA, LDH, and CytB genes. The optimal conditions for nucleic acid extraction from FTA cards and qPCR amplification were set up, and were confirmed to be suitable for parasite quantification using DNA as template after storage at room temperature for as long as 26 months in the case of P. berghei samples and 52 months for P. falciparum and P. yoelii. The quality of DNA extracted from the FTA cards for gene sequencing and microsatellite amplification was also assessed. This is the first study to report the suitability of FTA cards and qPCR assay to quantify parasite load in samples from in vivo efficacy models to support the drug discovery process.

Vaccine Efficacy against Malaria by the Combination of Porcine Parvovirus-Like Particles and Vaccinia Virus Vectors Expressing CS of Plasmodium

PubMed Central

Rodríguez, Dolores; González-Aseguinolaza, Gloria; Rodríguez, Juan R.; Vijayan, Aneesh; Gherardi, Magdalena; Rueda, Paloma; Casal, J. Ignacio; Esteban, Mariano

2012-01-01

With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs) carrying the CD8+ T cell epitope (SYVPSAEQI) of the circumsporozoite (CS) protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS), and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8+ T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV) vectors from the Western Reserve (WR) and modified virus Ankara (MVA) strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria. PMID:22529915

Surface Segregation in Multicomponent Systems: Modeling of Surface Alloys and Alloy Surfaces

NASA Technical Reports Server (NTRS)

Bozzolo, Guillermo; Ferrante, John; Noebe, Ronald D.; Good, Brian; Honecy, Frank S.; Abel, Phillip

1999-01-01

The study of surface segregation, although of great technological importance, has been largely restricted to experimental work due to limitations associated with theoretical methods. However, recent improvements in both first-particle and semi-empirical methods are opening, the doors to an array of new possibilities for surface scientists. We apply one of these techniques, the Bozzolo, Ferrante and Smith (BFS) method for alloys, which is particularly suitable for complex systems, to several aspects of the computational modeling of surfaces and segregation, including alloy surface segregation, structure and composition of alloy surfaces, and the formation of surface alloys. We conclude with the study of complex NiAl-based binary, ternary and quaternary thin films (with Ti, Cr and Cu additions to NiAl). Differences and similarities between bulk and surface compositions are discussed, illustrated by the results of Monte Carlo simulations. For some binary and ternary cases, the theoretical predictions are compared to experimental results, highlighting the accuracy and value of this developing theoretical tool.

Durable low surface-energy surfaces

NASA Technical Reports Server (NTRS)

Willis, Paul B. (Inventor); McElroy, Paul M. (Inventor); Hickey, Gregory H. (Inventor)

1993-01-01

A formulation for forming a low surface-energy surface on a substrate having (i) a fluoroalkyl silane having a low surface energy part, (ii) a liquid crystal silane operable for enhancing the orientation of the molecules of the fluoroalkyl silane and for crosslinking with the fluoroalkyl silane, and, (iii) a transport medium for applying the fluoroalkyl silane and the liquid crystal silane to the surface of a substrate. In one embodiment the formulation can includes a crosslinking agent for crosslinking the fluoroalkyl silane. In another embodiment the formulation has a condensation catalyst for enhancing chemical bonding of the fluoroalkyl silane to the substrate. The transport medium can be an alcohol such as methanol or ethanol.

Simple and rapid staining for detection of Entamoeba cysts and other protozoans with fluorochromes.

PubMed

Kawamoto, F; Mizuno, S; Fujioka, H; Kumada, N; Sugiyama, E; Takeuchi, T; Kobayashi, S; Iseki, M; Yamada, M; Matsumoto, Y

1987-02-01

Three fluorochromes were applied to stain various parasitic protozoans. By double staining with 4',6-diamidino-2-phenylindole and propidium iodide, differentiation of the nuclei from the cytoplasm can easily be achieved within several seconds. The chromatoid bodies in Entamoeba cysts were stained bright red. Plasmodium yoelii at all stages except late trophozoites and young gametocytes was easily identified. In the oocysts of Cryptosporidium sp., the nuclei and cytoplasm of the sporozoites fluoresced bluish white and red, respectively, whereas the residual body appeared blue or green. The third fluorochrome, Calcofluor white M2R, was suitable for detecting the cysts of Entamoeba spp. and Chilomastix mesnili.

PREFACE: Vibrations at surfaces Vibrations at surfaces

NASA Astrophysics Data System (ADS)

Rahman, Talat S.

2011-12-01

This special issue is dedicated to the phenomenon of vibrations at surfaces—a topic that was indispensible a couple of decades ago, since it was one of the few phenomena capable of revealing the nature of binding at solid surfaces. For clean surfaces, the frequencies of modes with characteristic displacement patterns revealed how surface geometry, as well as the nature of binding between atoms in the surface layers, could be different from that in the bulk solid. Dispersion of the surface phonons provided further measures of interatomic interactions. For chemisorbed molecules on surfaces, frequencies and dispersion of the vibrational modes were also critical for determining adsorption sites. In other words, vibrations at surfaces served as a reliable means of extracting information about surface structure, chemisorption and overlayer formation. Experimental techniques, such as electron energy loss spectroscopy and helium-atom-surface scattering, coupled with infra-red spectroscopy, were continually refined and their resolutions enhanced to capture subtleties in the dynamics of atoms and molecules at surfaces. Theoretical methods, whether based on empirical and semi-empirical interatomic potential or on ab initio electronic structure calculations, helped decipher experimental observations and provide deeper insights into the nature of the bond between atoms and molecules in regions of reduced symmetry, as encountered on solid surfaces. Vibrations at surfaces were thus an integral part of the set of phenomena that characterized surface science. Dedicated workshops and conferences were held to explore the variety of interesting and puzzling features revealed in experimental and theoretical investigations of surface vibrational modes and their dispersion. One such conference, Vibrations at Surfaces, first organized by Harald Ibach in Juelich in 1980, continues to this day. The 13th International Conference on Vibrations at Surfaces was held at the University of

Diagnosis, Treatment, and Prevention of Malaria

DTIC Science & Technology

1992-11-01

sometimes have diarrhea. The source of infection may be similar to those of nosocomial infections in other severely ill patients; however, passage of...developing within the liver, or the merozoites released from the liver. Clinical manifestations only occur after rupture of infected erythrocytes, and...they generally occur 10 to 14 days after an individual is bitten by the infected mosquito. In P. vivax and P. ovale infections some of the sporozoites

Surface thermodynamics, surface stress, equations at surfaces and triple lines for deformable bodies.

PubMed

Olives, Juan

2010-03-03

The thermodynamics and mechanics of the surface of a deformable body are studied here, following and refining the general approach of Gibbs. It is first shown that the 'local' thermodynamic variables of the state of the surface are only the temperature, the chemical potentials and the surface strain tensor (true thermodynamic variables, for a viscoelastic solid or a viscous fluid). A new definition of the surface stress is given and the corresponding surface thermodynamics equations are presented. The mechanical equilibrium equation at the surface is then obtained. It involves the surface stress and is similar to the Cauchy equation for the volume. Its normal component is a generalization of the Laplace equation. At a (body-fluid-fluid) triple contact line, two equations are obtained, which represent: (i) the equilibrium of the forces (surface stresses) for a triple line fixed on the body; (ii) the equilibrium relative to the motion of the line with respect to the body. This last equation leads to a strong modification of Young's classical capillary equation.

Surface-Activated Coupling Reactions Confined on a Surface.

PubMed

Dong, Lei; Liu, Pei Nian; Lin, Nian

2015-10-20

Chemical reactions may take place in a pure phase of gas or liquid or at the interface of two phases (gas-solid or liquid-solid). Recently, the emerging field of "surface-confined coupling reactions" has attracted intensive attention. In this process, reactants, intermediates, and products of a coupling reaction are adsorbed on a solid-vacuum or a solid-liquid interface. The solid surface restricts all reaction steps on the interface, in other words, the reaction takes place within a lower-dimensional, for example, two-dimensional, space. Surface atoms that are fixed in the surface and adatoms that move on the surface often activate the surface-confined coupling reactions. The synergy of surface morphology and activity allow some reactions that are inefficient or prohibited in the gas or liquid phase to proceed efficiently when the reactions are confined on a surface. Over the past decade, dozens of well-known "textbook" coupling reactions have been shown to proceed as surface-confined coupling reactions. In most cases, the surface-confined coupling reactions were discovered by trial and error, and the reaction pathways are largely unknown. It is thus highly desirable to unravel the mechanisms, mechanisms of surface activation in particular, of the surface-confined coupling reactions. Because the reactions take place on surfaces, advanced surface science techniques can be applied to study the surface-confined coupling reactions. Among them, scanning tunneling microscopy (STM) and X-ray photoelectron spectroscopy (XPS) are the two most extensively used experimental tools. The former resolves submolecular structures of individual reactants, intermediates, and products in real space, while the latter monitors the chemical states during the reactions in real time. Combination of the two methods provides unprecedented spatial and temporal information on the reaction pathways. The experimental findings are complemented by theoretical modeling. In particular, density

Surface Preparation Methods to Enhance Dynamic Surface Property Measurements of Shocked Metal Surfaces

NASA Astrophysics Data System (ADS)

Zellner, Michael; McNeil, Wendy; Gray, George, III; Huerta, David; King, Nicholas; Neal, George; Payton, Jeremy; Rubin, Jim; Stevens, Gerald; Turley, William; Buttler, William

2008-03-01

This effort investigates surface-preparation methods to enhance dynamic surface-property measurements of shocked metal surfaces. To assess the ability of making reliable and consistent dynamic surface-property measurements, the amount of material ejected from the free-surface upon shock release to vacuum (ejecta) was monitored for shocked Al-1100 and Sn targets. Four surface preparation methods were considered: fly-cut machined finish, diamond-turned machine finish, polished finish, and ball-rolled. The samples were shock loaded by in-contact detonation of HE PBX-9501 on the front-side of the metal coupons. Ejecta production at the back-side or free-side of the metal coupons was monitored using piezoelectric pins, optical shadowgraphy, and x-ray attenuation radiography.

Surface preparation methods to enhance dynamic surface property measurements of shocked metal surfaces

NASA Astrophysics Data System (ADS)

Zellner, M. B.; Vogan McNeil, W.; Gray, G. T.; Huerta, D. C.; King, N. S. P.; Neal, G. E.; Valentine, S. J.; Payton, J. R.; Rubin, J.; Stevens, G. D.; Turley, W. D.; Buttler, W. T.

2008-04-01

This effort investigates surface-preparation methods to enhance dynamic surface-property measurements of shocked metal surfaces. To assess the ability of making reliable and consistent dynamic surface-property measurements, the amount of material ejected from the free surface upon shock release to vacuum (ejecta) was monitored for shocked Al-1100 and Sn targets. Four surface-preparation methods were considered: Fly-cut machine finish, diamond-turned machine finish, polished finish, and ball rolled. The samples were shock loaded by in-contact detonation of HE PBX-9501 on the front side of the metal coupons. Ejecta production at the back side or free side of the metal coupons was monitored using piezoelectric pins, optical shadowgraphy, and x-ray attenuation radiography.

Surface impedance and optimum surface resistance of a superconductor with an imperfect surface

NASA Astrophysics Data System (ADS)

Gurevich, Alex; Kubo, Takayuki

2017-11-01

We calculate a low-frequency surface impedance of a dirty, s -wave superconductor with an imperfect surface incorporating either a thin layer with a reduced pairing constant or a thin, proximity-coupled normal layer. Such structures model realistic surfaces of superconducting materials which can contain oxide layers, absorbed impurities, or nonstoichiometric composition. We solved the Usadel equations self-consistently and obtained spatial distributions of the order parameter and the quasiparticle density of states which then were used to calculate a low-frequency surface resistance Rs(T ) and the magnetic penetration depth λ (T ) as functions of temperature in the limit of local London electrodynamics. It is shown that the imperfect surface in a single-band s -wave superconductor results in a nonexponential temperature dependence of Z (T ) at T ≪Tc which can mimic the behavior of multiband or d -wave superconductors. The imperfect surface and the broadening of the gap peaks in the quasiparticle density of states N (ɛ ) in the bulk give rise to a weakly temperature-dependent residual surface resistance. We show that the surface resistance can be optimized and even reduced below its value for an ideal surface by engineering N (ɛ ) at the surface using pair-breaking mechanisms, particularly by incorporating a small density of magnetic impurities or by tuning the thickness and conductivity of the normal layer and its contact resistance. The results of this work address the limit of Rs in superconductors at T ≪Tc , and the ways of engineering the optimal density of states by surface nanostructuring and impurities to reduce losses in superconducting microresonators, thin-film strip lines, and radio-frequency cavities for particle accelerators.

On-surface synthesis on a bulk insulator surface

NASA Astrophysics Data System (ADS)

Richter, Antje; Floris, Andrea; Bechstein, Ralf; Kantorovich, Lev; Kühnle, Angelika

2018-04-01

On-surface synthesis has rapidly emerged as a most promising approach to prepare functional molecular structures directly on a support surface. Compared to solution synthesis, performing chemical reactions on a surface offers several exciting new options: due to the absence of a solvent, reactions can be envisioned that are otherwise not feasible due to the insolubility of the reaction product. Perhaps even more important, the confinement to a two-dimensional surface might enable reaction pathways that are not accessible otherwise. Consequently, on-surface synthesis has attracted great attention in the last decade, with an impressive number of classical reactions transferred to a surface as well as new reactions demonstrated that have no classical analogue. So far, the majority of the work has been carried out on conducting surfaces. However, when aiming for electronic decoupling of the resulting structures, e.g. for the use in future molecular electronic devices, non-conducting surfaces are highly desired. Here, we review the current status of on-surface reactions demonstrated on the (10.4) surface of the bulk insulator calcite. Besides thermally induced C-C coupling of halogen-substituted aryls, photochemically induced [2  +  2] cycloaddition has been proven possible on this surface. Moreover, experimental evidence exists for coupling of terminal alkynes as well as diacetylene polymerization. While imaging of the resulting structures with dynamic atomic force microscopy provides a direct means of reaction verification, the detailed reaction pathway often remains unclear. Especially in cases where the presence of metal atoms is known to catalyze the corresponding solution chemistry reaction (e.g. in the case of the Ullmann reaction), disclosing the precise reaction pathway is of importance to understand and generalize on-surface reactivity on a bulk insulator surface. To this end, density-functional theory calculations have proven to provide atomic

The mechanics of malaria parasite invasion of the human erythrocyte - towards a reassessment of the host cell contribution.

PubMed

Koch, Marion; Baum, Jake

2016-03-01

Despite decades of research, we still know little about the mechanics of Plasmodium host cell invasion. Fundamentally, while the essential or non-essential nature of different parasite proteins is becoming clearer, their actual function and how each comes together to govern invasion are poorly understood. Furthermore, in recent years an emerging world view is shifting focus away from the parasite actin-myosin motor being the sole force responsible for entry to an appreciation of host cell dynamics and forces and their contribution to the process. In this review, we discuss merozoite invasion of the erythrocyte, focusing on the complex set of pre-invasion events and how these might prime the red cell to facilitate invasion. While traditionally parasite interactions at this stage have been viewed simplistically as mediating adhesion only, recent work makes it apparent that by interacting with a number of host receptors and signalling pathways, combined with secretion of parasite-derived lipid material, that the merozoite may initiate cytoskeletal re-arrangements and biophysical changes in the erythrocyte that greatly reduce energy barriers for entry. Seen in this light Plasmodium invasion may well turn out to be a balance between host and parasite forces, much like that of other pathogen infection mechanisms. © 2016 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.

The mechanics of malaria parasite invasion of the human erythrocyte – towards a reassessment of the host cell contribution

PubMed Central

Koch, Marion

2016-01-01

Summary Despite decades of research, we still know little about the mechanics of Plasmodium host cell invasion. Fundamentally, while the essential or non‐essential nature of different parasite proteins is becoming clearer, their actual function and how each comes together to govern invasion are poorly understood. Furthermore, in recent years an emerging world view is shifting focus away from the parasite actin–myosin motor being the sole force responsible for entry to an appreciation of host cell dynamics and forces and their contribution to the process. In this review, we discuss merozoite invasion of the erythrocyte, focusing on the complex set of pre‐invasion events and how these might prime the red cell to facilitate invasion. While traditionally parasite interactions at this stage have been viewed simplistically as mediating adhesion only, recent work makes it apparent that by interacting with a number of host receptors and signalling pathways, combined with secretion of parasite‐derived lipid material, that the merozoite may initiate cytoskeletal re‐arrangements and biophysical changes in the erythrocyte that greatly reduce energy barriers for entry. Seen in this light Plasmodium invasion may well turn out to be a balance between host and parasite forces, much like that of other pathogen infection mechanisms. PMID:26663815

Plasmodium falciparum: differing effects of non-esterified fatty acids and phospholipids on intraerythrocytic growth in serum-free medium.

PubMed

Asahi, Hiroko; Izumiyama, Shinji; Tolba, Mohammed Essa Marghany; Kwansa-Bentum, Bethel

2011-03-01

Different combinations of non-esterified fatty acids (NEFA) had variable effects on intraerythrocytic growth of Plasmodium falciparum. All stages of the parasite cultured in medium supplemented with cis-9-octadecenoic acid (C18:1-cis-9), hexadecanoic acid (C16:0), phospholipids (Pld) and bovine albumin free of NEFA were similar to those grown in complete growth medium. Three typical growth patterns indicating suppressed schizogony (SS), suppressed formation of merozoites (SMF), and inhibited invasion of merozoites (IMI) resulted from culture in other combinations of lipids. Unsaturated or saturated NEFA with longer or shorter carbon chains than C18:1-cis-9 or C16:0, higher degree of unsaturation, and trans-forms mainly resulted in SS and SMF effects. However, IMI or partial IMI was observed with tetradecanoic acid or octadecanoic acid enriched with C18:1-cis-9, and cis-9-hexadecenoic acid plus C16:0. Isoforms of C18:1-cis-9 also mainly resulted in partial IMI. SMF also occurred with C18:1-cis-9 plus C16:0 in the absence of Pld. Thus different NEFA exerted distinct roles in erythrocytic growth of the parasite by sustaining development at different stages. Copyright © 2010 Elsevier Inc. All rights reserved.

Discovery of three novel coccidian parasites infecting California sea lions (Zalophus californianus), with evidence of sexual replication and interspecies pathogenicity.

PubMed

Colegrove, Kathleen M; Grigg, Michael E; Carlson-Bremer, Daphne; Miller, Robin H; Gulland, Frances M D; Ferguson, David J P; Rejmanek, Daniel; Barr, Bradd C; Nordhausen, Robert; Melli, Ann C; Conrad, Patricia A

2011-10-01

Enteric protozoal infection was identified in 5 stranded California sea lions (Zalophus californianus). Microscopically, the apical cytoplasm of distal jejunal enterocytes contained multiple stages of coccidian parasites, including schizonts with merozoites and spherical gametocytes, which were morphologically similar to coccidians. By histopathology, organisms appeared to be confined to the intestine and accompanied by only mild enteritis. Using electron microscopy, both sexual (microgametocytes, macrogamonts) and asexual (schizonts, merozoites) coccidian stages were identified in enterocytes within parasitophorous vacuoles, consistent with apicomplexan development in a definitive host. Serology was negative for tissue cyst-forming coccidians, and immunohistochemistry for Toxoplasma gondii was inconclusive and negative for Neospora caninum and Sarcocystis neurona. Analysis of ITS-1 gene sequences amplified from frozen or formalin-fixed paraffin-embedded intestinal sections identified DNA sequences with closest homology to Neospora sp. (80%); these novel sequences were referred to as belonging to coccidian parasites "A," "B," and "C." Subsequent molecular analyses completed on a neonatal harbor seal (Phoca vitulina) with protozoal lymphadenitis, hepatitis, myocarditis, and encephalitis showed that it was infected with a coccidian parasite bearing the "C" sequence type. Our results indicate that sea lions likely serve as definitive hosts for 3 newly described coccidian parasites, at least 1 of which is pathogenic in a marine mammal intermediate host species.

Surface structure and stability of partially hydroxylated silica surfaces

DOE PAGES

Rimsza, J. M.; Jones, R. E.; Criscenti, L. J.

2017-04-04

Surface energies of silicates influence crack propagation during brittle fracture and decrease with surface relaxation caused by annealing and hydroxylation. Molecular-level simulations are particularly suited for the investigation of surface processes. In this work, classical MD simulations of silica surfaces are performed with two force fields (ClayFF and ReaxFF) to investigate the effect of force field reactivity on surface structure and energy as a function of surface hydroxylation. An unhydroxylated fracture surface energy of 5.1 J/m 2 is calculated with the ClayFF force field, and 2.0 J/m 2 is calculated for the ReaxFF force field. The ClayFF surface energies aremore » consistent with the experimental results from double cantilever beam fracture tests (4.5 J/m 2), whereas ReaxFF underestimated these surface energies. Surface relaxation via annealing and hydroxylation was performed by creating a low-energy equilibrium surface. Annealing condensed neighboring siloxane bonds increased the surface connectivity, and decreased the surface energies by 0.2 J/m 2 for ClayFF and 0.8 J/m 2 for ReaxFF. Posthydroxylation surface energies decreased further to 4.6 J/m 2 with the ClayFF force field and to 0.2 J/m 2 with the ReaxFF force field. Experimental equilibrium surface energies are ~0.35 J/m 2, consistent with the ReaxFF force field. Although neither force field was capable of replicating both the fracture and equilibrium surface energies reported from experiment, each was consistent with one of these conditions. Furthermore, future computational investigations that rely on accurate surface energy values should consider the surface state of the system and select the appropriate force field.« less

Brain Surface Conformal Parameterization Using Riemann Surface Structure

PubMed Central

Wang, Yalin; Lui, Lok Ming; Gu, Xianfeng; Hayashi, Kiralee M.; Chan, Tony F.; Toga, Arthur W.; Thompson, Paul M.; Yau, Shing-Tung

2011-01-01

In medical imaging, parameterized 3-D surface models are useful for anatomical modeling and visualization, statistical comparisons of anatomy, and surface-based registration and signal processing. Here we introduce a parameterization method based on Riemann surface structure, which uses a special curvilinear net structure (conformal net) to partition the surface into a set of patches that can each be conformally mapped to a parallelogram. The resulting surface subdivision and the parameterizations of the components are intrinsic and stable (their solutions tend to be smooth functions and the boundary conditions of the Dirichlet problem can be enforced). Conformal parameterization also helps transform partial differential equations (PDEs) that may be defined on 3-D brain surface manifolds to modified PDEs on a two-dimensional parameter domain. Since the Jacobian matrix of a conformal parameterization is diagonal, the modified PDE on the parameter domain is readily solved. To illustrate our techniques, we computed parameterizations for several types of anatomical surfaces in 3-D magnetic resonance imaging scans of the brain, including the cerebral cortex, hippocampi, and lateral ventricles. For surfaces that are topologically homeomorphic to each other and have similar geometrical structures, we show that the parameterization results are consistent and the subdivided surfaces can be matched to each other. Finally, we present an automatic sulcal landmark location algorithm by solving PDEs on cortical surfaces. The landmark detection results are used as constraints for building conformal maps between surfaces that also match explicitly defined landmarks. PMID:17679336

Evaluation of Surface Fatigue Strength Based on Surface Temperature

NASA Astrophysics Data System (ADS)

Deng, Gang; Nakanishi, Tsutomu

Surface temperature is considered to be an integrated index that is dependent on not only the load and the dimensions at the contact point but also the sliding velocity, rolling velocity, surface roughness, and lubrication conditions. Therefore, the surface durability of rollers and gears can be evaluated more exactly and simply by the use of surface temperature rather than Hertzian stress. In this research, surface temperatures of rollers under different rolling and sliding conditions are measured using a thermocouple. The effects of load P, mean velocity Vm and sliding velocity Vs on surface temperature are clarified. An experimental formula, which expresses the linear relationship between surface temperature and the P0.86Vs1.31Vm-0.83 value, is used to determine surface temperature. By comparing calculated and measured temperature on the tooth surface of a gear, this formula is confirmed to be applicable for gear tooth surface temperature calculation.

Surface phonons and elastic surface waves

NASA Astrophysics Data System (ADS)

Büscher, H.; Klein-Heßling, W.; Ludwig, W.

Theoretical investigations on the dynamics of the (001), (110) and (111) surfaces of some cubic metals (Ag, Cu, Ni) will be reviewed. Both, lattice dynamical and continuum theoretical results are obtained via a Green's function formalism. The main attitude of this paper is the comparison of our results with experiments and with results obtained via slab-calculations. The calculation of elastic surface waves has been performed using a modified surface-green-function-matching method. We have used two different approaches of calculation the bulk Green's function (a) using the spectral representation and (b) a method, what works on residues. The investigations are carried out using shortrange phenomenological potentials. The atomic force constants in the first surface layers are modified to describe surface phonon anomalies, observed by experiments. In the case of Ag (100) and Ag(110) we conclude that the detection of odd symmetry shear modes by Erskine et al. [1 a, b] was not very accurate.

The conserved clag multigene family of malaria parasites: essential roles in host-pathogen interaction.

PubMed

Gupta, Ankit; Thiruvengadam, Girija; Desai, Sanjay A

2015-01-01

The clag multigene family is strictly conserved in malaria parasites, but absent from neighboring genera of protozoan parasites. Early research pointed to roles in merozoite invasion and infected cell cytoadherence, but more recent studies have implicated channel-mediated uptake of ions and nutrients from host plasma. Here, we review the current understanding of this gene family, which appears to be central to host-parasite interactions and an important therapeutic target. Published by Elsevier Ltd.

Assimilation of Surface Temperature in Land Surface Models

NASA Technical Reports Server (NTRS)

Lakshmi, Venkataraman

1998-01-01

Hydrological models have been calibrated and validated using catchment streamflows. However, using a point measurement does not guarantee correct spatial distribution of model computed heat fluxes, soil moisture and surface temperatures. With the advent of satellites in the late 70s, surface temperature is being measured two to four times a day from various satellite sensors and different platforms. The purpose of this paper is to demonstrate use of satellite surface temperature in (a) validation of model computed surface temperatures and (b) assimilation of satellite surface temperatures into a hydrological model in order to improve the prediction accuracy of soil moistures and heat fluxes. The assimilation is carried out by comparing the satellite and the model produced surface temperatures and setting the "true"temperature midway between the two values. Based on this "true" surface temperature, the physical relationships of water and energy balance are used to reset the other variables. This is a case of nudging the water and energy balance variables so that they are consistent with each other and the true" surface temperature. The potential of this assimilation scheme is demonstrated in the form of various experiments that highlight the various aspects. This study is carried over the Red-Arkansas basin in the southern United States (a 5 deg X 10 deg area) over a time period of a year (August 1987 - July 1988). The land surface hydrological model is run on an hourly time step. The results show that satellite surface temperature assimilation improves the accuracy of the computed surface soil moisture remarkably.

The Plasmodium falciparum rhoptry protein RhopH3 plays essential roles in host cell invasion and nutrient uptake

PubMed Central

Sherling, Emma S; Knuepfer, Ellen; Brzostowski, Joseph A; Miller, Louis H; Blackman, Michael J; van Ooij, Christiaan

2017-01-01

Merozoites of the protozoan parasite responsible for the most virulent form of malaria, Plasmodium falciparum, invade erythrocytes. Invasion involves discharge of rhoptries, specialized secretory organelles. Once intracellular, parasites induce increased nutrient uptake by generating new permeability pathways (NPP) including a Plasmodium surface anion channel (PSAC). RhopH1/Clag3, one member of the three-protein RhopH complex, is important for PSAC/NPP activity. However, the roles of the other members of the RhopH complex in PSAC/NPP establishment are unknown and it is unclear whether any of the RhopH proteins play a role in invasion. Here we demonstrate that RhopH3, the smallest component of the complex, is essential for parasite survival. Conditional truncation of RhopH3 substantially reduces invasive capacity. Those mutant parasites that do invade are defective in nutrient import and die. Our results identify a dual role for RhopH3 that links erythrocyte invasion to formation of the PSAC/NPP essential for parasite survival within host erythrocytes. DOI: http://dx.doi.org/10.7554/eLife.23239.001 PMID:28252384

High Levels of Asymptomatic and Subpatent Plasmodium falciparum Parasite Carriage at Health Facilities in an Area of Heterogeneous Malaria Transmission Intensity in the Kenyan Highlands

PubMed Central

Stresman, Gillian H.; Stevenson, Jennifer C.; Ngwu, Nnenna; Marube, Elizabeth; Owaga, Chrispin; Drakeley, Chris; Bousema, Teun; Cox, Jonathan

2014-01-01

In endemic settings, health facility surveys provide a convenient approach to estimating malaria transmission intensity. Typically, testing for malaria at facilities is performed on symptomatic attendees, but asymptomatic infections comprise a considerable proportion of the parasite reservoir. We sampled individuals attending five health facilities in the western Kenyan highlands. Malaria prevalence by rapid diagnostic test (RDT) was 8.6–32.9% in the health facilities. Of all polymerase chain reaction-positive participants, 46.4% (95% confidence interval [95% CI] = 42.6–50.2%) of participants had infections that were RDT-negative and asymptomatic, and 55.9% of those infections consisted of multiple parasite clones as assessed by merozoite surface protein-2 genotyping. Subpatent infections were more common in individuals reporting the use of non-artemisinin–based antimalarials in the 2 weeks preceding the survey (odds ratio = 2.49, 95% CI = 1.04–5.92) compared with individuals not reporting previous use of antimalarials. We observed a large and genetically complex pool of subpatent parasitemia in the Kenya highlands that must be considered in malaria interventions. PMID:25331807

Antibody response to Plasmodium vivax antigens in Fy-negative individuals from the Colombian Pacific coast.

PubMed

Herrera, Sócrates; Gómez, Andrés; Vera, Omaira; Vergara, Juana; Valderrama-Aguirre, Augusto; Maestre, Amanda; Méndez, Fabián; Wang, Ruobing; Chitnis, Chetan E; Yazdani, Syed S; Arévalo-Herrera, Myriam

2005-11-01

The Duffy antigen (Fy) is necessary for Plasmodium vivax invasion of human erythrocytes. Some populations have a highly prevalent Fy-negative phenotype; such persons are naturally protected from P. vivax blood infection but are expected to completely support the P. vivax pre-erythrocytic cycle, representing a valuable model for studying the immune response during these parasitic stages. We typed 214 individuals, mostly Afro-Colombians, from a P. vivax-endemic area for Fy expression and determined the antibody response to P. vivax pre-erythrocytic (sporozoites and CS) and blood-stage antigens (blood forms, P. vivax merozoite surface protein 1, and P. vivax Duffy binding protein [PvDBP]). Antibody titers to P. vivax circumsporozoite protein, P11, and N-terminal peptides and the number of responders were similar in Fy-negative and Fy-positive individuals. The number of responders to sporozoites, blood forms, and PvDBP were different between these groups. Thus, Fy-negative individuals from malaria-endemic areas can be used to study the immune response to the P. vivax liver phase without interference of the erythrocytic cycle.

A preliminary study of genetic diversity of MSP-1 types in Plasmodium falciparum in southern province of Sistan Baluchistan of Iran.

PubMed

Zahra, Zamani; Reza, Razavi Mohammad; Mehdi, Assmar; Sedigheh, Sadeghi; Fatemeh, Pourfallah; Nikoo, Nasoohi; Ashraf, Sheibani; Mohammad, Raisi

2007-02-01

Plasmodiumfalciparum merozoite surface protein-1 (MSP-1) shows extensive antigenic diversity. This is due to the presence of seven variable blocks, five semi-conserved and also five conserved blocks. The variable blocks in the MSP-1 gene are principally dimorphic, displaying either K1 or MAD20 type; except for the block 2 region which is represented by three alleles, an RO33 type in addition to the other two. Allelic diversity is reported to be generated by intra-genic recombination between the variable blocks. A study of allelic variation of MSP-1 gene in Plasmodium falciparum was carried out in the southern province of Sistan Baluchistan in Iran in 2001-2003. Samples were obtained from 30 febrile patients and DNA was extracted and association types between blocks 2 and 6 was identified on each block using specific primers and compared with those from Vietnam, Brazil and Africa. The association types obtained, were similar though less in number than the ones from Vietnam, but more than those from Africa and Brazil.

Femtosecond laser-induced surface wettability modification of polystyrene surface

NASA Astrophysics Data System (ADS)

Wang, Bing; Wang, XinCai; Zheng, HongYu; Lam, YeeCheong

2016-12-01

In this paper, we demonstrated a simple method to create either a hydrophilic or hydrophobic surface. With femtosecond laser irradiation at different laser parameters, the water contact angle (WCA) on polystyrene's surface can be modified to either 12.7° or 156.2° from its original WCA of 88.2°. With properly spaced micro-pits created, the surface became hydrophilic probably due to the spread of the water droplets into the micro-pits. While with properly spaced micro-grooves created, the surface became rough and more hydrophobic. We investigated the effect of laser parameters on WCAs and analyzed the laser-treated surface roughness, profiles and chemical bonds by surface profilometer, scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). For the laser-treated surface with low roughness, the polar (such as C—O, C=O, and O—C=O bonds) and non-polar (such as C—C or C—H bonds) groups were found to be responsible for the wettability changes. While for a rough surface, the surface roughness or the surface topography structure played a more significant role in the changes of the surface WCA. The mechanisms involved in the laser surface wettability modification process were discussed.

Lateral engineering of surface states - towards surface-state nanoelectronics.

PubMed

García de Abajo, F J; Cordón, J; Corso, M; Schiller, F; Ortega, J E

2010-05-01

Patterned metal surfaces can host electron quantum waves that display interference phenomena over distances of a few nanometres, thus providing excellent information carriers for future atomic-scale devices. Here we demonstrate that collimation and waveguiding of surface electrons can be realized in silver-induced strain dislocation networks on Cu(111) surfaces, as a conceptual proof-of-principle of surface-state nanoelectronics (SSNE). The Ag/Cu(111) system exhibits featured surface bands with gaps at the Fermi energy, which are basic requirements for a potential SSNE material. We establish a solid analogy between the behavior of surface-state electrons and surface plasmons in patterned metal surfaces, thus facilitating the transfer of existing knowledge on plasmonic structures to the new scenario presented by engineered electronic surface-state nanostructures, with the advantage of a 1000-fold reduction in wavelength and geometrical parameters.

Surface Temperature Assimilation in Land Surface Models

NASA Technical Reports Server (NTRS)

Lakshmi, Venkataraman

1997-01-01

This paper examines the utilization of surface temperature as a variable to be assimilated in offline land surface hydrological models. Comparisons between the model computed and satellite observed surface temperatures have been carried out. The assimilation of surface temperature is carried out twice a day (corresponding to the AM and PM overpass of the NOAA10) over the Red- Arkansas basin in the Southwestern United States (31 deg 50 min N - 36 deg N, 94 deg 30 min W - 104 deg 30 min W) for a period of one year (August 1987 to July 1988). The effect of assimilation is to reduce the difference between the surface soil moisture computed for the precipitation and/or shortwave radiation perturbed case and the unperturbed case compared to no assimilation.

Surface Temperature Assimilation in Land Surface Models

NASA Technical Reports Server (NTRS)

Lakshmi, Venkataraman

1999-01-01

This paper examines the utilization of surface temperature as a variable to be assimilated in offline land surface hydrological models. Comparisons between the model computed and satellite observed surface temperatures have been carried out. The assimilation of surface temperature is carried out twice a day (corresponding to the AM and PM overpass of the NOAA10) over the Red-Arkansas basin in the Southwestern United States (31 degs 50 sec N - 36 degrees N, 94 degrees 30 seconds W - 104 degrees 3 seconds W) for a period of one year (August 1987 to July 1988). The effect of assimilation is to reduce the difference between the surface soil moisture computed for the precipitation and/or shortwave radiation perturbed case and the unperturbed case compared to no assimilation.

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213

In-surface confinement of topological insulator nanowire surface states

NASA Astrophysics Data System (ADS)

Chen, Fan W.; Jauregui, Luis A.; Tan, Yaohua; Manfra, Michael; Klimeck, Gerhard; Chen, Yong P.; Kubis, Tillmann

2015-09-01

The bandstructures of [110] and [001] Bi2Te3 nanowires are solved with the atomistic 20 band tight binding functionality of NEMO5. The theoretical results reveal: The popular assumption that all topological insulator (TI) wire surfaces are equivalent is inappropriate. The Fermi velocity of chemically distinct wire surfaces differs significantly which creates an effective in-surface confinement potential. As a result, topological insulator surface states prefer specific surfaces. Therefore, experiments have to be designed carefully not to probe surfaces unfavorable to the surface states (low density of states) and thereby be insensitive to the TI-effects.

Gammaherpesvirus Co-infection with Malaria Suppresses Anti-parasitic Humoral Immunity

PubMed Central

Matar, Caline G.; Anthony, Neil R.; O’Flaherty, Brigid M.; Jacobs, Nathan T.; Priyamvada, Lalita; Engwerda, Christian R.; Speck, Samuel H.; Lamb, Tracey J.

2015-01-01

Immunity to non-cerebral severe malaria is estimated to occur within 1-2 infections in areas of endemic transmission for Plasmodium falciparum. Yet, nearly 20% of infected children die annually as a result of severe malaria. Multiple risk factors are postulated to exacerbate malarial disease, one being co-infections with other pathogens. Children living in Sub-Saharan Africa are seropositive for Epstein Barr Virus (EBV) by the age of 6 months. This timing overlaps with the waning of protective maternal antibodies and susceptibility to primary Plasmodium infection. However, the impact of acute EBV infection on the generation of anti-malarial immunity is unknown. Using well established mouse models of infection, we show here that acute, but not latent murine gammaherpesvirus 68 (MHV68) infection suppresses the anti-malarial humoral response to a secondary malaria infection. Importantly, this resulted in the transformation of a non-lethal P. yoelii XNL infection into a lethal one; an outcome that is correlated with a defect in the maintenance of germinal center B cells and T follicular helper (Tfh) cells in the spleen. Furthermore, we have identified the MHV68 M2 protein as an important virus encoded protein that can: (i) suppress anti-MHV68 humoral responses during acute MHV68 infection; and (ii) plays a critical role in the observed suppression of anti-malarial humoral responses in the setting of co-infection. Notably, co-infection with an M2-null mutant MHV68 eliminates lethality of P. yoelii XNL. Collectively, our data demonstrates that an acute gammaherpesvirus infection can negatively impact the development of an anti-malarial immune response. This suggests that acute infection with EBV should be investigated as a risk factor for non-cerebral severe malaria in young children living in areas endemic for Plasmodium transmission. PMID:25996913

A semi-synthetic whole parasite vaccine designed to protect against blood stage malaria.

PubMed

Giddam, Ashwini Kumar; Reiman, Jennifer M; Zaman, Mehfuz; Skwarczynski, Mariusz; Toth, Istvan; Good, Michael F

2016-10-15

Although attenuated malaria parasitized red blood cells (pRBCs) are promising vaccine candidates, their application in humans may be restricted for ethical and regulatory reasons. Therefore, we developed an organic microparticle-based delivery platform as a whole parasite malaria-antigen carrier to mimic pRBCs. Killed blood stage parasites were encapsulated within liposomes that are targeted to antigen presenting cells (APCs). Mannosylated lipid core peptides (MLCPs) were used as targeting ligands for the liposome-encapsulated parasite antigens. MLCP-liposomes, but not unmannosylated liposomes, were taken-up efficiently by APCs which then significantly upregulated expression of MHC-ll and costimulatory molecules, CD80 and CD86. Two such vaccines using rodent model systems were constructed - one with Plasmodium chabaudi and the other with P. yoelii. MLCP-liposome vaccines were able to control the parasite burden and extended the survival of mice. Thus, we have demonstrated an alternative delivery system to attenuated pRBCs with similar vaccine efficacy and added clinical advantages. Such liposomes are promising candidates for a human malaria vaccine. Attenuated whole parasite-based vaccines, by incorporating all parasite antigens, are very promising candidates, but issues relating to production, storage and safety concerns are significantly slowing their development. We therefore developed a semi-synthetic whole parasite malaria vaccine that is easily manufactured and stored. Two such prototype vaccines (a P. chabaudi and a P. yoelii vaccine) have been constructed. They are non-infectious, highly immunogenic and give good protection profiles. This semi-synthetic delivery platform is an exciting strategy to accelerate the development of a licensed malaria vaccine. Moreover, this strategy can be potentially applied to a wide range of pathogens. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Persistence of Protective Immunity to Malaria Induced by DNA Priming and Poxvirus Boosting: Characterization of Effector and Memory CD8+-T-Cell Populations

PubMed Central

Sedegah, Martha; Brice, Gary T.; Rogers, William O.; Doolan, Denise L.; Charoenvit, Yupin; Jones, Trevor R.; Majam, Victoria F.; Belmonte, Arnel; Lu, Minh; Belmonte, Maria; Carucci, Daniel J.; Hoffman, Stephen L.

2002-01-01

The persistence of immunity to malaria induced in mice by a heterologous DNA priming and poxvirus boosting regimen was characterized. Mice were immunized by priming with DNA vaccine plasmids encoding the Plasmodium yoelii circumsporozoite protein (PyCSP) and murine granulocyte-macrophage colony-stimulating factor and boosting with recombinant vaccinia encoding PyCSP. BALB/c mice immunized with either high-dose (100 μg of p PyCSP plus 30 μg of pGM-CSF) or low-dose (1 μg of p PyCSP plus 1 μg of pGM-CSF DNA) priming were protected against challenge with 50 P. yoelii sporozoites. Protection 2 weeks after immunization was 70 to 100%, persisted at this level for at least 20 weeks, and declined to 30 to 40% by 28 weeks. Eight of eight mice protected at 20 weeks were still protected when rechallenged at 40 weeks. The antigen (Ag)-specific effector CD8+-T-cell population present 2 weeks after boosting had ex vivo Ag-specific cytolytic activity, expressed both gamma interferon (IFN-γ) and tumor necrosis factor alpha, and constituted 12 to 20% of splenic CD8+ T cells. In contrast, the memory CD8+-Ag-specific-cell population at 28 weeks lacked cytolytic activity and constituted only 6% of splenic CD8+ T cells, but at the single-cell level it produced significantly higher levels of IFN-γ than the effectors. High levels of Ag- or parasite-specific antibodies present 2 weeks after boosting had declined three- to sevenfold by 28 weeks. Low-dose priming was similarly immunogenic and as protective as high-dose priming against a 50-, but not a 250-, sporozoite challenge. These results demonstrate that a heterologous priming and boosting vaccination can provide lasting protection against malaria in this model system. PMID:12065488

DIFFEOMORPHIC SURFACE FLOWS: A NOVEL METHOD OF SURFACE EVOLUTION*

PubMed Central

Zhang, Sirong; Younes, Laurent; Zweck, John; Ratnanather, J. Tilak

2009-01-01

We describe a new class of surface flows, diffeomorphic surface flows, induced by restricting diffeomorphic flows of the ambient Euclidean space to a surface. Different from classical surface PDE flows such as mean curvature flow, diffeomorphic surface flows are solutions of integro-differential equations in a group of diffeomorphisms. They have the potential advantage of being both topology-invariant and singularity free, which can be useful in computational anatomy and computer graphics. We first derive the Euler–Lagrange equation of the elastic energy for general diffeomorphic surface flows, which can be regarded as a smoothed version of the corresponding classical surface flows. Then we focus on diffeomorphic mean curvature flow. We prove the short-time existence and uniqueness of the flow, and study the long-time existence of the flow for surfaces of revolution. We present numerical experiments on synthetic and cortical surfaces from neuroimaging studies in schizophrenia and auditory disorders. Finally we discuss unresolved issues and potential applications. PMID:20016768

A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.

PubMed

Hall, Neil; Karras, Marianna; Raine, J Dale; Carlton, Jane M; Kooij, Taco W A; Berriman, Matthew; Florens, Laurence; Janssen, Christoph S; Pain, Arnab; Christophides, Georges K; James, Keith; Rutherford, Kim; Harris, Barbara; Harris, David; Churcher, Carol; Quail, Michael A; Ormond, Doug; Doggett, Jon; Trueman, Holly E; Mendoza, Jacqui; Bidwell, Shelby L; Rajandream, Marie-Adele; Carucci, Daniel J; Yates, John R; Kafatos, Fotis C; Janse, Chris J; Barrell, Bart; Turner, C Michael R; Waters, Andrew P; Sinden, Robert E

2005-01-07

Plasmodium berghei and Plasmodium chabaudi are widely used model malaria species. Comparison of their genomes, integrated with proteomic and microarray data, with the genomes of Plasmodium falciparum and Plasmodium yoelii revealed a conserved core of 4500 Plasmodium genes in the central regions of the 14 chromosomes and highlighted genes evolving rapidly because of stage-specific selective pressures. Four strategies for gene expression are apparent during the parasites' life cycle: (i) housekeeping; (ii) host-related; (iii) strategy-specific related to invasion, asexual replication, and sexual development; and (iv) stage-specific. We observed posttranscriptional gene silencing through translational repression of messenger RNA during sexual development, and a 47-base 3' untranslated region motif is implicated in this process.

Antimalarial activity of novel 4-aminoquinolines active against drug resistant strains.

PubMed

Kondaparla, Srinivasarao; Soni, Awakash; Manhas, Ashan; Srivastava, Kumkum; Puri, Sunil K; Katti, S B

2017-02-01

In the present study we have synthesized a new class of 4-aminoquinolines and evaluated against Plasmodium falciparum in vitro (3D7-sensitive strain & K1-resistant strain) and Plasmodium yoelii in vivo (N-67 strain). Among the series, eleven compounds (5, 6, 7, 8, 9, 11, 12, 13, 14, 15 and 21) showed superior antimalarial activity against K1 strain as compared to CQ. In addition, all these analogues showed 100% suppression of parasitemia on day 4 in the in vivo mouse model against N-67 strain when administered orally. Further, biophysical studies suggest that this series of compounds act on heme polymerization target. Copyright © 2016 Elsevier Inc. All rights reserved.

Surface photovoltage spectroscopy applied to gallium arsenide surfaces

NASA Technical Reports Server (NTRS)

Bynik, C. E.

1975-01-01

The experimental and theoretical basis for surface photovoltage spectroscopy is outlined. Results of this technique applied to gallium arsenide surfaces, are reviewed and discussed. The results suggest that in gallium arsenide the surface voltage may be due to deep bulk impurity acceptor states that are pinned at the Fermi level at the surface. Establishment of the validity of this model will indicate the direction to proceed to increase the efficiency of gallium arsenide solar cells.

Multilayer Relaxation and Surface Energies of Metallic Surfaces

NASA Technical Reports Server (NTRS)

Bozzolo, Guillermo; Rodriguez, Agustin M.; Ferrante, John

1994-01-01

The perpendicular and parallel multilayer relaxations of fcc (210) surfaces are studied using equivalent crystal theory (ECT). A comparison with experimental and theoretical results is made for AI(210). The effect of uncertainties in the input parameters on the magnitudes and ordering of surface relaxations for this semiempirical method is estimated. A new measure of surface roughness is proposed. Predictions for the multilayer relaxations and surface energies of the (210) face of Cu and Ni are also included.

Advances in surfaces and osseointegration in implantology. Biomimetic surfaces

PubMed Central

Albertini, Matteo; Fernandez-Yague, Marc; Lázaro, Pedro; Herrero-Climent, Mariano; Bullon, Pedro; Gil, Francisco-Javier

2015-01-01

The present work is a revision of the processes occurring in osseointegration of titanium dental implants according to different types of surfaces -namely, polished surfaces, rough surfaces obtained from subtraction methods, as well as the new hydroxyapatite biomimetic surfaces obtained from thermochemical processes. Hydroxyapatite’s high plasma-projection temperatures have proven to prevent the formation of crystalline apatite on the titanium dental implant, but lead to the formation of amorphous calcium phosphate (i.e., with no crystal structure) instead. This layer produce some osseointegration yet the calcium phosphate layer will eventually dissolve and leave a gap between the bone and the dental implant, thus leading to osseointegration failure due to bacterial colonization. A new surface -recently obtained by thermochemical processes- produces, by crystallization, a layer of apatite with the same mineral content as human bone that is chemically bonded to the titanium surface. Osseointegration speed was tested by means of minipigs, showing bone formation after 3 to 4 weeks, with the security that a dental implant can be loaded. This surface can be an excellent candidate for immediate or early loading procedures. Key words:Dental implants, implants surfaces, osseointegration, biomimetics surfaces. PMID:25662555

Surface Treatment

NASA Technical Reports Server (NTRS)

Park, Cheol (Inventor); Lowther, Sharon E. (Inventor); St.Clair, Terry L. (Inventor)

2003-01-01

A simple surface treatment process is provided which offers a high performance surface for a variety of applications at low cost. This novel surface treatment, which is particularly useful for Ti-6Al-4V alloys, is achieved by forming oxides on the surface with a two-step chemical process and without mechanical abrasion. First, after solvent degreasing, sulfuric acid is used to generate a fresh titanium surface. Next, an alkaline perborate solution is used to form an oxide on the surface. This acid-followed-by-base treatment is cost effective and relatively safe to use in commercial applications. In addition, it is chromium-free, and has been successfully used with a sol-gel coating to afford a strong adhesive bond that exhibits excellent durability after the bonded specimens have been subjected to a harsh 72 hour water boil immersion. Phenylethynyl containing adhesives were used to evaluate this surface treatment with a novel coupling agent containing both trialkoxysilane and phenylethynyl groups. 8 Claims, 16 Drawing Sheets

Dropwise Condensation of Low Surface Tension Fluids on Omniphobic Surfaces

PubMed Central

Rykaczewski, Konrad; Paxson, Adam T.; Staymates, Matthew; Walker, Marlon L.; Sun, Xiaoda; Anand, Sushant; Srinivasan, Siddarth; McKinley, Gareth H.; Chinn, Jeff; Scott, John Henry J.; Varanasi, Kripa K.

2014-01-01

Compared to the significant body of work devoted to surface engineering for promoting dropwise condensation heat transfer of steam, much less attention has been dedicated to fluids with lower interfacial tension. A vast array of low-surface tension fluids such as hydrocarbons, cryogens, and fluorinated refrigerants are used in a number of industrial applications, and the development of passive means for increasing their condensation heat transfer coefficients has potential for significant efficiency enhancements. Here we investigate condensation behavior of a variety of liquids with surface tensions in the range of 12 to 28 mN/m on three types of omniphobic surfaces: smooth oleophobic, re-entrant superomniphobic, and lubricant-impregnated surfaces. We demonstrate that although smooth oleophobic and lubricant-impregnated surfaces can promote dropwise condensation of the majority of these fluids, re-entrant omniphobic surfaces became flooded and reverted to filmwise condensation. We also demonstrate that on the lubricant-impregnated surfaces, the choice of lubricant and underlying surface texture play a crucial role in stabilizing the lubricant and reducing pinning of the condensate. With properly engineered surfaces to promote dropwise condensation of low-surface tension fluids, we demonstrate a four to eight-fold improvement in the heat transfer coefficient. PMID:24595171

Dropwise condensation of low surface tension fluids on omniphobic surfaces.

PubMed

Rykaczewski, Konrad; Paxson, Adam T; Staymates, Matthew; Walker, Marlon L; Sun, Xiaoda; Anand, Sushant; Srinivasan, Siddarth; McKinley, Gareth H; Chinn, Jeff; Scott, John Henry J; Varanasi, Kripa K

2014-03-05

Compared to the significant body of work devoted to surface engineering for promoting dropwise condensation heat transfer of steam, much less attention has been dedicated to fluids with lower interfacial tension. A vast array of low-surface tension fluids such as hydrocarbons, cryogens, and fluorinated refrigerants are used in a number of industrial applications, and the development of passive means for increasing their condensation heat transfer coefficients has potential for significant efficiency enhancements. Here we investigate condensation behavior of a variety of liquids with surface tensions in the range of 12 to 28 mN/m on three types of omniphobic surfaces: smooth oleophobic, re-entrant superomniphobic, and lubricant-impregnated surfaces. We demonstrate that although smooth oleophobic and lubricant-impregnated surfaces can promote dropwise condensation of the majority of these fluids, re-entrant omniphobic surfaces became flooded and reverted to filmwise condensation. We also demonstrate that on the lubricant-impregnated surfaces, the choice of lubricant and underlying surface texture play a crucial role in stabilizing the lubricant and reducing pinning of the condensate. With properly engineered surfaces to promote dropwise condensation of low-surface tension fluids, we demonstrate a four to eight-fold improvement in the heat transfer coefficient.

Plasmodium falciparum coronin organizes arrays of parallel actin filaments potentially guiding directional motility in invasive malaria parasites.

PubMed

Olshina, Maya A; Angrisano, Fiona; Marapana, Danushka S; Riglar, David T; Bane, Kartik; Wong, Wilson; Catimel, Bruno; Yin, Meng-Xin; Holmes, Andrew B; Frischknecht, Friedrich; Kovar, David R; Baum, Jake

2015-07-18

Gliding motility in Plasmodium parasites, the aetiological agents of malaria disease, is mediated by an actomyosin motor anchored in the outer pellicle of the motile cell. Effective motility is dependent on a parasite myosin motor and turnover of dynamic parasite actin filaments. To date, however, the basis for directional motility is not known. Whilst myosin is very likely orientated as a result of its anchorage within the parasite, how actin filaments are orientated to facilitate directional force generation remains unexplained. In addition, recent evidence has questioned the linkage between actin filaments and secreted surface antigens leaving the way by which motor force is transmitted to the extracellular milieu unknown. Malaria parasites possess a markedly reduced repertoire of actin regulators, among which few are predicted to interact with filamentous (F)-actin directly. One of these, PF3D7_1251200, shows strong homology to the coronin family of actin-filament binding proteins, herein referred to as PfCoronin. Here the N terminal beta propeller domain of PfCoronin (PfCor-N) was expressed to assess its ability to bind and bundle pre-formed actin filaments by sedimentation assay, total internal reflection fluorescence (TIRF) microscopy and confocal imaging as well as to explore its ability to bind phospholipids. In parallel a tagged PfCoronin line in Plasmodium falciparum was generated to determine the cellular localization of the protein during asexual parasite development and blood-stage merozoite invasion. A combination of biochemical approaches demonstrated that the N-terminal beta-propeller domain of PfCoronin is capable of binding F-actin and facilitating formation of parallel filament bundles. In parasites, PfCoronin is expressed late in the asexual lifecycle and localizes to the pellicle region of invasive merozoites before and during erythrocyte entry. PfCoronin also associates strongly with membranes within the cell, likely mediated by interactions

Oxidative dissolution of pyrite surfaces by hexavalent chromium: Surface site saturation and surface renewal

NASA Astrophysics Data System (ADS)

Graham, Andrew M.; Bouwer, Edward J.

2012-04-01

In-situ reduction of toxic Cr(VI) to nontoxic Cr(III) represents an important natural attenuation process for Cr(VI)-impacted environments. This study investigates the stoichiometry and kinetics of Cr(VI) reduction by pyrite, a reduced iron-sulfur mineral ubiquitous in recent estuarine and marine sediments. Pyrite suspensions at surface loadings of 0.28-2.10 m2/L (typical of estuarine or marine sediments) were capable of completely reducing 7-120 μM Cr(VI) on the timescale of minutes to days, with the time to reaction completion decreasing with increasing pyrite loading, decreasing initial Cr(VI) concentration, and decreasing suspension pH. Analysis of metal species (Cr and Fe) and sulfur species in solution and at the mineral surface indicated that Cr(VI) oxidatively dissolved the pyrite surface, releasing ferrous iron and sulfate into solution as the reaction progressed. Surface disulfide groups were postulated as the Cr(VI)-reactive surface entity. Net production or consumption of aqueous Fe(II) was shown to depend upon the relative rates of proton-promoted Fe(II) release, Fe(II) release due to oxidative dissolution of pyrite in the presence of Cr(VI), and Fe(II) consumption due to homogeneous reaction with Cr(VI). Kinetics of Cr(VI) reduction by pyrite displayed a biphasic pattern, and the time to reaction completion increased dramatically with increasing initial Cr(VI) concentration. Rapid Cr(VI) removal occurred early in the reaction progress, attributable to Cr(VI) loss under an adsorption-limited regime. Slow, approximately zero-order, Cr(VI) removal occurred over the bulk of the time courses, and corresponded to Cr(VI) removal under surface site saturation conditions. Stoichiometric Cr(VI) reduction was able to proceed under surface site limited conditions owing to regeneration of reactive surface sites following desorption/dissolution of oxidized surface products, as demonstrated in repeat Cr(VI)-spiking experiments. The role of surface passivation was

[Bone cement adhesion on ceramic surfaces - surface activation of retention surfaces of knee prostheses by atmospheric plasma versus thermal surface treatment].

PubMed

Marx, B; Marx, R; Reisgen, U; Wirtz, D

2015-04-01

CoCrMo alloys are contraindicated for allergy sufferers. For these patients, uncemented and cemented prostheses made of titanium alloy are indicated. Knee prostheses machined from that alloy, however, may have poor tribological behaviour, especially in relation to UHMWPE inlays. Therefore, for knee replacement cemented high-strength oxide ceramic prostheses are suitable for allergy sufferers and in cases of particle-induced aseptic loosening. For adhesion of bone cement, the ceramic surface, however, only exposes inefficient mechanical retention spots as compared with a textured metal surface. Undercuts generated by corundum blasting which in the short-term are highly efficient on a CoCrMo surface are not possible on a ceramic surface due to the brittleness of ceramics. Textures due to blasting may initiate cracks which will weaken the strength of a ceramic prosthesis. Due to the lack of textures mechanical retention is poor or even not existent. Micromotions are promoted and early aseptic loosening is predictable. Instead silicoating of the ceramic surface will allow specific adhesion and result in better hydrolytic stability of bonding thereby preventing early aseptic loosening. Silicoating, however, presupposes a clean and chemically active surface which can be achieved by atmospheric plasma or thermal surface treatment. In order to evaluate the effectiveness of silicoating the bond strengths of atmospheric plasma versus thermal surface treated and silicate layered ZPTA surfaces were compared with "as-fired" surfaces by utilising TiAlV probes (diameter 6 mm) for traction-adhesive strength tests. After preparing samples for traction-adhesive strength tests (sequence: ceramic substrate, silicate and silane, protective lacquer [PolyMA], bone cement, TiAlV probe) they were aged for up to 150 days at 37 °C in Ringer's solution. The bond strengths observed for all ageing intervals were well above 20 MPa and much higher and more hydrolytically stable for

Cell mechanics and human disease states

NASA Astrophysics Data System (ADS)

Suresh, Subra

2006-03-01

This presentation will provide summary of our very recent studies exploring the effects of biochemical factors, influenced by foreign organisms or in vivo processes, on intracellular structural reorganization, single-cell mechanical response and motility of a population of cells in the context of two human diseases: malaria induced by Plasmodium falciparum merozoites that invade red blood cells, and gastrointestinal cancer metastasis involving epithelial cells. In both cases, particular attention will be devoted to systematic changes induced in specific molecular species in response to controlled alterations in disease state. The role of critical proteins in influencing the mechanical response of human red bloods during the intra-erythrocytic development of P. falciparum merozoites has also been assessed quantitatively using specific protein knock-out experiments by recourse to gene inactivation methods. Single-cell mechanical response characterization entails such tools as optical tweezers and mechanical plate stretchers whereas cell motility assays and cell-population biorheology characterization involves microfluidic channels. The experimental studies are accompanied by three-dimensional computational simulations at the continuum and mesoscopic scales of cell deformation. An outcome of such combined experimental and computational biophysical studies is the realization of how chemical factors influence single-cell mechanical response, cytoadherence, the biorheology of a large population of cells through microchannels representative of in vivo conditions, and the onset and progression of disease states.

DISCOVERY OF THREE NOVEL COCCIDIAN PARASITES INFECTING CALIFORNIA SEA LIONS (ZALOPHUS CALIFORNIANUS), WITH EVIDENCE OF SEXUAL REPLICATION AND INTERSPECIES PATHOGENICITY

PubMed Central

Colegrove, Kathleen M.; Grigg, Michael E.; Carlson-Bremer, Daphne; Miller, Robin H.; Gulland, Frances M. D.; Ferguson, David J. P.; Rejmanek, Daniel; Barr, Bradd C.; Nordhausen, Robert; Melli, Ann C.; Conrad, Patricia A.

2016-01-01

Enteric protozoal infection was identified in 5 stranded California sea lions (Zalophus californianus). Microscopically, the apical cytoplasm of distal jejunal enterocytes contained multiple stages of coccidian parasites, including schizonts with merozoites and spherical gametocytes, which were morphologically similar to coccidians. By histopathology, organisms appeared to be confined to the intestine and accompanied by only mild enteritis. Using electron microscopy, both sexual (microgametocytes, macrogamonts) and asexual (schizonts, merozoites) coccidian stages were identified in enterocytes within parasitophorous vacuoles, consistent with apicomplexan development in a definitive host. Serology was negative for tissue cyst-forming coccidians, and immunohistochemistry for Toxoplasma gondii was inconclusive and negative for Neospora caninum and Sarcocystis neurona. Analysis of ITS-1 gene sequences amplified from frozen or formalin-fixed paraffin-embedded intestinal sections identified DNA sequences with closest homology to Neospora sp. (80%); these novel sequences were referred to as belonging to coccidian parasites ‘‘A,’’ ‘‘B,’’ and ‘‘C.’’ Subsequent molecular analyses completed on a neonatal harbor seal (Phoca vitulina) with protozoal lymphadenitis, hepatitis, myocarditis, and encephalitis showed that it was infected with a coccidian parasite bearing the ‘‘C’’ sequence type. Our results indicate that sea lions likely serve as definitive hosts for 3 newly described coccidian parasites, at least 1 of which is pathogenic in a marine mammal intermediate host species. PMID:21495828

Relationship of wood surface energy to surface composition

Treesearch

Feipeng P. Liu; Timothy G. Rials; John Simonsen

1998-01-01

The wood cell wall is composed of cellulose, lignin, hemicelluloses, and extractives. Thus, the surface energy of the wood material must be some combination of the surface energies of these components. The influence of extractives on wood surface chemistry can be important in diverse industrial applications, such as coating, pulping, and wood-based composites. In this...

Surface tension, surface energy, and chemical potential due to their difference.

PubMed

Hui, C-Y; Jagota, A

2013-09-10

It is well-known that surface tension and surface energy are distinct quantities for solids. Each can be regarded as a thermodynamic property related first by Shuttleworth. Mullins and others have suggested that the difference between surface tension and surface energy cannot be sustained and that the two will approach each other over time. In this work we show that in a single-component system where changes in elastic energy can be neglected, the chemical potential difference between the surface and bulk is proportional to the difference between surface tension and surface energy. By further assuming that mass transfer is driven by this chemical potential difference, we establish a model for the kinetics by which mass transfer removes the difference between surface tension and surface energy.

[Influence of different surface treatments on porcelain surface topography].

PubMed

Tai, Yinxia; Zhu, Xianchun; Sen, Yan; Liu, Chang; Zhang, Xian; Shi, Xueming

2013-02-01

To evaluate the influence of different surface treatments on porcelain surface topography. Metal ceramic prostheses in 6 groups were treated according to the different surface treatment methods, and the surface topography was observed through scanning electron microscope (SEM). Group A was the control one (untreated), group B was etched by 9.6% hydrofluoric acid(HF), group C was deglazed by grinding and then etched by 9.6% HF, group D was treated with Nd: YAG laser irradiation(0.75 W) and HF etching, group E was treated with Nd: YAG laser irradiation (1.05 W) and HF etching, and group F was treated with laser irradiation (1.45 W) and HF etching. Surface topography was different in different groups. A lot of inerratic cracks with the shapes of rhombuses and grid, and crater with a shape of circle were observed on the ceramic surface after treatment with energy parameters of 1.05 W Nd: YAG laser irradiation and 9.6% HF etching (group E). Surface topography showed a lot of concaves on the inner wall of the cracks, and the concaves with diameter of 1-5 microm could be observed on the inner wall of the holes, which had a diameter of 20 microm under SEM. The use of Nd: YAG laser irradiation with the energy parameters of 1.05 W and the HF with a concentration of 9.6% can evenly coarsen the porcelain surface, that is an effective surface treatment method.

Test surfaces useful for calibration of surface profilometers

DOEpatents

Yashchuk, Valeriy V; McKinney, Wayne R; Takacs, Peter Z

2013-12-31

The present invention provides for test surfaces and methods for calibration of surface profilometers, including interferometric and atomic force microscopes. Calibration is performed using a specially designed test surface, or the Binary Pseudo-random (BPR) grating (array). Utilizing the BPR grating (array) to measure the power spectral density (PSD) spectrum, the profilometer is calibrated by determining the instrumental modulation transfer.

What's on the Surface? Physics and Chemistry of Delta-Doped Surfaces

NASA Technical Reports Server (NTRS)

Hoenk, Michael

2011-01-01

Outline of presentation: 1. Detector surfaces and the problem of stability 2. Delta-doped detectors 3. Physics of Delta-doped Silicon 4. Chemistry of the Si-SiO2 Interface 5. Physics and Chemistry of Delta-doped Surfaces a. Compensation b. Inversion c. Quantum exclusion. Conclusions: 1. Quantum confinement of electrons and holes dominates the behavior of delta-doped surfaces. 2. Stability of delta-doped detectors: Delta-layer creates an approx 1 eV tunnel barrier between bulk and surface. 3. At high surface charge densities, Tamm-Shockley states form at the surface. 4. Surface passivation by quantum exclusion: Near-surface delta-layer suppresses T-S trapping of minority carriers. 5. The Si-SiO2 interface compensates the surface 6. For delta-layers at intermediate depth, surface inversion layer forms 7. Density of Si-SiO2 interface charge can be extremely high (>10(exp 14)/sq cm)

Directional Reflective Surface Formed via Gradient-Impeding Acoustic Meta-Surfaces

PubMed Central

Song, Kyungjun; Kim, Jedo; Hur, Shin; Kwak, Jun-Hyuk; Lee, Seong-Hyun; Kim, Taesung

2016-01-01

Artificially designed acoustic meta-surfaces have the ability to manipulate sound energy to an extraordinary extent. Here, we report on a new type of directional reflective surface consisting of an array of sub-wavelength Helmholtz resonators with varying internal coiled path lengths, which induce a reflection phase gradient along a planar acoustic meta-surface. The acoustically reshaped reflective surface created by the gradient-impeding meta-surface yields a distinct focal line similar to a parabolic cylinder antenna, and is used for directive sound beamforming. Focused beam steering can be also obtained by repositioning the source (or receiver) off axis, i.e., displaced from the focal line. Besides flat reflective surfaces, complex surfaces such as convex or conformal shapes may be used for sound beamforming, thus facilitating easy application in sound reinforcement systems. Therefore, directional reflective surfaces have promising applications in fields such as acoustic imaging, sonic weaponry, and underwater communication. PMID:27562634

Strong surfaces, surface skeletons, and image superimposition

NASA Astrophysics Data System (ADS)

Malgouyres, Remy; Fourey, Sebastien

1998-10-01

After having recalled the definition and some local properties of strong surfaces, we present a related new thinning algorithm with surface skeleton and a specific application of these notions to superimposition of images of brains obtained by Magnetic Resonance Image.

Surface segregation and surface tension of polydisperse polymer melts.

PubMed

Minnikanti, Venkatachala S; Qian, Zhenyu; Archer, Lynden A

2007-04-14

The effect of polydispersity on surface segregation of a lower molecular weight polymer component in a higher molecular weight linear polymer melt host is investigated theoretically. We show that the integrated surface excess zM of a polymer component of molecular weight M satisfies a simple relation zM=2Ue(M/Mw-1)phiM, where Mw is the weight averaged molecular weight, phiM is the polymer volume fraction, and Ue is the attraction of polymer chain ends to the surface. Ue is principally of entropic origin, but also reflects any energetic preference of chain ends to the surface. We further show that the surface tension gammaM of a polydisperse melt of high molar mass components depends on the number average degree of polymerization Mn as, gammaM=gammainfinity+2UerhobRT/Mn. The parameter gammainfinity is the asymptotic surface tension of an infinitely long polymer of the same chemistry, rhob is the bulk density of the polymer, R is the universal gas constant, and T is the temperature. The predicted gammaM compare favorably with surface tension values obtained from self-consistent field theory simulations that include equation of state effects, which account for changes in polymer density with molecular weight. We also compare the predicted surface tension with available experimental data.

Particle-Surface Interaction Model and Method of Determining Particle-Surface Interactions

NASA Technical Reports Server (NTRS)

Hughes, David W. (Inventor)

2012-01-01

A method and model of predicting particle-surface interactions with a surface, such as the surface of a spacecraft. The method includes the steps of: determining a trajectory path of a plurality of moving particles; predicting whether any of the moving particles will intersect a surface; predicting whether any of the particles will be captured by the surface and/or; predicting a reflected trajectory and velocity of particles reflected from the surface.

Scanning Surface Potential Microscopy of Spore Adhesion on Surfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ida; Chung, Eunhyea; Kweon, Hyojin

2012-01-01

The adhesion of spores of Bacillus anthracis - the cause of anthrax and a likely biological threat - to solid surfaces is an important consideration in cleanup after an accidental or deliberate release. However, because of safety concerns, directly studying B. anthracis spores with advanced instrumentation is problematic. As a first step, we are examining the electrostatic potential of Bacillus thuringiensis (Bt), which is a closely related species that is often used as a simulant to study B. anthracis. Scanning surface potential microscopy (SSPM), also known as Kelvin probe force microscopy (KPFM), was used to investigate the influence of relativemore » humidity (RH) on the surface electrostatic potential of Bt that had adhered to silica, mica, or gold substrates. AFM/SSPM side-by-side images were obtained separately in air, at various values of RH, after an aqueous droplet with spores was applied on each surface and allowed to dry before measurements. In the SSPM images, a negative potential on the surface of the spores was observed compared with that of the substrates. The surface potential decreased as the humidity increased. Spores were unable to adhere to a surface with an extremely negative potential, such as mica.« less

Charge heterogeneity of surfaces: mapping and effects on surface forces.

PubMed

Drelich, Jaroslaw; Wang, Yu U

2011-07-11

The DLVO theory treats the total interaction force between two surfaces in a liquid medium as an arithmetic sum of two components: Lifshitz-van der Waals and electric double layer forces. Despite the success of the DLVO model developed for homogeneous surfaces, a vast majority of surfaces of particles and materials in technological systems are of a heterogeneous nature with a mosaic structure composed of microscopic and sub-microscopic domains of different surface characteristics. In such systems, the heterogeneity of the surface can be more important than the average surface character. Attractions can be stronger, by orders of magnitude, than would be expected from the classical mean-field DLVO model when area-averaged surface charge or potential is employed. Heterogeneity also introduces anisotropy of interactions into colloidal systems, vastly ignored in the past. To detect surface heterogeneities, analytical tools which provide accurate and spatially resolved information about material surface chemistry and potential - particularly at microscopic and sub-microscopic resolutions - are needed. Atomic force microscopy (AFM) offers the opportunity to locally probe not only changes in material surface characteristic but also charges of heterogeneous surfaces through measurements of force-distance curves in electrolyte solutions. Both diffuse-layer charge densities and potentials can be calculated by fitting the experimental data with a DLVO theoretical model. The surface charge characteristics of the heterogeneous substrate as recorded by AFM allow the charge variation to be mapped. Based on the obtained information, computer modeling and simulation can be performed to study the interactions among an ensemble of heterogeneous particles and their collective motions. In this paper, the diffuse-layer charge mapping by the AFM technique is briefly reviewed, and a new Diffuse Interface Field Approach to colloid modeling and simulation is briefly discussed. Copyright �

Wetting failure of hydrophilic surfaces promoted by surface roughness

PubMed Central

Zhao, Meng-Hua; Chen, Xiao-Peng; Wang, Qing

2014-01-01

Wetting failure is of vital importance to many physical phenomena, such as industrial coating and drop emission. Here we show when and how the surface roughness promotes the destabilization of a moving contact line on a hydrophilic surface. Beyond the balance of the driving force and viscous resistance where a stable wetting interface is sustained, wetting failure occurs and is modified by the roughness of the surface. The promoting effect arises only when the wetting velocity is high enough to create a gas-liquid-solid composite interface in the vicinity of the moving contact line, and it is a function of the intrinsic contact angle and proportion of solid tops. We propose a model to explain splashes of rough solid spheres impacting into liquids. It reveals a novel concept that dynamic wetting on hydrophilic rough surfaces can be similar to that on hydrophobic surfaces, and brings a new way to design surfaces with specific wetting properties. PMID:24948390

Spin-polarized surface resonances accompanying topological surface state formation

DOE PAGES

Jozwiak, Chris; Sobota, Jonathan A.; Gotlieb, Kenneth; ...

2016-10-14

Topological insulators host spin-polarized surface states born out of the energetic inversion of bulk bands driven by the spin-orbit interaction. Here we discover previously unidentified consequences of band-inversion on the surface electronic structure of the topological insulator Bi 2Se 3. By performing simultaneous spin, time, and angle-resolved photoemission spectroscopy, we map the spin-polarized unoccupied electronic structure and identify a surface resonance which is distinct from the topological surface state, yet shares a similar spin-orbital texture with opposite orientation. Its momentum dependence and spin texture imply an intimate connection with the topological surface state. Calculations show these two distinct states canmore » emerge from trivial Rashba-like states that change topology through the spin-orbit-induced band inversion. As a result, this work thus provides a compelling view of the coevolution of surface states through a topological phase transition, enabled by the unique capability of directly measuring the spin-polarized unoccupied band structure.« less

Spin-polarized surface resonances accompanying topological surface state formation

PubMed Central

Jozwiak, Chris; Sobota, Jonathan A.; Gotlieb, Kenneth; Kemper, Alexander F.; Rotundu, Costel R.; Birgeneau, Robert J.; Hussain, Zahid; Lee, Dung-Hai; Shen, Zhi-Xun; Lanzara, Alessandra

2016-01-01

Topological insulators host spin-polarized surface states born out of the energetic inversion of bulk bands driven by the spin-orbit interaction. Here we discover previously unidentified consequences of band-inversion on the surface electronic structure of the topological insulator Bi2Se3. By performing simultaneous spin, time, and angle-resolved photoemission spectroscopy, we map the spin-polarized unoccupied electronic structure and identify a surface resonance which is distinct from the topological surface state, yet shares a similar spin-orbital texture with opposite orientation. Its momentum dependence and spin texture imply an intimate connection with the topological surface state. Calculations show these two distinct states can emerge from trivial Rashba-like states that change topology through the spin-orbit-induced band inversion. This work thus provides a compelling view of the coevolution of surface states through a topological phase transition, enabled by the unique capability of directly measuring the spin-polarized unoccupied band structure. PMID:27739428

How Should Antibodies against P. falciparum Merozoite Antigens Be Measured?

PubMed

Chuangchaiya, Sriwipa; Persson, Kristina E M

2013-01-01

Immunity against malaria develops slowly and only after repeated exposure to the parasite. Many of those that die of the disease are children under five years of age. Antibodies are an important part of immunity, but which antibodies that are protective and how these should be measured are still unclear. We discuss the pros and cons of ELISA, invasion inhibition assays/ADCI, and measurement of affinity of antibodies and what can be done to improve these assays, thereby increasing the knowledge about the immune status of an individual, and to perform better evaluation of vaccine trials.

Periodic minimal surfaces

NASA Astrophysics Data System (ADS)

Mackay, Alan L.

1985-04-01

A minimal surface is one for which, like a soap film with the same pressure on each side, the mean curvature is zero and, thus, is one where the two principal curvatures are equal and opposite at every point. For every closed circuit in the surface, the area is a minimum. Schwarz1 and Neovius2 showed that elements of such surfaces could be put together to give surfaces periodic in three dimensions. These periodic minimal surfaces are geometrical invariants, as are the regular polyhedra, but the former are curved. Minimal surfaces are appropriate for the description of various structures where internal surfaces are prominent and seek to adopt a minimum area or a zero mean curvature subject to their topology; thus they merit more complete numerical characterization. There seem to be at least 18 such surfaces3, with various symmetries and topologies, related to the crystallographic space groups. Recently, glyceryl mono-oleate (GMO) was shown by Longley and McIntosh4 to take the shape of the F-surface. The structure postulated is shown here to be in good agreement with an analysis of the fundamental geometry of periodic minimal surfaces.

Fluoroalkylated Silicon-Containing Surfaces - Estimation of Solid Surface Energy

DTIC Science & Technology

2010-10-20

surface tension liquids such as octane (γlv = 21.6 mN/m) and methanol (γlv = 22.7 mN/m), requires an appropriately chosen surface micro/nano-texture in...addition to a low solid surface energy (γsv). 1H,1H,2H,2H- Heptadecafluorodecyl polyhedral oligomeric silsesquioxane (fluorodecyl POSS) offers one of...27.5 mN/m), while Girifalco-Good analysis was performed using a set of polar and non-polar liquids with a wider range of liquid surface tension (15.5

CELL SURFACE IMMUNOGLOBULIN

PubMed Central

Vitetta, Ellen S.; Uhr, Jonathan W.

1974-01-01

A new method for the detection of cell surface immunoglobulin labeled with isotopic precursors is described. The method consists of the aggregation of surface Ig on cells with specific antibody (heterologous) and the subsequent removal of antigen-antibody complexes by the combination of high speed centrifugation and immunoprecipitation of remaining soluble complexes using antibody to the heterologous Ig. Using this method, the kinetics of appearance of cell surface Ig and its turnover were studied in murine splenocytes. The results suggest that cell surface Ig is synthesized and transported in the same manner as secretory Ig rather than being synthesized on the plasma membrane. The turnover of intracellular and cell surface Ig in lymphocytes is slow. In contrast, intracellular Ig in plasma cells is rapidly secreted and usually without a cell surface phase. Cell surface Ig was shown to be radiolabeled with [3H]glucosamine, -galactose, and -fucose. The proportion of cell surface to intracellular (nonsurface) Ig labeled with these precursors suggests the same sequence of addition of sugars to Ig destined to be on the surface of lymphocytes as with Ig which will be secreted by plasma cells. Results with this new method also confirm earlier conclusions based on experiments using cell surface iodination: 8S IgM is the predominant Ig on the surface of murine splenocytes and the molecule appears to be attached by its µ-chains. PMID:4829935

Antiplasmodial activity of novel keto-enamine chalcone-chloroquine based hybrid pharmacophores.

PubMed

Sashidhara, Koneni V; Kumar, Manoj; Modukuri, Ram K; Srivastava, Rajeev Kumar; Soni, Awakash; Srivastava, Kumkum; Singh, Shiv Vardan; Saxena, J K; Gauniyal, Harsh M; Puri, Sunil K

2012-05-01

A series of novel keto-enamine chalcone-chloroquine based hybrids were synthesized following new methodology developed in our laboratory. The synthesized compounds were screened against chloroquine sensitive strain (3D7) of Plasmodium falciparum in an in vitro model. Some of the compounds were showing comparable antimalarial activity at par with chloroquine. Compounds with significant in vitro antimalarial activity were then evaluated for their in vivo efficacy in Swiss mice against Plasmodium yoelii (chloroquine resistant N-67 strain), wherein compounds 25 and 27 each showed an in vivo suppression of 99.9% parasitaemia on day 4. Biochemical studies reveal that inhibition of hemozoin formation is the primary mechanism of action of these analogues. Copyright © 2012 Elsevier Ltd. All rights reserved.

Surface Modification and Surface - Subsurface Exchange Processes on Europa

NASA Astrophysics Data System (ADS)

Phillips, Cynthia B.; Molaro, Jamie; Hand, Kevin P.

2017-10-01

The surface of Jupiter’s moon Europa is modified by exogenic processes such as sputtering, gardening, radiolysis, sulfur ion implantation, and thermal processing, as well as endogenic processes including tidal shaking, mass wasting, and the effects of subsurface tectonic and perhaps cryovolcanic activity. New materials are created or deposited on the surface (radiolysis, micrometeorite impacts, sulfur ion implantation, cryovolcanic plume deposits), modified in place (thermal segregation, sintering), transported either vertically or horizontally (sputtering, gardening, mass wasting, tectonic and cryovolcanic activity), or lost from Europa completely (sputtering, plumes, larger impacts). Some of these processes vary spatially, as visible in Europa’s leading-trailing hemisphere brightness asymmetry.Endogenic geologic processes also vary spatially, depending on terrain type. The surface can be classified into general landform categories that include tectonic features (ridges, bands, cracks); disrupted “chaos-type” terrain (chaos blocks, matrix, domes, pits, spots); and impact craters (simple, complex, multi-ring). The spatial distribution of these terrain types is relatively random, with some differences in apex-antiapex cratering rates and latitudinal variation in chaos vs. tectonic features.In this work, we extrapolate surface processes and rates from the top meter of the surface in conjunction with global estimates of transport and resurfacing rates. We combine near-surface modification with an estimate of surface-subsurface (and vice versa) transport rates for various geologic terrains based on an average of proposed formation mechanisms, and a spatial distribution of each landform type over Europa’s surface area.Understanding the rates and mass balance for each of these processes, as well as their spatial and temporal variability, allows us to estimate surface - subsurface exchange rates over the average surface age (~50myr) of Europa. Quantifying the

Surface Modification and Surface - Subsurface Exchange Processes on Europa

NASA Astrophysics Data System (ADS)

Phillips, C. B.; Molaro, J.; Hand, K. P.

2017-12-01

The surface of Jupiter's moon Europa is modified by exogenic processes such as sputtering, gardening, radiolysis, sulfur ion implantation, and thermal processing, as well as endogenic processes including tidal shaking, mass wasting, and the effects of subsurface tectonic and perhaps cryovolcanic activity. New materials are created or deposited on the surface (radiolysis, micrometeorite impacts, sulfur ion implantation, cryovolcanic plume deposits), modified in place (thermal segregation, sintering), transported either vertically or horizontally (sputtering, gardening, mass wasting, tectonic and cryovolcanic activity), or lost from Europa completely (sputtering, plumes, larger impacts). Some of these processes vary spatially, as visible in Europa's leading-trailing hemisphere brightness asymmetry. Endogenic geologic processes also vary spatially, depending on terrain type. The surface can be classified into general landform categories that include tectonic features (ridges, bands, cracks); disrupted "chaos-type" terrain (chaos blocks, matrix, domes, pits, spots); and impact craters (simple, complex, multi-ring). The spatial distribution of these terrain types is relatively random, with some differences in apex-antiapex cratering rates and latitudinal variation in chaos vs. tectonic features. In this work, we extrapolate surface processes and rates from the top meter of the surface in conjunction with global estimates of transport and resurfacing rates. We combine near-surface modification with an estimate of surface-subsurface (and vice versa) transport rates for various geologic terrains based on an average of proposed formation mechanisms, and a spatial distribution of each landform type over Europa's surface area. Understanding the rates and mass balance for each of these processes, as well as their spatial and temporal variability, allows us to estimate surface - subsurface exchange rates over the average surface age ( 50myr) of Europa. Quantifying the timescale

Laser surface treatment of pre-prepared Rene 41 surface

NASA Astrophysics Data System (ADS)

Yilbas, B. S.; Akhtar, S.; Karatas, C.

2012-11-01

Laser controlled melting of pre-prepared Rene 41 surface is carried out. A carbon film composing of uniformly distributed 5% TiC carbide particles is formed at the surface prior to laser treatment process. The carbon film provides increased absorption of the incident radiation and facilitates embedding of TiC particles at the surface region of the workpiece during the treatment process. Nitrogen at high pressure is used as assisting gas during the controlled melting. It is found that laser treated layer extents 40 μm below the surface with almost uniform thickness. Fine grains and ultra-short dendrites are formed at the surface region of the laser treated layer. Partially dissolved TiC particles and γ, γ' and γ'N phases are observed in the treated layer.

Surface properties of Ti-6Al-4V alloy part I: Surface roughness and apparent surface free energy.

PubMed

Yan, Yingdi; Chibowski, Emil; Szcześ, Aleksandra

2017-01-01

Titanium (Ti) and its alloys are the most often used implants material in dental treatment and orthopedics. Topography and wettability of its surface play important role in film formation, protein adhesion, following osseointegration and even duration of inserted implant. In this paper, we prepared Ti-6Al-4V alloy samples using different smoothing and polishing materials as well the air plasma treatment, on which contact angles of water, formamide and diiodomethane were measured. Then the apparent surface free energy was calculated using four different approaches (CAH, LWAB, O-W and Neumann's Equation of State). From LWAB approach the components of surface free energy were obtained, which shed more light on the wetting properties of samples surface. The surface roughness of the prepared samples was investigated with the help of optical profilometer and AFM. It was interesting whether the surface roughness affects the apparent surface free energy. It was found that both polar interactions the electron donor parameter of the energy and the work of water adhesion increased with decreasing roughness of the surfaces. Moreover, short time plasma treatment (1min) caused decrease in the surface hydrophilic character, while longer time (10min) treatment caused significant increase in the polar interactions and the work of water adhesion. Although Ti-6Al-4V alloy has been investigated many times, to our knowledge, so far no paper has been published in which surface roughness and changes in the surface free energy of the alloy were compared in the quantitative way in such large extent. This novel approach deliver better knowledge about the surface properties of differently smoothed and polished samples which may be helpful to facilitate cell adhesion, proliferation and mineralization. Therefore the results obtained present also potentially practical meaning. Copyright © 2016 Elsevier B.V. All rights reserved.

Surface oscillation and jetting from surface attached acoustic driven bubbles.

PubMed

Prabowo, Firdaus; Ohl, Claus-Dieter

2011-01-01

We report on an experimental study of the onset of surface oscillation and jetting of bubbles attached to a rigid surface. The driving frequency is 16.27 kHz and the radius of the spherical capped bubble is 160 ± 5 μm. The acoustic amplitude is increased from 0 to 0.085 bar while the oscillation is recorded with a high-speed camera at 180,000 frames/s over 8100 periods of oscillations. The radial and surface modes are analyzed from a Fourier decomposition. With increasing pressure amplitude we find three regimes: pure radial oscillation, development of surface oscillations, and a chaotic surface oscillation regime. These regimes appear abrupt and are repeatable. In the chaotic regime, fast liquid jetting towards the rigid surface is observed. Copyright © 2010 Elsevier B.V. All rights reserved.

Interactive Display of Surfaces Using Subdivision Surfaces and Wavelets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duchaineau, M A; Bertram, M; Porumbescu, S

2001-10-03

Complex surfaces and solids are produced by large-scale modeling and simulation activities in a variety of disciplines. Productive interaction with these simulations requires that these surfaces or solids be viewable at interactive rates--yet many of these surfaced solids can contain hundreds of millions of polygondpolyhedra. Interactive display of these objects requires compression techniques to minimize storage, and fast view-dependent triangulation techniques to drive the graphics hardware. In this paper, we review recent advances in subdivision-surface wavelet compression and optimization that can be used to provide a framework for both compression and triangulation. These techniques can be used to produce suitablemore » approximations of complex surfaces of arbitrary topology, and can be used to determine suitable triangulations for display. The techniques can be used in a variety of applications in computer graphics, computer animation and visualization.« less

Correction of localized shape errors on optical surfaces by altering the localized density of surface or near-surface layers

DOEpatents

Taylor, John S.; Folta, James A.; Montcalm, Claude

2005-01-18

Figure errors are corrected on optical or other precision surfaces by changing the local density of material in a zone at or near the surface. Optical surface height is correlated with the localized density of the material within the same region. A change in the height of the optical surface can then be caused by a change in the localized density of the material at or near the surface.

Surface adhesion and confinement variation of Staphylococcus aurius on SAM surfaces

NASA Astrophysics Data System (ADS)

Amroski, Alicia; Olsen, Morgan; Calabrese, Joseph; Senevirathne, Reshani; Senevirathne, Indrajith

2012-02-01

Controlled surface adhesion of non - pathogenic gram positive strain, Staphylococcus aureus is interesting as a model system due to possible development of respective biosensors for prevention and detection of the pathogenic strain methicillin resistant Staphylococcus aureus (MRSA) and further as a study for bio-machine interfacing. Self Assembled Monolayers (SAM) with engineered surfaces of linear thiols on Au(111) were used as the substrate. Sub cultured S. aureus were used for the analysis. The SAM layered surfaces were dipped in 2 -- 4 Log/ml S. aureus solution. Subsequent surface adhesion at different bacterial dilutions on surfaces will be discussed, and correlated with quantitative and qualitative adhesion properties of bacteria on the engineered SAM surfaces. The bacteria adhered SAM surfaces were investigated using intermittent contact, noncontact, lateral force and contact modes of Atomic Force Microscopy (AFM).

Surface-enhanced chiroptical spectroscopy with superchiral surface waves.

PubMed

Pellegrini, Giovanni; Finazzi, Marco; Celebrano, Michele; Duò, Lamberto; Biagioni, Paolo

2018-07-01

We study the chiroptical properties of one-dimensional photonic crystals supporting superchiral surface waves by introducing a simple formalism based on the Fresnel reflection matrix. We show that the proposed framework provides useful insights on the behavior of all the relevant chiroptical quantities, allowing for a deeper understanding of surface-enhanced chiral sensing platforms based on one-dimensional photonic crystals. Finally, we analyze and discuss the limitations of such platforms as the surface concentration of the target chiral analytes is gradually increased. © 2018 Wiley Periodicals, Inc.

Rhinitis and disseminated disease in a ferret (Mustela putorius furo) naturally infected with Sarcocystis neurona.

PubMed

Britton, Ann P; Dubey, J P; Rosenthal, Benjamin M

2010-04-19

Naturally occurring Sarcocystis neurona infection in a ferret (Mustela putorius furo) with rhinitis and disseminated disease are described for the first time. The ferret exhibited severe rhinitis with intra-lesional S. neurona merozoites and schizonts. Diagnosis was confirmed immunohistochemically by staining with S. neurona-specific antibodies, and by phylogenetic analyses of conserved and variable portions of nuclear ribosomal DNA. On the basis of intense schizogony in the nasal mucosa, we propose the possibility of an olfactory nerve pathway route of infection for S. neurona meningoencephalitis.

Bacteria-surface interactions.

PubMed

Tuson, Hannah H; Weibel, Douglas B

2013-05-14

The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field.

A corrugated perfect magnetic conductor surface supporting spoof surface magnon polaritons.

PubMed

Liu, Liang-liang; Li, Zhuo; Gu, Chang-qing; Ning, Ping-ping; Xu, Bing-zheng; Niu, Zhen-yi; Zhao, Yong-jiu

2014-05-05

In this paper, we demonstrate that spoof surface magnon polaritons (SSMPs) can propagate along a corrugated perfect magnetic conductor (PMC) surface. From duality theorem, the existence of surface electromagnetic modes on corrugated PMC surfaces are manifest to be transverse electric (TE) mode compared with the transverse magnetic (TM) mode of spoof surface plasmon plaritons (SSPPs) excited on corrugated perfect electric conductor surfaces. Theoretical deduction through modal expansion method and simulation results clearly verify that SSMPs share the same dispersion relationship with the SSPPs. It is worth noting that this metamaterial will have more similar properties and potential applications as the SSPPs in large number of areas.

Elliptic surface grid generation on minimal and parmetrized surfaces

NASA Technical Reports Server (NTRS)

Spekreijse, S. P.; Nijhuis, G. H.; Boerstoel, J. W.

1995-01-01

An elliptic grid generation method is presented which generates excellent boundary conforming grids in domains in 2D physical space. The method is based on the composition of an algebraic and elliptic transformation. The composite mapping obeys the familiar Poisson grid generation system with control functions specified by the algebraic transformation. New expressions are given for the control functions. Grid orthogonality at the boundary is achieved by modification of the algebraic transformation. It is shown that grid generation on a minimal surface in 3D physical space is in fact equivalent to grid generation in a domain in 2D physical space. A second elliptic grid generation method is presented which generates excellent boundary conforming grids on smooth surfaces. It is assumed that the surfaces are parametrized and that the grid only depends on the shape of the surface and is independent of the parametrization. Concerning surface modeling, it is shown that bicubic Hermite interpolation is an excellent method to generate a smooth surface which is passing through a given discrete set of control points. In contrast to bicubic spline interpolation, there is extra freedom to model the tangent and twist vectors such that spurious oscillations are prevented.

Surface correlations of hydrodynamic drag for transitionally rough engineering surfaces

NASA Astrophysics Data System (ADS)

Thakkar, Manan; Busse, Angela; Sandham, Neil

2017-02-01

Rough surfaces are usually characterised by a single equivalent sand-grain roughness height scale that typically needs to be determined from laboratory experiments. Recently, this method has been complemented by a direct numerical simulation approach, whereby representative surfaces can be scanned and the roughness effects computed over a range of Reynolds number. This development raises the prospect over the coming years of having enough data for different types of rough surfaces to be able to relate surface characteristics to roughness effects, such as the roughness function that quantifies the downward displacement of the logarithmic law of the wall. In the present contribution, we use simulation data for 17 irregular surfaces at the same friction Reynolds number, for which they are in the transitionally rough regime. All surfaces are scaled to the same physical roughness height. Mean streamwise velocity profiles show a wide range of roughness function values, while the velocity defect profiles show a good collapse. Profile peaks of the turbulent kinetic energy also vary depending on the surface. We then consider which surface properties are important and how new properties can be incorporated into an empirical model, the accuracy of which can then be tested. Optimised models with several roughness parameters are systematically developed for the roughness function and profile peak turbulent kinetic energy. In determining the roughness function, besides the known parameters of solidity (or frontal area ratio) and skewness, it is shown that the streamwise correlation length and the root-mean-square roughness height are also significant. The peak turbulent kinetic energy is determined by the skewness and root-mean-square roughness height, along with the mean forward-facing surface angle and spanwise effective slope. The results suggest feasibility of relating rough-wall flow properties (throughout the range from hydrodynamically smooth to fully rough) to surface

Upscaling and Downscaling of Land Surface Fluxes with Surface Temperature

NASA Astrophysics Data System (ADS)

Kustas, W. P.; Anderson, M. C.; Hain, C.; Albertson, J. D.; Gao, F.; Yang, Y.

2015-12-01

Land surface temperature (LST) is a key surface boundary condition that is significantly correlated to surface flux partitioning between latent and sensible heat. The spatial and temporal variation in LST is driven by radiation, wind, vegetation cover and roughness as well as soil moisture status in the surface and root zone. Data from airborne and satellite-based platforms provide LST from ~10 km to sub meter resolutions. A land surface scheme called the Two-Source Energy Balance (TSEB) model has been incorporated into a multi-scale regional modeling system ALEXI (Atmosphere Land Exchange Inverse) and a disaggregation scheme (DisALEXI) using higher resolution LST. Results with this modeling system indicates that it can be applied over heterogeneous land surfaces and estimate reliable surface fluxes with minimal in situ information. Consequently, this modeling system allows for scaling energy fluxes from subfield to regional scales in regions with little ground data. In addition, the TSEB scheme has been incorporated into a large Eddy Simulation (LES) model for investigating dynamic interactions between variations in the land surface state reflected in the spatial pattern in LST and the lower atmospheric air properties affecting energy exchange. An overview of research results on scaling of fluxes and interactions with the lower atmosphere from the subfield level to regional scales using the TSEB, ALEX/DisALEX and the LES-TSEB approaches will be presented. Some unresolved issues in the use of LST at different spatial resolutions for estimating surface energy balance and upscaling fluxes, particularly evapotranspiration, will be discussed.

Surface Habitat Systems

NASA Technical Reports Server (NTRS)

Kennedy, Kriss J.

2009-01-01

The Surface Habitat Systems (SHS) Focused Investment Group (FIG) is part of the National Aeronautics and Space Administration (NASA) Johnson Space Center (JSC) effort to provide a focused direction and funding to the various projects that are working on human surface habitat designs and technologies for the planetary exploration missions. The overall SHS-FIG effort focuses on directing and guiding those projects that: 1) develop and demonstrate new surface habitat system concepts, innovations, and technologies to support human exploration missions, 2) improve environmental systems that interact with human habitats, 3) handle and emplace human surface habitats, and 4) focus on supporting humans living and working in habitats on planetary surfaces. The activity areas of the SHS FIG described herein are focused on the surface habitat project near-term objectives as described in this document. The SHS-FIG effort focuses on mitigating surface habitat risks (as identified by the Lunar Surface Systems Project Office (LSSPO) Surface Habitat Element Team; and concentrates on developing surface habitat technologies as identified in the FY08 gap analysis. The surface habitat gap assessment will be updated annually as the surface architecture and surface habitat definition continues to mature. These technologies are mapped to the SHS-FIG Strategic Development Roadmap. The Roadmap will bring to light the areas where additional innovative efforts are needed to support the development of habitat concepts and designs and the development of new technologies to support of the LSSPO Habitation Element development plan. Three specific areas of development that address Lunar Architecture Team (LAT)-2 and Constellation Architecture Team (CxAT) Lunar habitat design issues or risks will be focused on by the SHS-FIG. The SHS-FIG will establish four areas of development that will help the projects prepare in their planning for surface habitat systems development. Those development areas are

VALIDATION OF MICROSATELLITE MARKERS FOR USE IN GENOTYPING POLYCLONAL PLASMODIUM FALCIPARUM INFECTIONS

PubMed Central

GREENHOUSE, BRYAN; MYRICK, ALISSA; DOKOMAJILAR, CHRISTIAN; WOO, JONATHAN M.; CARLSON, ELAINE J.; ROSENTHAL, PHILIP J.; DORSEY, GRANT

2006-01-01

Genotyping methods for Plasmodium falciparum drug efficacy trials have not been standardized and may fail to accurately distinguish recrudescence from new infection, especially in high transmission areas where polyclonal infections are common. We developed a simple method for genotyping using previously identified microsatellites and capillary electrophoresis, validated this method using mixtures of laboratory clones, and applied the method to field samples. Two microsatellite markers produced accurate results for single-clone but not polyclonal samples. Four other microsatellite markers were as sensitive as, and more specific than, commonly used genotyping techniques based on merozoite surface proteins 1 and 2. When applied to samples from 15 patients in Burkina Faso with recurrent parasitemia after treatment with sulphadoxine-pyrimethamine, the addition of these four microsatellite markers to msp1 and msp2 genotyping resulted in a reclassification of outcomes that strengthened the association between dhfr 59R, an anti-folate resistance mutation, and recrudescence (P = 0.31 versus P = 0.03). Four microsatellite markers performed well on polyclonal samples and may provide a valuable addition to genotyping for clinical drug efficacy studies in high transmission areas. PMID:17123974

Plasmodium falciparum Malaria in the Peruvian Amazon, a Region of Low Transmission, Is Associated with Immunologic Memory

PubMed Central

Clark, Eva H.; Silva, Claudia J.; Weiss, Greta E.; Li, Shanping; Padilla, Carlos; Crompton, Peter D.; Hernandez, Jean N.

2012-01-01

The development of clinical immunity to Plasmodium falciparum malaria is thought to require years of parasite exposure, a delay often attributed to difficulties in developing protective antibody levels. In this study, we evaluated several P. falciparum vaccine candidate antigens, including apical membrane antigen 1 (AMA-1), circumsporozoite protein (CSP), erythrocyte binding antigen 175 (EBA-175), and the 19-kDa region of merozoite surface protein 1 (MSP119). After observing a more robust antibody response to MSP119, we evaluated the magnitude and longevity of IgG responses specific to this antigen in Peruvian adults and children before, during, and after P. falciparum infection. In this low-transmission region, even one reported prior infection was sufficient to produce a positive anti-MSP119 IgG response for >5 months in the absence of reinfection. We also observed an expansion of the total plasmablast (CD19+ CD27+ CD38high) population in the majority of individuals shortly after infection and detected MSP1-specific memory B cells in a subset of individuals at various postinfection time points. This evidence supports our hypothesis that effective antimalaria humoral immunity can develop in low-transmission regions. PMID:22252876

Plasmodium falciparum malaria in the Peruvian Amazon, a region of low transmission, is associated with immunologic memory.

PubMed

Clark, Eva H; Silva, Claudia J; Weiss, Greta E; Li, Shanping; Padilla, Carlos; Crompton, Peter D; Hernandez, Jean N; Branch, OraLee H

2012-04-01

The development of clinical immunity to Plasmodium falciparum malaria is thought to require years of parasite exposure, a delay often attributed to difficulties in developing protective antibody levels. In this study, we evaluated several P. falciparum vaccine candidate antigens, including apical membrane antigen 1 (AMA-1), circumsporozoite protein (CSP), erythrocyte binding antigen 175 (EBA-175), and the 19-kDa region of merozoite surface protein 1 (MSP1(19)). After observing a more robust antibody response to MSP1(19), we evaluated the magnitude and longevity of IgG responses specific to this antigen in Peruvian adults and children before, during, and after P. falciparum infection. In this low-transmission region, even one reported prior infection was sufficient to produce a positive anti-MSP1(19) IgG response for >5 months in the absence of reinfection. We also observed an expansion of the total plasmablast (CD19(+) CD27(+) CD38(high)) population in the majority of individuals shortly after infection and detected MSP1-specific memory B cells in a subset of individuals at various postinfection time points. This evidence supports our hypothesis that effective antimalaria humoral immunity can develop in low-transmission regions.

Asymptomatic infection in individuals from the municipality of Barcelos (Brazilian Amazon) is not associated with the anti-Plasmodium falciparum glycosylphosphatidylinositol antibody response

PubMed Central

Gomes, Larissa Rodrigues; Totino, Paulo Renato Rivas; Sanchez, Maria Carmen Arroyo; Daniel, Elsa Paula da Silva Kaingona; de Macedo, Cristiana Santos; Fortes, Filomeno; Coura, José Rodrigues; Santi, Silvia Maria Di; Werneck, Guilherme Loureiro; Suárez-Mutis, Martha Cecilia; Ferreira-da-Cruz, Maria de Fátima; Daniel-Ribeiro, Cláudio Tadeu

2013-01-01

Anti-glycosylphosphatidylinositol (GPI) antibodies (Abs) may reflect and mediate, at least partially, anti-disease immunity in malaria by neutralising the toxic effect of parasitic GPI. Thus, we assessed the anti-GPI Ab response in asymptomatic individuals living in an area of the Brazilian Amazon that has a high level of malaria transmission. For comparative purposes, we also investigated the Ab response to a crude extract prepared from Plasmodium falciparum, the merozoite surface protein (MSP)3 antigen of P. falciparum and the MSP 1 antigen of Plasmodium vivax (PvMSP1-19) in these individuals and in Angolan patients with acute malaria. Our data suggest that the Ab response against P. falciparum GPI is not associated with P. falciparum asymptomatic infection in individuals who have been chronically exposed to malaria in the Brazilian Amazon. However, this Ab response could be related to ongoing parasitaemia (as was previously shown) in the Angolan patients. In addition, our data show that PvMSP1-19may be a good marker antigen to reflect previous exposure to Plasmodium in areas that have a high transmission rate of P. vivax. PMID:24037204

α-Thalassaemia trait is associated with antibody prevalence against malaria antigens AMA-1 and MSP-1.

PubMed

Daou, Modibo; Kituma, Elimsaada; Kavishe, Reginald; Chilongola, Jaffu; Mosha, Frank; van der Ven, André; Kouriba, Bourema; Bousema, Teun; Sauerwein, Robert; Doumbo, Ogobaro

2015-04-01

A longitudinal study was conducted in a low endemic area in northern Tanzania to examine the influence of the α-thalassaemia trait on malaria incidence and antibody responses to malaria apical membrane antigen-1 (AMA-1) and merozoite surface protein1-19 (MSP-119). Out of 394 children genotyped for α-thalassaemia trait, 4.1% (16 of 394) and 30.7% (121 of 394) were homozygous and heterozygous, respectively. During the 1 year follow-up, four incidents of malaria cases were detected without an evident association with α-thalassaemia. Being heterozygous or homozygous for α-thalassaemia was associated with an increased prevalence of antibodies to AMA-1 [odds ratio (OR): 1.83, 95% confidence interval (CI): 1.07-3.12, p = 0.027] and MSP-1 (OR: 2.04, 95% CI: 1.16-3.60, p = 0.013) after adjustment for age and reported bednet use. The observed association between α-thalassaemia and malaria antibody responses may reflect longer-term differences in antigen exposure or differences in antibody acquisition upon exposure in this low endemic setting. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Malaria in pregnant Cameroonian women: the effect of age and gravidity on submicroscopic and mixed-species infections and multiple parasite genotypes.

PubMed

Walker-Abbey, Annie; Djokam, Rosine R T; Eno, Anna; Leke, Rose F G; Titanji, Vincent P K; Fogako, Josephine; Sama, Grace; Thuita, Lucy H; Beardslee, Eliza; Snounou, Georges; Zhou, Ainong; Taylor, Diane Wallace

2005-03-01

Polymerase chain reaction (PCR)-based methods were used to investigate malaria in pregnant women residing in Yaounde, Cameroon. Microscopy and species-specific PCR-based diagnosis show that at delivery 82.4% of the women were infected with Plasmodium falciparum (27.5% blood-smear positive and 54.9% submicroscopic infections). The prevalence of P. malariae and P. ovale was 7.6% and 2.5%, respectively, with 9.4% infected with more than one species. Based on genotyping of the merozoite surface protein 1 (msp-1) and msp-2 alleles, the mean number of genetically different P. falciparum parasites in peripheral blood was 3.4 (range = 1-9) and 3.5 (range 1-8) in the placenta. Plasmodium falciparum detected by microscopy and PCR as well as mixed-species infections were significantly higher in women < or = 20 years old and paucigravidae, but maternal anemia was associated only with microscopic detection of parasites. Neither submicroscopic infections nor number of parasite genotypes decreased significantly with age or gravidity. Thus, pregnancy-associated immunity helps reduce malaria to submicroscopic levels, but does not reduce the number of circulating parasite genotypes.

A Smart Superwetting Surface with Responsivity in Both Surface Chemistry and Microstructure.

PubMed

Zhang, Dongjie; Cheng, Zhongjun; Kang, Hongjun; Yu, Jianxin; Liu, Yuyan; Jiang, Lei

2018-03-26

Recently, smart surfaces with switchable wettability have aroused much attention. However, only single surface chemistry or the microstructure can be changed on these surfaces, which significantly limits their wetting performances, controllability, and applications. A new surface with both tunable surface microstructure and chemistry was prepared by grafting poly(N-isopropylacrylamide) onto the pillar-structured shape memory polymer on which multiple wetting states from superhydrophilicity to superhydrophobicity can be reversibly and precisely controlled by synergistically regulating the surface microstructure and chemistry. Meanwhile, based on the excellent controllability, we also showed the application of the surface as a rewritable platform, and various gradient wettings can be obtained. This work presents for the first time a surface with controllability in both surface chemistry and microstructure, which starts some new ideas for the design of novel superwetting materials. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Laser-induced periodic annular surface structures on fused silica surface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yi; Brelet, Yohann; Forestier, Benjamin

2013-06-24

We report on the formation of laser-induced periodic annular surface structures on fused silica irradiated with multiple femtosecond laser pulses. This surface morphology emerges after the disappearance of the conventional laser induced periodic surface structures, under successive laser pulse irradiation. It is independent of the laser polarization and universally observed for different focusing geometries. We interpret its formation in terms of the interference between the reflected laser field on the surface of the damage crater and the incident laser pulse.

Corrosion prevention of magnesium surfaces via surface conversion treatments using ionic liquids

DOEpatents

Qu, Jun; Luo, Huimin

2016-09-06

A method for conversion coating a magnesium-containing surface, the method comprising contacting the magnesium-containing surface with an ionic liquid compound under conditions that result in decomposition of the ionic liquid compound to produce a conversion coated magnesium-containing surface having a substantially improved corrosion resistance relative to the magnesium-containing surface before said conversion coating. Also described are the resulting conversion-coated magnesium-containing surface, as well as mechanical components and devices containing the conversion-coated magnesium-containing surface.

'The surface management system' (SuMS) database: a surface-based database to aid cortical surface reconstruction, visualization and analysis

NASA Technical Reports Server (NTRS)

Dickson, J.; Drury, H.; Van Essen, D. C.

2001-01-01

Surface reconstructions of the cerebral cortex are increasingly widely used in the analysis and visualization of cortical structure, function and connectivity. From a neuroinformatics perspective, dealing with surface-related data poses a number of challenges. These include the multiplicity of configurations in which surfaces are routinely viewed (e.g. inflated maps, spheres and flat maps), plus the diversity of experimental data that can be represented on any given surface. To address these challenges, we have developed a surface management system (SuMS) that allows automated storage and retrieval of complex surface-related datasets. SuMS provides a systematic framework for the classification, storage and retrieval of many types of surface-related data and associated volume data. Within this classification framework, it serves as a version-control system capable of handling large numbers of surface and volume datasets. With built-in database management system support, SuMS provides rapid search and retrieval capabilities across all the datasets, while also incorporating multiple security levels to regulate access. SuMS is implemented in Java and can be accessed via a Web interface (WebSuMS) or using downloaded client software. Thus, SuMS is well positioned to act as a multiplatform, multi-user 'surface request broker' for the neuroscience community.

Surface optical vortices

NASA Astrophysics Data System (ADS)

Lembessis, V. E.; Babiker, M.; Andrews, D. L.

2009-01-01

It is shown how the total internal reflection of orbital-angular-momentum-endowed light can lead to the generation of evanescent light possessing rotational properties in which the intensity distribution is firmly localized in the vicinity of the surface. The characteristics of these surface optical vortices depend on the form of the incident light and on the dielectric mismatch of the two media. The interference of surface optical vortices is shown to give rise to interesting phenomena, including pattern rotation akin to a surface optical Ferris wheel. Applications are envisaged to be in atom lithography, optical surface tweezers, and spanners.

Identification of candidate vaccine antigens of bovine hemoparasites Theileria parva and Babesia bovis by use of helper T cell clones.

PubMed

Brown, W C; Zhao, S; Logan, K S; Grab, D J; Rice-Ficht, A C

1995-03-01

Current vaccines for bovine hemoparasites utilize live attenuated organisms or virulent organisms administered concurrently with antiparasitic drugs. Although such vaccines can be effective, for most hemoparasites the mechanisms of acquired resistance to challenge infection with heterologous parasite isolates have not been clearly defined. Selection of potentially protective antigens has traditionally made use of antibodies to identify immunodominant proteins. However, numerous studies have indicated that induction of high antibody titers neither predicts the ability of an antigen to confer protective immunity nor correlates with protection. Because successful parasites have evolved antibody evasion tactics, alternative strategies to identify protective immunogens should be used. Through the elaboration of cytokines, T helper 1-(Th1)-like T cells and macrophages mediate protective immunity against many intracellular parasites, and therefore most likely play an important role in protective immunity against bovine hemoparasites. CD4+ T cell clones specific for soluble or membrane antigens of either Theileria parva schizonts or Babesia bovis merozoites were therefore employed to identify parasite antigens that elicit strong Th cell responses in vitro. Soluble cytosolic parasite antigen was fractionated by gel filtration, anion exchange chromatography or hydroxylapatite chromatography, or a combination thereof, and fractions were tested for the ability to induce proliferation of Th cell clones. This procedure enabled the identification of stimulatory fractions containing T. parva proteins of approximately 10 and 24 kDa. Antisera raised against the purified 24 kDa band reacted with a native schizont protein of approximately 30 kDa. Babesia bovis-specific Th cell clones tested against fractionated soluble Babesia bovis merozoite antigen revealed the presence of at least five distinct antigenic epitopes. Proteins separated by gel filtration revealed four patterns of

Rough-surface model for surface temperature calculations on Vesta

NASA Astrophysics Data System (ADS)

Palmer, E.; Sykes, M.

2014-07-01

We model observations by the Dawn Visual and Infrared spectrometer (VIR) [1] to reproduce the observed surface temperature of Vesta. The VIR instrument has collected over 3,700 spectral cubes of Vesta out to 5.1 microns. The observed surface temperature is derived by matching the irradiance near 5 microns with a grey body, the Planck function after removing a reflected-light component per previous procedures [2--5] with similar results. We noted that the observed surface temperatures are significantly hotter than what simple theoretical models would predict [2]. To better understand this, we used a high-resolution topographic model of Vesta [6] that provided exact phase, incidence, and emission angles for every VIR pixel. We assume an emissivity of 0.9, Bond albedo of between 0.16 and 0.22 [5], and a variety of thermal inertia values for a low-contrast, highly degraded, homogenous crater. We have created a ''rough-surface'' thermal model that takes into account how irregular grains create sub-pixel variations in the thermal spectrum and describe the effect it has on the observed surface temperatures of Vesta. We have applied this method to the VIR observations of Vesta, which produced a high level of agreement with the observed surface temperatures.

Atomic force microscopy analysis of different surface treatments of Ti dental implant surfaces

NASA Astrophysics Data System (ADS)

Bathomarco, Ti R. V.; Solorzano, G.; Elias, C. N.; Prioli, R.

2004-06-01

The surface of commercial unalloyed titanium, used in dental implants, was analyzed by atomic force microscopy. The morphology, roughness, and surface area of the samples, submitted to mechanically-induced erosion, chemical etching and a combination of both, were compared. The results show that surface treatments strongly influence the dental implant physical and chemical properties. An analysis of the length dependence of the implant surface roughness shows that, for scan sizes larger than 50 μm, the average surface roughness is independent of the scanning length and that the surface treatments lead to average surface roughness in the range of 0.37 up to 0.48 μm. It is shown that the implant surface energy is sensitive to the titanium surface area. As the area increases there is a decrease in the surface contact angle.

Solid surface vs. liquid surface: nanoarchitectonics, molecular machines, and DNA origami.

PubMed

Ariga, Katsuhiko; Mori, Taizo; Nakanishi, Waka; Hill, Jonathan P

2017-09-13

The investigation of molecules and materials at interfaces is critical for the accumulation of new scientific insights and technological advances in the chemical and physical sciences. Immobilization on solid surfaces permits the investigation of different properties of functional molecules or materials with high sensitivity and high spatial resolution. Liquid surfaces also present important media for physicochemical innovation and insight based on their great flexibility and dynamicity, rapid diffusion of molecular components for mixing and rearrangements, as well as drastic spatial variation in the prevailing dielectric environment. Therefore, a comparative discussion of the relative merits of the properties of materials when positioned at solid or liquid surfaces would be informative regarding present-to-future developments of surface-based technologies. In this perspective article, recent research examples of nanoarchitectonics, molecular machines, DNA nanotechnology, and DNA origami are compared with respect to the type of surface used, i.e. solid surfaces vs. liquid surfaces, for future perspectives of interfacial physics and chemistry.

Sample-Based Surface Coloring

PubMed Central

Bürger, Kai; Krüger, Jens; Westermann, Rüdiger

2011-01-01

In this paper, we present a sample-based approach for surface coloring, which is independent of the original surface resolution and representation. To achieve this, we introduce the Orthogonal Fragment Buffer (OFB)—an extension of the Layered Depth Cube—as a high-resolution view-independent surface representation. The OFB is a data structure that stores surface samples at a nearly uniform distribution over the surface, and it is specifically designed to support efficient random read/write access to these samples. The data access operations have a complexity that is logarithmic in the depth complexity of the surface. Thus, compared to data access operations in tree data structures like octrees, data-dependent memory access patterns are greatly reduced. Due to the particular sampling strategy that is employed to generate an OFB, it also maintains sample coherence, and thus, exhibits very good spatial access locality. Therefore, OFB-based surface coloring performs significantly faster than sample-based approaches using tree structures. In addition, since in an OFB, the surface samples are internally stored in uniform 2D grids, OFB-based surface coloring can efficiently be realized on the GPU to enable interactive coloring of high-resolution surfaces. On the OFB, we introduce novel algorithms for color painting using volumetric and surface-aligned brushes, and we present new approaches for particle-based color advection along surfaces in real time. Due to the intermediate surface representation we choose, our method can be used to color polygonal surfaces as well as any other type of surface that can be sampled. PMID:20616392

Influence of betaine and salinomycin on intestinal absorption of methionine and glucose and on the ultrastructure of intestinal cells and parasite developmental stages in chicks infected with Eimeria acervulina.

PubMed

Augustine, P C; Danforth, H D

1999-01-01

The effect of betaine and salinomycin on absorption of methionine and glucose in tissue from the duodenal loops of Eimeria acervulina-infected chicks was determined. Differences in the ultrastructure of the intestinal cells and parasite developmental stages were also examined. With a drug-resistant isolate of E. acervulina, methionine absorption was significantly higher in chicks fed a basal diet supplemented with 0.15% betaine as compared with absorption in chicks fed the unsupplemented basal diet. Addition of 66 ppm salinomycin to the diet containing betaine did not further enhance absorption. Conversely, with a drug-sensitive isolate, methionine absorption was significantly higher in chicks fed a diet supplemented with both betaine and salinomycin than in chicks fed the unsupplemented basal diet. Tissue from chicks fed any of the supplemented diets was usually significantly heavier than that from chicks fed the unsupplemented diet, even when weight gains of the birds were similar. Glucose absorption was similar in all diet groups. Epithelial cells in coccidia-infected and uninfected chicks fed diets supplemented with betaine or betaine plus salinomycin were less electron dense than cells from chicks fed diets that were not supplemented with betaine. Merozoites of E. acervulina in chicks fed diets supplemented with salinomycin had extensive membrane disruption and vacuolization, but the damage was prevented when betaine was added to the diet. Numerous merozoites and intact schizonts were seen in the intestinal lumen of chicks fed the diet containing betaine plus salinomycin.

Re-evaluation of the life cycle of Eimeria maxima Tyzzer, 1929 in chickens (Gallus domesticus).

PubMed

Dubey, J P; Jenkins, M C

2017-12-14

A time-course study was conducted to resolve discrepancies in the literature and better define aspects of the Eimeria maxima life cycle such, as sites of development and both morphology and number of asexual stages. Broiler chickens were inoculated orally with five million E. maxima oocysts (APU1), and were necropsied at regular intervals from 12 to 120 h p.i. Small intestine tissue sections and smears were examined for developmental stages. The jejunum contained the highest numbers of developmental stages. At 12 h p.i., sporozoites were observed inside a parasitophorous vacuole (PV) in the epithelial villi and the lamina propria. By 24 h, sporozoites enclosed by a PV were observed in enterocytes of the glands of Lieberkühn. At 48 h p.i., sporozoites, elongated immature and mature schizonts, were all seen in the glands with merozoites budding off from a residual body. By 60 h, second-generation, sausage-shaped schizonts containing up to 12 merozoites were observed around a residual body in the villar tip of invaded enterocytes. At 72 and 96 h, profuse schizogony associated with third- and fourth-generation schizonts was observed throughout the villus. At 120 h, another generation (fifth) of schizonts were seen in villar tips as well as in subepithelium where gamonts and oocysts were also present; a few gamonts were in epithelium. Our finding of maximum parasitization of E. maxima in jejunum is important because this region is critical for nutrient absorption and weight gain.

Measurement of surface tension by sessile drop tensiometer with superoleophobic surface

NASA Astrophysics Data System (ADS)

Kwak, Wonshik; Park, Jun Kwon; Yoon, Jinsung; Lee, Sanghyun; Hwang, Woonbong

2018-03-01

A sessile drop tensiometer provides a simple and efficient method of determining the surface tension of various liquids. The technique involves obtaining the shape of an axisymmetric liquid droplet and iterative fitting of the Young-Laplace equation, which balances the gravitational deformation of the drop. Since the advent of high quality digital cameras and desktop computers, this process has been automated with precision. However, despite its appealing simplicity, there are complications and limitations in a sessile drop tensiometer, i.e., it must dispense spherical droplets with low surface tension. We propose a method of measuring surface tension using a sessile drop tensiometer with a superoleophobic surface fabricated by acidic etching and anodization for liquids with low surface tension and investigate the accuracy of the measurement by changing the wettability of the measuring plate surface.

Characterizing the effects of regolith surface roughness on photoemission from surfaces in space

NASA Astrophysics Data System (ADS)

Dove, A.; Horanyi, M.; Wang, X.

2017-12-01

Surfaces of airless bodies and spacecraft in space are exposed to a variety of charging environments. A balance of currents due to plasma bombardment, photoemission, electron and ion emission and collection, and secondary electron emission determines the surface's charge. Photoelectron emission is the dominant charging process on sunlit surfaces in the inner solar system due to the intense solar UV radiation. This can result in a net positive surface potential, with a cloud of photoelectrons immediately above the surface, called the photoelectron sheath. Conversely, the unlit side of the body will charge negatively due the collection of the fast-moving solar wind electrons. The interaction of charged dust grains with these positively and negatively charged surfaces, and within the photoelectron and plasma sheaths may explain the occurrence of dust lofting, levitation and transport above the lunar surface. The surface potential of exposed objects is also dependent on the material properties of their surfaces. Composition and particle size primarily affect the quantum efficiency of photoelectron generation; however, surface roughness can also control the charging process. In order to characterize these effects, we have conducted laboratory experiments to examine the role of surface roughness in generating photoelectrons in dedicated laboratory experiments using solid and dusty surfaces of the same composition (CeO2), and initial comparisons with JSC-1 lunar simulant. Using Langmuir probe measurements, we explore the measured potentials above insulating surfaces exposed to UV and an electric field, and we show that the photoemission current from a dusty surface is largely reduced due to its higher surface roughness, which causes a significant fraction of the emitted photoelectrons to be re-absorbed within the surface. We will discuss these results in context of similar situations on planetary surfaces.

Surface elastic wave detectors

NASA Technical Reports Server (NTRS)

Lawson, R. L.

1971-01-01

The potential applications of acoustic surface wave technology to multiplex communication systems such as data-bus, are examined. The goals are primarily to characterize certain aspects of surface wave trapped delay lines, surface wave modulation techniques, and surface wave applications that are relevant to the evaluation of surface wave devices in multiplex systems. The results indicate that there is a potential for the application of surface wave technology in data-bus type systems.

Effect of Shot Peening in Different Shot Distance and Shot Angle on Surface Morphology, Surface Roughness and Surface Hardness of 316L Biomaterial

NASA Astrophysics Data System (ADS)

Umbu Kondi Maliwemu, Erich; Malau, Viktor; Iswanto, Priyo Tri

2018-01-01

Shot peening is a mechanical surface treatment with a beneficial effect to generate compressive residual stress caused by plastic deformation on the surface of material. This plastic deformation can improve the surface characteristics of metallic materials, such as modification of surface morphology, surface roughness, and surface hardness. The objective of this study is to investigate the effect of shot peening in different shot distance and shot angle on surface morphology, surface roughness, and surface hardness of 316L biomaterial. Shot distance was varied at 6, 8, 10, and 12 cm and shot angle at 30, 60, and 90°, working pressure at 7 kg/cm2, shot duration for 20 minutes, and using steel balls S-170 with diameter of 0.6 mm. The results present that the shot distance and shot angle of shot peening give the significant effect to improve the surface morphology, surface roughness, and surface hardness of 316 L biomaterial. Shot peening can increase the surface roughness by the increasing of shot distance and by the decreasing of shot angle. The nearest shot distance (6 cm) and the largest shot angle (90°) give the best results on the grain refinement with the surface roughness of 1.04 μm and surface hardness of 534 kg/mm2.

A scheme for computing surface layer turbulent fluxes from mean flow surface observations

NASA Technical Reports Server (NTRS)

Hoffert, M. I.; Storch, J.

1978-01-01

A physical model and computational scheme are developed for generating turbulent surface stress, sensible heat flux and humidity flux from mean velocity, temperature and humidity at some fixed height in the atmospheric surface layer, where conditions at this reference level are presumed known from observations or the evolving state of a numerical atmospheric circulation model. The method is based on coupling the Monin-Obukov surface layer similarity profiles which include buoyant stability effects on mean velocity, temperature and humidity to a force-restore formulation for the evolution of surface soil temperature to yield the local values of shear stress, heat flux and surface temperature. A self-contained formulation is presented including parameterizations for solar and infrared radiant fluxes at the surface. Additional parameters needed to implement the scheme are the thermal heat capacity of the soil per unit surface area, surface aerodynamic roughness, latitude, solar declination, surface albedo, surface emissivity and atmospheric transmissivity to solar radiation.

Sea Surface Scanner: An advanced catamaran to study the sea surface

NASA Astrophysics Data System (ADS)

Wurl, O.; Mustaffa, N. I. H.; Ribas Ribas, M.

2016-02-01

The Sea Surface Scanner is a remote-controlled catamaran with the capability to sample the sea-surface microlayer in high resolution. The catamaran is equipped with a suite of sensors to scan the sea surface on chemical, biological and physical parameters. Parameters include UV absorption, fluorescence spectra, chlorophyll-a, photosynthetic efficiency, chromophoric dissolved organic matter (CDOM), dissolved oxygen, pH, temperature, and salinity. A further feature is a capability to collect remotely discrete water samples for detailed lab analysis. We present the first high-resolution (< 30 sec) data on the sea surface microlayer. We discuss the variability of biochemical properties of the sea surface and its implication on air-sea interaction.

Mechanics of active surfaces

NASA Astrophysics Data System (ADS)

Salbreux, Guillaume; Jülicher, Frank

2017-09-01

We derive a fully covariant theory of the mechanics of active surfaces. This theory provides a framework for the study of active biological or chemical processes at surfaces, such as the cell cortex, the mechanics of epithelial tissues, or reconstituted active systems on surfaces. We introduce forces and torques acting on a surface, and derive the associated force balance conditions. We show that surfaces with in-plane rotational symmetry can have broken up-down, chiral, or planar-chiral symmetry. We discuss the rate of entropy production in the surface and write linear constitutive relations that satisfy the Onsager relations. We show that the bending modulus, the spontaneous curvature, and the surface tension of a passive surface are renormalized by active terms. Finally, we identify active terms which are not found in a passive theory and discuss examples of shape instabilities that are related to active processes in the surface.

Surface Conductive Glass.

ERIC Educational Resources Information Center

Tanaka, John; Suib, Steven L.

1984-01-01

Discusses the properties of surface-conducting glass and the chemical nature of surface-conducting stannic (tin) oxide. Also provides the procedures necessary for the preparation of surface-conducting stannic oxide films on glass substrates. The experiment is suitable for the advanced inorganic chemistry laboratory. (JN)

Surface functionalization of dopamine coated iron oxide nanoparticles for various surface functionalities

NASA Astrophysics Data System (ADS)

Sherwood, Jennifer; Xu, Yaolin; Lovas, Kira; Qin, Ying; Bao, Yuping

2017-04-01

We present effective conjugation of four small molecules (glutathione, cysteine, lysine, and Tris(hydroxymethyl)aminomethane) onto dopamine-coated iron oxide nanoparticles. Conjugation of these molecules could improve the surface functionality of nanoparticles for more neutral surface charge at physiological pH and potentially reduce non-specific adsorption of proteins to nanoparticles surfaces. The success of conjugation was evaluated with dynamic light scattering by measuring the surface charge changes and Fourier transform infrared spectroscopy for surface chemistry analysis. The stability of dopamine-coated nanoparticles and the ability of conjugated nanoparticles to reduce the formation of protein corona were evaluated by measuring the size and charge of the nanoparticles in biological medium. This facile conjugation method opens up possibilities for attaching various surface functionalities onto iron oxide nanoparticle surfaces for biomedical applications.

A Plasmodium Promiscuous T Cell Epitope Delivered within the Ad5 Hexon Protein Enhances the Protective Efficacy of a Protein Based Malaria Vaccine.

PubMed

Fonseca, Jairo Andres; Cabrera-Mora, Monica; Kashentseva, Elena A; Villegas, John Paul; Fernandez, Alejandra; Van Pelt, Amelia; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

2016-01-01

A malaria vaccine is a public health priority. In order to produce an effective vaccine, a multistage approach targeting both the blood and the liver stage infection is desirable. The vaccine candidates also need to induce balanced immune responses including antibodies, CD4+ and CD8+ T cells. Protein-based subunit vaccines like RTS,S are able to induce strong antibody response but poor cellular reactivity. Adenoviral vectors have been effective inducing protective CD8+ T cell responses in several models including malaria; nonetheless this vaccine platform exhibits a limited induction of humoral immune responses. Two approaches have been used to improve the humoral immunogenicity of recombinant adenovirus vectors, the use of heterologous prime-boost regimens with recombinant proteins or the genetic modification of the hypervariable regions (HVR) of the capsid protein hexon to express B cell epitopes of interest. In this study, we describe the development of capsid modified Ad5 vectors that express a promiscuous Plasmodium yoelii T helper epitope denominated PyT53 within the hexon HVR2 region. Several regimens were tested in mice to determine the relevance of the hexon modification in enhancing protective immune responses induced by the previously described protein-based multi-stage experimental vaccine PyCMP. A heterologous prime-boost immunization regime that combines a hexon modified vector with transgenic expression of PyCMP followed by protein immunizations resulted in the induction of robust antibody and cellular immune responses in comparison to a similar regimen that includes a vector with unmodified hexon. These differences in immunogenicity translated into a better protective efficacy against both the hepatic and red blood cell stages of P. yoelii. To our knowledge, this is the first time that a hexon modification is used to deliver a promiscuous T cell epitope. Our data support the use of such modification to enhance the immunogenicity and protective

Malaria Infections Do Not Compromise Vaccine-Induced Immunity against Tuberculosis in Mice

PubMed Central

Parra, Marcela; Derrick, Steven C.; Yang, Amy; Tian, JinHua; Kolibab, Kristopher; Oakley, Miranda; Perera, Liyanage P.; Jacobs, William R.; Kumar, Sanjai; Morris, Sheldon L.

2011-01-01

Background Given the considerable geographic overlap in the endemic regions for malaria and tuberculosis, it is probable that co-infections with Mycobacterium tuberculosis and Plasmodium species are prevalent. Thus, it is quite likely that both malaria and TB vaccines may be used in the same populations in endemic areas. While novel vaccines are currently being developed and tested individually against each of these pathogens, the efficacy of these vaccines has not been evaluated in co-infection models. To further assess the effectiveness of these new immunization strategies, we investigated whether co-infection with malaria would impact the anti-tuberculosis protection induced by four different types of TB vaccines in a mouse model of pulmonary tuberculosis. Principal Findings Here we show that the anti-tuberculosis protective immunity induced by four different tuberculosis vaccines was not impacted by a concurrent infection with Plasmodium yoelii NL, a nonlethal form of murine malaria. After an aerogenic challenge with virulent M. tuberculosis, the lung bacterial burdens of vaccinated animals were not statistically different in malaria infected and malaria naïve mice. Multi-parameter flow cytometric analysis showed that the frequency and the median fluorescence intensities (MFI) for specific multifunctional T (MFT) cells expressing IFN-γ, TNF-α, and/or IL-2 were suppressed by the presence of malaria parasites at 2 weeks following the malaria infection but was not affected after parasite clearance at 7 and 10 weeks post-challenge with P. yoelii NL. Conclusions Our data indicate that the effectiveness of novel TB vaccines in protecting against tuberculosis was unaffected by a primary malaria co-infection in a mouse model of pulmonary tuberculosis. While the activities of specific MFT cell subsets were reduced at elevated levels of malaria parasitemia, the T cell suppression was short-lived. Our findings have important relevance in developing strategies for the

First report of Hepatozoon sp. in the Oregon spotted frog, Rana pretiosa.

PubMed

Stenberg, Patricia L; Bowerman, William J

2010-07-01

From 2005 through 2008, we screened 650 Oregon spotted frogs (Rana pretiosa) from three populations in central Oregon, USA, for hemoparasites. A Hepatozoon sp., not previously reported in R. pretiosa, was found in one population of frogs, mostly as intracellular gamonts at a prevalence of 10.5% with parasitemias ranging from 0.02% to greater than 42% of erythrocytes within individual frogs. Intra-and extracellular merozoites were present, but rare. A potential vector, the mosquito Culex boharti, was common throughout the habitat of the population carrying Hepatozoon sp.

Modelling of Surfaces. Part 2: Metallic Alloy Surfaces Using the BFS Method

NASA Technical Reports Server (NTRS)

Bozzolo, Guillermo; Ferrante, John; Kobistek, Robert J.

1994-01-01

Using BFS, a new semiempirical method for alloys, we study the surface structure of fcc ordered binary alloys. We concentrate on the calculation of surface energies and surface relaxations for the L1(sub 0) and L1(sub 2) ordered structures. Different terminations of the low-index faces are studied. Also, we present results for the interlayer relaxations for planes close to the surface, revealing different relaxations for atoms of different species producing a rippled surface layer.

Comment on 'Surface thermodynamics, surface stress, equations at surfaces and triple lines for deformable bodies'.

PubMed

Gutman, E M

2010-10-27

In a recent publication by Olives (2010 J. Phys.: Condens. Matter 22 085005) he studied 'the thermodynamics and mechanics of the surface of a deformable body, following and refining the general approach of Gibbs' and believed that 'a new definition of the surface stress is given'. However, using the usual way of deriving the equations of Gibbs-Duhem type the author, nevertheless, has fallen into a mathematical discrepancy because he has tried to unite in one equation different thermodynamic systems and 'a new definition of the surface stress' has appeared known in the usual theory of elasticity.

Surface and guided waves on structured surfaces and inhomogeneous media

NASA Astrophysics Data System (ADS)

Polanco, Javier

Surface and guided waves on structured surfaces and inhomogeneous media studies the propagation of waves in systems with spatially varying parameters. In the rainbow case (chapter 1), the dielectric constant changes with coordinates. In the cylinder case: boundary and the metal (chapter 2), it is a curved surface. Finally, in the last case (chapter 3), the dielectric constant changes in z-direction.

Genetic diversity of Plasmodium falciparum merozoite surface protein-1 (block 2), glutamate-rich protein and sexual stage antigen Pfs25 from Chandigarh, North India.

PubMed

Kaur, Hargobinder; Sehgal, Rakesh; Goyal, Kapil; Makkar, Nikita; Yadav, Richa; Bharti, Praveen K; Singh, Neeru; Sarmah, Nilanju P; Mohapatra, Pradyumna K; Mahanta, Jagadish; Bansal, Devendra; Sultan, Ali A; Kanwar, Jagat R

2017-12-01

To elucidate the genetic diversity of Plasmodium falciparum in residual transmission foci of northern India. Clinically suspected patients with malaria were screened for malaria infection by microscopy. 48 P. falciparum-infected patients were enrolled from tertiary care hospital in Chandigarh, India. Blood samples were collected from enrolled patients, genomic DNA extraction and nested PCR was performed for further species confirmation. Sanger sequencing was carried out using block 2 region of msp1, R2 region of glurp and pfs25-specific primers. Extensive diversity was found in msp1 alleles with predominantly RO33 alleles. Overall allelic prevalence was 55.8% for RO33, 39.5% for MAD20 and 4.7% for K1. Six variants were observed in MAD20, whereas no variant was found in RO33 and K1 alleles. A phylogenetic analysis of RO33 alleles indicated more similarity to South African isolates, whereas MAD20 alleles showed similarity with South-East Asian isolates. In glurp, extensive variation was observed with eleven different alleles based on the AAU repeats. However, pfs25 showed less diversity and was the most stable among the targeted genes. Our findings document the genetic diversity among circulating strains of P. falciparum in an area of India with low malaria transmission and could have implications for control strategies to reach the national goal of malaria elimination. © 2017 John Wiley & Sons Ltd.

Production of a Recombinant E. coli Expressed Malarial Vaccine from the C-Terminal Fragment of Plasmodium Falciparum 3D7 Merozoite Surface Protein-1.

DTIC Science & Technology

2000-04-01

Reportable Outcomes 1. Manuscript in preparation: Evelina Angov, Barbara Aufiero, Michel Van Handenhove, Christian Ockenhouse, Kent Kester, Doug Walsh, Jana...Burnouf, T., Ouattara, D., Attanath, P., Bouharoun-Tayoun, H., Chantavanich, P., Foucault , C., Chongsuphajaisiddhi, T., and Druilhe, P. (1991

Evaluation of Purine Salvage as a Chemotherapeutic Target in the Plasmodium yoelii Rodent Model

DTIC Science & Technology

2008-03-01

total RNA was extracted from the WT and the B3 and D1 clones of the KO parasite lines using the Trizol method on saponin lysed parasites. For each...group, RNA originating from the two mice was pooled. Total RNA integrity was checked using the Agilent Bioanalyzer (Agilent Technologies , Santa Clara...twice on the array. The array has been developed and previously evaluated with hybridizations of total RNA extracted from blood stages. Probe

Water at surfaces with tunable surface chemistries

NASA Astrophysics Data System (ADS)

Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

2018-03-01

Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

Thermal and UV Hydrosilylation of Alcohol-Based Bifunctional Alkynes on Si (111) surfaces: How surface radicals influence surface bond formation.

PubMed

Khung, Y L; Ngalim, S H; Scaccabarozi, A; Narducci, D

2015-06-12

Using two different hydrosilylation methods, low temperature thermal and UV initiation, silicon (111) hydrogenated surfaces were functionalized in presence of an OH-terminated alkyne, a CF3-terminated alkyne and a mixed equimolar ratio of the two alkynes. XPS studies revealed that in the absence of premeditated surface radical through low temperature hydrosilylation, the surface grafting proceeded to form a Si-O-C linkage via nucleophilic reaction through the OH group of the alkyne. This led to a small increase in surface roughness as well as an increase in hydrophobicity and this effect was attributed to the surficial etching of silicon to form nanosize pores (~1-3 nm) by residual water/oxygen as a result of changes to surface polarity from the grafting. Furthermore in the radical-free thermal environment, a mix in equimolar of these two short alkynes can achieve a high contact angle of ~102°, comparable to long alkyl chains grafting reported in literature although surface roughness was relatively mild (rms = ~1 nm). On the other hand, UV initiation on silicon totally reversed the chemical linkages to predominantly Si-C without further compromising the surface roughness, highlighting the importance of surface radicals determining the reactivity of the silicon surface to the selected alkynes.

Thermal and UV Hydrosilylation of Alcohol-Based Bifunctional Alkynes on Si (111) surfaces: How surface radicals influence surface bond formation

PubMed Central

Khung, Y. L.; Ngalim, S. H.; Scaccabarozi, A.; Narducci, D.

2015-01-01

Using two different hydrosilylation methods, low temperature thermal and UV initiation, silicon (111) hydrogenated surfaces were functionalized in presence of an OH-terminated alkyne, a CF3-terminated alkyne and a mixed equimolar ratio of the two alkynes. XPS studies revealed that in the absence of premeditated surface radical through low temperature hydrosilylation, the surface grafting proceeded to form a Si-O-C linkage via nucleophilic reaction through the OH group of the alkyne. This led to a small increase in surface roughness as well as an increase in hydrophobicity and this effect was attributed to the surficial etching of silicon to form nanosize pores (~1–3 nm) by residual water/oxygen as a result of changes to surface polarity from the grafting. Furthermore in the radical-free thermal environment, a mix in equimolar of these two short alkynes can achieve a high contact angle of ~102°, comparable to long alkyl chains grafting reported in literature although surface roughness was relatively mild (rms = ~1 nm). On the other hand, UV initiation on silicon totally reversed the chemical linkages to predominantly Si-C without further compromising the surface roughness, highlighting the importance of surface radicals determining the reactivity of the silicon surface to the selected alkynes. PMID:26067470

Fast Disinfecting Antimicrobial Surfaces

PubMed Central

Madkour, Ahmad E.; Dabkowski, Jeffery M.; Nüsslein, Klaus; Tew, Gregory N.

2013-01-01

Silicon wafers and glass surfaces were functionalized with facially amphiphilic antimicrobial copolymers using the “grafting from” technique. Surface initiated atom transfer radical polymerization (ATRP) was used to grow poly(butylmethacrylate)-co-poly(Boc-aminoethyl methacrylate) from the surfaces. Upon Boc-deprotection, these surfaces became highly antimicrobial and killed S. aureus and E. coli 100% in less than 5 min. The molecular weight and grafting density of the polymer were controlled by varying the polymerization time and initiator surface density. Antimicrobial studies showed that the killing efficiency of these surfaces was independent of polymer layer thickness or grafting density within the range of surfaces studied. PMID:19177651

Surface plasmon polaritons and waveguide modes at structured and inhomogeneous surfaces

NASA Astrophysics Data System (ADS)

Polanco, Javier

In chapter 1, properties of a p-polarized surface plasmon polariton are studied, propagating circumferentially around a portion of a cylindrical interface between vacuum and a metal, a situation investigated earlier by M. V. Berry (J. Phys. A: Math. Gen. 8, (1975) 1952). When the metal is convex toward the vacuum this mode is radiative and consequently is attenuated as it propagates on the cylindrical surface. An approximate analytic solution of the dispersion relation for this wave is obtained by an approach different from the one used by Berry, and plots of the real and imaginary parts of its wave number are presented. When the metal is concave to the vacuum, the resulting dispersion relation possesses a multiplicity of solutions that have the nature of waveguide modes that owe their existence to the curvature of the interface. In chapter 2, the reduced Rayleigh equation for the scattering of a surface plasmon polariton incident normally on a one-dimensional ridge or groove on an otherwise planar metal surface is solved by a purely numerical approach. The solution is used to calculate the reflectivity and transmissivity of the surface plasmon polariton, and its conversion into volume electromagnetic waves in the vacuum above the metal surface. The results obtained are compared with those of earlier calculations of these quantities. In chapter 3, the results of the previous chapter are extended to the scattering of a surface plasmon polariton incident non-normally on a one-dimensional ridge or groove on an otherwise planar metal surface. As before, the reflectivity and transmissivity of the surface plasmon polariton are calculated, and its conversion into volume electromagnetic waves in the vacuum above the metal surface. In chapter 4, the dynamics of the scattering of surface plasmon polariton (SPP) pulses are investigated theoretically, by single nanoscale metal Gaussian defects through a rigorous calculation of the time dependence of the reflected and

Automated classification of articular cartilage surfaces based on surface texture.

PubMed

Stachowiak, G P; Stachowiak, G W; Podsiadlo, P

2006-11-01

In this study the automated classification system previously developed by the authors was used to classify articular cartilage surfaces with different degrees of wear. This automated system classifies surfaces based on their texture. Plug samples of sheep cartilage (pins) were run on stainless steel discs under various conditions using a pin-on-disc tribometer. Testing conditions were specifically designed to produce different severities of cartilage damage due to wear. Environmental scanning electron microscope (SEM) (ESEM) images of cartilage surfaces, that formed a database for pattern recognition analysis, were acquired. The ESEM images of cartilage were divided into five groups (classes), each class representing different wear conditions or wear severity. Each class was first examined and assessed visually. Next, the automated classification system (pattern recognition) was applied to all classes. The results of the automated surface texture classification were compared to those based on visual assessment of surface morphology. It was shown that the texture-based automated classification system was an efficient and accurate method of distinguishing between various cartilage surfaces generated under different wear conditions. It appears that the texture-based classification method has potential to become a useful tool in medical diagnostics.

PREFACE: Nanostructured surfaces

NASA Astrophysics Data System (ADS)

Palmer, Richard E.

2003-10-01

We can define nanostructured surfaces as well-defined surfaces which contain lateral features of size 1-100 nm. This length range lies well below the micron regime but equally above the Ångstrom regime, which corresponds to the interatomic distances on single-crystal surfaces. This special issue of Journal of Physics: Condensed Matter presents a collection of twelve papers which together address the fabrication, characterization, properties and applications of such nanostructured surfaces. Taken together they represent, in effect, a status report on the rapid progress taking place in this burgeoning area. The first four papers in this special issue have been contributed by members of the European Research Training Network ‘NanoCluster’, which is concerned with the deposition, growth and characterization of nanometre-scale clusters on solid surfaces—prototypical examples of nanoscale surface features. The paper by Vandamme is concerned with the fundamentals of the cluster-surface interaction; the papers by Gonzalo and Moisala address, respectively, the optical and catalytic properties of deposited clusters; and the paper by van Tendeloo reports the application of transmission electron microscopy (TEM) to elucidate the surface structure of spherical particles in a catalyst support. The fifth paper, by Mendes, is also the fruit of a European Research Training Network (‘Micro-Nano’) and is jointly contributed by three research groups; it reviews the creation of nanostructured surface architectures from chemically-synthesized nanoparticles. The next five papers in this special issue are all concerned with the characterization of nanostructured surfaces with scanning tunnelling microscopy (STM) and atomic force microscopy (AFM). The papers by Bolotov, Hamilton and Dunstan demonstrate that the STM can be employed for local electrical measurements as well as imaging, as illustrated by the examples of deposited clusters, model semiconductor structures and real

Cytoadherence and Genotype of Plasmodium falciparum Strains from Symptomatic Children in Franceville, Southeastern Gabon

PubMed Central

Touré, Fousseyni S.; Ouwe-Missi-Oukem-Boyer, Odile; Mezui-Me-Ndong, Jérôme; Ndong-Atome, Guy Roger; Bisvigou, Ulrick; Mazier, Dominique; Bisser, Sylvie

2007-01-01

Background: Plasmodium falciparum causes severe clinical manifestations by sequestering parasitized red blood cells (PRBC) in the microvasculature of major organs such as the brain. This sequestration results from PRBC adherence to vascular endothelial cells via erythrocyte membrane protein 1, a variant parasite surface antigen. Objective: To determine whether P. falciparum multiple genotype infection (MGI) is associated with stronger PRBC cytoadherence and greater clinical severity. Methods: Nested polymerase chain reaction was used to genotype P. falciparum isolates from symptomatic children and to distinguish between single genotype infection (SGI) and MGI. PRBC cytoadhesion was studied with cultured human lung endothelial cells. Results: Analysis of two highly polymorphic regions of the merozoite surface antigen (MSP)-1 and MSP-2 genes and a dimorphic region of the erythrocyte binding antigen-175 gene showed that 21.4% and 78.6% of the 42 children had SGI and MGI, respectively. It also showed that 37 (89%) of the 42 PRBC samples expressed MSP-1 allelic family K1. Cytoadherence values ranged from 58 to 1811 PRBC/mm2 of human lung endothelial cells monolayer in SGI and from 5 to 5744 PRBC/mm2 in MGI. MGI was not associated with higher cytoadherence values or with more severe malaria. Conclusions: These results suggested that infection of the same individual by multiple clones of P. falciparum does not significantly influence PRBC cytoadherence or disease severity and confirmed the predominance of the MSP-1 K1 genotype in southeastern Gabon. PMID:17607045

Scattering of Light and Surface Plasmon Polaritons from Rough Surfaces

DTIC Science & Technology

2013-06-14

Scattering of an electromagnetic wave from a slightly random dielectric surface: Yoneda peak and Brewster angle in incoherent scattering.” Waves...device applications. Thus, the negative refraction of a surface plasmon polariton was studied in two papers. In the first [1], all- angle negative... angle of incidence, measured counterclockwise from the negative x1 axis, is . The surface plasmon polariton of frequency transmitted through the

Superhydrophobic surfaces

DOEpatents

Wang, Evelyn N; McCarthy, Matthew; Enright, Ryan; Culver, James N; Gerasopoulos, Konstantinos; Ghodssi, Reza

2015-03-24

Surfaces having a hierarchical structure--having features of both microscale and nanoscale dimensions--can exhibit superhydrophobic properties and advantageous condensation and heat transfer properties. The hierarchical surfaces can be fabricated using biological nanostructures, such as viruses as a self-assembled nanoscale template.

Effective surface and boundary conditions for heterogeneous surfaces with mixed boundary conditions

NASA Astrophysics Data System (ADS)

Guo, Jianwei; Veran-Tissoires, Stéphanie; Quintard, Michel

2016-01-01

To deal with multi-scale problems involving transport from a heterogeneous and rough surface characterized by a mixed boundary condition, an effective surface theory is developed, which replaces the original surface by a homogeneous and smooth surface with specific boundary conditions. A typical example corresponds to a laminar flow over a soluble salt medium which contains insoluble material. To develop the concept of effective surface, a multi-domain decomposition approach is applied. In this framework, velocity and concentration at micro-scale are estimated with an asymptotic expansion of deviation terms with respect to macro-scale velocity and concentration fields. Closure problems for the deviations are obtained and used to define the effective surface position and the related boundary conditions. The evolution of some effective properties and the impact of surface geometry, Péclet, Schmidt and Damköhler numbers are investigated. Finally, comparisons are made between the numerical results obtained with the effective models and those from direct numerical simulations with the original rough surface, for two kinds of configurations.

Surface Coverage and Metallicity of ZnO Surfaces from First-Principles Calculations

NASA Astrophysics Data System (ADS)

Zhang, Xiao; Schleife, Andre; The Schleife research Group Team

Zinc oxide (ZnO) surfaces are widely used in different applications such as catalysis, biosensing, and solar cells. These surfaces are, in many cases, chemically terminated by hydroxyl groups. In experiment, a transition of the ZnO surface electronic properties from semiconducting to metallic was reported upon increasing the hydroxyl coverage to more than approximately 80 %. The reason for this transition is not well understood yet. We report on first-principles calculations based on density functional theory for the ZnO [ 10 1 0 ] surface, taking different amounts of hydroxyl coverage into account. We calculated band structures for fully relaxed configurations and verified the existence of this transition. However, we only find the fully covered surface to be metallic. We thus explore the possibility for clustering of the surface-terminating hydroxyl groups based on total-energy calculations. We also found that the valence band maximum consists of oxygen p states from both the surface hydroxyl groups and the surface oxygen atoms of the material. The main contribution to the metallicity is found to be from the hydroxyl groups.

Free-surface liquid jet impingement on rib patterned superhydrophobic surfaces

NASA Astrophysics Data System (ADS)

Maynes, D.; Johnson, M.; Webb, B. W.

2011-05-01

We report experimental results characterizing the dynamics of a liquid jet impinging normally on hydrophilic, hydrophobic, and superhydrophobic surfaces spanning the Weber number (based on the jet velocity and diameter) range from 100 to 1900. The superhydrophobic surfaces are fabricated with both hydrophobically coated silicon and polydimethylsiloxane that exhibit alternating microribs and cavities. For all surfaces a transition from a thin radially moving liquid sheet occurs. This takes the form of the classical hydraulic jump for the hydrophilic surfaces but is markedly different for the hydrophobic and superhydrophobic surfaces, where the transition is significantly influenced by surface tension and a break-up into droplets is observed at high Weber number. For the superhydrophobic surfaces, the transition exhibits an elliptical shape with the major axis being aligned parallel to the ribs, concomitant with the frictional resistance being smaller in the parallel direction than in the transverse direction. However, the total projected area of the ellipse exhibits a nearly linear dependence on the jet Weber number, and was nominally invariant with varying hydrophobicity and relative size of the ribs and cavities. For the hydrophobic and superhydrophobic scenarios, the local Weber number based on the local radial velocity and local depth of the radially moving liquid sheet is observed to be of order unity at the transition location. The results also reveal that for increasing relative size of the cavities, the ratio of the ellipse axis (major-to-minor) increases.

Application of modern surface analytical tools in the investigation of surface deterioration processes

NASA Technical Reports Server (NTRS)

Buckley, D. H.

1983-01-01

Surface profilometry and scanning electron microscopy were utilized to study changes in the surface of polymers when eroded. The X-ray photoelectron spectroscopy (XPS) and depth profile analysis indicate the corrosion of metal and ceramic surfaces and reveal the diffusion of certain species into the surface to produce a change in mechanical properties. Ion implantation, nitriding and plating and their effects on the surface are characterized. Auger spectroscopy analysis identified morphological properties of coatings applied to surfaces by sputter deposition.

The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

PubMed Central

Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

2004-01-01

Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

Excitation of multiple surface-plasmon-polariton waves using a compound surface-relief grating

NASA Astrophysics Data System (ADS)

Faryad, Muhammad; Lakhtakia, Akhlesh

2012-01-01

The excitation of multiple surface-plasmon-polariton waves, all of the same frequency but different polarization states, phase speeds, spatial profiles and degrees of localization, by a compound surface-relief grating formed by a metal and a rugate filter, both of finite thickness, was studied using the rigorous coupled-wave approach. Each period of the compound surface-relief grating was chosen to have an integral number of periods of two different simple surface-relief gratings. The excitation of different SPP waves was inferred from the absorptance peaks that were independent of the thickness of the rugate filter. The excitation of each SPP wave could be attributed to either a simple surface-relief grating present in the compound surface-relief grating or to the compound surface-relief grating itself. However, the excitation of SPP waves was found to be less efficient with the compound surface-relief grating than with a simple surface-relief grating.

Cell/surface interactions on laser micro-textured titanium-coated silicon surfaces.

PubMed

Mwenifumbo, Steven; Li, Mingwei; Chen, Jianbo; Beye, Aboubaker; Soboyejo, Wolé

2007-01-01

This paper examines the effects of nano-scale titanium coatings, and micro-groove/micro-grid patterns on cell/surface interactions on silicon surfaces. The nature of the cellular attachment and adhesion to the coated/uncoated micro-textured surfaces was elucidated by the visualization of the cells and relevant cytoskeletal & focal adhesion proteins through scanning electron microscopy and immunofluorescence staining. Increased cell spreading and proliferation rates are observed on surfaces with 50 nm thick Ti coatings. The micro-groove geometries have been shown to promote contact guidance, which leads to reduced scar tissue formation. In contrast, smooth surfaces result in random cell orientations and the increased possibility of scar tissue formation. Immunofluorescence cell staining experiments also reveal that the actin stress fibers are aligned along the groove dimensions, with discrete focal adhesions occurring along the ridges, within the grooves and at the ends of the cell extensions. The implications of the observed cell/surface interactions are discussed for possible applications of silicon in implantable biomedical systems.

Slippery Liquid-Infused Porous Surfaces and Droplet Transportation by Surface Acoustic Waves

NASA Astrophysics Data System (ADS)

Luo, J. T.; Geraldi, N. R.; Guan, J. H.; McHale, G.; Wells, G. G.; Fu, Y. Q.

2017-01-01

On a solid surface, a droplet of liquid will stick due to the capillary adhesion, and this causes low droplet mobility. To reduce contact line pinning, surface chemistry can be coupled to micro- and/or nanostructures to create superhydrophobic surfaces on which a droplet balls up into an almost spherical shape, thus, minimizing the contact area. Recent progress in soft matter has now led to alternative lubricant-impregnated surfaces capable of almost zero contact line pinning and high droplet mobility without causing droplets to ball up and minimize the contact area. Here we report an approach to surface-acoustic-wave- (SAW) actuated droplet transportation enabled using such a surface. These surfaces maintain the contact area required for efficient energy and momentum transfer of the wave energy into the droplet while achieving high droplet mobility and a large footprint, therefore, reducing the threshold power required to induce droplet motion. In our approach, we use a slippery layer of lubricating oil infused into a self-assembled porous hydrophobic layer, which is significantly thinner than the SAW wavelength, and avoid damping of the wave. We find a significant reduction (up to 85%) in the threshold power for droplet transportation compared to that using a conventional surface-treatment method. Moreover, unlike droplets on superhydrophobic surfaces, where interaction with the SAW induces a transition from a Cassie-Baxter state to a Wenzel state, the droplets on our liquid-impregnated surfaces remain in a mobile state after interaction with the SAW.

Symmetric and asymmetric capillary bridges between a rough surface and a parallel surface.

PubMed

Wang, Yongxin; Michielsen, Stephen; Lee, Hoon Joo

2013-09-03

Although the formation of a capillary bridge between two parallel surfaces has been extensively studied, the majority of research has described only symmetric capillary bridges between two smooth surfaces. In this work, an instrument was built to form a capillary bridge by squeezing a liquid drop on one surface with another surface. An analytical solution that describes the shape of symmetric capillary bridges joining two smooth surfaces has been extended to bridges that are asymmetric about the midplane and to rough surfaces. The solution, given by elliptical integrals of the first and second kind, is consistent with a constant Laplace pressure over the entire surface and has been verified for water, Kaydol, and dodecane drops forming symmetric and asymmetric bridges between parallel smooth surfaces. This solution has been applied to asymmetric capillary bridges between a smooth surface and a rough fabric surface as well as symmetric bridges between two rough surfaces. These solutions have been experimentally verified, and good agreement has been found between predicted and experimental profiles for small drops where the effect of gravity is negligible. Finally, a protocol for determining the profile from the volume and height of the capillary bridge has been developed and experimentally verified.

Surface freezing of water.

PubMed

Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

2016-01-01

Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

Fluorinated silica microchannel surfaces

DOEpatents

Kirby, Brian J.; Shepodd, Timothy Jon

2005-03-15

A method for surface modification of microchannels and capillaries. The method produces a chemically inert surface having a lowered surface free energy and improved frictional properties by attaching a fluorinated alkane group to the surface. The coating is produced by hydrolysis of a silane agent that is functionalized with either alkoxy or chloro ligands and an uncharged C.sub.3 -C.sub.10 fluorinated alkane chain. It has been found that the extent of surface coverage can be controlled by controlling the contact time from a minimum of about 2 minutes to a maximum of 120 minutes for complete surface coverage.

Positrons in surface physics

NASA Astrophysics Data System (ADS)

Hugenschmidt, Christoph

2016-12-01

Within the last decade powerful methods have been developed to study surfaces using bright low-energy positron beams. These novel analysis tools exploit the unique properties of positron interaction with surfaces, which comprise the absence of exchange interaction, repulsive crystal potential and positron trapping in delocalized surface states at low energies. By applying reflection high-energy positron diffraction (RHEPD) one can benefit from the phenomenon of total reflection below a critical angle that is not present in electron surface diffraction. Therefore, RHEPD allows the determination of the atom positions of (reconstructed) surfaces with outstanding accuracy. The main advantages of positron annihilation induced Auger-electron spectroscopy (PAES) are the missing secondary electron background in the energy region of Auger-transitions and its topmost layer sensitivity for elemental analysis. In order to enable the investigation of the electron polarization at surfaces low-energy spin-polarized positrons are used to probe the outermost electrons of the surface. Furthermore, in fundamental research the preparation of well defined surfaces tailored for the production of bound leptonic systems plays an outstanding role. In this report, it is envisaged to cover both the fundamental aspects of positron surface interaction and the present status of surface studies using modern positron beam techniques.

Self-cleaning of Surfaces: the Role of Surface Wettability and Dust Types

NASA Astrophysics Data System (ADS)

Quan, Yun-Yun; Zhang, Li-Zhi; Qi, Rong-Hui; Cai, Rong-Rong

2016-12-01

The self-cleaning property is usually connected to superhydrophobic surfaces (SHSs) where the dust particles can be easily removed by the rolling motion of droplets. It seems that superhydrophobicity (its durability is questionable nowadays) is a necessity. However here, it is disclosed that self-cleaning can also be realized on an ordinary surface by droplet impinging. The effects of surface wettability and the types of dust particles are considered. The self-cleaning is realized by two steps: (1) the pickup of particles by the water-air interface of an impinging droplet, (2) the release of the impinging droplets from the surface. It can be observed that only the trailing edges of the droplets can pick up particles when the droplets recoil from the inclined surfaces. The hydrophilic surface can also achieve self-cleaning under some conditions. This interesting finding may be helpful for the successful implementation of self-cleaning with common surfaces.

Effect of surface curvature on diffusion-limited reactions on a curved surface

NASA Astrophysics Data System (ADS)

Eun, Changsun

2017-11-01

To investigate how the curvature of a reactive surface can affect reaction kinetics, we use a simple model in which a diffusion-limited bimolecular reaction occurs on a curved surface that is hollowed inward, flat, or extended outward while keeping the reactive area on the surface constant. By numerically solving the diffusion equation for this model using the finite element method, we find that the rate constant is a non-linear function of the surface curvature and that there is an optimal curvature providing the maximum value of the rate constant, which indicates that a spherical reactant whose entire surface is reactive (a uniformly reactive sphere) is not the most reactive species for a given reactive surface area. We discuss how this result arises from the interplay between two opposing effects: the exposedness of the reactive area to its partner reactants, which causes the rate constant to increase as the curvature increases, and the competition occurring on the reactive surface, which decreases the rate constant. This study helps us to understand the role of curvature in surface reactions and allows us to rationally design reactants that provide a high reaction rate.

Preparation of stable silica surfaces for surface forces measurement

NASA Astrophysics Data System (ADS)

Ren, Huai-Yin; Mizukami, Masashi; Kurihara, Kazue

2017-09-01

A surface forces apparatus (SFA) measures the forces between two surfaces as a function of the surface separation distance. It is regarded as an essential tool for studying the interactions between two surfaces. However, sample surfaces used for the conventional SFA measurements have been mostly limited to thin (ca. 2-3 μm) micas, which are coated with silver layers (ca. 50 nm) on their back, due to the requirement of the distance determination by transmission mode optical interferometry called FECO (fringes of equal chromatic order). The FECO method has the advantage of determining the absolute distance, so it should be important to increase the availability of samples other than mica, which is chemically nonreactive and also requires significant efforts for cleaving. Recently, silica sheets have been occasionally used in place of mica, which increases the possibility of surface modification. However, in this case, the silver layer side of the sheet is glued on a cylindrical quartz disc using epoxy resin, which is not stable in organic solvents and can be easily swollen or dissolved. The preparation of substrates more stable under severe conditions, such as in organic solvents, is necessary for extending application of the measurement. In this study, we report an easy method for preparing stable silica layers of ca. 2 μm in thickness deposited on gold layers (41 nm)/silica discs by sputtering, then annealed to enhance the stability. The obtained silica layers were stable and showed no swelling in organic solvents such as ethanol and toluene.

PREFACE: Atom-surface scattering Atom-surface scattering

NASA Astrophysics Data System (ADS)

Miret-Artés, Salvador

2010-08-01

It has been a privilege and a real pleasure to organize this special issue or festschrift in the general field of atom-surface scattering (and its interaction) in honor of J R Manson. This is a good opportunity and an ideal place to express our deep gratitude to one of the leaders in this field for his fundamental and outstanding scientific contributions. J R Manson, or Dick to his friends and colleagues, is one of the founding fathers, together with N Cabrera and V Celli, of the 'Theory of surface scattering and detection of surface phonons'. This is the title of the very well-known first theoretical paper by Dick published in Physical Review Letters in 1969. My first meeting with Dick was around twenty years ago in Saclay. J Lapujoulade organized a small group seminar about selective adsorption resonances in metal vicinal surfaces. We discussed this important issue in surface physics and many other things as if we had always known each other. This familiarity and warm welcome struck me from the very beginning. During the coming years, I found this to be a very attractive aspect of his personality. During my stays in Göttingen, we had the opportunity to talk widely about science and life at lunch or dinner time, walking or cycling. During these nice meetings, he showed, with humility, an impressive cultural background. It is quite clear that his personal opinions about history, religion, politics, music, etc, come from considering and analyzing them as 'open dynamical systems'. In particular, with good food and better wine in a restaurant or at home, a happy cheerful soirée is guaranteed with him, or even with only a good beer or espresso, and an interesting conversation arises naturally. He likes to listen before speaking. Probably not many people know his interest in tractors. He has an incredible collection of very old tractors at home. In one of my visits to Clemson, he showed me the collection, explaining to me in great detail, their technical properties

Evaluation of the surface free energy of plant surfaces: toward standardizing the procedure

PubMed Central

Fernández, Victoria; Khayet, Mohamed

2015-01-01

Plant surfaces have been found to have a major chemical and physical heterogeneity and play a key protecting role against multiple stress factors. During the last decade, there is a raising interest in examining plant surface properties for the development of biomimetic materials. Contact angle measurement of different liquids is a common tool for characterizing synthetic materials, which is just beginning to be applied to plant surfaces. However, some studies performed with polymers and other materials showed that for the same surface, different surface free energy values may be obtained depending on the number and nature of the test liquids analyzed, materials' properties, and surface free energy calculation methods employed. For 3 rough and 3 rather smooth plant materials, we calculated their surface free energy using 2 or 3 test liquids and 3 different calculation methods. Regardless of the degree of surface roughness, the methods based on 2 test liquids often led to the under- or over-estimation of surface free energies as compared to the results derived from the 3-Liquids method. Given the major chemical and structural diversity of plant surfaces, it is concluded that 3 different liquids must be considered for characterizing materials of unknown physico-chemical properties, which may significantly differ in terms of polar and dispersive interactions. Since there are just few surface free energy data of plant surfaces with the aim of standardizing the calculation procedure and interpretation of the results among for instance, different species, organs, or phenological states, we suggest the use of 3 liquids and the mean surface tension values provided in this study. PMID:26217362

The physics of water droplets on surfaces: exploring the effects of roughness and surface chemistry

NASA Astrophysics Data System (ADS)

Eid, K. F.; Panth, M.; Sommers, A. D.

2018-03-01

This paper explores the fluid property commonly called surface tension, its effect on droplet shape and contact angle, and the major influences of contact angle behaviour (i.e. surface roughness and surface chemistry). Images of water droplets placed on treated copper surfaces are used to measure the contact angles between the droplets and the surface. The surface wettability is manipulated either by growing a self-assembled monolayer on the surface to make it hydrophobic or by changing the surface roughness. The main activities in this experiment, then, are (1) preparing and studying surfaces with different surface wettability and roughness; (2) determining the shape and contact angles of water droplets on these surfaces; and (3) demonstrating the spontaneous motion of water droplets using surface tension gradients.

Influence of surface potential on the adhesive force of radioactive gold surfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kweon, Hyojin; Yiacoumi, Sotira; Lee, Ida

2013-08-23

Radioactive particles may acquire surface potential through self-charging, and thus can behave differently from natural aerosols in atmospheric systems with respect to aggregation, deposition, resuspension, and transport to areas surrounding a radioactive source. Here, this work focuses on the adhesive force between radioactive particles and metallic surfaces, which relates to the deposition and resuspension of particles on surrounding surfaces. Scanning surface potential microscopy was employed to measure the surface potential of radioactive gold foil. Atomic force microscopy was used to investigate the adhesive force for gold that acquired surface charge either by irradiation or by application of an equivalent electricalmore » bias. Overall, the adhesive force increases with increasing surface potential or relative humidity. However, a behavior that does not follow the general trend was observed for the irradiated gold at a high decay rate. A comparison between experimental measurements and calculated values revealed that the surface potential promotes adhesion. The contribution of the electrostatic force at high levels of relative humidity was lower than the one found using theoretical calculations due to the effects caused by enhanced adsorption rate of water molecules under a high surface charge density. Lastly, the results of this study can be used to provide a better understanding of the behavior of radioactive particles in atmospheric systems.« less

Perfect Surface Wave Cloaks

NASA Astrophysics Data System (ADS)

Mitchell-Thomas, R. C.; McManus, T. M.; Quevedo-Teruel, O.; Horsley, S. A. R.; Hao, Y.

2013-11-01

This Letter presents a method for making an uneven surface behave as a flat surface. This allows an object to be concealed (cloaked) under an uneven portion of the surface, without disturbing the wave propagation on the surface. The cloaks proposed in this Letter achieve perfect cloaking that only relies upon isotropic radially dependent refractive index profiles, contrary to those previously published. In addition, these cloaks are very thin, just a fraction of a wavelength in thickness, yet can conceal electrically large objects. While this paper focuses on cloaking electromagnetic surface waves, the theory is also valid for other types of surface waves. The performance of these cloaks is simulated using dielectric filled waveguide geometries, and the curvature of the surface is shown to be rendered invisible, hiding any object positioned underneath. Finally, a transformation of the required dielectric slab permittivity was performed for surface wave propagation, demonstrating the practical applicability of this technique.

Air-ground interface: Surface waves, surface impedance and acoustic-to-seismic coupling coefficient

NASA Technical Reports Server (NTRS)

Daigle, Gilles; Embleton, Tony

1990-01-01

In atmospheric acoustics, the subject of surface waves has been an area of discussion for many years. The existence of an acoustic surface wave is now well established theoretically. The mathematical solution for spherical wave propagation above an impedance boundary includes the possibility of a contribution that possesses all the standard properties for a surface wave. Surface waves exist when the surface is sufficiently porous, relative to its acoustical resistance, that it can influence the airborne particle velocity near the surface and reduce the phase velocity of sound waves in air at the surface. This traps some of the sound energy in the air to remain near the surface as it propagates. Above porous grounds, the existence of surface waves has eluded direct experimental confirmation (pulse experiments have failed to show a separate arrival expected from the reduced phase speed) and indirect evidence for its existence has appeared contradictory. The experimental evidence for the existence of an acoustical surface wave above porous boundaries is reviewed. Recent measurements including pulse experiments are also described. A few years ago the acoustic impedance of a grass-covered surface was measured in the frequency range 30 to 300 Hz. Here, further measurements on the same site are discussed. These measurements include core samples, a shallow refractive survey to determine the seismic velocities, and measurements of the acoustic-to-seismic coupling coefficient.

Surface Forces Apparatus Measurements of Interactions between Rough and Reactive Calcite Surfaces.

PubMed

Dziadkowiec, Joanna; Javadi, Shaghayegh; Bratvold, Jon E; Nilsen, Ola; Røyne, Anja

2018-06-26

nm-Range forces acting between calcite surfaces in water affect macroscopic properties of carbonate rocks and calcite-based granular materials and are significantly influenced by calcite surface recrystallization. We suggest that the repulsive mechanical effects related to nm-scale surface recrystallization of calcite in water could be partially responsible for the observed decrease of cohesion in calcitic rocks saturated with water. Using the surface forces apparatus, we simultaneously followed the calcite reactivity and measured the forces in water in two surface configurations: between two rough calcite surfaces (CC) and between rough calcite and a smooth mica surface (CM). We used nm-scale rough, polycrystalline calcite films prepared by atomic layer deposition. We measured only repulsive forces in CC in CaCO 3 -saturated water, which was related to roughness and possibly to repulsive hydration effects. Adhesive or repulsive forces were measured in CM in CaCO 3 -saturated water depending on calcite roughness, and the adhesion was likely enhanced by electrostatic effects. The pull-off adhesive force in CM became stronger with time, and this increase was correlated with a decrease of roughness at contacts, the parameter which could be estimated from the measured force-distance curves. That suggested a progressive increase of real contact areas between the surfaces, caused by gradual pressure-driven deformation of calcite surface asperities during repeated loading-unloading cycles. Reactivity of calcite was affected by mass transport across nm- to μm-thick gaps between the surfaces. Major roughening was observed only for the smoothest calcite films, where gaps between two opposing surfaces were nm-thick over μm-sized areas and led to force of crystallization that could overcome confining pressures of the order of MPa. Any substantial roughening of calcite caused a significant increase of the repulsive mechanical force contribution.

Effect of Surface Treatment on the Surface Characteristics of AISI 316L Stainless Steel

NASA Technical Reports Server (NTRS)

Trigwell, Steve; Selvaduray, Guna

2005-01-01

The ability of 316L stainless steel to maintain biocompatibility, which is dependent upon the surface characteristics, is critical to its effectiveness as an implant material. The surfaces of mechanically polished (MP), electropolished (EP) and plasma treated 316L stainless steel coupons were characterized by X-ray Photoelectron Spectroscopy (XPS) and Auger Electron Spectroscopy (AES) for chemical composition, Atomic Force Microscopy for surface roughness, and contact angle measurements for critical surface tension. All surfaces had a Ni concentration that was significantly lower than the bulk concentration of -43%. The Cr content of the surface was increased significantly by electropolishing. The surface roughness was also improved significantly by electropolishing. Plasma treatment had the reverse effect - the surface Cr content was decreased. It was also found that the Cr and Fe in the surface exist in both the oxide and hydroxide states, with the ratios varying according to surface treatment.

Carboxyl-rich plasma polymer surfaces in surface plasmon resonance immunosensing

NASA Astrophysics Data System (ADS)

Makhneva, Ekaterina; Obrusník, Adam; Farka, Zdeněk; Skládal, Petr; Vandenbossche, Marianne; Hegemann, Dirk; Zajíčková, Lenka

2018-01-01

Stable carboxyl-rich plasma polymers (PPs) were deposited onto the gold surface of surface plasmon resonance (SPR) chips under conditions that were chosen based on lumped kinetic model results. Carboxyl-rich films are of high interest for bio-applications thanks to their high reactivity, allowing the formation of covalent linkages between biomolecules and a surface. Accordingly, the monoclonal antibody, specific to human serum albumin (HSA), was immobilized and the performance of SPR immunosensors was evaluated by the immunoassay flow test. The developed sensors performed high level of stability and provided selective and high response to the HSA antigen solutions. The achieved results confirmed that the presented methodologies for the grafting of biomolecules on the gold surfaces have great potential for biosensing applications.

Surface Structure and Surface Electronic States Related to Plasma Cleaning of Silicon and Germanium

NASA Astrophysics Data System (ADS)

Cho, Jaewon

This thesis discusses the surface structure and the surface electronic states of Si and Ge(100) surfaces as well as the effects of oxidation process on the silicon oxide/Si(100) interface structure. The H-plasma exposure was performed in situ at low temperatures. The active species, produced in the H-plasma by the rf-excitation of H_2 gas, not only remove microcontaminants such as oxygen and carbon from the surface, but also passivate the surface with atomic hydrogen by satisfying the dangling bonds of the surface atoms. The surfaces were characterized by Angle Resolved UV-Photoemission Spectroscopy (ARUPS) and Low Energy Electron Diffraction (LEED). In the case of Si(100), H-plasma exposure produced ordered H-terminated crystallographic structures with either a 2 x 1 or 1 x 1 LEED pattern. The hydride phases, found on the surfaces of the cleaned Si(100), were shown to depend on the temperature of the surface during H-plasma cleaning. The electronic states for the monohydride and dihydride phases were identified by ARUPS. When the plasma cleaned surface was annealed, the phase transition from the dihydride to monohydride was observed. The monohydride Si-H surface bond was stable up to 460^circC, and the dangling bond surface states were identified after annealing at 500^circC which was accompanied by the spectral shift. The H-terminated surface were characterized to have a flat band structure. For the Ge(100) surface, an ordered 2 x 1 monohydride phase was obtained from the surface cleaned at 180 ^circC. After plasma exposure at <=170^circC a 1 x 1 surface was observed, but the ARUPS indicated that the surface was predominantly composed of disordered monohydride structures. After annealing above the H-dissociation temperatures, the shift in the spectrum was shown to occur with the dangling bond surface states. The H-terminated surfaces were identified to be unpinned. The interface structure of silicon oxide/Si(100) was studied using ARUPS. Spectral shifts were

Dissecting the interface between apicomplexan parasite and host cell: Insights from a divergent AMA–RON2 pair

PubMed Central

Parker, Michelle L.; Penarete-Vargas, Diana M.; Hamilton, Phineas T.; Guérin, Amandine; Dubey, Jitender P.; Perlman, Steve J.; Spano, Furio; Lebrun, Maryse; Boulanger, Martin J.

2016-01-01

Plasmodium falciparum and Toxoplasma gondii are widely studied parasites in phylum Apicomplexa and the etiological agents of severe human malaria and toxoplasmosis, respectively. These intracellular pathogens have evolved a sophisticated invasion strategy that relies on delivery of proteins into the host cell, where parasite-derived rhoptry neck protein 2 (RON2) family members localize to the host outer membrane and serve as ligands for apical membrane antigen (AMA) family surface proteins displayed on the parasite. Recently, we showed that T. gondii harbors a novel AMA designated as TgAMA4 that shows extreme sequence divergence from all characterized AMA family members. Here we show that sporozoite-expressed TgAMA4 clusters in a distinct phylogenetic clade with Plasmodium merozoite apical erythrocyte-binding ligand (MAEBL) proteins and forms a high-affinity, functional complex with its coevolved partner, TgRON2L1. High-resolution crystal structures of TgAMA4 in the apo and TgRON2L1-bound forms complemented with alanine scanning mutagenesis data reveal an unexpected architecture and assembly mechanism relative to previously characterized AMA–RON2 complexes. Principally, TgAMA4 lacks both a deep surface groove and a key surface loop that have been established to govern RON2 ligand binding selectivity in other AMAs. Our study reveals a previously underappreciated level of molecular diversity at the parasite–host-cell interface and offers intriguing insight into the adaptation strategies underlying sporozoite invasion. Moreover, our data offer the potential for improved design of neutralizing therapeutics targeting a broad range of AMA–RON2 pairs and apicomplexan invasive stages. PMID:26712012

Targeting the GPI biosynthetic pathway.

PubMed

Yadav, Usha; Khan, Mohd Ashraf

2018-02-27

The GPI (Glycosylphosphatidylinositol) biosynthetic pathway is a multistep conserved pathway in eukaryotes that culminates in the generation of GPI glycolipid which in turn anchors many proteins (GPI-APs) to the cell surface. In spite of the overall conservation of the pathway, there still exist subtle differences in the GPI pathway of mammals and other eukaryotes which holds a great promise so far as the development of drugs/inhibitors against specific targets in the GPI pathway of pathogens is concerned. Many of the GPI structures and their anchored proteins in pathogenic protozoans and fungi act as pathogenicity factors. Notable examples include GPI-anchored variant surface glycoprotein (VSG) in Trypanosoma brucei, GPI-anchored merozoite surface protein 1 (MSP1) and MSP2 in Plasmodium falciparum, protein-free GPI related molecules like lipophosphoglycans (LPGs) and glycoinositolphospholipids (GIPLs) in Leishmania spp., GPI-anchored Gal/GalNAc lectin and proteophosphoglycans in Entamoeba histolytica or the GPI-anchored mannoproteins in pathogenic fungi like Candida albicans. Research in this active area has already yielded encouraging results in Trypanosoma brucei by the development of parasite-specific inhibitors of GlcNCONH 2 -β-PI, GlcNCONH 2 -(2-O-octyl)-PI and salicylic hydroxamic acid (SHAM) targeting trypanosomal GlcNAc-PI de-N-acetylase as well as the development of antifungal inhibitors like BIQ/E1210/gepinacin/G365/G884 and YW3548/M743/M720 targeting the GPI specific fungal inositol acyltransferase (Gwt1) and the phosphoethanolamine transferase-I (Mcd4), respectively. These confirm the fact that the GPI pathway continues to be the focus of researchers, given its implications for the betterment of human life.

Fabrication of a bionic microstructure on a C/SiC brake lining surface: Positive applications of surface defects for surface wetting control

NASA Astrophysics Data System (ADS)

Wu, M. L.; Ren, C. Z.; Xu, H. Z.; Zhou, C. L.

2018-05-01

The material removal processes generate interesting surface topographies, unfortunately, that was usually considered to be surface defects. To date, little attention has been devoted to the positive applications of these interesting surface defects resulted from laser ablation to improve C/SiC surface wettability. In this study, the formation mechanism behind surface defects (residual particles) is discussed first. The results showed that the residual particles with various diameters experienced regeneration and migration, causing them to accumulate repeatedly. The effective accumulation of these residual particles with various diameters provides a new method about fabricating bionic microstructures for surface wetting control. The negligible influence of ablation processes on the chemical component of the subsurface was studied by comparing the C-O-Si weight percentage at the C/SiC subsurface. A group of microstructures were fabricated under different laser trace and different laser parameters. Surface wettability experimental results for different types of microstructures were compared. The results showed that the surface wettability increased as the laser scanning speed decreased. The surface wettability increased with the density of the laser scanning trace. We also demonstrated the application of optimized combination of laser parameters and laser trace to simulate a lotus leaf's microstructure on C/SiC surfaces. The parameter selection depends on the specific material properties.

Surface diffusion of a carbon-adatom on Au(110) surfaces

NASA Astrophysics Data System (ADS)

Kim, E.; Safavi-Naini, A.; Hite, D. A.; McKay, K. S.; Pappas, D. P.; Weck, P. F.; Sadeghpour, H. R.

We have investigated the surface diffusion of carbon-adatom on gold surfaces using density functional theory and detailed scanning probe microscopy. The decoherence of trapped-ion quantum gates due to heating of their motional modes is a fundamental science and engineering problem. In an effort to understand heating at the trap-electrode surfaces, we investigate the possible source of noise by focusing on the diffusion of carbon-containing adsorbates onto the Au(110) surface. In this study, we show how the diffusive motion of carbon adatom on gold surface significantly affects the energy landscape and adatom dipole moment variation. A simple model for the diffusion noise, which varies quadratically with the variation of the dipole moment, qualitatively reproduces the measured noise spectrum, and the estimate of the noise spectral density is in accord with measured values. Sandia National Laboratories is a multiprogram laboratory operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Company, for the United States Department of Energy's NNSA under Contract DE-AC04-94AL85000.

Surface forces between hydrophilic silica surfaces in a moisture-sensitive oleophilic diacrylate monomer liquid

NASA Astrophysics Data System (ADS)

Ito, Shunya; Kasuya, Motohiro; Kurihara, Kazue; Nakagawa, Masaru

2018-02-01

We measured the surface forces generated between fused silica surfaces in a low-viscosity oleophilic diacrylate monomer for reliably repeated ultraviolet (UV) nanoimprinting, and studied the influence of water in monomer liquids on the forces. Fused silica surfaces, with a static contact angle of 52.6 ± 1.7° for water, owing to the low degree of hydroxylation, hardly showed reproducible surface forces with repeated scan cycles, comprising approach and separation, even in an identical liquid monomer medium with both of low and high water content. The monomer liquid with a high water content of approximately 420 ppm showed a greater tendency to increase the surface forces at longer surface-surface distances compared with the monomer liquid with a low water content of approximately 60 ppm. On the other hand, silica surfaces with a water contact angle of < 5° after exposure to vacuum UV (VUV) light under a reduced air pressure showed reproducible profiles of surfaces forces using the monomer with a low water concentration of approximately 60 ppm for repeated surface forces scan cycles even in separately prepared silica surfaces, whilst they showed less reproducible profiles in the liquids with high water content of 430 ppm. These results suggested that water possibly adsorbed on the hydrophilic and hydrophobic silica surfaces in the monomer liquid of the high water concentration influenced the repeatability of the surface forces profiles.

Production of hybrid macro/micro/nano surface structures on Ti6Al4V surfaces by picosecond laser surface texturing and their antifouling characteristics.

PubMed

Rajab, Fatema H; Liauw, Christopher M; Benson, Paul S; Li, Lin; Whitehead, Kathryn A

2017-12-01

The development of surfaces which reduce biofouling has attracted much interest in practical applications. Three picosecond laser generated surface topographies (Ti1, Ti2, Ti3) on titanium were produced, treated with fluoroalkylsilane (FAS), then characterised using Scanning Electron Microscopy (SEM), Energy Dispersive X-ray Spectroscopy (EDX), Raman Spectroscopy, Fourier Transform Infra-Red (FTIR) spectroscopy, contact angle measurements and white light interference microscopy. The surfaces had a range of different macro/micro/nano topographies. Ti2 had a unique, surface topography with large blunt conical peaks and was predominantly a rutile surface with closely packed, self-assembled FAS; this was the most hydrophobic sample (water contact angle 160°; ΔG iwi was -135.29mJm -2 ). Bacterial attachment, adhesion and retention to the surfaces demonstrated that all the laser generated surfaces retained less bacteria than the control surface. This also occurred following the adhesion and retention assays when the bacteria were either not rinsed from the surfaces or were retained in static conditions for one hour. This work demonstrated that picosecond laser generated surfaces may be used to produce antiadhesive surfaces that significantly reduced surface fouling. It was determined that a tri-modally dimensioned surface roughness, with a blunt conical macro-topography, combined with a close-packed fluoroalkyl monolayer was required for an optimised superhydrophobic surface. These surfaces were effective even following surface immersion and static conditions for one hour, and thus may have applications in a number of food or medical industries. Copyright © 2017 Elsevier B.V. All rights reserved.

Antisoiling technology: Theories of surface soiling and performance of antisoiling surface coatings

NASA Technical Reports Server (NTRS)

Cuddihy, E. F.; Willis, P. B.

1984-01-01

Physical examination of surfaces undergoing natural outdoor soiling suggests that soil matter accumulates in up to three distinct layers. The first layer involves strong chemical attachment or strong chemisorption of soil matter on the primary surface. The second layer is physical, consisting of a highly organized arrangement of soil creating a gradation in surface energy from a high associated with the energetic first layer to the lowest possible state on the outer surfce of the second layer. The lowest possible energy state is dictated by the physical nature of the regional atmospheric soiling materials. These first two layers are resistant to removal by rain. The third layer constitutes a settling of loose soil matter, accumulating in dry periods and being removed during rainy periods. Theories and evidence suggest that surfaces that should be naturally resistant to the formation of the first two-resistant layers should be hard, smooth, hydrophobic, free of first-period elements, and have the lowest possible surface energy. These characteristics, evolving as requirements for low-soiling surfaces, suggest that surfaces or surface coatings should be of fluorocarbon chemistry. Evidence for the three-soil-layer concept, and data on the positive performance of candidate fluorocarbon coatings on glass and transparent plastic films after 28 months of outdoor exposure, are presented.

Surface mining

Treesearch

Robert Leopold; Bruce Rowland; Reed Stalder

1979-01-01

The surface mining process consists of four phases: (1) exploration; (2) development; (3) production; and (4) reclamation. A variety of surface mining methods has been developed, including strip mining, auger, area strip, open pit, dredging, and hydraulic. Sound planning and design techniques are essential to implement alternatives to meet the myriad of laws,...

Combined surface hardening and laser patterning approach for functionalising stainless steel surfaces

NASA Astrophysics Data System (ADS)

Garcia-Giron, A.; Romano, J. M.; Liang, Y.; Dashtbozorg, B.; Dong, H.; Penchev, P.; Dimov, S. S.

2018-05-01

The paper reports a laser patterning method for producing surfaces with dual scale topographies on ferritic stainless steel plates that are hardened by low temperature plasma surface alloying. Nitrogen and carbon based gasses were used in the alloying process to obtain surface layers with an increased hardness from 172 HV to 1001 HV and 305 HV, respectively. Then, a nanosecond infrared laser was used to pattern the plasma treated surfaces and thus to obtain super-hydrophobicity, by creating cell- or channel-like surface structures. The combined surface hardening and laser patterning approach allowed super-hydrophobic surfaces to be produced on both nitrided and carburised stainless steel plates with effective contact angles higher than 150°. The hardened layers on nitrided samples had cracks and was delaminated after the laser patterning while on plasma carburised samples remained intact. The results showed that by applying the proposed combined approach it is possible to retain the higher hardness of the nitrided stainless steel plates and at the same time to functionalise them to obtain super-hydrophobic properties.

QSAR, docking and ADMET studies of artemisinin derivatives for antimalarial activity targeting plasmepsin II, a hemoglobin-degrading enzyme from P. falciparum.

PubMed

Qidwai, Tabish; Yadav, Dharmendra K; Khan, Feroz; Dhawan, Sangeeta; Bhakuni, R S

2012-01-01

This work presents the development of quantitative structure activity relationship (QSAR) model to predict the antimalarial activity of artemisinin derivatives. The structures of the molecules are represented by chemical descriptors that encode topological, geometric, and electronic structure features. Screening through QSAR model suggested that compounds A24, A24a, A53, A54, A62 and A64 possess significant antimalarial activity. Linear model is developed by the multiple linear regression method to link structures to their reported antimalarial activity. The correlation in terms of regression coefficient (r(2)) was 0.90 and prediction accuracy of model in terms of cross validation regression coefficient (rCV(2)) was 0.82. This study indicates that chemical properties viz., atom count (all atoms), connectivity index (order 1, standard), ring count (all rings), shape index (basic kappa, order 2), and solvent accessibility surface area are well correlated with antimalarial activity. The docking study showed high binding affinity of predicted active compounds against antimalarial target Plasmepsins (Plm-II). Further studies for oral bioavailability, ADMET and toxicity risk assessment suggest that compound A24, A24a, A53, A54, A62 and A64 exhibits marked antimalarial activity comparable to standard antimalarial drugs. Later one of the predicted active compound A64 was chemically synthesized, structure elucidated by NMR and in vivo tested in multidrug resistant strain of Plasmodium yoelii nigeriensis infected mice. The experimental results obtained agreed well with the predicted values.

Diffusion on Cu surfaces

NASA Technical Reports Server (NTRS)

Karimi, Majid

1993-01-01

Understanding surface diffusion is essential in understanding surface phenomena, such as crystal growth, thin film growth, corrosion, physisorption, and chemisorption. Because of its importance, various experimental and theoretical efforts have been directed to understand this phenomena. The Field Ion Microscope (FIM) has been the major experimental tool for studying surface diffusion. FIM have been employed by various research groups to study surface diffusion of adatoms. Because of limitations of the FIM, such studies are only limited to a few surfaces: nickel, platinum, aluminum, iridium, tungsten, and rhodium. From the theoretical standpoint, various atomistic simulations are performed to study surface diffusion. In most of these calculations the Embedded Atom Method (EAM) along with the molecular static (MS) simulation are utilized. The EAM is a semi-empirical approach for modeling the interatomic interactions. The MS simulation is a technique for minimizing the total energy of a system of particles with respect to the positions of its particles. One of the objectives of this work is to develop the EAM functions for Cu and use them in conjunction with the molecular static (MS) simulation to study diffusion of a Cu atom on a perfect as well as stepped Cu(100) surfaces. This will provide a test of the validity of the EAM functions on Cu(100) surface and near the stepped environments. In particular, we construct a terrace-ledge-kink (TLK) model and calculate the migration energies of an atom on a terrace, near a ledge site, near a kink site, and going over a descending step. We have also calculated formation energies of an atom on the bare surface, a vacancy in the surface, a stepped surface, and a stepped-kink surface. Our results are compared with the available experimental and theoretical results.

Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys

NASA Astrophysics Data System (ADS)

Celik, Fuat E.; Mavrikakis, Manos

2015-10-01

Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While the metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.

Surface composition of alloys

NASA Astrophysics Data System (ADS)

Sachtler, W. M. H.

1984-11-01

In equilibrium, the composition of the surface of an alloy will, in general, differ from that of the bulk. The broken-bond model is applicable to alloys with atoms of virtually equal size. If the heat of alloy formation is zero, the component of lower heat of atomization is found enriched in the surface. If both partners have equal heats of sublimination, the surface of a diluted alloy is enriched with the minority component. Size effects can enhance or weaken the electronic effects. In general, lattice strain can be relaxed by precipitating atoms of deviating size on the surface. Two-phase alloys are described by the "cherry model", i.e. one alloy phase, the "kernel" is surrounded by another alloy, the "flesh", and the surface of the outer phase, the "skin" displays a deviating surface composition as in monophasic alloys. In the presence of molecules capable of forming chemical bonds with individual metal atoms, "chemisorption induced surface segregation" can be observed at low temperatures, i.e. the surface becomes enriched with the metal forming the stronger chemisorption bonds.

Creating micro-scale surface topology to achieve anisotropic wettability on an aluminum surface

NASA Astrophysics Data System (ADS)

Sommers, Andrew D.; Jacobi, Anthony M.

2006-08-01

A technique for fabricating micropatterned aluminum surfaces with parallel grooves 30 µm wide and tens of microns in depth is described. Standard photolithographic techniques are used to obtain this precise surface-feature patterning. Positive photoresists, S1813 and AZ4620, are selected to mask the surface, and a mixture of BCl3 and Cl2 gases is used to perform the etching. Experimental data show that a droplet placed on the micro-grooved aluminum surface using a micro-syringe exhibits an increased apparent contact angle, and for droplets condensed on these etched surfaces, more than a 50% reduction in the volume needed for the onset of droplet sliding is manifest. No chemical surface treatment is necessary to achieve this water repellency; it is accomplished solely by an anisotropic surface morphology that manipulates droplet geometry and creates and exploits discontinuities in the three-phase contact line. These micro-structured surfaces are proposed for use in a broad range of air-cooling applications, where the management of condensate and defrost liquid on the heat transfer surface is essential to the energy-efficient operation of the machine.

Antibacterial Au nanostructured surfaces

NASA Astrophysics Data System (ADS)

Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun

2016-01-01

We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was <1% of that from flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It

Surface charge control for zwitterionic polymer brushes: Tailoring surface properties to antifouling applications.

PubMed

Guo, Shanshan; Jańczewski, Dominik; Zhu, Xiaoying; Quintana, Robert; He, Tao; Neoh, Koon Gee

2015-08-15

Electrostatic interactions play an important role in adhesion phenomena particularly for biomacromolecules and microorganisms. Zero charge valence of zwitterions has been claimed as the key to their antifouling properties. However, due to the differences in the relative strength of their acid and base components, zwitterionic materials may not be charge neutral in aqueous environments. Thus, their charge on surfaces should be further adjusted for a specific pH environment, e.g. physiological pH typical in biomedical applications. Surface zeta potential for thin polymeric films composed of polysulfobetaine methacrylate (pSBMA) brushes is controlled through copolymerizing zwitterionic SBMA and cationic methacryloyloxyethyltrimethyl ammonium chloride (METAC) via surface-initiated atom transfer polymerization. Surface properties including zeta potential, roughness, free energy and thickness are measured and the antifouling performance of these surfaces is assessed. The zeta potential of pSBMA brushes is -40 mV across a broad pH range. By adding 2% METAC, the zeta potential of pSBMA can be tuned to zero at physiological pH while minimally affecting other physicochemical properties including dry brush thickness, surface free energy and surface roughness. Surfaces with zero and negative zeta potential best resist fouling by bovine serum albumin, Escherichia coli and Staphylococcus aureus. Surfaces with zero zeta potential also reduce fouling by lysozyme more effectively than surfaces with negative and positive zeta potential. Copyright © 2015 Elsevier Inc. All rights reserved.

Bacterial resistance of self-assembled surfaces using PPOm-b-PSBMAn zwitterionic copolymer - concomitant effects of surface topography and surface chemistry on attachment of live bacteria.

PubMed

Hsiao, Sheng-Wen; Venault, Antoine; Yang, Hui-Shan; Chang, Yung

2014-06-01

Three well-defined diblock copolymers made of poly(sulfobetaine methacrylate) (poly(SBMA)) and poly(propylene oxide) (PPO) groups were synthesized by atom transfer radical polymerization (ATRP) method. They were physically adsorbed onto three types of surfaces having different topography, including smooth flat surface, convex surface, and indented surface. Chemical state of surfaces was characterized by XPS while the various topographies were examined by SEM and AFM. Hydrophilicity of surfaces was dependent on both the surface chemistry and the surface topography, suggesting that orientation of copolymer brushes can be tuned in the design of surfaces aimed at resisting bacterial attachment. Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans and Escherichia coli with green fluorescent protein (E. coli GFP) were used in bacterial tests to assess the resistance to bacterial attachment of poly(SBMA)-covered surfaces. Results highlighted a drastic improvement of resistance to bacterial adhesion with the increasing of poly(SBMA) to PPO ratio, as well as an important effect of surface topography. The chemical effect was directly related to the length of the hydrophilic moieties. When longer, more water could be entrapped, leading to improved anti-bacterial properties. The physical effect impacted on the orientation of the copolymer brushes, as well as on the surface contact area available. Convex surfaces as well as indented surfaces wafer presented the best resistance to bacterial adhesion. Indeed, bacterial attachment was more importantly reduced on these surfaces compared with smooth surfaces. It was explained by the non-orthogonal orientation of copolymer brushes, resulting in a more efficient surface coverage of zwitterionic molecules. This work suggests that not only the control of surface chemistry is essential in the preparation of surfaces resisting bacterial attachment, but also the control of surface topography and orientation of antifouling

Surface states and annihilation characteristics of positrons trapped at the oxidized Cu(100) surface

NASA Astrophysics Data System (ADS)

Fazleev, N. G.; Weiss, A. H.

2013-06-01

In this work we present the results of theoretical studies of positron surface and bulk states and annihilation probabilities of surface-trapped positrons with relevant core electrons at the oxidized Cu(100) surface under conditions of high oxygen coverage. Oxidation of the Cu(100) surface has been studied by performing an ab-initio investigation of the stability and electronic structure of the Cu(100) missing row reconstructed surface at various on-surface and subsurface oxygen coverages ranging from 0.5 to 1.5 monolayers using density functional theory (DFT). All studied structures have been found to be energetically more favorable as compared to structures formed by purely on-surface oxygen adsorption. The observed decrease in the positron work function when oxygen atoms occupy on-surface and subsurface sites has been attributed to a significant charge redistribution within the first two layers, buckling effects within each layer and an interlayer expansion. The computed positron binding energy, positron surface state wave function, and annihilation probabilities of the surface trapped positrons with relevant core electrons demonstrate their sensitivity to oxygen coverage, atomic structure of the topmost layers of surfaces, and charge transfer effects. Theoretical results are compared with experimental data obtained from studies of oxidation of the Cu(100) surface using positron annihilation induced Auger electron spectroscopy (PAES). The results presented provide an explanation for the changes observed in the probability of annihilation of surface trapped positrons with Cu 3p core-level electrons as a function of annealing temperature.

Inclusion of Solar Elevation Angle in Land Surface Albedo Parameterization Over Bare Soil Surface.

PubMed

Zheng, Zhiyuan; Wei, Zhigang; Wen, Zhiping; Dong, Wenjie; Li, Zhenchao; Wen, Xiaohang; Zhu, Xian; Ji, Dong; Chen, Chen; Yan, Dongdong

2017-12-01

Land surface albedo is a significant parameter for maintaining a balance in surface energy. It is also an important parameter of bare soil surface albedo for developing land surface process models that accurately reflect diurnal variation characteristics and the mechanism behind the solar spectral radiation albedo on bare soil surfaces and for understanding the relationships between climate factors and spectral radiation albedo. Using a data set of field observations, we conducted experiments to analyze the variation characteristics of land surface solar spectral radiation and the corresponding albedo over a typical Gobi bare soil underlying surface and to investigate the relationships between the land surface solar spectral radiation albedo, solar elevation angle, and soil moisture. Based on both solar elevation angle and soil moisture measurements simultaneously, we propose a new two-factor parameterization scheme for spectral radiation albedo over bare soil underlying surfaces. The results of numerical simulation experiments show that the new parameterization scheme can more accurately depict the diurnal variation characteristics of bare soil surface albedo than the previous schemes. Solar elevation angle is one of the most important factors for parameterizing bare soil surface albedo and must be considered in the parameterization scheme, especially in arid and semiarid areas with low soil moisture content. This study reveals the characteristics and mechanism of the diurnal variation of bare soil surface solar spectral radiation albedo and is helpful in developing land surface process models, weather models, and climate models.

Iron oxide surfaces

NASA Astrophysics Data System (ADS)

Parkinson, Gareth S.

2016-03-01

The current status of knowledge regarding the surfaces of the iron oxides, magnetite (Fe3O4), maghemite (γ-Fe2O3), haematite (α-Fe2O3), and wüstite (Fe1-xO) is reviewed. The paper starts with a summary of applications where iron oxide surfaces play a major role, including corrosion, catalysis, spintronics, magnetic nanoparticles (MNPs), biomedicine, photoelectrochemical water splitting and groundwater remediation. The bulk structure and properties are then briefly presented; each compound is based on a close-packed anion lattice, with a different distribution and oxidation state of the Fe cations in interstitial sites. The bulk defect chemistry is dominated by cation vacancies and interstitials (not oxygen vacancies) and this provides the context to understand iron oxide surfaces, which represent the front line in reduction and oxidation processes. Fe diffuses in and out from the bulk in response to the O2 chemical potential, forming sometimes complex intermediate phases at the surface. For example, α-Fe2O3 adopts Fe3O4-like surfaces in reducing conditions, and Fe3O4 adopts Fe1-xO-like structures in further reducing conditions still. It is argued that known bulk defect structures are an excellent starting point in building models for iron oxide surfaces. The atomic-scale structure of the low-index surfaces of iron oxides is the major focus of this review. Fe3O4 is the most studied iron oxide in surface science, primarily because its stability range corresponds nicely to the ultra-high vacuum environment. It is also an electrical conductor, which makes it straightforward to study with the most commonly used surface science methods such as photoemission spectroscopies (XPS, UPS) and scanning tunneling microscopy (STM). The impact of the surfaces on the measurement of bulk properties such as magnetism, the Verwey transition and the (predicted) half-metallicity is discussed. The best understood iron oxide surface at present is probably Fe3O4(100); the structure is

Surface-stabilized gold nanocatalysts

DOEpatents

Dai, Sheng [Knoxville, TN; Yan, Wenfu [Oak Ridge, TN

2009-12-08

A surface-stabilized gold nanocatalyst includes a solid support having stabilizing surfaces for supporting gold nanoparticles, and a plurality of gold nanoparticles having an average particle size of less than 8 nm disposed on the stabilizing surfaces. The surface-stabilized gold nanocatalyst provides enhanced stability, such as at high temperature under oxygen containing environments. In one embodiment, the solid support is a multi-layer support comprising at least a first layer having a second layer providing the stabilizing surfaces disposed thereon, the first and second layer being chemically distinct.

Mapping surface charge density of lipid bilayers by quantitative surface conductivity microscopy

PubMed Central

Klausen, Lasse Hyldgaard; Fuhs, Thomas; Dong, Mingdong

2016-01-01

Local surface charge density of lipid membranes influences membrane–protein interactions leading to distinct functions in all living cells, and it is a vital parameter in understanding membrane-binding mechanisms, liposome design and drug delivery. Despite the significance, no method has so far been capable of mapping surface charge densities under physiologically relevant conditions. Here, we use a scanning nanopipette setup (scanning ion-conductance microscope) combined with a novel algorithm to investigate the surface conductivity near supported lipid bilayers, and we present a new approach, quantitative surface conductivity microscopy (QSCM), capable of mapping surface charge density with high-quantitative precision and nanoscale resolution. The method is validated through an extensive theoretical analysis of the ionic current at the nanopipette tip, and we demonstrate the capacity of QSCM by mapping the surface charge density of model cationic, anionic and zwitterionic lipids with results accurately matching theoretical values. PMID:27561322

Optimum surface roughness prediction for titanium alloy by adopting response surface methodology

NASA Astrophysics Data System (ADS)

Yang, Aimin; Han, Yang; Pan, Yuhang; Xing, Hongwei; Li, Jinze

Titanium alloy has been widely applied in industrial engineering products due to its advantages of great corrosion resistance and high specific strength. This paper investigated the processing parameters for finish turning of titanium alloy TC11. Firstly, a three-factor central composite design of experiment, considering the cutting speed, feed rate and depth of cut, are conducted in titanium alloy TC11 and the corresponding surface roughness are obtained. Then a mathematic model is constructed by the response surface methodology to fit the relationship between the process parameters and the surface roughness. The prediction accuracy was verified by the one-way ANOVA. Finally, the contour line of the surface roughness under different combination of process parameters are obtained and used for the optimum surface roughness prediction. Verification experimental results demonstrated that material removal rate (MRR) at the obtained optimum can be significantly improved without sacrificing the surface roughness.

Mapping surface charge density of lipid bilayers by quantitative surface conductivity microscopy

NASA Astrophysics Data System (ADS)

Klausen, Lasse Hyldgaard; Fuhs, Thomas; Dong, Mingdong

2016-08-01

Local surface charge density of lipid membranes influences membrane-protein interactions leading to distinct functions in all living cells, and it is a vital parameter in understanding membrane-binding mechanisms, liposome design and drug delivery. Despite the significance, no method has so far been capable of mapping surface charge densities under physiologically relevant conditions. Here, we use a scanning nanopipette setup (scanning ion-conductance microscope) combined with a novel algorithm to investigate the surface conductivity near supported lipid bilayers, and we present a new approach, quantitative surface conductivity microscopy (QSCM), capable of mapping surface charge density with high-quantitative precision and nanoscale resolution. The method is validated through an extensive theoretical analysis of the ionic current at the nanopipette tip, and we demonstrate the capacity of QSCM by mapping the surface charge density of model cationic, anionic and zwitterionic lipids with results accurately matching theoretical values.

Mapping surface charge density of lipid bilayers by quantitative surface conductivity microscopy.

PubMed

Klausen, Lasse Hyldgaard; Fuhs, Thomas; Dong, Mingdong

2016-08-26

Local surface charge density of lipid membranes influences membrane-protein interactions leading to distinct functions in all living cells, and it is a vital parameter in understanding membrane-binding mechanisms, liposome design and drug delivery. Despite the significance, no method has so far been capable of mapping surface charge densities under physiologically relevant conditions. Here, we use a scanning nanopipette setup (scanning ion-conductance microscope) combined with a novel algorithm to investigate the surface conductivity near supported lipid bilayers, and we present a new approach, quantitative surface conductivity microscopy (QSCM), capable of mapping surface charge density with high-quantitative precision and nanoscale resolution. The method is validated through an extensive theoretical analysis of the ionic current at the nanopipette tip, and we demonstrate the capacity of QSCM by mapping the surface charge density of model cationic, anionic and zwitterionic lipids with results accurately matching theoretical values.

Nano- and Micro-Scale Oxidative Patterning of Titanium Implant Surfaces for Improved Surface Wettability.

PubMed

Kim, In-hye; Son, Jun Sik; Choi, Seok Hwa; Kim, Kyo-han; Kwon, Tae-yub

2016-02-01

A simple and scalable surface modification treatment is demonstrated, in which nano- and microscale features are introduced into the surface of titanium (Ti) substrates by means of a novel and eco-friendly oxidative aqueous solution composed of hydrogen peroxide (H202) and sodium bicarbonate (NaHCO3). By immersing mirror-polished Ti discs in an aqueous mixture of 30 wt% H2O2/5 wt% NaHCO3 at 23 +/- 3 degrees C for 4 h, it was confirmed that this mixture is capable of generating microscale topographies on Ti surfaces. It also simultaneously formed nanochannels that were regularly arranged in a comb-like pattern on the Ti surface, thus forming a hierarchical surface structure. Further, these nano/micro-textured Ti surfaces showed great surface roughness and excellent wettability when compared with control Ti surfaces. This study demonstrates that a H2O2/NaHCO3 mixture can be effectively utilized to create reproducible nano/microscale topographies on Ti implant surfaces, thus providing an economical new oxidative solution that may be used effectively and safely as a Ti surface modification treatment.

Surface characterization and adhesion and friction properties of hydrophobic leaf surfaces.

PubMed

Burton, Zachary; Bhushan, Bharat

2006-01-01

Super-hydrophobic surfaces as well as low adhesion and friction are desirable for various industrial applications. Certain plant leaves are known to be hydrophobic in nature. These leaves are hydrophobic due to the presence of microbumps and a thin wax film on the surface of the leaf. The purpose of this study is to fully characterize the leaf surface and to separate out the effects of the microbumps and the wax on the hydrophobicity. Furthermore, the adhesion and friction properties of the leaves, with and without wax, are studied. Using an optical profiler and an atomic/friction force microscope (AFM/FFM), measurements on the hydrophobic leaves, both with and without wax, were made to fully characterize the leaf surface. Using a model that predicts contact angle as a function of roughness, the roughness factor for the hydrophobic leaves has been calculated, which is used to calculate the contact angle for a flat leaf surface. It is shown that both the microbumps and the wax play an equally important role in the hydrophobic nature as well as adhesion and friction of the leaf. This study will be useful in developing super-hydrophobic surfaces.

Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys

DOE PAGES

Celik, Fuat E.; Mavrikakis, Manos

2015-01-12

Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less

Stability of Surface and Subsurface Hydrogen on and in Au/Ni Near-Surface Alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Celik, Fuat E.; Mavrikakis, Manos

2015-10-01

Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less

Modification of Surface Energy via Direct Laser Ablative Surface Patterning

NASA Technical Reports Server (NTRS)

Wohl, Christopher J., Jr. (Inventor); Belcher, Marcus A. (Inventor); Connell, John W. (Inventor); Hopkins, John W. (Inventor)

2015-01-01

Surface energy of a substrate is changed without the need for any template, mask, or additional coating medium applied to the substrate. At least one beam of energy directly ablates a substrate surface to form a predefined topographical pattern at the surface. Each beam of energy has a width of approximately 25 micrometers and an energy of approximately 1-500 microJoules. Features in the topographical pattern have a width of approximately 1-500 micrometers and a height of approximately 1.4-100 micrometers.

Bio-Inspired Functional Surfaces Based on Laser-Induced Periodic Surface Structures.

PubMed

Müller, Frank A; Kunz, Clemens; Gräf, Stephan

2016-06-15

Nature developed numerous solutions to solve various technical problems related to material surfaces by combining the physico-chemical properties of a material with periodically aligned micro/nanostructures in a sophisticated manner. The utilization of ultra-short pulsed lasers allows mimicking numerous of these features by generating laser-induced periodic surface structures (LIPSS). In this review paper, we describe the physical background of LIPSS generation as well as the physical principles of surface related phenomena like wettability, reflectivity, and friction. Then we introduce several biological examples including e.g., lotus leafs, springtails, dessert beetles, moth eyes, butterfly wings, weevils, sharks, pangolins, and snakes to illustrate how nature solves technical problems, and we give a comprehensive overview of recent achievements related to the utilization of LIPSS to generate superhydrophobic, anti-reflective, colored, and drag resistant surfaces. Finally, we conclude with some future developments and perspectives related to forthcoming applications of LIPSS-based surfaces.

Surface texturing of fluoropolymers

NASA Technical Reports Server (NTRS)

Banks, B. A.; Mirtich, M. J.; Sovey, J. S. (Inventor)

1982-01-01

A method is disclosed for improving surface texture for adhesive bonding, metal bonding, substrate plating, decal substrate preparation, and biomedical implant applications. The surface to be bonded is dusted in a controlled fashion to produce a disbursed layer of fine mesh particles which serve as masks. The surface texture is produced by impinging gas ions on the masked surface. The textured surface takes the form of pillars or cones. The bonding material, such as a liquid epoxy, flows between the pillars which results in a bond having increased strength. For bonding metals a thin film of metal is vapor or sputter deposited onto the textured surface. Electroplating or electroless plating is then used to increase the metal thickness in the desired amount.

Generation Mechanism of Nonlinear Rayleigh Surface Waves for Randomly Distributed Surface Micro-Cracks.

PubMed

Ding, Xiangyan; Li, Feilong; Zhao, Youxuan; Xu, Yongmei; Hu, Ning; Cao, Peng; Deng, Mingxi

2018-04-23

This paper investigates the propagation of Rayleigh surface waves in structures with randomly distributed surface micro-cracks using numerical simulations. The results revealed a significant ultrasonic nonlinear effect caused by the surface micro-cracks, which is mainly represented by a second harmonic with even more distinct third/quadruple harmonics. Based on statistical analysis from the numerous results of random micro-crack models, it is clearly found that the acoustic nonlinear parameter increases linearly with micro-crack density, the proportion of surface cracks, the size of micro-crack zone, and the excitation frequency. This study theoretically reveals that nonlinear Rayleigh surface waves are feasible for use in quantitatively identifying the physical characteristics of surface micro-cracks in structures.

Generation Mechanism of Nonlinear Rayleigh Surface Waves for Randomly Distributed Surface Micro-Cracks

PubMed Central

Ding, Xiangyan; Li, Feilong; Xu, Yongmei; Cao, Peng; Deng, Mingxi

2018-01-01

This paper investigates the propagation of Rayleigh surface waves in structures with randomly distributed surface micro-cracks using numerical simulations. The results revealed a significant ultrasonic nonlinear effect caused by the surface micro-cracks, which is mainly represented by a second harmonic with even more distinct third/quadruple harmonics. Based on statistical analysis from the numerous results of random micro-crack models, it is clearly found that the acoustic nonlinear parameter increases linearly with micro-crack density, the proportion of surface cracks, the size of micro-crack zone, and the excitation frequency. This study theoretically reveals that nonlinear Rayleigh surface waves are feasible for use in quantitatively identifying the physical characteristics of surface micro-cracks in structures. PMID:29690580

On the wettability diversity of C/SiC surface: Comparison of the ground C/SiC surface and ablated C/SiC surface from three aspects

NASA Astrophysics Data System (ADS)

Wu, M. L.; Ren, C. Z.; Xu, H. Z.

2016-11-01

The coefficient of thermal conductivity was influenced by the wetting state of material. The wetting state usually depends on the surface wettability. C/SiC is a promising ceramic composites with multi-components. The wettability of C/SiC composites is hard to resort to the classical wetting theory directly. So far, few investigations focused on C/SiC surface wettability diversity after different material removal processes. In this investigation, comparative studies of surface wettability of ground C/SiC surface and laser-ablated C/SiC surface were carried out through apparent contact angle (APCA) measurements. The results showed that water droplets easily reached stable state on ground C/SiC surface; while the water droplets rappidly penetrated into the laser-ablated C/SiC surface. In order to find out the reason for wettability distinctions between the ground C/SiC surface and the laser-ablated C/SiC surface, comparative studies on the surface micro-structure, surface C-O-Si distribution, and surface C-O-Si weight percentage were carried out. The results showed that (1) A large number of micro cracks in the fuzzy pattern layer over laser-ablated C/SiC surfaces easily destoried the surface tension of water droplets, while only a few cracks existed over the ground C/SiC surfaces. (2) Chemical components (C, O, Si) were non-uniformly distributed on ground C/SiC surfaces, while the chemical components (C, O, Si) were uniformly distributed on laser-ablated C/SiC surfaces. (3) The carbon weight percentage on ground C/SiC surfaces were higher than that on laser-ablated C/SiC surfaces. All these made an essential contribution to the surface wettability diversity of C/SiC surface. Although more investigations about the quantitative influence of surface topography and surface chemical composition on composites wettability are still needed, the conslusion can be used in application: the wettability of C/SiC surface can be controlled by different material removal process

Structural-phase states and wear resistance of surface formed on steel by surfacing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapralov, Evgenie V.; Raykov, Sergey V.; Vaschuk, Ekaterina S.

2014-11-14

Investigations of elementary and phase structure, state of defect structure and tribological characteristics of a surfacing, formed on a low carbon low-alloy steel by a welding method were carried out. It was revealed that a surfacing, formed on a steel surface is accompanied by the multilayer formation, and increases the wear resistance of the layer surfacing as determined.

Evaluation of the surface roughness of zirconia ceramics after different surface treatments.

PubMed

Kirmali, Omer; Akin, Hakan; Kapdan, Alper

2014-08-01

This study aimed to investigate the effects of different mechanical surface treatments of pre-sintered zirconium oxide (ZrO2) in an attempt to improve its bonding potential. One hundred and twenty IPS e-max ZirCAD (Ivoclar Vivadent) pre-sintered zirconia blocks (7 mm diameter, 3 mm height) received six different surface treatments (n = 20): Group C was untreated (control); Group E was Er:YAG laser irradiated; Group N was Nd:YAG laser irradiated; Group SB was sandblasted, Group SN was sandblasted and Nd:YAG laser irradiated; and Group SE was sandblasted and Er:YAG laser irradiated. After the surface treatments, the average surface roughness (Ra, µm) of each specimen was determined with a profilometer, then all the specimens were sintered. The surface roughness values were analysed through one-way ANOVA and Tukey's test. Changes in the morphological characteristics of ZrO2 were examined through scanning electron microscopy (SEM). Sintered sandblasted, Er:YAG laser treatment, sandblasted + Er:YAG laser and sandblasted + Nd:YAG laser irradiation resulted in a rougher surface than the other treatments. Nd:YAG laser irradiation alone was not effective in altering the zirconia surface morphology.

DNA ELECTROPHORESIS AT SURFACES

DOE Office of Scientific and Technical Information (OSTI.GOV)

RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

2003-09-01

During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in themore » different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.« less

Evaluation of a surface/vegetation parameterization using satellite measurements of surface temperature

NASA Technical Reports Server (NTRS)

Taconet, O.; Carlson, T.; Bernard, R.; Vidal-Madjar, D.

1986-01-01

Ground measurements of surface-sensible heat flux and soil moisture for a wheat-growing area of Beauce in France were compared with the values derived by inverting two boundary layer models with a surface/vegetation formulation using surface temperature measurements made from NOAA-AVHRR. The results indicated that the trends in the surface heat fluxes and soil moisture observed during the 5 days of the field experiment were effectively captured by the inversion method using the remotely measured radiative temperatures and either of the two boundary layer methods, both of which contain nearly identical vegetation parameterizations described by Taconet et al. (1986). The sensitivity of the results to errors in the initial sounding values or measured surface temperature was tested by varying the initial sounding temperature, dewpoint, and wind speed and the measured surface temperature by amounts corresponding to typical measurement error. In general, the vegetation component was more sensitive to error than the bare soil model.

Surface profile changes of scuffed bearing surfaces. [before and after acid treatment

NASA Technical Reports Server (NTRS)

Lauer, J. L.; Fung, S. S.; Jones, W. R., Jr.

1982-01-01

A phase locked interference microscope capable of resolving depth differences to 30 A and planar displacements of 6000 A was constructed for the examination of the profiles of bearing surfaces without physical contact. This instrument was used to determine surface chemical reactivity by applying a drop of dilute alcoholic hydrochloric acid and measuring the profile of the solid surface before and after application of this probe. Scuffed bearing surfaces reacted much faster than unscuffed ones, but bearing surfaces which had been previously exposed to lubricants containing an organic chloride reacted much more slowly. In a separate series of experiments, a number of stainless steel plates were heated in a nitrogen atmosphere to different temperatures and their reactivity examined later at room temperature. The change of surface contour as a result of the probe reaction followed an Arrhenius type relation with respect to heat treatment temperature. This result could have implications on the scuffing mechanism.

Characteristics of Turbulent Airflow Deduced from Rapid Surface Thermal Fluctuations: An Infrared Surface Anemometer

NASA Astrophysics Data System (ADS)

Aminzadeh, Milad; Breitenstein, Daniel; Or, Dani

2017-12-01

The intermittent nature of turbulent airflow interacting with the surface is readily observable in fluctuations of the surface temperature resulting from the thermal imprints of eddies sweeping the surface. Rapid infrared thermography has recently been used to quantify characteristics of the near-surface turbulent airflow interacting with the evaporating surfaces. We aim to extend this technique by using single-point rapid infrared measurements to quantify properties of a turbulent flow, including surface exchange processes, with a view towards the development of an infrared surface anemometer. The parameters for the surface-eddy renewal (α and β ) are inferred from infrared measurements of a single-point on the surface of a heat plate placed in a wind tunnel with prescribed wind speeds and constant mean temperatures of the surface. Thermally-deduced parameters are in agreement with values obtained from standard three-dimensional ultrasonic anemometer measurements close to the plate surface (e.g., α = 3 and β = 1/26 (ms)^{-1} for the infrared, and α = 3 and β = 1/19 (ms)^{-1} for the sonic-anemometer measurements). The infrared-based turbulence parameters provide new insights into the role of surface temperature and buoyancy on the inherent characteristics of interacting eddies. The link between the eddy-spectrum shape parameter α and the infrared window size representing the infrared field of view is investigated. The results resemble the effect of the sampling height above the ground in sonic anemometer measurements, which enables the detection of larger eddies with higher values of α . The physical basis and tests of the proposed method support the potential for remote quantification of the near-surface momentum field, as well as scalar-flux measurements in the immediate vicinity of the surface.

Impact of initial surface parameters on the final quality of laser micro-polished surfaces

NASA Astrophysics Data System (ADS)

Chow, Michael; Bordatchev, Evgueni V.; Knopf, George K.

2012-03-01

Laser micro-polishing (LμP) is a new laser-based microfabrication technology for improving surface quality during a finishing operation and for producing parts and surfaces with near-optical surface quality. The LμP process uses low power laser energy to melt a thin layer of material on the previously machined surface. The polishing effect is achieved as the molten material in the laser-material interaction zone flows from the elevated regions to the local minimum due to surface tension. This flow of molten material then forms a thin ultra-smooth layer on the top surface. The LμP is a complex thermo-dynamic process where the melting, flow and redistribution of molten material is significantly influenced by a variety of process parameters related to the laser, the travel motions and the material. The goal of this study is to analyze the impact of initial surface parameters on the final surface quality. Ball-end micromilling was used for preparing initial surface of samples from H13 tool steel that were polished using a Q-switched Nd:YAG laser. The height and width of micromilled scallops (waviness) were identified as dominant parameter affecting the quality of the LμPed surface. By adjusting process parameters, the Ra value of a surface, having a waviness period of 33 μm and a peak-to-valley value of 5.9 μm, was reduced from 499 nm to 301 nm, improving the final surface quality by 39.7%.

Surface nanobubbles and nanodroplets

NASA Astrophysics Data System (ADS)

Lohse, Detlef; Zhang, Xuehua

2015-07-01

Surface nanobubbles are nanoscopic gaseous domains on immersed substrates which can survive for days. They were first speculated to exist about 20 years ago, based on stepwise features in force curves between two hydrophobic surfaces, eventually leading to the first atomic force microscopy (AFM) image in 2000. While in the early years it was suspected that they may be an artifact caused by AFM, meanwhile their existence has been confirmed with various other methods, including through direct optical observation. Their existence seems to be paradoxical, as a simple classical estimate suggests that they should dissolve in microseconds, due to the large Laplace pressure inside these nanoscopic spherical-cap-shaped objects. Moreover, their contact angle (on the gas side) is much smaller than one would expect from macroscopic counterparts. This review will not only give an overview on surface nanobubbles, but also on surface nanodroplets, which are nanoscopic droplets (e.g., of oil) on (hydrophobic) substrates immersed in water, as they show similar properties and can easily be confused with surface nanobubbles and as they are produced in a similar way, namely, by a solvent exchange process, leading to local oversaturation of the water with gas or oil, respectively, and thus to nucleation. The review starts with how surface nanobubbles and nanodroplets can be made, how they can be observed (both individually and collectively), and what their properties are. Molecular dynamic simulations and theories to account for the long lifetime of the surface nanobubbles are then reported on. The crucial element contributing to the long lifetime of surface nanobubbles and nanodroplets is pinning of the three-phase contact line at chemical or geometric surface heterogeneities. The dynamical evolution of the surface nanobubbles then follows from the diffusion equation, Laplace's equation, and Henry's law. In particular, one obtains stable surface nanobubbles when the gas influx from

Method for large-scale fabrication of atomic-scale structures on material surfaces using surface vacancies

DOEpatents

Lim, Chong Wee; Ohmori, Kenji; Petrov, Ivan Georgiev; Greene, Joseph E.

2004-07-13

A method for forming atomic-scale structures on a surface of a substrate on a large-scale includes creating a predetermined amount of surface vacancies on the surface of the substrate by removing an amount of atoms on the surface of the material corresponding to the predetermined amount of the surface vacancies. Once the surface vacancies have been created, atoms of a desired structure material are deposited on the surface of the substrate to enable the surface vacancies and the atoms of the structure material to interact. The interaction causes the atoms of the structure material to form the atomic-scale structures.

Surface characterization

Treesearch

Mandla A. Tshabalala

2005-01-01

Surface properties of wood play an important role when wood is used or processed into different commodities such as siding, joinery, textiles, paper, sorption media or wood composites. Thus, for example, the quality and durability of a wood coating are determined by the surface properties of the wood and the coating. The same is true for wood composites, as the...

Bio-Inspired Functional Surfaces Based on Laser-Induced Periodic Surface Structures

PubMed Central

Müller, Frank A.; Kunz, Clemens; Gräf, Stephan

2016-01-01

Nature developed numerous solutions to solve various technical problems related to material surfaces by combining the physico-chemical properties of a material with periodically aligned micro/nanostructures in a sophisticated manner. The utilization of ultra-short pulsed lasers allows mimicking numerous of these features by generating laser-induced periodic surface structures (LIPSS). In this review paper, we describe the physical background of LIPSS generation as well as the physical principles of surface related phenomena like wettability, reflectivity, and friction. Then we introduce several biological examples including e.g., lotus leafs, springtails, dessert beetles, moth eyes, butterfly wings, weevils, sharks, pangolins, and snakes to illustrate how nature solves technical problems, and we give a comprehensive overview of recent achievements related to the utilization of LIPSS to generate superhydrophobic, anti-reflective, colored, and drag resistant surfaces. Finally, we conclude with some future developments and perspectives related to forthcoming applications of LIPSS-based surfaces. PMID:28773596

Enhanced perfume surface delivery to interfaces using surfactant surface multilayer structures.

PubMed

Bradbury, Robert; Penfold, Jeffrey; Thomas, Robert K; Tucker, Ian M; Petkov, Jordan T; Jones, Craig

2016-01-01

Enhanced surface delivery and retention of perfumes at interfaces are the keys to their more effective and efficient deployment in a wide range of home and personal care related formulations. It has been previously demonstrated that the addition of multivalent counterions, notably Ca(2+), induces multilayer adsorption at the air-water interface for the anionic surfactant, sodium dodecyl-6-benzenesulfonate, LAS-6. Neutron reflectivity, NR, measurements are reported here which demonstrate that such surfactant surface multilayer structures are a potentially promising vehicle for enhanced delivery of perfumes to interfaces. The data show that the incorporation of the model perfumes, phenylethanol, PE, and linalool, LL, into the surface multilayer structure formed by LAS-6/Ca(2+) results in the surface structures being retained up to relatively high perfume mole fractions. Furthermore the amount of perfume at the surface is enhanced by at least an order of magnitude, compared to that co-adsorbed with a surfactant monolayer. Copyright © 2015 Elsevier Inc. All rights reserved.

Use of structured surfaces for friction and wear control on bearing surfaces

NASA Astrophysics Data System (ADS)

Wang, Ling

2014-10-01

Surface texturing with purposely made regular micropatterns on flat or curved surfaces, as opposed to random roughness inherited from machining processes, has attracted significant attention in recent years. At the 2013 World Tribology Congress in Turin alone there were over 40 presentations related to surface texturing for tribological applications, from magnetic hard discs and hydrodynamic bearings to artificial joints. Although surface texturing has been reported being successfully applied in industrial applications such as seals, pistons, and thrust pad bearings, the demand for robust design is still high. Etsion has recently reviewed the modeling research mainly conducted by his group Etsion I (2013 Friction 1 195-209). This paper aims to review the state-of-the-art development of surface texturing made by a wider range of researchers.

Surface faulting. A preliminary view

USGS Publications Warehouse

Sharp, R.V.

1989-01-01

This description of surface faulting near Spitak, Armenia, is based on a field inspection made December 22-26, 1988. The surface rupture west of Spitak, displacement of the ground surface, pre-earthquake surface expressions of the fault, and photolineaments in landsat images are described and surface faulting is compared to aftershocks. It is concluded that the 2 meters of maximum surface displacement fits well within the range of reliably measured maximum surface offsets for historic reverse and oblique-reverse faulting events throughout the world. By contrast, the presently known length of surface rupture near Spitak, between 8 and 13 km, is shorter than any other reverse or oblique-reverse event of magnitude greater than 6.0. This may be a reason to suppose that additional surface rupture might remain unmapped.

Surface Microwave and Surface Transversal Pulsed-Periodic Discharges in Supersonic Flow

DTIC Science & Technology

2004-03-01

plasmas of different types of gas discharges near the surface of Aerodynamic models and in the boundary layers. Also, the contractor will develop modes...regions near the surface. The following experimental work will be done in supersonic air flow (Mɚ) at pressures between 1 and 200 Torr: a...198 CHAPTER IX NUMERICAL CALCULATION OF CHARACTERISTICS OF SUPERSONIC FLOW NEAR A FLAT PLATE WITH MICROWAVE DISCHARGE ON ITS SURFACE

EDITORIAL: Molecular switches at surfaces Molecular switches at surfaces

NASA Astrophysics Data System (ADS)

Weinelt, Martin; von Oppen, Felix

2012-10-01

In nature, molecules exploit interaction with their environment to realize complex functionalities on the nanometer length scale. Physical, chemical and/or biological specificity is frequently achieved by the switching of molecules between microscopically different states. Paradigmatic examples are the energy production in proton pumps of bacteria or the signal conversion in human vision, which rely on switching molecules between different configurations or conformations by external stimuli. The remarkable reproducibility and unparalleled fatigue resistance of these natural processes makes it highly desirable to emulate nature and develop artificial systems with molecular functionalities. A promising avenue towards this goal is to anchor the molecular switches at surfaces, offering new pathways to control their functional properties, to apply electrical contacts, or to integrate switches into larger systems. Anchoring at surfaces allows one to access the full range from individual molecular switches to self-assembled monolayers of well-defined geometry and to customize the coupling between molecules and substrate or between adsorbed molecules. Progress in this field requires both synthesis and preparation of appropriate molecular systems and control over suitable external stimuli, such as light, heat, or electrical currents. To optimize switching and generate function, it is essential to unravel the geometric structure, the electronic properties and the dynamic interactions of the molecular switches on surfaces. This special section, Molecular Switches at Surfaces, collects 17 contributions describing different aspects of this research field. They analyze elementary processes, both in single molecules and in ensembles of molecules, which involve molecular switching and concomitant changes of optical, electronic, or magnetic properties. Two topical reviews summarize the current status, including both challenges and achievements in the field of molecular switches on

Durable, Low-Surface-Energy Treatments

NASA Technical Reports Server (NTRS)

Willis, Paul B.; Mcelroy, Paul M.; Hickey, Gregory S.

1992-01-01

Chemical treatment for creation of durable, low-surface-energy coatings for glass, ceramics and other protonated surfaces easily applied, and creates very thin semipermanent film with extremely low surface tension. Exhibits excellent stability; surfaces retreated if coating becomes damaged or eroded. Uses include water-repellent surfaces, oil-repellent surfaces, antimigration barriers, corrosion barriers, mold-release agents, and self-cleaning surfaces. Film resists wetting by water, alcohols, hydrocarbon solvents, and silicone oil. Has moderate resistance to abrasion, such as rubbing with cloths, and compression molding to polymers and composite materials.

Controlling the surface photovoltage on WSe2 by surface chemical modification

NASA Astrophysics Data System (ADS)

Liu, Ro-Ya; Ozawa, Kenichi; Terashima, Naoya; Natsui, Yuto; Feng, Baojie; Ito, Suguru; Chen, Wei-Chuan; Cheng, Cheng-Maw; Yamamoto, Susumu; Kato, Hiroo; Chiang, Tai-Chang; Matsuda, Iwao

2018-05-01

The surface photovoltage (SPV) effect is key to the development of opto-electronic devices such as solar-cells and photo-detectors. For the prototypical transition metal dichalcogenide WSe2, core level and valence band photoemission measurements show that the surface band bending of pristine cleaved surfaces can be readily modified by adsorption with K (an electron donor) or C60 (an electron acceptor). Time-resolved pump-probe photoemission measurements reveal that the SPV for pristine cleaved surfaces is enhanced by K adsorption, but suppressed by C60 adsorption, and yet the SPV relaxation time is substantially shortened in both cases. Evidently, adsorbate-induced electronic states act as electron-hole recombination centers that shorten the carrier lifetime.

Microswimmers near surfaces

NASA Astrophysics Data System (ADS)

Elgeti, Jens; Gompper, Gerhard

2016-11-01

Both, in their natural environment and in a controlled experimental setup, microswimmers regularly interact with surfaces. These surfaces provide a steric boundary, both for the swimming motion and the hydrodynamic flow pattern. These effects typically imply a strong accumulation of microswimmers near surfaces. While some generic features can be derived, details of the swimmer shape and propulsion mechanism matter, which give rise to a broad range of adhesion phenomena and have to be taken into account to predict the surface accumulation for a given swimmer. We show in this minireview how numerical simulations and analytic theory can be used to predict the accumulation statistics for different systems, with an emphasis on swimmer shape, hydrodynamics interactions, and type of noisy dynamics.

Effects of surface wettability and contact time on protein adhesion to biomaterial surfaces

PubMed Central

Xu, Li-Chong; Siedlecki, Christopher A.

2013-01-01

Atomic force microscopy (AFM) was used to directly measure the adhesion forces between three test proteins and low density polyethylene (LDPE) surfaces treated by glow discharge plasma to yield various levels of water wettability. The adhesion of proteins to the LDPE substrates showed a step dependence on the wettability of surfaces as measured by the water contact angle (θ). For LDPE surfaces with θ > ∼60–65°, stronger adhesion forces were observed for bovine serum albumin, fibrinogen and human FXII than for the surfaces with θ < 60°. Smaller adhesion forces were observed for FXII than for the other two proteins on all surfaces although trends were identical. Increasing the contact time from 0 to 50 s for each protein–surface combination increased the adhesion force regardless of surface wettability. Time varying adhesion data was fit to an exponential model and free energies of protein unfolding were calculated. This data, viewed in light of previously published studies, suggests a 2-step model of protein denaturation, an early stage on the order of seconds to minutes where the outer surface of the protein interacts with the substrate and a second stage involving movement of hydrophobic amino acids from the protein core to the protein/surface interface. Impact statement The work described in this manuscript shows a stark transition between protein adherent and protein non-adherent materials in the range of water contact angles 60–65°, consistent with known changes in protein adsorption and activity. Time-dependent changes in adhesion force were used to calculate unfolding energies relating to protein–surface interactions. This analysis provides justification for a 2-step model of protein denaturation on surfaces. PMID:17466368

CYGNSS Surface Wind Observations and Surface Flux Estimates within Low-Latitude Extratropical Cyclones

NASA Astrophysics Data System (ADS)

Crespo, J.; Posselt, D. J.

2017-12-01

The Cyclone Global Navigation Satellite System (CYGNSS), launched in December 2016, aims to improve estimates of surface wind speeds over the tropical oceans. While CYGNSS's core mission is to provide better estimates of surface winds within the core of tropical cyclones, previous research has shown that the constellation, with its orbital inclination of 35°, also has the ability to observe numerous extratropical cyclones that form in the lower latitudes. Along with its high spatial and temporal resolution, CYGNSS can provide new insights into how extratropical cyclones develop and evolve, especially in the presence of thick clouds and precipitation. We will demonstrate this by presenting case studies of multiple extratropical cyclones observed by CYGNSS early on in its mission in both Northern and Southern Hemispheres. By using the improved estimates of surface wind speeds from CYGNSS, we can obtain better estimates of surface latent and sensible heat fluxes within and around extratropical cyclones. Surface heat fluxes, driven by surface winds and strong vertical gradients of water vapor and temperature, play a key role in marine cyclogenesis as they increase instability within the boundary layer and may contribute to extreme marine cyclogenesis. In the past, it has been difficult to estimate surface heat fluxes from space borne instruments, as these fluxes cannot be observed directly from space, and deficiencies in spatial coverage and attenuation from clouds and precipitation lead to inaccurate estimates of surface flux components, such as surface wind speeds. While CYGNSS only contributes estimates of surface wind speeds, we can combine this data with other reanalysis and satellite data to provide improved estimates of surface sensible and latent heat fluxes within and around extratropical cyclones and throughout the entire CYGNSS mission.

Photogrammetry: An available surface characterization tool for solar concentrators. Part 2: Assessment of surfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shortis, M.; Johnston, G.

1997-11-01

In a previous paper, the results of photogrammetric measurements of a number of paraboloidal reflecting surfaces were presented. These results showed that photogrammetry can provide three-dimensional surface characterizations of such solar concentrators. The present paper describes the assessment of the quality of these surfaces as a derivation of the photogrammetrically produced surface coordinates. Statistical analysis of the z-coordinate distribution of errors indicates that these generally conform to a univariate Gaussian distribution, while the numerical assessment of the surface normal vectors on these surfaces indicates that the surface normal deviations appear to follow an approximately bivariate Gaussian distribution. Ray tracing ofmore » the measured surfaces to predict the expected flux distribution at the focal point of the 400 m{sup 2} dish show a close correlation with the videographically measured flux distribution at the focal point of the dish.« less

Antibacterial Au nanostructured surfaces.

PubMed

Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun

2016-02-07

We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was <1% of that from flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.