Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal
2016-06-15
This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.
Genetics Home Reference: beta thalassemia
... Facebook Twitter Home Health Conditions Beta thalassemia Beta thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Beta thalassemia is a blood disorder that reduces the production ...
Amoozgar, Hamid; Zeighami, Samaneh; Haghpanah, Sezaneh; Karimi, Mehran
2017-01-01
The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. A P-value of less than 0.05 was considered statistically significant. The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (P<0.05). Pulmonary acceleration time as an indicator of pulmonary pressure was lower in beta thalassemia intermedia group. Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure.
Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai
2018-01-01
Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis
Hagag, Adel A; Elgamsy, Mohamed A; El-Asy, Hassan M; Gamal, Rasha M; Elshahaby, Walid N; Abd Elbar, Enaam S
2016-01-01
'Beta thalassemia is inherited hemoglobin disorder resulting in chronic hemolytic anemia that requires lifelong transfusion therapy'. 'Repeated blood transfusions and RBCs hemolysis are the main causes of iron overload', which in addition to immune abnormalities, are common predisposing factors to infections in patients with thalassemia. The Aim of this Work: The aim of this work was to study immune status including T lymphocyte subsets and serum immunoglobulin levels 'in children with beta- thalassemia in correlation with iron overload'. The present 'study was conducted on 40 children with beta thalassemia major under follow up at Hematology Unit, Pediatric Department, Tanta University' 'including 24 males and 16 females with mean' age value of 9. 22 ± 3.9 years and 20 'healthy children of matched age and sex as a control group'. All children included in the study were subjected to; 'complete blood count, Hb electrophoresis, serum iron status', T cell subsets including CD3, CD4 and CD8 and serum immunoglobulin levels including IgM, IgA and IgG. 'Pallor and jaundice were the most common presenting' clinical manifestations. Infective episodes 'were significantly higher in patients' compared with controls. There were significantly lower Hb, MCV and MCH levels and significantly higher WBCs and platelets counts, reticulocytes and lymphocytes percentage in patients than controls and no significant differences in MCHC between patients and controls. Serum ferritin and iron were 'significantly higher but TIBC was significantly lower in' patients than controls. CD3, CD4 and IgM were significantly lower but CD8, IgG, and IgA 'were significantly higher in patients than controls' with negative correlation between CD3, CD4, IgM and ferritin and positive correlation between CD8, IgG, IgA and ferritin. Iron overload can affect humeral and cell mediated immunity in patients with beta thalassemia with reduction of IgM, CD3 and CD4 and elevation of CD8, IgG, and IgA. Regular follow
Molecular basis of beta-thalassemia in the Maldives.
Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y
1998-03-01
We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.
Lee, Anselm C W; Ma, Edmond S K; Chan, Amy Y Y; Szeto, S C; Chan, L C
2008-01-01
An extended family with three individuals affected by two different forms of double heterozygosity for beta-thalassemia and Hb New York is reported. Double heterozygosity of Hb New York [beta 113 GTG-->GAG; VAL-->GLU] and beta degrees codon 17 was detected in a fetus following prenatal screening for thalassemia. The father and a paternal aunt were also found to be heterozygous for Hb New York and beta degrees IVSII-654. Both adults had clinical and hematological features consistent with beta-thalassemia trait. The affected child was followed up after birth and manifested the typical course of a thalassemia trait, with no signs of organomegaly or overt hemolysis. Observations strongly suggest that double heterozygosity of Hb New York and beta degrees thalassemia has mild, if any, clinical symptoms, and is not an indication of therapeutic abortion when detected antenatally.
Is beta-thalassemia trait a protective factor against ischemic cerebrovascular accidents?
Karimi, Mehran; Borhani Haghighi, Afshin; Yazdani, Maryam; Raisi, Hamideh; Giti, Rahil; Namazee, Mohammad Reza
2008-01-01
In this research, we sought to determine the association between beta-thalassemia trait and ischemic cerebrovascular accident (CVA). In acase-control study, 148 patients with thromboembolic cerebrovascular events were evaluated for the presence of hypertension, diabetes mellitus, hyperlipidemia, and beta-thalassemia trait. A total of 156 age- and sex-matched patients with no cardiac or cerebrovascular diseases, serving as the control group, were also investigated for the above-mentioned risk factors. We found that 6.1% of patients with ischemic CVA and 12.2% of the control group had beta-thalassemia trait (P = .066). In male patients, the negative association between ischemic CVA and presence of beta-thalassemia trait was significant (P = .008). In patients, the prevalence of hypertension was also significantly different between those with and without beta-thalassemia trait (P = .01); those with beta-thalassemia trait had a lower mean blood pressure than those without the trait. beta-Thalassemia trait may have a protective effect against ischemic CVA that might be caused by the lower arterial blood pressure observed in those with this trait.
Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai
2014-01-01
Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381
Ophthalmic Evaluation in Beta-Thalassemia.
Merchant, Rashid H; Punde, Hrishikesh; Thacker, Neepa; Bhatt, Deepak
2017-07-01
To determine the association of ocular manifestations in beta-thalassemia with the patient's age, blood transfusion requirements, average serum ferritin and dose and duration of iron chelation therapy. Sixty multi-transfused beta thalassemia patients of 12 to 18 y of age on chelation therapy were included in this cross-sectional analysis. Structural and functional evaluation of the retina was done using Optical coherence tomography (OCT) and Electroretinography (ERG), including flash ERG and Pattern ERG (PERG). Routine ophthalmic examination and B scan of the eye was also done. Flash ERG a-waves and b-waves were recorded, however only a-wave amplitude was evaluated. Pattern ERG n35, n95 and p50 waves were recorded and p50 wave amplitude was evaluated. The a-wave on flash and p50 on pattern waves represent retinal photoreceptor epithelium (RPE) photoreceptor response, which is mainly affected in beta-thalassemia. Ocular changes were detected in 38.3% and a significant correlation was noted with increase in age (p = 0.045) but not with serum ferritin, transfusion requirements or chelation therapy. Refractive errors were found in 14 cases (23%), such as myopia with astigmatism in 13 (21.7%) and only myopia in 6 subjects (10%). OCT abnormality was noted in 1 patient (1.7%) who had thinning of central retina; right eye 132 μm and left eye 146 μm (n > 200 μm). Abnormalities were noted in a-wave amplitude on flash ERG in 20% of cases, while reduced p50 amplitude on PERG was noted in 15%. A significant correlation was noted between ocular findings and increase in age, but not with serum ferritin, transfusion requirements or chelation therapy. ERG appears to be a promising tool for screening patients with beta-thalassemia and can serve as a follow-up test for evaluating retinal function.
Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G
1981-01-01
Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with Hb E-beta-thalassemia and Hb E trait. The initial rate of beta-globin synthesis (betaE/alpha=0.20-0.34) was less than expected on the basis of gene dosage, or comparable studies of other compound heterozygous states for beta-thalassemia and structurally abnormal beta-chains. betaE-globin synthesis was not only reduced during short-term incubations (1-5 min), but also remained relatively unchanged during long-term pulse or chase incubations up to 5h. Analysis of globin mRNA by cell-free translation and molecular hybridization confirmed that the unexpectedly low levels of betaE-globin synthesis were associated with comparable reduction in the levels of beta-globin mRNA. In Hb E-beta-thalassemia the betaA + betaE (alpha globin nRNA ratio observed were substantially lower than those obtained from reticulocytes of patients with heterozygous beta-thalassemia, or Hb S-betaO-thalassemia, while in Hb E trait, the betaA + betaE/alpha mRNA ratio was in the ranged observed for beta-thalassemia trait. The betaE-globin gene specifies reduced accumulation of betaE-globin mRNA, a property characteristic of other forms of beta-thalassemia. The beta-thalassemia phenotype associated with inheritance of Hb E is thus determined at the level of beta-globin mRNA metabolism. PMID:6166632
Pregnancy outcomes among women with beta-thalassemia trait.
Charoenboon, Chitrakan; Jatavan, Phudit; Traisrisilp, Kuntharee; Tongsong, Theera
2016-04-01
To compare the obstetric outcomes between pregnant women affected by beta-thalassemia trait and normal controls. A retrospective cohort study was conducted on singleton pregnant women complicated by beta-thalassemia trait and normal controls, randomly selected with the controls-to-case ratio of 2:1. All were low-risk pregnancies without underlying medical diseases and fetal anomalies. The pregnancies undergoing invasive prenatal diagnosis were excluded. A total of 597 pregnant women with beta-thalassemia trait and 1194 controls were recruited. Baseline characteristics and maternal outcomes in the two groups were similar, except that hemoglobin levels were slightly lower in the study group. The prevalence of small for gestational age and preterm birth tended to be higher in the study group but not reached the significant levels but the rate of low birth weight was significantly higher in the study group (relative risk 1.25; 95 % CI 1.00-1.57). Additionally, abortion rate was also significantly higher in the study group (relative risk 3.25; 95 % CI 1.35-7.80). Beta-thalassemia trait could minimally, but significantly, increase risk of low birth weight but did not increase rates of maternal adverse outcomes.
Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A
2005-01-01
Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.
Beta-thalassemia intermedia associated with moyamoya syndrome.
Göksel, Basak Karakurum; Ozdogu, Hakan; Yildirim, Tulin; Oğuzkurt, Levent; Asma, Suheyl
2010-07-01
Moyamoya syndrome (MMS) is a progressive disorder. We report a 19-year-old boy with beta-thalassemia who presented with a left hemiparesis. Brain MRI showed old middle cerebral artery and left frontal subcortical white matter infarcts. Brain magnetic resonance angiography and digital subtraction angiography revealed occlusion of the bilateral internal carotid arteries with a rich network of basal collateral vessels. To our knowledge this is the third report of beta-thalassemia intermedia and MMS, and the first report of a patient in Turkey. It emphasizes the potential for cerebral infarct due to anemia, protein S and thrombocytosis.
High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.
Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong
2017-12-01
High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.
Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan
2007-05-01
We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.
Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle
NASA Astrophysics Data System (ADS)
Sakhnini, Lama
2003-05-01
In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.
George, Elizabeth; Ann, T J A Mary
2010-12-01
The haemoglobinopathies and thalassemias represent the most common inherited monogenic disorders in the world. Beta-thalassaemia major is an ongoing public health problem in Malaysia. Prior to 2004, the country had no national policy for screening and registry for thalassemia. In the absence of a national audit, the true figure of the extent of thalassemia in the Malaysian population was largely presumptive from micro-mapping studies from various research workers in the country. The estimated carrier rate for beta-thalassemia in Malaysia is 3.5-4%. There were 4768 transfusion dependent thalassemia major patients as of May 2010 (Data from National Thalassemia Registry).
Thalassemia major and consanguinity in Shiraz city, Iran.
Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh
2004-09-05
Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (p< 0.00001). A nonstatistically significant difference was observed between male (53.5%) and female (46.5%) thalassemia patients. Comparison of data with the situation in 22 years ago revealed a 16.4% decrease in familial marriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.
Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.
Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong
2013-11-01
Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.
Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran.
Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat; Monavari, Seyed Hamidreza
2017-03-01
Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures.
Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran
Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat
2017-01-01
Background Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. Methods This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. Results The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. Conclusion In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures. PMID:28401102
Youssry, Ilham; Soliman, Nohair; Ghamrawy, Mona; Samy, Rania Mohamed; Nasr, Amal; Abdel Mohsen, Mohamed; ElShahaat, Mohamed; Bou Fakhredin, Rayan; Taher, Ali
2017-04-01
The presence of elevated numbers of circulating microparticles (MPs) has been hypothesized to be responsible for the occurrence of thromboembolic events (TEEs) in thalassemic patients. Our aim is to evaluate the presence and the thrombotic risk of circulating MPs in thalassemia patients and to determine the difference in MPs between β-thalassemia major (β-TM) and thalassemia intermedia (TI). The percentage of the annexin-labeled MPs, platelet-derived MPs (PMPs), erythrocyte-derived MPs (RMPs), and endothelial-derived MPs (EMPs) was measured by flow cytometry, in 87 thalassemia patients (39 β-TM and 48 TI). By multiple regression analysis, we then assessed the various independent risk factors for the occurrence of TEE. The thalassemic patients who experienced TEE had a significantly higher platelet count, higher percentage of annexin-labeled MPs, and higher percentage of PMPs (p value = 0.014, 0.003, and 0.014, respectively). There was no significant difference between β-TM and TI patients at the level of any of the studied MPs. The predictive risk factors for TEE in thalassemic patients were splenectomy, total and direct bilirubin, the RMPs, and the EMPs (OR = 10.07 (CI = 3.7-27.1), 4.3 (CI = 2.1-8.7), 1.4 (CI = 1.5-6.2), 1.6 (CI = 1.1-2.2), 3.0 (CI = 1.9-4.9), respectively). In conclusion, the elevated numbers of circulating MPs is a risk factor for the TEE in thalassemia patients.
Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie
2017-10-01
We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.
Adipocytokine concentrations in children with different types of beta-thalassemia.
Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz
2014-06-01
Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.
[Clinical analysis of three cases with beta-thalassemia].
Li, X Y; Liu, M J; Xu, L H; Xu, H G; Chen, H L; Fang, J P
2018-04-02
Objective: To study the diagnostic strategy of β-thalassemia through retrospective analysis of 3 cases of β-thalassemia. Methods: Three patients were admitted to the Department of Pediatrics, Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2014 to June 2015. The clinical manifestations, hemoglobin electrophoresis and gene detection of these patients and their parents were analyzed, diagnostic ideas and key points were discussed when beta thalassemia gene detection did not explain clinical manifestations or hemoglobin electrophoresis. Results: Case 1, boy, 5 years old, was diagnosed as compound heterozygotes of β41-42 and IVS-Ⅱ-654 with hereditary persistence of fetal hemoglobin(HPFH) according to the clinical manifestations of mild anemia, normal size of liver and spleen, 92.8% fetal hemoglobin (HbF) and gene analysis. Case 2, girl, 3 years old, was confirmed the diagnosis of thalassemia intermedia with β41-42 heterozygote compound and ααα anti3.7 heterozygote in accordance with the manifestations of severe anemia, hepatosplenomegaly, 8.6% HbF, 4.1% hemoglobin A 2 (HbA 2 ) and gene analysis. Case 3, girl, 3 years old, with severe anemia, hepatosplenomegaly, 51.2% HbF and 3.7% HbA 2 , was diagnosed as thalassemia major with compound heterozygotes of PolyA (T→C) and β17 by DNA sequencing. Conclusion: The diagnosis of β-thalassemia should be confirmed by clinical manifestations of hemolytic anemia, hemoglobin electrophoresis, gene diagnosis and family survey.
Management of beta-thalassemia-associated osteoporosis.
Giusti, Andrea; Pinto, Valeria; Forni, Gian Luca; Pilotto, Alberto
2016-03-01
Beta-Thalassemia-associated osteoporosis is a multifactorial and complex condition. Different acquired and genetic factors are involved in its pathogenesis. These factors produce an imbalance in bone remodeling by inhibiting osteoblast activity and increasing osteoclast function, leading to bone loss and increased fracture risk. The management of patients presenting with thalassemia-associated osteoporosis should consist of the implementation of general measures and the prescription of a specific pharmacological agent, with the aim of reducing fracture risk and preventing disability and deterioration of quality of life. General measures include control of anemia, adequate chelation therapy, healthy nutrition and lifestyle, regular exercise, adequate management of comorbid conditions, hormone replacement therapy in patients with hypogonadism, and vitamin D supplementation/therapy. Among the pharmacological agents currently available for the management of osteoporosis in postmenopausal women and men, bisphosphonates have been shown to improve bone mineral density, to reduce bone turnover, and to decrease bone/back pain in patients with thalassemia-associated osteoporosis, with a good profile of safety and tolerability. On the other hand, there are limited experiences with other pharmacological agents (e.g., denosumab or teriparatide). The complexity of this condition presents diagnostic and therapeutic challenges and underscores the importance of a comprehensive and multidisciplinary approach. © 2016 New York Academy of Sciences.
Beta-thalassemia problems in the Turkish population in the F.R.G.
Holzgreve, W; Sevinchan, E; Kohne, E; Sevinchan, S; Miny, P; Horst, J
1990-01-01
A sample of 165 normal Turkish probands (79 males, 86 females) living in the F.R.G. was screened for the presence of heterozygous beta-thalassemia as well as their knowledge and perception of thalassemias in general. Hematologic studies revealed two persons to be heterozygous for beta-thalassemia who had not known this before. This incidence of 1.2% in our sample of Turkish probands living in the F.R.G. is in accordance with the average range of 0.2-6% given by the World Health Organization for Turkey. The probands' places of origin in Turkey correlate well with the pattern of migration within the country, with most people coming from central Anatolia which is an area with a relatively low incidence of beta-thalassemia. Interviews conducted by a Turkish doctor revealed that the knowledge about thalassemias and the function of blood in general was extremely limited in our study population. On the other hand, 50% of the respondents would refrain from marriage or choose a different partner if both partners knew that they were heterozygous for thalassemia. 19% would still marry in this situation but refrain from having children. When asked about their most likely decision in the case of an early diagnosis of homozygous thalassemia, 78% said they would have a termination and only 15% would definitely go on with the pregnancy. About 65% felt that consanguineous marriage is a predisposing factor for diseases in the offspring. From our study it can be concluded that a large-scale screening program in the high-risk population which exists in most Mediterranean countries would be difficult regarding the more than one million people from Turkey living in the F.R.G. and would have to take into account the cultural and educational conditions of the Turkish minority. In general, if no Turkish-speaking specialist is available to explain the diagnostic possibilities, probably pre-pregnancy or early pregnancy testing would be the most appropriate way of reaching the couples at risk
Tan, Jin-Ai Mary Anne; Tan, Kim-Lian; Omar, Khairul Zaman; Chan, Lee-Lee; Wee, Yong-Chui; George, Elizabeth
2009-09-01
Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A). HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia. Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA. The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.
Blood transfusion versus hydroxyurea in beta-thalassemia in Iran: a cost-effectiveness study.
Ravangard, Ramin; Mirzaei, Zahra; Keshavarz, Khosro; Haghpanah, Sezaneh; Karimi, Mehran
2017-11-21
Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered.
Multiorgan failure during a sickle cell crisis in sickle/beta-thalassemia.
Tedla, Fasika M; Friedman, Eli A
2003-08-01
In contrast to the chronic nephropathy associated with sickle cell syndromes, acute renal failure and multiorgan dysfunction caused by acute sickling crisis are encountered infrequently. The authors present the first case of extensive multiorgan failure during a sickling episode in a patient with sickle/beta+thalassemia. The authors also review the interaction of the thalassemias with sickle cell disease and outline the distinctive course of their patient in comparison with previous reports.
[Beta thalassemia major and pregnancy during adolescence: report of two cases].
Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura
2015-06-01
Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.
Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong
2016-11-01
For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R
1981-01-01
Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.
Rossetti, Liliana C; Targovnik, Héctor M; Varela, Viviana
2004-06-01
In order to determine the molecular heterogeneity of the beta-thalassemia gene and to analyze the influence of immigration from the Mediterranean Basin, a total of 254 families (475 subjects) from Argentinean beta-thalassemia patients were investigated using molecular biology techniques. This allowed us to provide a simplified diagnosis and genetic counselling of this disorder in Argentina.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
The psychological burden of patients with beta thalassemia major in Syria.
Gharaibeh, Huda; Amarneh, Basil H; Zamzam, Suzan Z
2009-10-01
The objective of this study was to identify the psychosocial burden of thalassemia on children with beta-thalassemia major in Damascus, Syria. The sample consisted of thalassemic patients aged 6-18 years old, admitted to the thalassemia center in Damascus, accompanied by their parents. The parents answered a structured questionnaire (developed by Ratip & Modell) on behalf of their children. The psychosocial burden affected many aspects of life such as education, time off school, sporting capabilities, difference from friends/siblings, social interactions, family adjustment, anxiety, isolation, and stigmatization. Results indicated a significant association between socio-demographic characteristics such as age, gender, school grade, current schooling, work, family income, and the occurrence of complications with the psychosocial burden variables including education, time off school, sporting capabilities, difference from friends, social interactions and stigmatization. The findings suggest the need for psychological support as well as medical help for thalassemic families. Health professionals need to assess the psychological status of children with thalassemia and that of their families in order to minimize these burdens; thus, nurses must provide psychosocial support for children with thalassemia and encourage other family members to assist in providing support for the affected children. The current study triggered the need for new policies and new roles for the community health nurse and social workers as well as the need for counseling and educational programs for children with thalassemia.
Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin
2002-08-01
To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV < 85 fl) and elevated levels of Hb A(2) (>/=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta
Genetic therapy for beta-thalassemia: from the bench to the bedside.
Arumugam, Paritha; Malik, Punam
2010-01-01
Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.
Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R
1981-01-01
Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation. PMID:6165992
Cardiac complications in beta-thalassemia: From mice to men.
Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C; Chattipakorn, Nipon
2017-06-01
Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of
Cardiac complications in beta-thalassemia: From mice to men
Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C.
2017-01-01
Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of
Regional consensus opinion for the management of Beta thalassemia major in the Arabian Gulf area
2013-01-01
Thalassemia syndrome has diverse clinical presentations and a global spread that has far exceeded the classical Mediterranean basin where the mutations arose. The mutations that give rise to either alpha or beta thalassemia are numerous, resulting in a wide spectrum of clinical severity ranging from carrier state to life-threatening, inherited hemolytic anemia that requires regular blood transfusion. Beta thalassemia major constitutes a remarkable challenge to health care providers. The complications arising due to the anemia, transfusional iron overload, as well as other therapy-related complications add to the complexity of this condition. To produce this consensus opinion manuscript, a PubMed search was performed to gather evidence-based original articles, review articles, as well as published work reflecting the experience of physicians and scientists in the Arabian Gulf region in an effort to standardize the management protocol. PMID:24044606
Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U
1984-01-01
A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198
[Current management of thalassemia intermedia].
Thuret, I
2014-11-01
Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Non-transfusion-dependent thalassemia encompasses 3 main clinical forms: beta-thalassemia intermedia, hemoglobin E/beta-thalassemia and alpha-thalassemia intermedia (HbH disease). Clinical severity of thalassemia intermedia increases with age, with more severe anemia and more frequent complications such as extramedullary hematopoiesis and iron overload mainly related to increased intestinal absorption. Numerous adverse events including pulmonary hypertension and hypercoagulability have been associated with splenectomy, often performed in thalassemia intermedia patients. The potential preventive benefit of transfusion and chelation therapies on the occurrence of numerous complications supports the strategy of an earlier therapeutic intervention. Increasing knowledge about pathophysiological mechanisms involved in thalassemia erythropoiesis and related iron overload is currently translating in novel therapeutic approaches. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Chorionic villus sampling for beta-thalassemia: the first report of experience in Iran.
Akhlaghpoor, Shahram
2006-12-01
Beta-thalassemia is one of the most common hereditary disorders in Iran. The prenatal diagnosis of beta-thalassemia is part of a control program in our country and it began 13 years ago. During the past 8 years the number of procedures has increased significantly as also the legal abortions. This is the first report made on the CVS program in Iran. One thousand six hundred and sixty-one cases of transabdominal Chorionic Villus Sampling (CVS) have been retrospectively evaluated. Among them 1381 cases had inclusion criteria. CVS results, complications and fetal loss rate were evaluated. The distributions of the population at risk were divided between eight regions that have been proposed for beta-thalassemia mapping previously. The mean age of the patients was 26.2 +/- 5.2 years with mean gestational age of 11.4 +/- 1.4 weeks. CVS was successful in all the patients (100%) although 1% required a second procedure. Post CVS fetal loss was 1.45%. Other minor complications were bleeding or spotting (1.81%), amniotic fluid leak (0.5%), small sub-chorionic hematoma (0.58%), severe abdominal pain (0.6%) and severe vasovagal reaction (0.14%). Late complications were seen in 0.21% (oligohydraminos). Approximately 2/3 of the patients were referred from three regions of the country, North (26.8%), South West (22.4%), Central (19.5%) and the remainder (31.3%) were from the other five regions. CVS is a safe and effective method for prenatal diagnosis of beta-thalassemia in countries with a high prevalence as in Iran. The overall complication rate is quite low and acceptable. Fortunately the recent acceptance of legal abortion with respect to Muslim rules has increased the effectiveness of the procedure and made great advances in its application in Iran. Correspondingly, social knowledge has also improved but still there is a gap between the population at risk and the required prenatal diagnosis laboratories and sampling centers. 2006 John Wiley & Sons, Ltd.
Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis
2018-01-01
Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482
Changing patterns of thalassemia worldwide.
Vichinsky, Elliott P
2005-01-01
Thalassemia is a growing global public health problem with an estimated 900,000 births of clinically significant thalassemia disorders expected to occur in the next 20 years. This growth will occur in disorders previously uncommon in many parts of the world. In particular, hemoglobin (Hb) E-beta-thalassemia and Hb H disease account for much of the projected increases in thalassemia. Worldwide, Hb E-beta-thalassemia is one of the most frequent hemoglobinopathies. The incidence of Hb E approaches 60% of the populations in many regions of Southeast Asia. In coastal regions of North America, its prevalence is rapidly growing. The severity of Hb E-beta-thalassemia ranges from a complete lack of symptoms to transfusion dependence. alpha-Thalassemia diseases, often considered benign, are now recognized to be more severe than originally reported. Hb H, Hb H-Constant Spring (CS), and homozygous alpha-thalassemia affect at least a million people worldwide. California considers Hb H disease a public health problem and has initiated a neonatal screening program for Hb H and particularly Hb H-CS. Homozygous alpha-thalassemia, usually fatal, is also being more commonly detected. Several regions have initiated universal prenatal screening programs to address homozygous alpha-thalassemia. In summary, the prognosis for thalassemia disorders is improving, but prenatal diagnosis and neonatal screenings are needed. Comprehensive services that address language and social barriers as well as access to Hb F-enhancing agents and transfusions are needed.
Tricuspid regurgitation in patients with beta-thalassemia major.
Wu, K H; Chang, J S; Su, B H; Peng, C T
2004-12-01
Although cardiac complications remain the main causes of death in thalassemic patients, right heart dysfunction has been little studied and the mechanism is still unclear. Echocardiography was performed in 39 patients with beta-thalassemia major and 35 aged-matched controls. The gender, age, heart rate, blood pressure, left ventricular ejection fraction (LVEF), acceleration time (AcT) of right ventricular outflow and right ventricular ejection time (RVET), AcT/RVET, and the presence of tricuspid regurgitation (TR) were compared between the two groups. We also compared the gender, age, age at first blood transfusion, serum ferritin level, alanine aminotransferase (ALT), the presence of antibodies to hepatitis C virus, liver fibrosis, splenectomy, platelet counts, diabetes mellitus, arrhythmia, cardiomegaly, LVEF, AcT, RVET, AcT/RVET, and signal intensity ratio (SIR) of myocardial magnetic resonance imaging (MRI) between thalassemic patients with and without TR. The incidence of TR in thalassemic patients was significantly higher than that in the control group (30.8 vs 11.4%, p=0.03). The incidences of splenectomy (p=0.03), platelet counts (p=0.01), and SIR of myocardial MRI (p=0.03) in thalassemic patients with TR were significantly higher than in those without TR. The AcT was shorter and the AcT/RVET ratio was smaller, suggesting higher pulmonary pressure in the thalassemic patients with TR. Occurrence of TR in patients with beta-thalassemia major may be a consequence of cardiac iron deposit, thrombocytosis, splenectomy, or pulmonary hypertension.
Noori, Noormohammad; Mohamadi, Mehdi; Keshavarz, Kambiz; Alavi, Seyed Mostafa; Mahjoubifard, Maziar; Mirmesdagh, Yalda
2013-01-01
Heart disease is the main cause of mortality and morbidity in patients with beta thalassemia, rendering its early diagnosis vital. We studied and compared echocardiographic findings in patients with beta thalassemia major, patients with beta thalassemia intermedia, and a control group. Eighty asymptomatic patients with thalassemia major and 22 asymptomatic cases with thalassemia intermedia (8-25 years old) were selected from those referred to Ali Asghar Hospital (Zahedan-Iran) between June 2008 and June 2009. Additionally, 80 healthy individuals within the same age and sex groups were used as controls. All the individuals underwent echocardiography, the data of which were analyzed with the Student t-test. The mean value of the pre-ejection period/ejection time ratio of the left ventricle during systole, the diameter of the posterior wall of the left ventricle during diastole, the left and right isovolumic relaxation times, and the right myocardial performance index in the patients with beta thalassemia major and intermedia increased significantly compared to those of the controls, but the other parameters were similar between the two patient groups. The mean values of the left and right pre-ejection periods, left ventricular end systolic dimension, and left isovolumic contraction time in the patients with thalassemia intermedia increased significantly compared to those of the controls. In the left side, myocardial performance index, left ventricular mass index, isovolumic contraction time, and deceleration time exhibited significant changes between the patients with thalassemia major and those with thalassemia intermedia, whereas all the echocardiographic parameters of the right side were similar between these two groups. The results showed that the systolic and diastolic functions of the right and left sides of the heart would be impaired in patients with thalassemia major and thalassemia intermedia. Consequently, serial echocardiography is suggested in
Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.
Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A
1997-05-01
The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.
Li, Chunfu; Wang, Yanhua; Wu, Xuedong; Pei, Fuyu; He, Yuelin; Feng, Xiaoqin; Liu, Huaying
2012-05-01
To investigate the effects of different doses of antithymocyte globubin-fresenius (ATG-F) for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in patients with beta-thalassemia Major. Sixty-four children with beta-thalassemia major undergoing allo-HSCT were divided into two equal groups to receive ATG-F pretreatments at high (30 mg/kg) or low (15 mg/kg) doses as part of the conditioning regimen including mainly cyclophosphamide, busulfan, fludarabine, and thiotepa. The outcomes of the patients were compared between the two groups. No obvious difference were noted in the time to leukocyte and platelet engraftment between the two groups. The incidence of grade II-IV acute graft-versus-host disease (aGVHD) appeared to be higher in the low-dose group than in the high-dose group (12.5% vs 9.4%). The incidence of grade III-IV aGVHD was also higher in the low dose group (12.5% vs 6.3%), but the difference was not statistically significant. Application of high-dose ATG-F was associated with a higher rate of probable and possible fungal infection (P<0.05). The two doses of ATG-F is feasible as a part of the conditioning regimen for allo-HSCT in children with beta-thalassemia major.
Wang, Wenjuan; Yuan, Yuan; Zheng, Haiqing; Wang, Yaoshen; Zeng, Dan; Yang, Yihua; Yi, Xin; Xia, Yang; Zhu, Chunjiang
2017-07-01
Thalassemia is a dangerous hematolytic genetic disease. In south China, ∼24% Chinese carry alpha-thalassemia or beta-thalassemia gene mutations. Given the fact that the invasive sampling procedures can only be performed by professionals in experienced centers, it may increase the risk of miscarriage or infection. Thus, most people are worried about the invasive operation. As such, a noninvasive and accurate prenatal diagnosis is needed for appropriate genetic counseling for families with high risks. Here we sought to develop capture probes and their companion analysis methods for the noninvasive prenatal detection of deletional and nondeletional thalassemia. Two families diagnosed as carriers of either beta-thalassemia gene or Southeast Asian deletional alpha-thalassemia gene mutation were recruited. The maternal plasma and amniotic fluid were collected for prenatal diagnosis. Probes targeting exons of the genes of interest and the highly heterozygous SNPs within the 1Mb flanking region were designed. The target capture sequencing was performed with plasma DNA from the pregnant woman and genomic DNA from the couples and their children. Then the parental haplotype was constructed by the trios-based strategy. The fetal haplotype was deduced from the parental haplotype with a hidden Markov model-based algorithm. The fetal genotypes were successfully deduced in both families noninvasively. The noninvasively constructed haplotypes of both fetuses were identical to the invasive prenatal diagnosis results with an accuracy rate of 100% in the target region. Our study demonstrates that the effective noninvasive prenatal diagnosis of alpha-thalassemia and beta-thalassemia can be achieved with the targeted capture sequencing and the haplotype-assisted analysis method.
Polyneuropathy and myopathy in beta-thalassemia major patients.
Nemtsas, P; Arnaoutoglou, M; Perifanis, V; Koutsouraki, E; Spanos, G; Arnaoutoglou, N; Chalkia, P; Pantelidou, D; Orologas, A
2018-05-01
The thalassemias are the most common single gene disorder in the world. Nowadays, the average life expectancy of patients in developed countries has increased significantly, while, there was an increase of complications. We aimed to investigate peripheral neuropathy and myopathy in this patient group using a neurophysiological study. We performed nerve conduction studies and electromyography of upper and lower extremities on 36 beta-thalassemia major (β-thal) patients. The electrophysiological findings were correlated with demographic data and laboratory parameters of the disease. Patients with β-thal present polyneuropathy or myopathy at (50%). Polyneuropathy was detected in (38.9%) and myopathy in (27.8%), while polyneuropathy and myopathy were present at (16.7%) with an overlap of the diseases in 1/3 of the patients. There was not a statistically significant correlation of polyneuropathy and myopathy with age, sex, splenectomy, nor with respect to laboratory parameters, hemoglobin, and ferritin. However, there was a statistically significant correlation of polyneuropathy and myopathy with iron overload, as recorded by the magnetic resonance imaging (MRI) of the heart and the liver. Our findings suggest that iron overload plays a key role in the pathogenesis of polyneuropathy and myopathy in β-thal patients, and performing heart and liver MRI for the prediction of such lesions in an annual basis is warranted.
... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...
β-Thalassemia Intermedia: A Bird's-Eye View.
Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali
2014-03-01
Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia
Beta Thalassemia (For Parents)
... July 2015 More on this topic for: Parents Kids Teens Blood Transfusions Iron Iron-Deficiency Anemia Blood Test: Hemoglobin Electrophoresis Sickle Cell Disease Alpha Thalassemia Anemia Word! Anemia About Anemia Stem Cell Transplants Blood Transfusions Anemia Sickle Cell Disease ...
Mahdieh, Nejat; Rabbani, Bahareh
2016-11-01
Thalassemia is one of the most common single gene disorders worldwide. Nearly 80 to 90 million with minor beta thalassemia and 60-70 thousand affected infants are born annually worldwide. A comprehensive search on several databases including PubMed, InterScience, British Library Direct, and Science Direct was performed extracting papers about mutation detection and frequency of beta thalassemia. All papers reporting on the mutation frequency of beta thalassemia patients were selected to analyze the frequency of mutations in different regions and various ethnicities. Mutations of 31,734 individuals were identified. Twenty common mutations were selected for further analysis. Genotype-phenotype correlation, interactome, and in silico analyses of the mutations were performed using available bioinformatics tools. Secondary structure prediction was achieved for two common mutations with online tools. The mutations were also common among the countries neighboring Iran, which are responsible for 71% to 98% of mutations. Computational analyses could be used in addition to segregation and expression analysis to assess the extent of pathogenicity of the variant. The genetics of beta thalassemia in Iran is more extensively heterogeneous than in neighboring countries. Some common mutations have arisen historically from Iran and moved to other populations due to population migrations. Also, due to genetic drift, the frequencies of some mutations have increased in small populations. Copyright © 2016 Elsevier Ltd. All rights reserved.
Premature atherosclerosis in children with beta-thalassemia major: New diagnostic marker.
Sherief, Laila M; Dawood, Osama; Ali, Adel; Sherbiny, Hanan S; Kamal, Naglaa M; Elshanshory, Mohamed; Alazez, Osama Abd; Alhady, Mohamed Abd; Nour, Mohamed; Mokhtar, Wesam A
2017-03-09
Early vascular alteration, atherosclerosis and coronary artery disease have emerged as important cardiovascular complications among beta-thalassemia major (B-TM) patients. The aims of the current study were to assess the prevalence of premature atherosclerosis among our B-TM patients, and to investigate the diagnostic value of serum Osteoprotegerin assay as an early biomarker for atherosclerosis. This cross-sectional study was conducted at Hematology unit - Pediatric Department, Zagazig University Children Hospital- Egypt in the period from March 2014 to March 2015. A total of 115 children were enrolled in the current study; as sixty-five (65) children with beta thalassemia major aged 5-18 years, on regular blood transfusion regimen represented the patient group. While fifty (50) healthy children, with comparable age and gender, were assigned as control group. All participants were subjected to history taking, thorough clinical examination and laboratory investigations including; complete blood count, liver and kidney function tests, C- reactive protein, lipid profile, serum ferritin and serum Osteoprotegerin (OPG) assay. Also, carotid artery intima media thickness (CAIMT) was performed by duplex ultrasound for patients and controls. Our B-TM patients were transfusion-dependent for as long as 8.5 ± 3.8 years with significantly higher serum ferritin levels (2490 ± 1579 ng/dl vs 83 ± 32 ng/dl, p = 0.001), C-reactive protein (5.7 ± 5.7 vs 0.9 ± 0.9), liver enzymes and bilirubin when compared to controls. Significantly higher serum triglyceride (128 ± 20 vs 101 ± 7 mg/dL, p = 0.009) and atherogenic index of plasma (0.45 ± 0.12 vs 0.22 ± 0.04, p = 0.001) were recorded in patients than comparisons. On the contrary, total serum cholesterol (116 ± 16 vs 143 ± 5, p < 0.001), low density lipoprotein-cholesterol (LDL-C) (44 ± 9 vs 73 ± 6, p < 0.001) and high density lipoprotein
β-Thalassemia Intermedia: A Bird’s-Eye View
Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali
2014-01-01
Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe
Dimou, Niki L; Pantavou, Katerina G; Bagos, Pantelis G
2017-09-01
Apolipoprotein E (ApoE) is potentially a genetic risk factor for the development of left ventricular failure (LVF), the main cause of death in beta-thalassemia homozygotes. In the present study, we synthesize the results of independent studies examining the effect of ApoE on LVF development in thalassemic patients through a meta-analytic approach. However, all studies report more than one outcome, as patients are classified into three groups according to the severity of the symptoms and the genetic polymorphism. Thus, a multivariate meta-analytic method that addresses simultaneously multiple exposures and multiple comparison groups was developed. Four individual studies were included in the meta-analysis involving 613 beta-thalassemic patients and 664 controls. The proposed method that takes into account the correlation of log odds ratios (log(ORs)), revealed a statistically significant overall association (P-value = 0.009), mainly attributed to the contrast of E4 versus E3 allele for patients with evidence (OR: 2.32, 95% CI: 1.19, 4.53) or patients with clinical and echocardiographic findings (OR: 3.34, 95% CI: 1.78, 6.26) of LVF. This study suggests that E4 is a genetic risk factor for LVF in beta-thalassemia major. The presented multivariate approach can be applied in several fields of research. © 2017 John Wiley & Sons Ltd/University College London.
Maheri, Aghbabak; Sadeghi, Roya; Shojaeizadeh, Davoud; Tol, Azar; Yaseri, Mehdi; Ebrahimi, Mojtaba
2016-01-01
A health-promoting lifestyle (HPL) is a factor that affects the quality of life (QoL) in patients with beta-thalassemia (β-thalassemia). Due to the lack of studies of this issue, this study aimed to determine the association between HPL and QoL among adults with β-thalassemia. This cross-sectional (descriptive-analytic) study was conducted among 389 adult patients with β-thalassemia in Tehran, Iran. The research instrument included a questionnaire consisting of three parts: demographic items, the Short-Form Health Survey and the Health-Promoting Lifestyle Profile. The data were analyzed using SPSS version 23.0. The results were considered significant at the conventional p<0.05 level. The mean age of the participants was 30.2±8.3 years. The mean score of the HPL dimensions was 127.28±21.53, and the mean score of the QoL domains was 61.44±23.38. The highest and the lowest mean scores of the HPL dimensions were found for spiritual growth (23.96±5.74) and physical activity (11.32±3.95), respectively. The QoL scores in all three domains (total, physical component summary score, and mental component summary score) were moderate. Health responsibility, physical activity, spiritual growth, and interpersonal relations were significant predictive factors of QoL in adults with β-thalassemia; these four dimensions explained 37.9% of the variance in QoL. QoL and HPL were not at acceptable levels among patients with thalassemia. Therefore, educational interventions emphasizing spiritual growth, physical activity, and interpersonal relations are necessary for patients with thalassemia.
High incidence of silent cerebral infarcts in adult patients with beta thalassemia major.
Pazgal, Idit; Inbar, Edna; Cohen, Maya; Shpilberg, Ofer; Stark, Pinhas
2016-08-01
Survival of beta thalassemia major (TM) patients has improved significantly over the past few decades. Consequently, less commonly reported complications are now being recognized. An incidence as high as 60% of silent cerebral infarcts (SCI) has been demonstrated by brain Magnetic Resonance Imaging (MRI) studies in beta thalassemia intermedia (TI). The aim of this study was to determine whether regularly transfused TM adult patients experience less SCI, as compared to the incidence described in TI. In this observational study, 28 transfusion dependent TM patients, >18years of age underwent brain MRI studies. Focal bright foci in the cerebral white matter were demonstrated in 17 (60.7%) patients; most of them had multiple lesions. Elevated serum ferritin (SF), primarily 5years Area Under the Curve, was found to have a significant association with the presence of SCI (p<0.031). Similar results were found when 4 patients with intact spleen and 2 patients with splenules were excluded (p=0.027). There was no significant association between number of SCI and clinical or other laboratory parameter evaluated. The present study demonstrates a high rate of SCI in regularly transfused TM adult patients. Effective continuous iron chelation, preventive low dose aspirin and routine periodical brain MRI are recommended. Copyright © 2016 Elsevier Ltd. All rights reserved.
Non-transfusion-dependent thalassemias
Musallam, Khaled M.; Rivella, Stefano; Vichinsky, Elliott; Rachmilewitz, Eliezer A.
2013-01-01
Non-transfusion-dependent thalassemias include a variety of phenotypes that, unlike patients with beta (β)-thalassemia major, do not require regular transfusion therapy for survival. The most commonly investigated forms are β-thalassemia intermedia, hemoglobin E/β-thalassemia, and α-thalassemia intermedia (hemoglobin H disease). However, transfusion-independence in such patients is not without side effects. Ineffective erythropoiesis and peripheral hemolysis, the hallmarks of disease process, lead to a variety of subsequent pathophysiologies including iron overload and hypercoagulability that ultimately lead to a number of serious clinical morbidities. Thus, prompt and accurate diagnosis of non-transfusion-dependent thalassemia is essential to ensure early intervention. Although several management options are currently available, the need to develop more novel therapeutics is justified by recent advances in our understanding of the mechanisms of disease. Such efforts require wide international collaboration, especially since non-transfusion-dependent thalassemias are no longer bound to low- and middle-income countries but have spread to large multiethnic cities in Europe and the Americas due to continued migration. PMID:23729725
Diop, Madoky Magatte; Toure, P S; Leye, M Y; Leye, A; El Fadjri, S; Diop, M; Ka, M M; Diop, Oulimata D; Fall, S; Ndiaye, F S
2012-01-01
Pernicious anemia appears classically by macrocytosis. We report a case of a late discovered Biermer disease, on a 42-year-old young black woman. The reason was an unusual aspect of this disease in a context of betathalassemia. The patient presented chronic anemia which evolved during about ten year. Biology showed a normocytosis and signs of hemolysis according to beta-thalassemia. This was confirmed by an electrophoresis showing 9.1 % of fraction F some haemoglobin. Since this date, the patient was treated by folic acid alone with periodic transfusions of red blood cell. She presented eight years after the beginning of her disease, neurological deterioration. Diagnosis of pernicious anemia was finally established up on histological gastritis, low level of the blood rate of vitamin B12, macrocytosis, and presence of intrinsic anti-factor and parietal anti-cells antibodies.
Laboratory investigation of hemoglobinopathies and thalassemias: review and update.
Clarke, G M; Higgins, T N
2000-08-01
Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.
Quality of life among children with beta-thalassemia major treated in Western Saudi Arabia.
Ayoub, Mohammed D; Radi, Suhaib A; Azab, Abdulrahman M; Abulaban, Abdulrahman A; Balkhoyor, Abdulrahman H; Bedair, Seifeleslam W; Aljaouni, Soad K; Kari, Jameela A
2013-12-01
To assess the quality of life among children and adolescents with thalassemia major. This cross-sectional study used the Pediatric Quality of Life Inventory (PedsQL). Children and adolescents with beta-thalassemia major who attended the Day Care Unit at King Abdulaziz University Hospital, Jeddah, Saudi Arabia from October 2012 to February 2013 were surveyed. The questions highlighted 4 health status scales, namely physical functioning (PF), emotional functioning (EF), school performance (SC), and social functioning (SF). Scores were calculated for each patient and data were analyzed using the Statistical Package for Social Sciences. We recruited 46 children (60.9% males). The median age of the sample was 12 years (range, 2-18 years). Most patients (84.8%) had 3 weekly blood transfusions. The mean+/-SD physical functioning (PF) score was 57.2+/-25.9; the EF score was 74.1+/-20.3, SF score was 78.5+/-24, and SC score was 54.3+/-24.2. The PF score was significantly lower in patients with a family history of thalassemia (p=0.003), and in those whose families had low incomes (p=0.049). Conversely, the SF score was significantly higher in school-educated patients (p=0.01). The quality of life of thalassemic children is affected by multiple factors, such as family income and a family history of thalassemia. Education appeared to increase patient functionality. Supportive measures could improve the quality of life in thalassemic patients.
Lived experiences of Iranian parents of beta-thalassemia children
Shahraki-vahed, Aziz; Firouzkouhi, Mohammadreza; Abdollahimohammad, Abdolghani; Ghalgaie, Jamile
2017-01-01
Introduction Thalassemia is a chronic blood disease, which imposes adverse effects on patients and their families. Parents of such patients, given that they had the thalassemia trait, hold themselves responsible for their children’s disease in addition to other difficulties, bear the burden of guilt and hopelessness and worry about the health and future of their children. This study aimed to explore the lived experiences of parents of children with thalassemia. Methods The present research was conducted using a descriptive phenomenological approach. A purposive sampling was carried out until data saturation. Participants included 15 parents of children with thalassemia who were referred to the Thalassemia Center of Zabol to perform therapeutic procedures for their child in 2016. Results Extracted interviews were analyzed employing Colaizzi’s method, and four main themes were obtained, including “Gray marriage consanguinity”, “Burdened with increased number of thalassemia children”, “Socio-familial worries” and “Inexpressible wishes for having an ideal society”. Conclusion The results revealed that parents of children with thalassemia experience a wide range of problems in different aspects, such as physical, emotional, mental, social, economic and familial dimensions. Their experiences are valuable and can help in achieving a better understanding of their problems, which in turn can enable the members of the treatment team to play a more active role and the society to have a better understanding of this disease. PMID:28721064
Mamtani, Manju; Jawahirani, Anil; Das, Kishor; Rughwani, Vinky; Kulkarni, Hemant
2006-08-01
It is being increasingly recognized that a majority of the countries in the thalassemia-belt need a cost-effective screening program as the first step towards control of thalassemia. Although the naked eye single tube red cell osmotic fragility test (NESTROFT) has been considered to be a very effective screening tool for beta-thalassemia trait, assessment of its diagnostic performance has been affected with the reference test- and verification-bias. Here, we set out to provide estimates of sensitivity and specificity of NESTROFT corrected for these potential biases. We conducted a cross-sectional diagnostic test evaluation study using data from 1563 subjects from Central India with a high prevalence of beta-thalassemia. We used latent class modelling after ensuring its validity to account for the reference test bias and global sensitivity analysis to control the verification bias. We also compared the results of latent class modelling with those of five discriminant indexes. We observed that across a range of cut-offs for the mean corpuscular volume (MCV) and the hemoglobin A2 (HbA2) concentration the average sensitivity and specificity of NESTROFT obtained from latent class modelling was 99.8 and 83.7%, respectively. These estimates were comparable to those characterizing the diagnostic performance of HbA2, which is considered by many as the reference test to detect beta-thalassemia. After correction for the verification bias these estimates were 93.4 and 97.2%, respectively. Combined with the inexpensive and quick disposition of NESTROFT, these results strongly support its candidature as a screening tool-especially in the resource-poor and high-prevalence settings.
EFFECTS OF HOME-CARE TRAINING ON THE SELF-EFFICACY OF PATIENTS WITH BETA THALASSEMIA MAJOR
Moghadam, Mahdieh Poodineh; Nourisancho, Hajar; Shahdadi, Hossein; Shahraki, Sohila; Azarkish, Batoul; Balouchi, Abbas
2016-01-01
Background: The self-efficacy of thalassemia patients is an important factor in creating behavioral changes in such patients. Home-care training reduces hospitalization duration as well as relevant costs and improves disease outcomes. This study was designed to assess the effect of home-care training on the self-efficacy of patients with beta thalassemia major. Methodology: This was a quasi-experimental, case-control, before and after intervention study conducted on 136 thalassemia cases from January 2014 to October 2015. Data was collected through Shere general self-efficacy questionnaire (SGSES). Home-care trainings were provided in the form of training courses with respect to the training needs of thalassemia major cases. Two (2) months after the end of training courses, SGSES questionnaire was filled again and the obtained data was analyzed by SPSS 21 as well as descriptive-inferential statistics (significance level=P≤0.05). Results: The results of this study revealed that the mean self-efficacy score of control group was 48.69±6.82 before intervention which increased to 46.69±6.81 after intervention. The mean self-efficacy score of case group was 44.58±5.23 before intervention which increased to 49.5±6.66 after intervention. The rise of self-efficacy score, after intervention, was significantly higher in the case group compared with the control group (P≤.001). Conclusion: According to results, home-care training can develop self-efficacy in thalassemia patients. In home-care training procedure patients play an active role. By providing home-care trainings, therefore, an effective step should be taken to promote the self-efficacy of the patients and to decrease associated problems. PMID:27999484
Daar, S; Pathare, A V
2006-05-01
Iron overload is the main cause of morbidity and mortality especially from heart failure in patients with beta thalassemia major (TM). Successful iron chelation is therefore essential for the optimal management of TM. Although desferrioxamine (DFX) has been the major iron-chelating treatment of transfusional iron overload, compliance is a major hindrance in achieving optimal therapeutic results. The availability of oral iron chelation with deferiprone (L(1)) since 1987 is useful but showed poor efficacy when used alone as compared to DFX. We therefore decided to compare DFX alone with a prospective combined therapy with DFX and L(1) in beta thalassemia major patients with iron overload. We studied 91 patients with beta thalassemia major (mean age+/-SD, 15.02+/-5.8; range 2-30 years) attending the day care unit for regular transfusional support. They received packed red cells every 3-4 weeks to maintain pretransfusion hemoglobin concentration above 9 g/dl. They had been receiving DFX at a daily dose of 40 mg kg(-1) day(-1) by subcutaneous infusion for 8-10 h on 4-5 nights each week for the past several years. However, due to various reasons, they had developed considerable transfusional iron overload. These patients were allocated to prospectively receive additional therapy with oral iron chelator L(1) at 75 mg kg(-1) day(-1) body weight in three divided doses with food after informed consent and continued to receive treatment with DFX as per the above dosage. Of the 91 patients, six developed severe gastrointestinal (GI) upset, two agranulocytosis, two arthropathy, one persistently raised liver enzymes, two died owing to sepsis, and two received allogeneic bone marrow transplantation. Amongst the remaining 76 patients, 21 were found noncompliant (not taking DFX regularly, but taking L(1) regularly). Thus, in the 55 evaluable patients {6-48 months on combination therapy; mean [(+/-SD)22+/-12 months]}, the mean serum ferritin (+/-SD) fell dramatically from 3
Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier
2006-01-01
The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.
Fisher, L; Rowley, P T; Lipkin, M
1981-01-01
Providing adequate counseling of patients identified in genetic screening programs is a major responsibility and expense. Adults in a health maintenance organization, unselected for interest, were screened for beta-thalassemia trait as part of preventive health care. Counseling was provided by either a trained physician (conventional counseling) or by a videotape containing the same information followed by an opportunity to question a trained physician (programmed counseling). Immediately before and after counseling, knowledge of thalassemia, knowledge of genetics, and mood change were assessed by questionnaire. Comparable mood changes and similar learning about thalassemia and genetics occurred with both counseling methods. Thus, as judged by immediate effects on knowledge and mood, videotaped instruction can greatly reduce professional time required for genetic counseling and facilitate the incorporation of genetic screening into primary health care. PMID:7325162
In vivo reduction of erythrocyte oxidant stress in a murine model of beta-thalassemia.
de Franceschi, Lucia; Turrini, Franco; Honczarenko, Marek; Ayi, Kojio; Rivera, Alicia; Fleming, Mark D; Law, Terry; Mannu, Franca; Kuypers, Frans A; Bast, Aalt; van der Vijgh, Wim J F; Brugnara, Carlo
2004-11-01
Oxidant damage is an important contributor to the premature destruction of erythrocytes and anemia in thalassemias. To assess the extent of oxidant damage of circulating erythrocytes and the effects of antioxidant therapy on erythrocyte characteristics and anemia, we used a mouse model of human beta-thalassemia intermedia (b1/b2 deletion). Several parameters indicative of oxidant damage were measured at baseline and following administration of the semi-synthetic flavonoid antioxidant, 7-monohydroxyethylrutoside (monoHER), to beta-thalassemic mice at a dose of either 500 mg/kg i.p. once a day (n=6) or 250 mg/kg i.p. twice a day (n=6) for 21 days. Significant erythrocyte oxidant damage at baseline was indicated by: (i) dehydration, reduced cell K content, and up-regulated K-Cl co-transport; (ii) marked membrane externalization of phosphatidylserine; (iii) reduced plasma and membrane content of vitamin E; and (iv) increased membrane bound IgG. MonoHER treatment increased erythrocyte K content, and markedly improved all cellular indicators of oxidant stress and of lipid membrane peroxidation. While anemia did not improve, monoHER therapy reduced reticulocyte counts, improved survival of a fraction of red cells, and reduced ineffective erythropoiesis with decreased total bilirubin, lactate dehydrogenase and plasma iron. Antioxidant therapy reverses several indicators of oxidant damage in vivo. These promising antioxidant effects of monoHER should be investigated further.
Paciaroni, Katia; Gallucci, Cristiano; De Angelis, Gioia; Alfieri, Cecilia; Roveda, Andrea; Lucarelli, Guido
2009-06-01
An adult patient affected by beta(0)-thalassemia major underwent allogeneic bone marrow transplant (BMT) from a matched related donor. Forty days after transplant, allogeneic engraftment failure and autologous beta(0)-thalassemic bone marrow recovery were documented. Red blood cell transfusions were required until 118 days post-transplant. Thereafter, the haemoglobin (Hb) levels stabilized over 11.8 gr/dl throughout the ongoing 34-month follow-up, abolishing the need for transfusion support. The Hb electrophoresis showed 100% Hb Fetal (HbF). This unexplained case suggests full HbF production may occur in an adult patient with beta(0)-thalassemia major.
Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol
2018-02-26
Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.
Thalassemia and malaria: new insights into an old problem.
Clegg, J B; Weatherall, D J
1999-01-01
The hemoglobinopathies are probably the world's most common genetic diseases: The World Health Organization has estimated that at least 5% of the population are carriers for one or other of the most serious forms, the alpha- and beta-thalassemias and the structural variant hemoglobins S, C, and E, which are found at polymorphic frequencies in many countries. All these hemoglobinopathies are believed to provide protection against malaria, and it is thought that, in malarial regions of the world, natural selection has been responsible for elevating and maintaining their gene frequencies, an idea first proposed 50 years ago by J.B.S. Haldane. Epidemiological studies undertaken in the 1950s on hemoglobin S in Africa provided support for the "malaria hypothesis," but until recently it has proved extremely difficult to verify it for the thalassemias. The application of molecular methods has, however, provided new opportunities to address this old question. Population and molecular genetic analysis of thalassemia variants, and microepidemiological studies of the relationship between alpha-thalassemia and malaria in the southwest Pacific, have provided unequivocal evidence for protection. Surprisingly, some of this protection appears to derive from enhanced susceptibility in very young thalassemic children to both Plasmodium falciparum and, especially, P. vivax, and this early exposure appears to provide the basis for better protection in later life.
Ragab, Seham M.; Badr, Eman A.; Ibrahim, Ahmed S.
2016-01-01
Background Osteoporosis is a major complication of beta thalassemia major (TM). Increased oxidative stress and its controlling genes were linked to osteoporosis. Ile105 Val variant is a functional polymorphism of Glutathione S-transferase P1 (GSTP1), with reduced anti-oxidative property. No data are available about this variant or its association with osteoporosis among thalassemia patients yet. Objectives To investigate Ile105Val polymorphism and its possible association with bone mineral density (BMD) values in a group of TM children. Methods Thirty five TM children and 30 age and sex matched healthy controls were included. Liver and renal functions, serum ferritin, calcium, phosphorous, alkaline phosphatase and osteocalcin were assayed. BMD was determined by DXA with calculation of Z-scores at lumbar spine (LS) and femoral neck (FN). Height for age Z- score (HAZ) adjusted BMD Z-scores were calculated. GSTP1 Ile105Val polymorphism was studied by polymerase chain reaction-restriction fragment length polymorphism. Results The relative frequency of 105 Val allele was significantly higher in TM patients than the controls (p<0.0001). Significant association between genotype subgroups and BMD parameters was detected. Compared to wild homozygotes, polymorphic homozygotes had lower LS-BMD (p =0.029), LS-BMD Z –score (p=0.008 ), LS- BMD haz - Z-score (p=0.011), FN- BMD (p= 0.001), FN- BMD Z –score (p=0.02) and FN-BMD haz - Z-score (p=0.001). They exhibited higher osteocalcin levels compared to heterozygotes and wild homozygotes (p=0.012, p=0.013, respectively). Conclusion Ile105Val polymorphism was frequent among TM patients and could increase their susceptibility to reduced BMD. Large sample studies are required to confirm these findings. PMID:26740865
Yalçn, Siddika Songül; Durmuşoğlu-Sendoğdu, Mine; Gümrük, Fatma; Unal, Selma; Karg, Eda; Tuğrul, Belma
2007-08-01
This study was planned to explore the self-concept, behavioral, and parental attitudes of the children with beta-thalassemia major, and the factors that affect them. The study was undertaken between January and June 2004 at the Hacettepe University Ihsan Doğramaci Children's Hospital, Pediatric Hematology Unit, Ankara and 43 voluntary children with beta-thalassemia major on regular blood transfusion and iron chelation treatment between the ages of 5.0 and 18.0 years were included into the study. Age, sex, birth order, school performance, hemoglobin value, serum ferritin levels, associated illness, splenectomy status, presence of thalassemic sibling or relatives, death of thalassemic relatives, place of residence, maternal and paternal education were recorded. Parental Attitude Research Instrument, Piers-Harris Self-Concept Scale, and Child Behavior Checklist were applied. Higher educated mothers have lower overprotection (P=0.009), parental discordance (P=0.044), and discipline scores (P=0.002) than lower educated mothers. In cases with death of thalassemic relatives, democratic/equality attitude scores were decreased (P=0.034). With stepwise multiple linear regression analysis, splenectomy, good school achievement, absence of death of thalassemic relatives, and serum ferritin levels were found to increase Piers-Harris Self-Concept Scale; however, total behavior problem score was found to decrease with increasing age, splenectomy and decreasing overprotection subscale of Parental Attitude Research Instrument scores. The self-esteem and behavior problems of children with thalassemia depended not only on the variables related exclusively to the child (age, school achievement) and the illness-associated conditions (splenectomy, serum ferritin levels) but also on the parental attitude (overprotection).
Waheed, Nadia; Ali, Shafqut; Butt, Muhammad Asghar
2014-01-01
Thalassemia major is the most common genetic disorder in Pakistan. The study was done to compare the efficacy and safety of the deferiprone with deferrioxamine for the treatment of iron overload in children with thalassemia major. This randomized controlled trail was conducted at thalassemia blood transfusion unit of Allied Hospital, Faisalabad (AHF)/District Headquarter Hospital (DHQ), Faisalabad. Thalassemia-Unit Hilal-e-Ahmar, Alizeb Foundation and Blood Bank Services Faisalabad from November 2010 to December 2011.Children with beta thalassemia major of age more than 2 years and less than 16 years with transfusion iron over load were randomly allocated to one of the two groups each comprising of 67 patients. One group received deferiprone given at a daily dose of 75mg/kg in three divided doses orally while the other group received deferrioxamine at dose 50 mg/kg/24hrs for 5 days/week as parental infusion. Changes in the serum ferritin level were assessed. Cardiac function and toxicity were also examined. Serum ferritin was significantly reduced after 1 year in both treatment arms (p=0.01). Neutropenia observed in 13 (19.40%) non-splenectomized patients taking deferiprone. Transient elevations in ALT were observed in 3 (4.47%) children taking deferiprone. Left ventricular ejection fraction (LVEF) remained in normal range in both treatment arm but has decreased significantly in Deferrioxamine group compliance. Compliance was better in deferiprone as compared to deferrioxamine. Discontinuing percentage 2 (3%) vs 9 (13.43%). Deferiprone is a highly efficacious and safe chelation therapy for patients with thalassemia major who are non-compliant to Deferrioxamine. Deferiprone have an efficacy profile comparable to standard Deferrioxamine.
Retinal abnormalities in β-thalassemia major.
Bhoiwala, Devang L; Dunaief, Joshua L
2016-01-01
Patients with beta (β)-thalassemia (β-TM: β-thalassemia major, β-TI: β-thalassemia intermedia) have a variety of complications that may affect all organs, including the eye. Ocular abnormalities include retinal pigment epithelial degeneration, angioid streaks, venous tortuosity, night blindness, visual field defects, decreased visual acuity, color vision abnormalities, and acute visual loss. Patients with β-thalassemia major are transfusion dependent and require iron chelation therapy to survive. Retinal degeneration may result from either retinal iron accumulation from transfusion-induced iron overload or retinal toxicity induced by iron chelation therapy. Some who were never treated with iron chelation therapy exhibited retinopathy, and others receiving iron chelation therapy had chelator-induced retinopathy. We will focus on retinal abnormalities present in individuals with β-thalassemia major viewed in light of new findings on the mechanisms and manifestations of retinal iron toxicity. Copyright © 2016 Elsevier Inc. All rights reserved.
Russo, Vincenzo; Rago, Anna; Papa, Andrea Antonio; Nigro, Gerardo
2016-07-01
Beta-thalassemia major (β-TM) is a genetic hemoglobin disorder characterized by an absent synthesis of globin chains that are essential for hemoglobin formation, causing chronic hemolytic anemia. Clinical management of thalassemia major consists in regular long-life red blood cell transfusions and iron chelation therapy to remove iron introduced in excess with transfusions. Iron deposition in combination with inflammatory and immunogenic factors is involved in the pathophysiology of cardiac dysfunction in these patients. Heart failure and arrhythmias, caused by myocardial siderosis, are the most important life-limiting complications of iron overload in beta-thalassemia patients. Cardiac complications are responsible for 71% of global death in the beta-thalassemia major patients. The aim of this review was to describe the most frequent electrocardiographic abnormalities and arrhythmias observed in β-TM patients, analyzing their prognostic impact and current treatment strategies. © 2016 Wiley Periodicals, Inc.
Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan
2006-01-01
Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.
Hypertriglyceridemia Thalassemia Syndrome: Common Disease, Uncommon Association.
Das, Lipsa; Samprathi, Madhusudan; Shukla, Umesh; Bandyopadhyay, Debapriya; Das, Rashmi Ranjan
2016-07-01
Hypertriglyceridemia has been rarely described with thalassemia, an entity called hypertriglyceridemia-thalassemia syndrome. The authors describe a young infant diagnosed with thalassemia major with severe hypertriglyceridemia. The presence of severe hypertriglyceridemia in this child which rapidly resolved after transfusion, probably suggests a self limited mechanism which may not require therapy. Though hypertriglyceridemia has been reported with hemolytic anemias, the mechanism is unclear. This case illustrates that thalassemia may be associated with hypertriglyceridemia; once familial and secondary causes are ruled out, clinicians may wait for spontaneous resolution before considering specific therapy.
Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe
2008-12-01
Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.
Craniofacial Characteristics of Thalassemia Major Patients
Karakas, Sacide; Tellioglu, Ayfer Metin; Bilgin, Mehmet; Omurlu, Imran Kurt; Caliskan, Sercin; Coskun, Salih
2016-01-01
Objective: Thalassemias major are the most common autosomal recessive disorders; they are characterized by anomalies in the synthesis of the beta chains of hemoglobin and are often associated with varying degrees of craniofacial anomalies. The purpose of this study was to evaluate the craniofacial dimensions of β-thalassemia patients and to identify differences by comparing them to those of a control group. Materials and Methods: The study comprised 43 thalassemia major patients and 26 age- and sex- matched healthy control subjects. Anthropometric measurements were performed in six different craniofacial regions (head, face, nose, mouth, eyes, and ears); a total of 23 craniofacial variables were measured. Results: Craniofacial measurements in the regions of the face, nose, lips and mouth, and ears in the thalassemia major patient group yielded statistically significant differences compared to those in the control group (p<0.05). However, no statistically significant differences were observed in the measurements of the head and eye regions. Conclusion: The study increased our understanding of the craniofacial anatomy of thalassemia major patients and enabled us to obtain quantitative results. PMID:28149147
Ghafourian, Mehri; Esmaeili, Mehrnosh; Dashti-Gerdabi, Nader; Sadeghi, Alireza; Malekei Naseri, Ali; Kazemi, Akhtar
2017-01-01
Thalassemia syndrome is the most common genetic disorder in the world and infection is the second cause of death in these patients. Measurement of serum C3 and C4 complement factors in serum was done in 60 patients with beta thalassemia major in comparison with 30 healthy subjects as control group. The serum level of C3 and C4 complement factors in 60 patients with beta thalassemia major who were randomly selected from among the patients referred to Shafa Hospital of Ahvaz was evaluated and compared with 30 samples from healthy individuals with no history of recent infectious or autoimmune diseases. It should be noted that single-radial-immunodiffusion assay was used in this study. This study has shown a significant reduction in serum levels of C3 and C4 in patients compared to controls (P value < 0.05). Decreased synthesis or increased consumption of complement factors in patients receiving multiple blood transfusions might lead to continuous contact between the immune system and various antigens, causing nonstop use of complement factors, recurrent infections, changes in parameters of the immune system due to iron overload as well as exposure to infectious factors such as HBV, HCV, HIV, and HTLV through blood transfusion.
Taher, Ali; Al Jefri, Abdullah; Elalfy, Mohsen Saleh; Al Zir, Kusai; Daar, Shahina; Rofail, Diana; Baladi, Jean François; Habr, Dany; Kriemler-Krahn, Ulrike; El-Beshlawy, Amal
2010-01-01
Patient-reported outcomes of once-daily oral deferasirox (Exjade) in iron-overloaded patients with beta-thalassemia not achieving successful chelation with prior deferoxamine and/or deferiprone were investigated in a prospective, open-label, 1-year, multicenter study in the Middle East (ESCALATOR). The initial dose of deferasirox was 20 mg/kg/day, with subsequent dose adjustments. At baseline and the end of study (EOS), patients (n = 237) completed a 5-point rating scale for treatment satisfaction and convenience, and recorded time lost to treatment. At EOS, 90.7% of patients were 'satisfied'/'very satisfied' with their iron chelation therapy (ICT) versus 23.2% at baseline. 92.8% (EOS) versus 21.5% (baseline) of patients considered their therapy to be 'convenient'/'very convenient'. Time lost to therapy for daily activities was substantially reduced (3.2 +/- 8.6 [mean +/- SD; EOS] vs. 30.1 +/- 44.2 [baseline] h/month). Patients reported greater satisfaction and convenience, and lower impact on daily activities, with deferasirox than with previous ICT. This may help improve adherence to lifelong ICT in iron-overloaded beta-thalassemia patients. 2010 S. Karger AG, Basel.
Better Renal Resistive Index Profile in Subjects with Beta Thalassemia Minor
.
Basut, Fahrettin; Keşkek, Şakir Özgür; Gülek, Bozkurt
2018-05-03
Beta thalassaemia minor is a common genetic disorder without any characteristic symptoms except mild anemia. It is found to be associated with some cardiovascular risk factors such as insulin resistance and diabetes mellitus. The renal resistive index (RRI) is a measure of renal arterial resistance to blood flow. The aim of this study was to evaluate the renal resistive index in subjects with beta thalassaemia minor (BTM). A total of 253 subjects were included in this cross-sectional study. The study group consisted of 148 subjects with BTM and the control group consisted of 105 healthy subjects. Beta thalassaemia minor was diagnosed by complete blood count and hemoglobin electrophoresis. Blood pressure measurement and biochemical tests were performed. Renal resistive index of all subjects was measured using renal Doppler ultrasonography. Subjects with beta thalassemia minor had lower renal resistive indices compared to healthy subjects (0.58 ± 0.04 vs. 0.60 ± 0.06, p = 0.0016). Additionally, the RRI levels of subjects with BTM were correlated with systolic blood pressure (p = 0.017, r = 0.194). In this study, lower renal resistive index was found in subjects with BTM. This may be associated with decreased vascular resistance and blood viscosity in these subjects. ©2018The Author(s). Published by S. Karger AG, Basel.
Impact of beta thalassemia on maxillary sinuses and sino-nasal passages: A case control study.
Ragab, Ahmed; Ragab, Seham Mohammed; Shawki, Mohammed
2015-12-01
Skeletal changes among beta (β) thalassemia children are well documented, but without available data regarding sino-nasal passages alterations. The authors investigated the maxillary sinuses and sino-nasal passages changes in β-thalassemia children and correlated such changes with the amount of transfused red cells and the erythroid marrow activity. Clinical analyses including otorhinolaryngical examination (ORL) were obtained in twenty β-thalassemia children and 20 matched healthy controls. Hemoglobin (Hb), serum ferritin, soluble transferrin receptor (sTfR) levels and bone mineral density of the lumbar spine (BMD ls) were assayed. The two groups were analyzed for the CT image parameters: bone thickness, anterior and posterior choanae diameters, extramedullary hematopoiesis and chronic rhinosinusitis (CRS) RESULTS: Nasal congestion/obstruction was identified in 14 (70%) children. Eight patients (40%) had criteria of chronic rhinosinusitis. In comparison with the normal controls, the increase in the roof, floor, medial, anterior, lateral and posterior maxillary bony walls thickness was significantly higher (1.26, 2.46, 2.6, 2.9, 3.23 and 5.34-folds, respectively). The mean posterior choanae horizontal, vertical diameters and their surface area were significantly reduced in the patients compared to the controls. The mean anterior maxillary wall bone thickness directly correlated with sTfR (P=0.047) while that of the posterior wall correlated inversely with Hb level (P=0.013). The mean vertical posterior choanae diameter had positive correlation with the amount of transfused red cells (P=0.001) and negative correlation with sTfR (P=0.001). The Hounsfield unit of maxillary sinus wall had direct relation with BMDls (P=0.003) CONCLUSIONS: Thalassemia children are at risk of different folds increase of maxillary sinuses walls thicknesses utmost at posterior and lateral walls. Other sino-nasal morbidities include diminished posterior choanal diameter, nasal obstruction
Retinal abnormalities in β-thalassemia major
Bhoiwala, Devang L.; Dunaief, Joshua L.
2015-01-01
Patients with beta (β)-thalassemia (β-TM: thalassemia major, β-TI: thalassemia intermedia) have a variety of complications that may affect all organs, including the eye. Ocular abnormalities include retinal pigment epithelium degeneration, angioid streaks, venous tortuosity, night blindness, visual field defects, decreased visual acuity, color vision abnormalities, and acute visual loss. Patients with β-TM are transfusion dependent and require iron chelation therapy (ICT) in order to survive. Retinal degeneration may result from either retinal iron accumulation from transfusion-induced iron overload or retinal toxicity induced by ICT. Some who were never treated with ICT exhibited retinopathy, and others receiving ICT had chelator-induced retinopathy. We will focus on retinal abnormalities present in individuals with β-TM viewed in light of new findings on the mechanisms and manifestations of retinal iron toxicity. PMID:26325202
Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein
2011-03-15
Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.
Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S
2017-12-30
Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.
Sudden monocular blindness associated with homozygous B-thalassemia in a young Liberian.
Njoh, J; York, S
1990-05-01
A 16-year old Liberian female presented with sudden monocular blindness. Physical examination and laboratory investigations were normal except that the patient had homozygous B-Thalassemia (HbA 58%, HbF 5% and HbA2 7.0%). Family study revealed that both parents had B-Thalassemia trait. We feel that the association of sudden monocular blindness with homozygous B-Thalassemia which has not been reported before, is not fortuitous but causal. It is therefore suggested that homozygous B-Thalassemia be added to the list of haemoglobinopathies (HbAS, SS and SC) that have been reported to cause blindness as complication.
Alternative options for DNA-based experimental therapy of β-thalassemia.
Gambari, Roberto
2012-04-01
Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.
Frischknecht, Hannes; Troxler, Heinz; Greiner, Jeanette; Hengartner, Heinz; Dutly, Fabrizio
2008-01-01
We describe a Hb S/beta-thalassemia (beta-thal) mutation involving an AT transition at codon 132 of the beta-globin gene. The mutation, in the heterozygous state, unlike several other mutations in exon 3, shows no signs of dominant thalassemia but those of a typical beta(0) carrier. Compound heterozygosity with Hb S [beta6(A3)GluVal, GAGGTG] showed a severe clinical picture.
Assessment of cognitive function in children with beta-thalassemia major: a cross-sectional study.
Raafat, Nelly; El Safy, Usama; Khater, Nahed; Hassan, Tamer; Hassan, Basheir; Siam, Ahmed; Youssef, Amira; El Shabrawy, Amany
2015-03-01
Multiple risk factors contribute to cognitive impairment in children with β-thalassemia major. For a more refined understanding of this issue, we attempted to evaluate cognitive function in β-thalassemia major patients and identify the relationship between possible cognitive dysfunction and the following: demography, transfusion and chelation characteristics, iron overload, and disease complications. We studied 100 β-thalassemia major children and 100 healthy controls who matched well in terms of age, sex, and socioeconomic status. All participants underwent psychometric assessment using Wechsler Intelligence Scale for Children-Third Edition, Arabic version. The mean Full-Scale IQ and Performance IQ of patients were significantly lower than those of controls, whereas no significant difference was found for Verbal IQ. No significant relationship existed between IQ and any of the assessed parameters. We concluded that Performance IQ, not Verbal IQ, was significantly affected in β-thalassemia major patients, but there was no clear association between IQ and any of the parameters. © The Author(s) 2014.
Hydroxycarbamide-Induced Changes in E/beta Thalassemia Red Blood Cells
Sylvia, Singer T.; Elliott, Vichinsky; Sandra, Larkin; Nancy, Olivieri; Nancy, Sweeters; Frans, Kuypers A.
2010-01-01
In thalassemia, fetal hemoglobin (HbF) augmentation with hydroxycarbamide (also known as hydroxyurea) is not always successful. The expected parallel effects on RBC membrane deformability, cell hydration and membrane phospholipid organization, all important for extending RBC life span and increasing Hb, have been infrequently examined. We analyzed these characteristics in 15 non-transfused E/β 0 thalassemia patients treated with HU (mean 10.2 months). Membrane deformability and cell hydration mildly improved in association with increased HbF levels approaching statistical significance (r = 0.51, p=0.06). All measures improved considerably splenectomized patients. These findings underscore the disappointing results of hydroxyurea treatment in clinical trials; and the importance of examining the effect on red cell characteristics for the development and understanding of HbF-enhancing agents. PMID:18821710
Origa, Raffaella
2017-06-01
β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.
Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.
Dong, Alisa C; Rivella, Stefano
2017-01-01
Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.
Hydroxyurea for hemoglobin E/β-thalassemia: a systematic review and meta-analysis.
Algiraigri, Ali H; Kassam, Aliya
2017-12-01
Hemoglobin E-beta thalassemia (Hb E/β-thalassemia) is a distinct, yet common, type of β-thalassemia, in which the patient co-inherits a β-thalassemia allele from one parent, and a structural variant, Hb E, from the other parent. This co-inheritance leads to remarkable clinical heterogeneity, varying degrees of chronic anemia, and a wide spectrum of complications due to ineffective erythropoiesis and iron overload. Hydroxyurea (HU), an oral chemotherapeutic drug, is expected to decrease disease severity. To assess the clinical efficacy and safety of HU in Hb E/β-thalassemia patients. We searched MEDLINE, EMBASE, Cochrane databases, and major preceding conferences for studies that assessed HU in Hb E/β-thalassemias patients. The effect size was estimated as a proportion (responder/sample size). Qualities of eligible studies were assessed using NIH tools. A total of five [one randomized clinical trial (RCT) and four observational] studies involving 106 patients were included. HU was associated with a significant RR of 46% with no statistical heterogeneity. No serious adverse effects were reported. Patients with Hb E/β-thalassemia may benefit from a trial of HU, though large RCTs assessing efficacy should be conducted to confirm the findings of this meta-analysis and to assess long-term toxicity and response sustainability.
Klaihmon, Phatchanat; Vimonpatranon, Sinmanus; Noulsri, Egarit; Lertthammakiat, Surapong; Anurathapan, Usanarat; Sirachainan, Nongnuch; Hongeng, Suradej; Pattanapanyasat, Kovit
2017-10-01
Bone marrow transplantation (BMT) serves as the only curative treatment for patients with β-thalassemia major; however, hemostatic changes have been observed in these BMT patients. Aggregability of thalassemic red blood cells (RBCs) and increased red blood cell-derived microparticles (RMPs) expressing phosphatidylserine (PS) are thought to participate in thromboembolic events by initially triggering platelet activation. To our knowledge, there has been no report providing quantitation of these circulating PS-expressing RBCs and RMPs in young β-thalassemia patients after BMT. Whole blood from each subject was fluorescently labeled to detect RBC markers (CD235a) and annexin-V together with the known number TruCount™ beads. PS-expressing RBCs, RMPs, and activated platelets were identified by flow cytometry. In our randomized study, we found the decreased levels of three aforementioned factors compared to levels in patients receiving regular blood transfusion (RT). This study showed that BMT in β-thalassemia patients decreases the levels of circulating PS-expressing RBCs, their MPs, and procoagulant platelets when compared to patients who received RT. Normalized levels of these coagulation markers may provide the supportive evidence of the effectiveness of BMT for curing thalassemia.
Could Heterozygous Beta Thalassemia Provide Protection Against Multiple Sclerosis?
Cikrikcioglu, Mehmet Ali; Ozcan, Muhammed Emin; Halac, Gulistan; Gultepe, Ilhami; Celik, Kenan; Sekin, Yahya; Eser, Elif Ece; Burhan, Sebnem; Cetin, Guven; Uysal, Omer
2016-01-01
Background Heterozygous beta thalassemia (HBT) has been proposed to increase the risk of developing autoimmune disease. Our aim in this study was to examine the prevalence of HBT among multiple sclerosis (MS) patients. Material/Methods HBT frequency was investigated in our MS group (243 patients with MS). Hemoglobin electrophoresis (HE) was carried out if MS patients had a mean corpuscular volume of (MCV) <80 fL and a mean corpuscular hemoglobin level of (MCH) <27 pg/L according to a complete blood count (CBC). If MCV was lower than 80 fL, MCH was lower than 27 pg/L, and Hemoglobin A2 equal to or higher than 3.5%, a diagnosis of HBT was established. The frequency of patients with HBT in our MS patient group was statistically compared with the prevalence of HBT in the city of Istanbul, where our MS patients lived. Results The HBT prevalence was 0.823% (2 patients) in the MS patient group. The prevalence of HBT in Istanbul has been reported to be 4.5%. According to the z-test, the HBT prevalence in our MS patient group was significantly lower than that in Istanbul (Z=6.3611, two-sided p value <0.0001, 95% confidence interval of prevalence of HBT in our MS patient group: 0.000998–0.029413). Conclusions Contrary to our hypothesis at the outset of study, the reduced HBT prevalence in the MS group compared to HBT frequency in the city of Istanbul might indicate that HBT is protective against MS. PMID:27941710
Einy, Shmuel; Hazan-Molina, Hagai; Ben-Barak, Ayelet; Aizenbud, Dror
Beta Thalassemia (βT) patients present a unique facial appearance and specific craniofacial, jaw and dental patterns. Although this anomaly often requires orthodontic management, βT patients have received scant attention in the orthodontic and dental literature over the past 50 years. The aim of this article is to review the characteristic craniofacial and dental manifestation pattern of βT patients and to emphasize their preferred orthodontic management protocol by presenting a βT orthodontic treated patient. A 10 year old patient presented with a complaint of severe esthetic and functional disorders due to her diagnosis of βT. We initiated orthodontic treatment including a combined orthopedic and functional treatment modality to improve facial appearance. Maxillary restraint and increased mandibular size during treatment along with an increase in the vertical dimension were achieved. The patient presented with Angle class I molar relationship, with reduction of the excessive overjet and deep overbite. Orthodontic treatment comprised of maxillary orthopedic treatment directed especially toward premaxilla with light forces, and mandibular modification by functional appliance along with fixed orthodontic treatment is recommended in βT patients.
Sruamsiri, Rosarin; Chaiyakunapruk, Nathorn; Pakakasama, Samart; Sirireung, Somtawin; Sripaiboonkij, Nintita; Bunworasate, Udomsak; Hongeng, Suradej
2013-02-05
Hematopoieticic stem cell transplantation is the only therapeutic option that can cure thalassemia disease. Reduced intensity hematopoietic stem cell transplantation (RI-HSCT) has demonstrated a high cure rate with minimal complications compared to other options. Because RI-HSCT is very costly, economic justification for its value is needed. This study aimed to estimate the cost-utility of RI-HSCT compared with blood transfusions combined with iron chelating therapy (BT-ICT) for adolescent and young adult with severe thalassemia in Thailand. A Markov model was used to estimate the relevant costs and health outcomes over the patients' lifetimes using a societal perspective. All future costs and outcomes were discounted at a rate of 3% per annum. The efficacy of RI-HSCT was based a clinical trial including a total of 18 thalassemia patients. Utility values were derived directly from all patients using EQ-5D and SF-6D. Primary outcomes of interest were lifetime costs, quality adjusted life-years (QALYs) gained, and the incremental cost-effectiveness ratio (ICER) in US ($) per QALY gained. One-way and probabilistic sensitivity analyses (PSA) were conducted to investigate the effect of parameter uncertainty. In base case analysis, the RI-HSCT group had a better clinical outcomes and higher lifetime costs. The incremental cost per QALY gained was US $3,236 per QALY. The acceptability curve showed that the probability of RI-HSCT being cost-effective was 71% at the willingness to pay of 1 time of Thai Gross domestic product per capita (GDP per capita), approximately US $4,210 per QALY gained. The most sensitive parameter was utility of severe thalassemia patients without cardiac complication patients. At a societal willingness to pay of 1 GDP per capita, RI-HSCT was a cost-effective treatment for adolescent and young adult with severe thalassemia in Thailand compared to BT-ICT.
2013-01-01
Background Hematopoieticic stem cell transplantation is the only therapeutic option that can cure thalassemia disease. Reduced intensity hematopoietic stem cell transplantation (RI-HSCT) has demonstrated a high cure rate with minimal complications compared to other options. Because RI-HSCT is very costly, economic justification for its value is needed. This study aimed to estimate the cost-utility of RI-HSCT compared with blood transfusions combined with iron chelating therapy (BT-ICT) for adolescent and young adult with severe thalassemia in Thailand. Methods A Markov model was used to estimate the relevant costs and health outcomes over the patients’ lifetimes using a societal perspective. All future costs and outcomes were discounted at a rate of 3% per annum. The efficacy of RI-HSCT was based a clinical trial including a total of 18 thalassemia patients. Utility values were derived directly from all patients using EQ-5D and SF-6D. Primary outcomes of interest were lifetime costs, quality adjusted life-years (QALYs) gained, and the incremental cost-effectiveness ratio (ICER) in US ($) per QALY gained. One-way and probabilistic sensitivity analyses (PSA) were conducted to investigate the effect of parameter uncertainty. Results In base case analysis, the RI-HSCT group had a better clinical outcomes and higher lifetime costs. The incremental cost per QALY gained was US $ 3,236 per QALY. The acceptability curve showed that the probability of RI-HSCT being cost-effective was 71% at the willingness to pay of 1 time of Thai Gross domestic product per capita (GDP per capita), approximately US $ 4,210 per QALY gained. The most sensitive parameter was utility of severe thalassemia patients without cardiac complication patients. Conclusion At a societal willingness to pay of 1 GDP per capita, RI-HSCT was a cost-effective treatment for adolescent and young adult with severe thalassemia in Thailand compared to BT-ICT. PMID:23379888
Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A
2009-06-04
Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.
Health related quality of life in Middle Eastern children with beta-thalassemia.
Caocci, Giovanni; Efficace, Fabio; Ciotti, Francesca; Roncarolo, Maria Grazia; Vacca, Adriana; Piras, Eugenia; Littera, Roberto; Markous, Raji Suleiman Dawood; Collins, Gary Stephen; Ciceri, Fabio; Mandelli, Franco; Marktel, Sarah; La Nasa, Giorgio
2012-06-22
Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL) in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years). HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL) 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002), Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015) and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047). HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046) and their parents (p = 0.007). The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children's HRQoL.
Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia
NASA Astrophysics Data System (ADS)
Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon
2015-09-01
Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.
Quality of Life in Children with Thalassemia and their Caregivers in India.
Sharma, Sapna; Seth, Bageshree; Jawade, Prashant; Ingale, Madhavi; Setia, Maninder Singh
2017-03-01
To assess and compare the Quality of Life (QOL) of children with beta-thalassemia major on regular transfusion therapy with normal children, and of the caregivers of children with beta-thalassemia major to that of caregivers of normal children. A cross-sectional comparison of QOL in 75 thalassemic and 80 non-thalassemic children was conducted using the PedsQL™ 4.0 generic core scale. Also self-rated health was assessed in their caregivers using Short Form-36 Health Survey. The total QOL score according to child-self report [83.7 (10.8) vs. 97.6 (3.3); p < 0.001] and parent-proxy report [84.2 (11.9) vs. 96.7 (3.5); p < 0.001] was significantly lower in cases as compared with controls. It was found that a significantly higher proportion of caregivers of cases reported poor health compared with caregivers of controls (29.2% vs. 2.5%, p < 0.001). Even after adjusting for age, sex, socio-economic status, and total QOL score by the parent, it was found that caregivers of thalassemic children were significantly more likely to report poor health compared with those of controls (odds ratio: 15.8, 95% confidence intervals: 2.8-89.9). Health Related QOL is significantly affected in children with beta-thalassemia major on regular transfusion across all age groups, gender and socio-economic classes and also in their caregivers.
Three mouse models of human thalassemia.
Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F
1981-01-01
Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454
... Thalassemia” More What can a person living with thalassemia do to stay healthy? A healthy lifestyle is ... disorder”, as well as making healthy choices. Managing Thalassemia Thalassemia is a treatable disorder that can be ...
... CDC’s Work Related Information UDC System Basics About Thalassemia Recommend on Facebook Tweet Share Compartir Did You ... to death. What are the different types of thalassemia? When we talk about different “types” of thalassemia, ...
Alpha Thalassemia (For Parents)
... Safe Videos for Educators Search English Español Alpha Thalassemia KidsHealth / For Parents / Alpha Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Alfa talasemia Thalassemias Thalassemias are a group of blood disorders that ...
Uysal, Aysel; Alkan, Gül; Kurtoğlu, Ayşegül; Erol, Onur; Kurtoğlu, Erdal
2017-09-01
Iron accumulation in the endocrine glands has been implicated in the aetiopathogenesis of decreased reproductive capacity in patients with beta-thalassemia major (β-TM). The aim of the current study was to investigate the serum concentration of anti-Müllerian hormone (AMH), a marker of ovarian reserve, in women with transfusion-dependent β-TM. In this case-control study, we recruited 43 women with transfusion-dependent TM and 44 age-matched healthy controls. Hormonal and haematological parameters, serum level of AMH, antral follicle count, and ovarian volume were assessed. Twenty-two of the 43 women were hypogonadotropic, 8 with primary amenorrhea and 14 with secondary amenorrhea. FSH, LH, estradiol, prolactin, and AMH levels; antral follicle count; and ovarian volume were significantly lower in women with TM compared with the control group (p<0.05 for all). AMH level and other ovarian reserve markers are significantly diminished in women with transfusion-dependent TM compared to age-matched controls. Our findings support a deleterious effect of iron overload on ovarian tissue. Published by Elsevier B.V.
Fucharoen, Suthat; Weatherall, David J.
2012-01-01
Hemoglobin E (HbE) is an extremely common structural hemoglobin variant that occurs at high frequencies throughout many Asian countries. It is a β-hemoglobin variant, which is produced at a slightly reduced rate and hence has the phenotype of a mild form of β thalassemia. Its interactions with different forms of α thalassemia result in a wide variety of clinical disorders, whereas its coinheritance with β thalassemia, a condition called hemoglobin E β thalassemia, is by far the most common severe form of β thalassemia in Asia and, globally, comprises approximately 50% of the clinically severe β-thalassemia disorders. PMID:22908199
Ragab, Seham M.; Safan, Manal A.; Badr, Eman A.
2015-01-01
Background Serum haptoglobin (Hp) is a reliable marker for hemolysis regardless the inflammatory state. Objective We investigated the possible relation between Hp depletion and hemolysis severity, hepatitis C virus (HCV) infection and iron load in β-thalassemia children. Methods Twenty two β-thalassemia major (TM),20 β-thalassemia intermedia (TI) children with 20 age and sex matched healthy controls were involved. Pre-transfusion hemoglobin level was considered. Serum ferritin, Hp and transferrin receptor levels (sTfR) (by ELISA ), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (by colorimetric method) were assayed. Markers of hepatitis C virus (HCV) were done by PCR. Results The mean Hp levels among the studied groups were as follows; 8.02 ± 0.93 (mg/dl), 8.6 ±0.72 (mg/dl) and 122 ± 18.5(mg/dl) for TM, TI and the controls respectively. Both patient groups had significantly lower Hp level compared to the controls (P<0.0001) with significant lower level in TM compared to TI children ( P= 0.034). Significant inverse correlations were found between serum Hp and sTfR levels ( reflecting the erythropoietic activity) in thalassemia children combined and in each group (TM and TI) as well as among HCV infected children. STfR was the only significant independent predictor for serum Hp level (t= −5.585, P<0.0001). Among HCV infected patients, no significant correlation was found between serum Hp and serum transaminases. Conclusion Serum Hp depletion in thalassemia had significant relation to disease severity and correlated well with their erythropoietic activity, as assessed by the measurement of sTfR without significant relation to HCV infection. Extensive multicenter studies are recommended. PMID:25745546
CLINICAL APPLICATION OF RECOMBINANT ERYTHROPOIETIN IN BETA-THALASSAEMIA INTERMEDIA.
Asadov, Ch; Alimirzoyeva, Z; Hasanova, M; Mammadova, T; Shirinova, A
2016-06-01
Research objective is to study the efficacy of recombinant erythropoietin (epoetin alfa) as alternative method of treatment beta-thalassemia intermedia. Study involved 58 patients with beta-thalassemia intermedia (23 women and 35 men). In all observed patients was defined levels of hemoglobin (Hb), red blood cells (RBC), erythrocyte indexes (MCV, MCH, MCHC), hemoglobin fractions (HbA, HbA2, HbF), serum ferritin, serum erythropoietin before and after administrated rEPO. All patients received rEPO during 6 month at the dose - 10000 IU subcutaneously. The majority of patients - 39 (67%) had a good response to rEPO (increase in hemoglobin level more than 20 g/l); 16 patients (28%) had a mean response (increase in Hb 10 - 20 g/l); in 3 (5%) patients occurred poor response to rEPO therapy (increase in Hb <10 g/l). After rEPO treatment of beta-thalassemia intermedia patients there was a statistically significant change in the number of RBC, levels of HbF and sEPO. The evaluation of interdependence between the indices of the baseline sEPO and increased Hb values in patients after rEPO treatment revealed the presence of the reverse direct relationship (r=-0.67). Based on the results, it can be concluded that the use of rEPO in complex therapy of beta-thalassemia intermedia leads to increased levels of Hb and consequently reducing the need for blood transfusions, and accordingly expected to prevent severe complications of blood transfusion (alloimmunization, hypersplenism, iron overload, contamination transmissible infections) facilitating normal growth and development, and a better quality of life.
Hypertriglyceridemia thalassemia syndrome.
Jain, Mili; Ali, Wahid; Singh, Brijendra Bahadur; Verma, Nishant; Kumar, Ashutosh
2018-06-14
Hypertriglyceridemia thalassemia syndrome is a rare entity with an unknown pathogenetic link. We report a case of an 8-month-old female with thalassemia major and increased triglyceride (TG) levels. The clinical features were as in classical thalassemia except for a white discoloration of the plasma. After exclusion of familial triglyceridemia and secondary causes (hypothyroidism, nephrotic syndrome, drugs etc.), a diagnosis of hypertriglyceridemia thalassemia syndrome was made. The high levels of TG in these patients are associated with oxidative stress and higher risk of acute pancreatitis and coronary diseases. An early recognition is thus essential. In our patient, the levels reduced after a transfusion therapy similar to previous reports.
Changes in lncRNAs and related genes in β-thalassemia minor and β-thalassemia major.
Ma, Jing; Liu, Fei; Du, Xin; Ma, Duan; Xiong, Likuan
2017-03-01
β-thalassemia is caused by β-globin gene mutations. However, heterogeneous phenotypes were found in individuals with same genotype, and still undescribed mechanism underlies such variation. We collected blood samples from 30 β-thalassemia major, 30 β-thalassemia minor patients, and 30 matched normal controls. Human lncRNA Array v2.0 (8 × 60 K, Arraystar) was used to detect changes in long non-coding RNAs (lncRNAs) and mRNAs in three samples each from β-thalassemia major, β-thalassemia minor, and control groups. Compared with normal controls, 1424 and 2045 lncRNAs were up- and downregulated, respectively, in β-thalassemia major patients, whereas 623 and 349 lncRNAs were up- and downregulated, respectively, in β-thalassemia minor patients. Compared with β-thalassemia minor group, 1367 and 2356 lncRNAs were up- and downregulated, respectively, in β-thalassemia major group. We selected five lncRNAs that displayed altered expressions (DQ583499, X-inactive specific transcript (Xist), lincRNA-TPM1, MRFS16P, and lincRNA-RUNX2-2) and confirmed their expression levels in all samples using real-time polymerase chain reaction. Based on coding-noncoding gene co-expression network and gene ontology biological process analyses, several signaling pathways were associated with three common organ systems exhibiting β-thalassemia phenotypes: hematologic, skeletal, and hepatic systems. This study implicates that abnormal expression levels of lncRNAs and mRNA in β-thalassemia cases may be correlated with its various clinical phenotypes.
Biedrzycki, Olaf J; Bevan, David; Lucas, Sebastian
2009-06-01
Introduced into clinical practice in the 1960s, the analgesic fentanyl is 100 times more potent than morphine. Various methods of administration exist including the transdermal Duragesic patch system, widely used in chronic pain and palliative care settings. Numerous, often imaginative methods of abuse of fentanyl patches have been reported; the majority of fatal fentanyl overdose cases resulting from deliberate abuse or suicide. We describe the accidental overdose of a young black male with sickle cell/beta-thalassemia who had been using the Duragesic system for almost 2 years.At autopsy the macroscopic findings were of nonspecific opiate overdose with congested heavy lungs. Histopathological examination revealed severe sickling of red blood cells in the lungs (acute chest syndrome). Toxicological examination revealed blood and urine fentanyl levels of 40 microg/L and 400 microg/L (10 fold and 100 fold higher than therapeutic levels). The mast cell tryptase was also significantly elevated at 76 microg/L, (Normal 2-14 microg/L). We discuss the relevance of these findings with regard to the cause of death, and stress the need to consider fentanyl when confronted with nonspecific signs of opiate overdose as it is not detected in routine toxicological drug screens.
Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin
2017-02-10
Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal
Echocardiographic evaluation of thalassemia intermedia patients in Duhok, Iraq.
Mohammad, Ameen Mosa
2014-12-11
Cardiac complications are among the most serious problems of thalassemia intermedia patients. The current study was initiated to address the latter issue through the study of the echocardiographic findings and correlate it with clinical characteristics of thalassemia intermedia patients in Duhok, Kurdistan region, Iraq. An echocardiographic assessment of 61 beta-thalassemia intermedia cases was performed. It included 30 males and 31 females, with a mean age 19.6 ± 7.5 years. The standard echostudy of two-dimension and M-mode measurements of cardiac chambers were done. The continuous doppler regurgitant jet of tricuspid and pulmonary valves were recorded. Left ventricle diastolic function was assessed by pulsed doppler of mitral valve inflow. To correlate the clinical with echocardiographic findings, patients were divided, according to tricuspid regurgitant velocity, into three groups (<2.5 m/sec, 2.5-2.9 m/sec and ≥3 m/sec). Tricuspid regurgitant velocity <2.5 m/sec, 2.5-2.9 m/sec and ≥3 m/sec occurred in 42(69%), 11(18%) and 8(13%) respectively. Comparing to other groups patients with tricuspid regurgitant velocity ≥3 m/sec were older and included more males. They had lower hemoglobin levels, but higher ferritin levels. Their age at diagnosis and the age of the initiation of blood transfusion were later. Most of them had significant exertional dyspnea. They also had relatively lower left ventricle ejection fraction values. Right ventricular diameter and right atrial size were larger in the same group. Tricuspid regurgitant velocity as a continuous predictor was associated positively with age, cardiac volumes and pulmonary regurgitation though negatively associated with ejection fraction. Echo-derived right and left side cardiac complications are not uncommon in thalassemia intermedia patients. Therapeutic trails targeting these complications are indicated, and echocardiographic assessment is necessary to be offered early for thalassemia intermedia.
Abou-Zeid, Ahmed A; Jumuah, Wael A; Ebied, Essam F; Abd El Samee Atia, Karim Sabry; El Ghamrini, Yasser; Somaie, Dina A
2017-08-01
Colorectal cancer in Egypt has a higher incidence in young patients compared to western countries, where the disease is more prevalent in the old age group. This difference has been attributed to higher incidence of hereditary cancers in young Egyptian patients. The aim of this study is to compare the family history criteria and pathology features of tumors in young (≤40 years) and old (>40 years) Egyptian patients with adenocarcinoma of the colon and rectum. This is the analysis of our prospectively collected data on the pathology features of tumors in 313 consecutive patients (133 young, 180 old) with colorectal cancer presenting to the Department of Surgery within an eight-year period. A detailed family history was obtained from 258 patients (112 young, 146 old). 41 young and 48 old patients reported family history of cancer, the difference was not statistically significant. Ten young patients (9%) reported a family history of colorectal cancer in a first degree relative (3 fitting into Amsterdam criteria, 7 fitting into less strict criteria) which was not significantly different from the old age group. The pathologic features of tumors in both groups resembled sporadic rather than hereditary cancer and there was no significant difference between groups in tumor location, degree of differentiation, mucin production, synchronous and metachronous colorectal tumors or polyps and grossly stricturing or ulcerating tumors. Extracolonic tumors developed in one young and two old patients. The characteristics of large bowel cancer in young Egyptian patients do not differ significantly from those in older patients. Despite the high incidence of large bowel cancer in young Egyptian patients, family history and pathologic features of tumors do not support a hereditary origin of colorectal cancer in this age group in Egypt. Copyright © 2017 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.
[Long-term effects of combined therapy in patients with beta-thalassemia major].
Bagnulo, S; Giannini, A M; Moscatelli, F; Stragapede, L; Acquafredda, A; Dammacco, A
1998-01-01
We evaluated therapy complications in 19 beta-thalassemia major patients (mean age from 3 years/5 months and 1 years/6 months) who were followed at II Pediatric Department-University of Bari. 3 out of 19 patients underwent allogenic BMT from matched related donor; 2 out of 19 underwent splenectomy. All of them were receiving hypertransfusion therapy and continuous chelation with DFO. In all patients we performed physical examination, laboratory assays, cardiac and endocrinologic function tests, serum HBV-HCV-HIV antibodies, otoscopy and audiometric test, fundus oculi, skeletal x-ray. 1 out of 19 patients, who was under 15, had a slight dilatation of left ventricle and arythmia. All patients were HBsAb positive. 4/19 patients were HCV Ab positive (ELISA test) with an increase in ALT-AST serum levels since at least 6 months. In 3 of them we assessed RIBA test, always positive. 3 of them underwent liver biopsy (1 iron overload 2 chronic active hepatitis). All patients were HIV Ab negative. 4/15 patients revealed low GH levels after Arginina test. 13 pre-pubescent patients had normal results with GNRH test but lower results after FSH test. 1 pubescent patient had gonadotropic hypophyseal deficit. 4 patients had subclinic hypothiroidism. We couldn't find any sequelas in bone-eyes-ears. Hypertransfusion therapy, chelation, profilaxis of infections improved length and quality of life in thalassemic patients. Hypogonadotropic hypogonadism remains a serious sequela and we think it needs to be treated.
Khosravi, Sharifeh; Salehi, Mansour; Ramezanzadeh, Mahboobeh; Mirzaei, Hamed; Salehi, Rasoul
2016-05-01
Thalassemia is curable by bone marrow transplantation; however, finding suitable donors with defined HLA combination remains a major challenge. Cord blood stem cells with preselected HLA system through preimplantation genetic diagnosis (PGD) proved very useful for resolving scarce HLA-matched bone marrow donors. A thalassemia trait couple with an affected child was included in this study. We used informative STR markers at the HLA and beta globin loci to develop a single cell multiplex fluorescent PCR protocol. The protocol was extensively optimized on single lymphocytes isolated from the couple's peripheral blood. The optimized protocol was applied on single blastomeres biopsied from day 3 cleavage stage IVF embryos of the couple. Four IVF embryos biopsied on day 3 and a single blastomere of each were provided for genetic diagnosis of combined β-thalassemia mutations and HLA typing. Of these, one embryo was diagnosed as homozygous normal for the thalassemia mutation and HLA matched with the existing affected sibling. The optimized protocol worked well in PGD clinical cycle for selection of thalassemia-unaffected embryos with the desired HLA system. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.
Beta-thalassemia major and female fertility: the role of iron and iron-induced oxidative stress.
Roussou, Paraskevi; Tsagarakis, Nikolaos J; Kountouras, Dimitrios; Livadas, Sarantis; Diamanti-Kandarakis, Evanthia
2013-01-01
Endocrine complications due to haemosiderosis are present in a significant number of patients with beta-thalassemia major (BTM) worldwide and often become barriers in their desire for parenthood. Thus, although spontaneous fertility can occur, the majority of females with BTM is infertile due to hypogonadotropic hypogonadism (HH) and need assisted reproductive techniques. Infertility in these women seems to be attributed to iron deposition and iron-induced oxidative stress (OS) in various endocrine organs, such as hypothalamus, pituitary, and female reproductive system, but also through the iron effect on other organs, such as liver and pancreas, contributing to the impaired metabolism of hormones and serum antioxidants. Nevertheless, the gonadal function of these patients is usually intact and fertility is usually retrievable. Meanwhile, a significant prooxidants/antioxidants imbalance with subsequent increased (OS) exists in patients with BTM, which is mainly caused by tissue injury due to overproduction of free radicals by secondary iron overload, but also due to alteration in serum trace elements and antioxidant enzymes. Not only using the appropriate antioxidants, essential trace elements, and minerals, but also regulating the advanced glycation end products, could probably reduce the extent of oxidative damage and related complications and retrieve BTM women's infertility.
Genetics Home Reference: alpha thalassemia
... Facebook Twitter Home Health Conditions Alpha thalassemia Alpha thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Alpha thalassemia is a blood disorder that reduces the production ...
[Sickle cell syndrome. Association between hemoglobin S and β thalassemia].
Gasparini, Nehuen P; Agriello, Evangelina E; Zanella, M J Lorena; Iommi, María P; Maradei, Juan; Sandoval, Marisa J
Sickle cell syndrome HbS/β thalassemia is an inheritable mendelian type disease where two affected alleles are simultaneously present, one from HbS (βS) and the other from β thalassemia. That situation is mainly linked to individuals who share African and Mediterranean ancestors. The mutation responsible for HbS is a point mutation, whereas for β thalassemia, there are more than 200 mutations that cause different degrees of deficiency synthesis of β globin chain, which justifies the clinical and genetic heterogeneity of this syndrome. It is presented a clinical case of a young adult man with limited resources that consulted by longstanding bone pain. The patient presented anemia with a marked microcytosis. Hemoglobin electrophoresis was performed, an abnormal peak in position of HbS and high HbA2 fraction were detected. These last results indicated two possible molecular alterations simultaneously, for this reason the molecular study was performed looking for the most common β thalassemia mutations in our population and, the point mutation responsible for S hemoglobinopathy. Clinical data and biochemical laboratory allowed the diagnosis of sickle cell syndrome. The molecular study confirmed the syndrome carrying mutations IVS-I nt 110 G > A, responsible for β thalassemia and, codon 6 A > T (GAG → GTG: Glu → Val) responsible for S hemoglobinophaty. Since it is a disease of high health impact, it is important to provide genetic counseling to the whole family.
Hepcidin is suppressed by erythropoiesis in hemoglobin E β-thalassemia and β-thalassemia trait
Jones, Emma; Pasricha, Sant-Rayn; Allen, Angela; Evans, Patricia; Fisher, Chris A.; Wray, Katherine; Premawardhena, Anuja; Bandara, Dyananda; Perera, Ashok; Webster, Craig; Sturges, Pamela; Olivieri, Nancy F.; St. Pierre, Timothy; Armitage, Andrew E.; Porter, John B.; Weatherall, David J.
2015-01-01
Hemoglobin E (HbE) β-thalassemia is the most common severe thalassemia syndrome across Asia, and millions of people are carriers. Clinical heterogeneity in HbE β-thalassemia is incompletely explained by genotype, and the interaction of phenotypic variation with hepcidin is unknown. The effect of thalassemia carriage on hepcidin is also unknown, but it could be relevant for iron supplementation programs aimed at combating anemia. In 62 of 69 Sri Lankan patients with HbE β-thalassemia with moderate or severe phenotype, hepcidin was suppressed, and overall hepcidin inversely correlated with iron accumulation. On segregating by phenotype, there were no differences in hepcidin, erythropoiesis, or hemoglobin between severe or moderate disease, but multiple linear regression showed that erythropoiesis inversely correlated with hepcidin only in severe phenotypes. In moderate disease, no independent predictors of hepcidin were identifiable; nevertheless, the low hepcidin levels indicate a significant risk for iron overload. In a population survey of Sri Lankan schoolchildren, β-thalassemia (but not HbE) trait was associated with increased erythropoiesis and mildly suppressed hepcidin, suggesting an enhanced propensity to accumulate iron. In summary, the influence of erythropoiesis on hepcidin suppression associates with phenotypic disease variation and pathogenesis in HbE β-thalassemia and indicates that the epidemiology of β-thalassemia trait requires consideration when planning public health iron interventions. PMID:25519750
de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J
2016-10-01
Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.
Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen
2016-04-14
The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.
Coinheritance of B-Thalassemia and Sickle Cell Anaemia in Southwestern Nigeria.
Vincent, Osunkalu; Oluwaseyi, Bamisaye; James, Babatunde; Saidat, Lawal
2016-11-01
Genes for haemoglobin S are found in high frequencies in Nigeria. However, there is little information on beta thalassemia in sickle cell anaemia in this population. The clinical presentation of HbS- β thalassemia is enormously variable, ranging from an asymptomatic state to a severe disorder similar to homozygous sickle cell disease. Haemoglobin A 2 and HbF were determined in sickle cell anaemia patients attending LAUTECH Teaching Hospital, Osogbo, by elution after electrophoresis and alkaline denaturation methods respectively. Haematological parameters were estimated using Sysmex KX-21N and percentage target cells using Leishman's staining technique. Exactly 6% f the SCA patients were found to have elevated HbA 2 (>3.3%) and HbF (>1.3%). These patients also had normal erythrocyte indices, increased platelet count, a significantly higher HCT and an increased % target cell. These findings confirm that the frequency of beta thalassaemia in sickle cell patients in Nigeria is higher than previously thought. It is therefore important to consider the possibility of this variant in patients with sickle cell anaemia since their course may differ from that of patients with homozygous sickle cell anaemia.
Interaction of malaria with a common form of severe thalassemia in an Asian population
O'Donnell, A.; Premawardhena, A.; Arambepola, M.; Samaranayake, R.; Allen, S. J.; Peto, T. E. A.; Fisher, C. A.; Cook, J.; Corran, P. H.; Olivieri, Nancy F.; Weatherall, D. J.
2009-01-01
In many Asian populations, the commonest form of severe thalassemia results from the coinheritance of HbE and β thalassemia. The management of this disease is particularly difficult because of its extreme clinical diversity; although some genetic and adaptive factors have been identified as phenotypic modifiers, the reasons remain unclear. Because the role of the environment in the course of severe thalassemia has been neglected completely and because malaria due to both Plasmodium falciparum and Plasmodium vivax has been prevalent in Sri Lanka, we carried out a pilot study of patients with HbE β thalassemia that showed high frequencies of antibodies to both parasite species and that 28.6% of the children had DNA-based evidence of current infection with P. vivax. Malarial antibodies then were assessed in patients with HbE β thalassemia compared with those in age-matched controls. There was a significant increase in the frequency of antibodies in the thalassemic patients, particularly against P. vivax and in young children. There was also a higher frequency in those who had been splenectomized compared with those with intact spleens, although in the latter it was still higher than that in the controls. The thalassemic patients showed significant correlations between malaria antibody status and phenotype. Patients with HbE β thalassemia may be more prone to malaria, particularly P. vivax, which is reflected in their clinical severity. Because P. vivax malaria is widespread in Asia, further studies of its interaction with HbE β thalassemia and related diseases are required urgently as a part of ongoing thalassemia control programs. PMID:19841268
A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.
Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François
2007-12-01
We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.
Bornaun, Helen; Dedeoglu, Reyhan; Oztarhan, Kazim; Dedeoglu, Savas; Erfidan, Erkan; Gundogdu, Muge; Aydogan, Gonul; Cengiz, Dicle
2016-01-01
Background Myocardial iron overload is the most common cause of mortality in patients with thalassemia major (TM), also known as beta-thalassemia. T2* cardiovascular magnetic resonance imaging (MRI) is the best way of monitoring cardiac iron, and new echocardiographic techniques can be used to assess cardiac function. Objectives The aim of this study was to assess the systolic and diastolic right ventricular (RV) function of patients with TM using tissue Doppler imaging (TDI) and to determine whether this echocardiographic technique is an adequate diagnostic tool for the screening and detection of subclinical cardiac dysfunction. Patients and Methods Eighty-four patients with TM were evaluated by conventional echocardiography and pulse-wave TDI. The data of the TM group (Group 1) were compared with that of 85 age- and sex-matched healthy controls (Group 2). Cardiovascular T2* MRI examinations were performed in 49 of the 85 patients. Results The patients with TM had significantly lower values for weight, height, body mass index, systolic arterial pressure, deceleration time, E’/A’, and ejection time (ET) than the controls. Group 1 also had significantly higher values for peak early diastolic velocity (E) over peak late diastolic velocity (A), peak early diastolic velocity of TDI (E’), peak late diastolic velocity of TDI (A’), E/E’, isovolumetric relaxation time, isovolumetric contraction time, and RV magnetic perfusion imaging (MPI) than Group 2. Conclusions RV diastolic dysfunction occurs before systolic deterioration in patients with TM and cannot be screened with conventional echocardiographic techniques. In routine practice, TDI measurements, MPI (for global function) and the E/E’ parameter (for diastolic function) can be used to screen and detect early RV dysfunction. PMID:27617076
Inadequate Dietary Intake in Patients with Thalassemia
Fung, Ellen B.; Xu, Yan; Trachtenberg, Felicia; Odame, Isaac; Kwiatkowski, Janet L.; Neufeld, Ellis J.; Thompson, Alexis A.; Boudreaux, Jeanne; Quinn, Charles T.; Vichinsky, Elliott P.
2012-01-01
Background Patients with thalassemia have low circulating levels of many nutrients, but the contribution of dietary intake has not been assessed. Objective Assess dietary intake in a large contemporary sample of patients with thalassemia. Design Prospective, longitudinal cohort study using a validated food frequency questionnaire Participants 221 patients (19.7±11.3 yrs, 106 female) categorized into three age groups: young children (3–7.9 y), older children/adolescents (8–18.9 yr), and adult (≥ 19 yr). 78.8% β-thalassemia; 90% chronically transfused. Setting 10 hematology outpatient clinics in the United States and Canada. Main outcome measures Comparison of intake with U.S. Dietary Reference Intakes, and correlation with serum 25-OH vitamin D and total body iron stores. Statistical Analyses Performed Intake was defined as inadequate if less than the estimated average requirement (EAR). Chi-square, Fisher’s exact and Student’s t-test were utilized to compare intake between age categories and logistic regression analysis to test the relationship between intake and outcomes, controlling for age, gender and race. Results Over 30% of patients consumed inadequate levels of vitamin A, D, E, K, folate, calcium, and magnesium. The only nutrients for which >90% of patients consumed adequate amounts were riboflavin, vitamin B12 and selenium. Dietary inadequacy increased with increasing age group (p<0.01) for vitamins A, C, E, B6, folate, thiamin, calcium, magnesium and zinc. Over half the sample took additional supplements of calcium and vitamin D, although circulating levels of 25-OH vitamin D remained insufficient in 61% of patients. Dietary iron intake was not related to total body iron stores. Conclusion Patients with thalassemia have reduced intake of many key nutrients. These preliminary findings of dietary inadequacy is concerning and supports the need for nutritional monitoring to determine which patients are at greatest risk for nutritional deficiency
Cappellini, Maria Domenica; Bejaoui, Mohamed; Agaoglu, Leyla; Porter, John; Coates, Thomas; Jeng, Michael; Lai, Maria Eliana; Mangiagli, Antonio; Strauss, Gabriele; Girot, Robert; Watman, Nora; Ferster, Alina; Loggetto, Sandra; Abish, Sharon; Cario, Holger; Zoumbos, Nicolaos; Vichinsky, Elliott; Opitz, Herbert; Ressayre-Djaffer, Catherine; Abetz, Linda; Rofail, Diana; Baladi, Jean-Francois
2007-05-01
Iron chelation therapy (ICT) with deferoxamine (DFO), the current standard for the treatment of iron overload in patients with transfusion-dependent disorders such as beta-thalassemia, requires regular subcutaneous or intravenous infusions. This can lead to reduced quality of life and poor adherence, resulting in increased morbidity and mortality in iron-overloaded patients with beta-thalassemia. Deferasirox is an orally administered iron chelator that has been approved for use in the United States, Switzerland, and other countries. This analysis was conducted to compare patient-reported outcomes (PROs) during receipt of DFO infusions or once-daily oral therapy with deferasirox (ICL670). PROs were prospectively evaluated as part of a randomized, Phase III study comparing the efficacy and safety profile of DFO 20 to 60 mg/kg per day with those of deferasirox 5 to 30 mg/kg per day in patients (age > or =2 years) with beta-thalassemia who were receiving regular transfusions and had a liver iron concentration of > or =2 mg/g dry weight. PRO questionnaires were completed by patients or a parent or legal guardian at baseline, week 4, week 24, and end of study (EOS). Patients assessed their level of satisfaction with study treatment (very satisfied, satisfied, neutral, dissatisfied, or very dissatisfied) and rated its convenience (very convenient, convenient, neutral, inconvenient, or very inconvenient). Time lost from normal activities due to ICT in the previous 4 weeks was recorded using a single global assessment. At week 4, patients who had previous experience with DFO were asked to indicate their preference for treatment (ICT received before the study, ICT received during the study, no preference, or no response) and the reason for that preference. At EOS, all patients were asked if they would be willing to continue using the ICT they had received during the study. All study analyses were performed in all patients who received at least 1 dose of study medication
Oxidative status and serum PON1 activity in beta-thalassemia minor.
Selek, Sahbettin; Aslan, Mehmet; Horoz, Mehmet; Gur, Mustafa; Erel, Ozcan
2007-03-01
Paraoxonase-1 (PON1) deficiency is related to increased susceptibility to low density lipoprotein oxidation and development of atherosclerosis. The aim of this study was to investigate paraoxonase and arylesterase activities along with oxidative status parameters, and to find out if there is any increased susceptibility to atherogenesis, which might be reflected with increased oxidative stress and decreased serum PON1 activity in beta-thalassemia minor (BTM) subjects. Thirty-two subjects with BTM and 28 healthy subjects as control were enrolled in the study. Serum paraoxonase and arylesterase activities, lipid hydroperoxide (LOOH) levels, total antioxidant capacity (TAC), total oxidant status (TOS) and oxidative stress index (OSI) were determined. Serum TAC, paraoxonase and arylesterase activities were significantly lower in BTM subjects than controls (for all p<0.001), while TOS, LOOH levels and OSI were significantly higher (p<0.001, p<0.05 and p<0.001; respectively). In BTM subjects, OSI, TOS, LOOH levels and TAC were significantly correlated with serum paraoxonase (r=-0.245, p<0.05; r=-0.231, p<0.05; r=-0.264, p<0.05 and, r=0.342, p<0.05, respectively) and arylesterase activities (r=-0.332, p<0.05, r=-0.308, p<0.05; r=-0.320, p<0.05 and r=0.443, p<0.05). Additionally, hemoglobin level was also correlated with serum paraoxonase (r=0.501, p<0.001) and arylesterase activities (r=0.501, p<0.001), TAC (r=0.402, p<0.05), TOS (r=-0.274, p<0.05) and OSI (r=-0.352, p<0.05). Oxidative stress is increased, while serum PON1 activity is decreased in BTM subjects. Decrease in PON1 activity seems to be associated with both the degree of oxidative stress and anemia. BTM subjects may be more prone to development of atherogenesis due to low serum PON1 activity.
Thalassemia: Complications and Treatment
... on Facebook Tweet Share Compartir If I have thalassemia, how does it affect my body? Since your ... like flu shots and other vaccines. How is thalassemia treated? The type of treatment a person receives ...
Thalassemia and Hemoglobin E in Southern Thai Blood Donors
Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol
2014-01-01
Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%), heterozygous α-thalassemia 1 (1.7%), heterozygous β-thalassemia without α-thalassemia (0.9%), heterozygous Hb E without α-thalassemia (5.2%), double heterozygotes for Hb E/α-thalassemia 1 (1.7%), homozygous Hb E without α-thalassemia (0.9%), and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%). The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors. PMID:25050123
Sutipornpalangkul, Werasak; Morales, Noppawan Phumala; Unchern, Supeenun; Sanvarinda, Yupin; Chantharaksri, Udom; Fucharoen, Suthat
2012-01-01
Beta-thalassemia/Hemoglobin E (beta-thal/Hb E) is prevalent in Thailand. The imbalance of globin chains in red blood cells is the primary cause of this anemic disease. The excess alpha-globin in beta-thal/Hb E causes typical damage(s) to membrane of erythroblasts and erythrocytes. By using three paramagnetic labeled compounds (5-, 12-, and 16-spin labeled stearic acids, SLS), the changes of the molecular motion in the lipid bilayer of thalassemic RBCs that have structural modification can be detected. to investigate erythrocyte membrane fluidity and the effect of vitamin E treatment in beta-thalassemia/Hemoglobin E patients by using spin labeling techniques. The erythrocyte membrane fluidity was investigated in nine splenectomized and five non-splenectomized beta-thalassemia/hemoglobin E (beta-thal/Hb E) patients using EPR spin labeling techniques. To determine the effect of vitamin E on erythrocyte membrane fluidity, only the splenectomized patients were enrolled. Patients were divided into two groups. The first group received 350 mg vitamin E daily for a period of 1 month (n = 5) and the second group received placebo for an equal period (n = 4). Three paramagnetic fatty acid, 5-, 12-, and 16-doxyl stearic acids, (5-, 12- and 16-DS) were used to label phospholipids layer near both the surface (5-DS) and the deeper hydrophobic region of membrane (12-and 16-DS). Lipid peroxidation (TBARs) was measured using a colorimetric method. Vitamin E was measured with high performance liquid chromatography (HPLC). Significantly higher values of erythrocyte membrane fluidity were revealed with 12-, 16-DS in splenectomized patients, as compared with non-splenectomized patients and normal subjects. In 3-thal/Hb E patients, fluidity values, both outer hyperfine splitting (2T(//)) and order parameter (S) of 12-DS showed inverse correlation with serum TBARs. There was no significant difference between the fluidity values measured with 5-DS. After vitamin E supplementation, the
Jenkins, Zandra A; Hagar, Ward; Bowlus, Christopher L; Johansson, Hans E; Harmatz, Paul; Vichinsky, Elliott P; Theil, Elizabeth C
2007-06-01
Hypertransfusional (>8 transfusions/year) iron in liver biopsies collected immediately after transfusions in beta-thalassemia and sickle cell disease correlated with increased expression (RNA) for iron regulatory proteins 1 and 2 (3-, 9- to 11-fold) and hepcidin RNA: (5- to 8-fold) (each p <.01), while ferritin H and L RNA remained constant. A different H:L ferritin ratio in RNA (0.03) and protein (0.2-0.6) indicated disease-specific trends and suggests novel post-transcriptional effects. Increased iron regulatory proteins could stabilize the transferrin receptor mRNA and, thereby, iron uptake. Increased hepcidin, after correction of anemia by transfusion, likely reflects excess liver iron. Finally, the absence of a detectable change in ferritin mRNA indicates insufficient oxidative stress to significantly activate MARE/ARE promoters.
Ferreira, Marina Neves; Bonini-Domingos, Claudia Regina; Fonseca Estevão, Isabeth; de Castro Lobo, Clarice Lopes; Souza Carrocini, Gisele Cristina; Silveira-Carvalho, Aparecida Perpétuo; Ricci, Octávio; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia
2017-06-14
In Brazil, there have been no previous studies of Toxoplasma gondii infection in sickle cell anemia patients and carriers of severe forms of beta-thalassemia. This study evaluated T. gondii infection in patients with beta-hemoglobinopathies. A total of 158 samples, 77 (48.7%) men and 81 (51.3%) women, were evaluated. Three groups were formed: G1 (85 patients with sickle cell disease); G2 (11 patients with homozygous beta-thalassemia; G3 (62 patients with heterozygous beta-thalassemia). ELISA was employed to identify anti-T. gondii IgM and IgG antibodies, and molecular analysis was performed to determine beta-hemoglobin mutations. Fisher's exact test was used to compare frequencies of anti-T. gondii IgM and IgG antibodies in respect to gender and age. Anti-T. gondii IgG antibodies were found in 43.5% of individuals in G1, 18.1% in G2 and 50% in G3. All samples from G1 and G2 were seronegative for anti-T. gondii IgM antibodies, but 3.2% from G3 were seropositive. Considering anti-T. gondii IgG antibodies, no statistical significant differences were found between these groups nor in seroprevalence between genders within each group. Despite this, comparisons of the mean ages between G1, G2 and G3 were statistically significant (G2 vs. G1: p value = 0.0001; G3 vs. G1: p-value <0.0001; G3 vs. G2: p-value = 0.0001). A comparison by age of patients with sickle cell anemia showed a trend of lower risk of infection among younger individuals. Therefore, this study demonstrates that T. gondii infection occurs in patients with beta-thalassemia and sickle cell anemia in Brazil as seen by the presence of anti-T. gondii IgM and IgG antibodies.
beta-lactamase production by oral pigmented Prevotella species isolated from young children.
Könönen, E; Nyfors, S; Mättö, J; Asikainen, S; Jousimies-Somer, H
1997-09-01
The frequency of beta-lactamase production by oral pigmented Prevotella species isolated from 23 healthy young children and the minimal inhibitory concentrations (MICs) for 186 available beta-lactamase-positive isolates were examined by using the chromogenic cephalosporin disk test (AB BIODISK, Solna, Sweden) and the Etest (AB BIODISK) and/or the agar dilution method of the National Committee for Clinical Laboratory Standards (Villanova, PA, USA), respectively. beta-Lactamase-positive Prevotella melaninogenica strains were isolated from all children, and more than two-thirds of the Prevotella denticola and Prevotella loescheii strains isolated from the children were beta-lactamase-positive. The beta-lactamase-producing Prevotella intermedia group consisted of Prevotella nigrescens and the P. intermedia/ P. nigrescens-like organism (PINLO); P. intermedia was not found. Only two P. nigrescens isolates but most of the PINLO isolates produced beta-lactamase. The MICs for beta-lactamase-producing strains varied between 0.38 and 64 micrograms/mL. beta-Lactamase production by oral pigmented Prevotella species colonizing young children is already frequent. The phenomenon should be taken into account in the treatment of pediatric anaerobic infections of oral origin.
Gaziev, Javid; Isgrò, Antonella; Sodani, Pietro; Marziali, Marco; Paciaroni, Katia; Gallucci, Cristiano; De Angelis, Gioia; Andreani, Marco; Testi, Manuela; Alfieri, Cecilia; Ribersani, Michela; Galluccio, Tiziana; Battarra, Maria Rosa; Morrone, Aldo; Lucarelli, Guido
2016-04-01
Bone marrow transplantation (BMT) for class 3 patients with thalassemia is challenging due to high rates of graft rejection and transplant-related mortality. Since the first studies of BMT in the late 1980s, a number of conditioning regimens have been designed to improve outcomes, but with suboptimal results. Here we report the outcome of transplantation in class 3 patients using a modified protocol. Sixty-three patients between 5 and 16.7 years of age with class 3 thalassemia received HLA-matched sibling BMT following either the original protocol (26 patients) or the modified protocol (37 patients). Both regimens comprised preconditioning cytoreduction with hydroxyurea and azathioprine starting at -45 days pretransplant, and fludarabine from days -16 to -12. Conditioning was performed with busulfan and cyclophosphamide (original protocol) or with busulfan, thiotepa, and cyclophosphamide (modified protocol). The 2 groups showed similar patient demographics. At day 0, the degree of cytoreduction (lymphopenia, neuthropenia, and thrombocytopenia) achieved by the modified protocol was greater than the original protocol. The incidence of graft failure/rejection was significantly higher in the original group (15%; 95% confidence interval [95% CI], 5-32%) compared with the modified group (0%) (P = 0.014). The respective 5-year thalassemia-free survival rates were 73% (95% CI, 51-86%) and 92% (95% CI, 77-97%) (P = 0.047). Both groups showed similar incidences of grades II to IV acute graft-versus host disease. Modified protocol did not increase nonhematological toxicity or infectious complications. The modified treatment protocol effectively and safely prevented graft failure/rejection and significantly increased thalassemia-free survival of class 3 patients with thalassemia.
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
La Nasa, Giorgio; Vacca, Adriana; Littera, Roberto; Piras, Eugenia; Orru, Sandro; Greco, Marianna; Carcassi, Carlo; Caocci, Giovanni
2016-01-01
Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT) continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA)-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cord blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS) and thalassemia-free survival (TFS) rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD) remains the most important complication in unrelated HSCT in thalassemia, leading to significant rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individualize appropriate strategies for its prevention and management. This review provides an overview of recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia. PMID:27872728
Benites, Bruno Deltreggia; Bastos, Stephany Oliveira; Baldanzi, Gabriel; Dos Santos, Allan de Oliveira; Ramos, Celso Dario; Costa, Fernando Ferreira; Gilli, Simone Cristina Olenscki; Saad, Sara Teresinha Olalla
2016-12-01
In sickle cell/β-thalassemia, mutations in the corresponding β-globin genes are responsible for complex pathological events resulting in diverse clinical complications. The objective of this study was to provide an overview of the clinical and laboratory characteristics of patients with the syndrome, and of the degree of severity of clinical manifestations resulting from the β-thalassemia mutation. A retrospective chart review was performed on 46 patients with sickle cell/β-thalassemia (31 Sβ° and 15 Sβ + ), evaluating hematological parameters and end organ damage. Statistical analyzes were carried out in order to highlight differences between the two groups according to the nature of the thalassemia mutation. As expected, patients with the Sβ 0 phenotype had a higher degree of hematological involvement in comparison to Sβ + patients; with lower hemoglobin levels, and signs of more intense chronic hemolysis. However, Sβ + patients were more prone to the occurrence of acute chest syndrome. The impact of the thalassemia mutation upon total body and bone composition was also evident, as Sβ 0 patients presented lower body mass index (BMI) and bone mineral density. The degree of bone damage correlated to lower BMI and hemoglobin levels, as well as plaquetosis, monocytosis and elevated lactate dehydrogenase, possibly reflecting the effects of hemolysis and inflammation upon bone metabolism and body constitution. This study identified significant differences among sickle cell/β-thalassemia patients according to the beta mutation involvement, pointing to an important predictor of disease severity.
Modeling and Collective Painting in an Egyptian Primary School.
ERIC Educational Resources Information Center
El Bassiouny, Mahmoud
1980-01-01
The author's art instruction for young Egyptian children focuses on design, creative expression, and appreciation of Egypt's unique artistic tradition. This article is one of several in this issue on art education in other countries. (SJL)
Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio
2012-01-01
This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841
Inadequate dietary intake in patients with thalassemia.
Fung, Ellen B; Xu, Yan; Trachtenberg, Felicia; Odame, Isaac; Kwiatkowski, Janet L; Neufeld, Ellis J; Thompson, Alexis A; Boudreaux, Jeanne; Quinn, Charles T; Vichinsky, Elliott P
2012-07-01
Patients with thalassemia have low circulating levels of many nutrients, but the contribution of dietary intake has not been assessed. Our objective was to assess dietary intake in a large contemporary sample of subjects with thalassemia. A prospective, longitudinal cohort study using a validated food frequency questionnaire was conducted. Two hundred and twenty-one subjects (19.7±11.3 years, 106 were female) were categorized into the following age groups: young children (3 to 7.9 years), older children/adolescents (8 to 18.9 years), and adults (19 years or older); 78.8% had β-thalassemia and 90% were chronically transfused. This study took place at 10 hematology outpatient clinics in the United States and Canada. We conducted a comparison of intake with US Dietary Reference Intakes and correlated dietary intake of vitamin D with serum 25-OH vitamin D and dietary iron with total body iron stores. Intake was defined as inadequate if it was less than the estimated average requirement. χ(2), Fisher's exact, and Student's t test were used to compare intake between age categories and logistic regression analysis to test the relationship between intake and outcomes, controlling for age, sex, and race. More than 30% of subjects consumed inadequate levels of vitamin A, D, E, K, folate, calcium, and magnesium. The only nutrients for which >90% of subjects consumed adequate amounts were riboflavin, vitamin B-12, and selenium. Dietary inadequacy increased with increasing age group (P<0.01) for vitamins A, C, E, B-6, folate, thiamin, calcium, magnesium, and zinc. More than half of the sample took additional supplements of calcium and vitamin D, although circulating levels of 25-OH vitamin D remained insufficient in 61% of subjects. Dietary iron intake was not related to total body iron stores. Subjects with thalassemia have reduced intake of many key nutrients. These preliminary findings of dietary inadequacy are concerning and support the need for nutritional monitoring to
Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.
Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio
2007-01-01
A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.
The Molecular Basis of β-Thalassemia
Thein, Swee Lay
2013-01-01
The β-thalassemias are characterized by a quantitative deficiency of β-globin chains underlaid by a striking heterogeneity of molecular defects. Although most of the molecular lesions involve the structural β gene directly, some down-regulate the gene through distal cis effects, and rare trans-acting mutations have also been identified. Most β-thalassemias are inherited in a Mendelian recessive fashion but there is a subgroup of β-thalassemia alleles that behave as dominant negatives. Unraveling the molecular basis of β-thalassemia has provided a paradigm for understanding of much of human genetics. PMID:23637309
UVBY beta photometry of the young southern cluster NGC3293 and comparison with other young clusters
NASA Astrophysics Data System (ADS)
Shobbrook, R. R.
1980-09-01
Stromgren uvby photometry has been obtained for 42 members and beta photometry for 37 members of the young southern galactic cluster NGC 3293. The distance modulus obtained from using Crawford's beta/M(V) calibration is 12.75 mag, corresponding to a distance of 3.55 kpc. Comparison of the colour/colour and the HR diagrams of NGC 3293 with those of the five other young northern and southern clusters reveals large differences between the clusters which may possibly be due to metal abundance variations across the Galaxy. Apparently correlated with this effect is a variation of the luminosities of the lower main sequences over about 1 mag. The fainter stars in the southern clusters appear to be an average of 0.7 mag brighter than those in the northern clusters, but it is not certain at present how much of this difference is due to possible systematic errors in the beta index zero point between the northern and southern hemispheres.
... carries oxygen to the body. That leads to anemia. Thalassemias occur most often among people of Italian, ... severe. Some people have no symptoms or mild anemia. The most common severe type in the United ...
Tatsumi, N; Yokota, M; Shindoh, K; Funahara, Y; Nathalang, O; Sukpanichnant, S; Bunyaratvej, A; Fucharoen, S
1997-01-01
Presently genetic analyses for thalassemia types require relatively large amounts of heparinized blood (5 to 10 ml), and transport as well as degeneration of these sample is a problem in the developing world. We have developed a new method to simplify this procedure and obtain DNAs from small specimens. As experimental materials, thinly smeared blood on a glass slide or blood filtered with and adhered on polysthylene telephtalate (PST) fibers were used. These materials could be safely stored without interfering with DNA extraction for up to 3 months. The slide materials were digested with proteinase K, and DNA was extracted with Tris-EDTA-phenol:chloroform and precipitated with absolute ethanol. The PST specimens were washed with physiologic saline and treated in the same manner as described above. Products were easily amplified by PCR and digested with restriction endonucleases for beta thalassemia typing as well as for HLA-DQA1 gene typing. Results obtained by this method correlated well with previously reported incidences for thalassemia and HLA-DQA1 types in Thailand. This method can be used in the routine laboratory because it allows for stable and biosafe genetic analyses.
Zafari, Mandana; Gill, Pooria; Kowsaryan, Mehrnoush; Alipour, Abbass; Banihashemi, Ali
2016-10-01
The high-resolution melting (HRM) technique is fast, effective and successful method for mutation detection. The aim of this study was to determine the sensitivity and specificity of the HRM method for detection of a paternally inherited mutation in a fetus as a noninvasive prenatal diagnosis of β-thalassemia. Genomic DNAs were prepared from 50 β-thalassemia minor couples whose pregnancy was at risk for homozygous β-thalassemia. Ten milliliters of the maternal blood from each pregnant woman were collected and after separating plasma stored at -80 °C until analysis. The extracted DNAs were analyzed by HRM real-time PCR for detection of IVS-II-I (G-A) as a paternally inherited mutation. The gold standard was the result of a chorionic villus sampling by a standard reverse dot blotting test. The sensitivity and specificity of HRM real-time PCR were 92.6% and 82.6%, respectively. Also, the positive and negative predictive values were 86.2% and 90.47%, respectively. HRM real-time PCR was a sensitive and specific method for determining the paternally inherited mutation in the fetus at risk with thalassemia major.
Pulmonary hypertension associated with thalassemia syndromes
Fraidenburg, Dustin R.; Machado, Roberto F.
2016-01-01
Chronic hemolytic anemia has increasingly been identified as an important risk factor for the development of pulmonary hypertension. Within the thalassemia syndromes, there are multiple mechanisms, both distinct and overlapping, by which pulmonary hypertension develops and that differ among β-thalassemia major or intermedia patients. Pulmonary hypertension in β-thalassemia major correlates with the severity of hemolysis, yet in patients whose disease is well treated with chronic transfusion therapy, the development of pulmonary hypertension can be related to cardiac dysfunction and the subsequent toxic effects of iron overload rather than hemolysis. β-thalassemia intermedia, on the other hand, has a higher incidence of pulmonary hypertension owing to the low level of hemolysis that exists over years without the requirement for frequent transfusions, while splenectomy is shown to play an important role in both types. Standard therapies such as chronic transfusion have been shown to mitigate pulmonary hypertension, and appropriate chelation therapy can avoid the toxic effects of iron overload, yet is not indicated in many patients. Limited evidence exists for the use of pulmonary vasodilators or other therapies, such as l-carnitine, to treat pulmonary hypertension associated with thalassemia. Here we review the most recent findings regarding the pathogenic mechanisms, epidemiology, presentation, diagnosis, and treatment of pulmonary hypertension in thalassemia syndromes. PMID:27008311
ERIC Educational Resources Information Center
Schroeder, Liesa
1999-01-01
Provides an activity where sixth-grade students replicated the Egyptian art form of tomb painting. Explains that the students researched information about Egyptian culture and history in order to familiarize themselves with Egyptian wall-painting style. Discusses the process of creating tomb paintings in detail. (CMK)
Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men
Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung
2015-01-01
Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766
Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand
Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara
2015-01-01
Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819
Karimzaei, Tahmineh; Masoudi, Qolamreza; Shahrakipour, Mahnaz; Navidiyan, Ali; Jamalzae, Abd Al-Qaffar; Zoraqi Bamri, Ahmad
2015-06-09
Thalassemia is the most common genetic disorder and rising in the world as a health problem. Due to the criticality of this disease, in our country thalassemia prevention programs are more importance. The aim of this study was investigation of knowledge, attitude and behavior of marrying partners who were thalassemia genetic carriers in prevention of the birth of the children with major thalassemia. This study was a descriptive-analytic study. Data collection tool was a self-administered questionnaire that included 43 items. The content validity of questionnaire was investigated under the supervision of physicians, experts of health education and promotion. Its reliability was confirmed by Cronbach's Alpha test. The subjects in the study consisted of 100 marrying partners who were genetic carriers of thalassemia who referred to Premarital Counseling Center in Iranshahr City. Iranshahr is a a large city of Sistan and Balouchestan Province that located in southeast of Iran. The subjects were selected by convenience non-probability sampling method. Data analyzed using descriptive and analytic statistical tests in SPSS 16.00 and level of significance considered on α<0.05. The average age of men and women that participated in this study was 21.92 and 24 years respectively. 88% of the partners had familial relationships. The educational level of most of the men (34%) was diploma and of women (44%) was pre-diploma. The research findings showed that 7% and 62% of the subjects had poor and mediocre levels of knowledge respectively. Also results showed that only 13% of them had a satisfactory behavior and educational status had a positive correlation with knowledge, behavior, perceived susceptibility and perceived severity (P<0.05). As well there was a significant statistical relationship between gender and familial relationship, and the perceived barriers of participants. (p=0.01). The survey viewpoint of participants showed that they believed knowledge increasing (40
NASA Astrophysics Data System (ADS)
Symons, Sarah
Diagonal, transit, and Ramesside star clocks are tables of astronomical information occasionally found in ancient Egyptian temples, tombs, and papyri. The tables represent the motions of selected stars (decans and hour stars) throughout the Egyptian civil year. Analysis of star clocks leads to greater understanding of ancient Egyptian constellations, ritual astronomical activities, observational practices, and pharaonic chronology.
[Prenatal diagnosis of Thailand deletion of α-thalassemia 1 families].
Lin, N; Lin, Y; Huang, H L; Lin, X L; He, D Q; He, S Q; Guo, D H; Li, Y; Xu, L P
2016-06-28
To conduct analysis and prenatal diagnosis on 11 couples carrying Thailand deletion (--(THΑI)) α-thalassemia 1, so as to provide information for clinical genetic counseling on α-thalassemia 1. Altogether 11 Thailand deletion (--(THΑI)) α-thalassemia 1 families were collected from Fujian Maternal and Children Health Hospital from May 2009 to September 2015. Gap-polymerase chain reaction (gap-PCR) and reverse dot blot (RDB) technology were used to detect the thalassemia mutations in the couples and fetuses. In one family, Thailand deletion α-thalassemia 1 was detected in both the pregnant woman and her husband. In 10 families, Thailand deletion α-thalassemia 1 was detected in either the pregnant women or the husband, while the spouses had α-thalassemia heterozygote (1 combined with β thalassemia heterozygote). Thailand deletion α-thalassemia 1 family members all had lower mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH). In prenatal diagnosis of the 12 fetuses, 4 fetuses were found with hemoglobin(Hb) Bart's hydrops fetalis syndrome, 5 were with α-thalassemia heterozygote, and 3 were normal. For couples with positive hematological phenotype but normal results in routine genetic examination of α-thalassemia, attention should be paid especially for with a history of having babies of hydrops fetalis syndrome or hemoglobin H disease. It is necessary to consider the possibility of the rare Thailand deletion (--(THΑI)) α-thalassemia 1. Prenatal diagnosis for high-risk families plays an important role.
Contrasting molecular pathology of colorectal carcinoma in Egyptian and Western patients
Soliman, A S; Bondy, M L; El-Badawy, S A; Mokhtar, N; Eissa, S; Bayoumy, S; Seifeldin, I A; Houlihan, P S; Lukish, J R; Watanabe, T; Chan, A On On; Zhu, D; Amos, C I; Levin, B; Hamilton, S R
2001-01-01
Colorectal carcinoma is uncommon in Egypt, but a high proportion of cases occurs before age 40 years and in the rectum. We compared the molecular pathology of 59 representative Egyptian patients aged 10–72 to Western patients with sporadic, young-onset, or hereditary non-polyposis colorectal cancer syndrome (HNPCC)-associated carcinoma and found significant differences. Most Egyptian cancers were rectal (51%) and poorly differentiated (58%). High levels of microsatellite instability (MSI-H) were frequent (37%) and attributable in some cases (36%) to methylation of the promoter of the hMLH1 mismatch repair gene, but no MSI-H cancer had loss of hMSH2 mismatch repair gene product of the type seen with germline hMSH2 mutation in HNPCC. K-ras mutation was uncommon (11%). In subset analyses, high frequencies of MSI-H in rectal carcinomas (36%) and p53 gene product overexpression in MSI-H cancers (50%) were found. MSI-H and K-ras mutation in Egyptians under age 40 were unusual (17% and 0%, respectively), and schistosomiasis was associated with MSI and K-ras mutation. Cluster analysis identified 2 groups: predominantly young men with poorly differentiated mucinous and signet-ring cell colorectal carcinoma lacking K-ras mutation; older patients who had well- or moderately differentiated adenocarcinoma often with MSI-H, K-ras mutation and schistosomiasis. Our findings show that the molecular pathology of colorectal cancer in older as well as younger Egyptians has unique differences from Western patients, and schistosomiasis influences the molecular pathogenesis of some tumours. © 2001 Cancer Research Campaignhttp://www.bjcancer.com PMID:11592777
Caocci, Giovanni; Orofino, Maria Grazia; Vacca, Adriana; Piroddi, Antonio; Piras, Eugenia; Addari, Maria Carmen; Caria, Rossella; Pilia, Maria Paola; Origa, Raffaella; Moi, Paolo; La Nasa, Giorgio
2017-12-01
Allogeneic hematopoietic stem cell transplantation (HSCT) in thalassemia remains a challenge. We reported a single-centre case-control study of a large cohort of 516 children and adult patients treated with HSCT or blood transfusion support and iron chelation therapy; 258 patients (median age 12, range 1-45) underwent sibling (67%) or unrelated (33%) HSCT; 97 patients were adults (age ≥ 16 years). The median follow-up after HSCT was 11 years (range 1-30). The conditioning regimen was busulfan (80.6%) or treosulfan-based (19.4%). A cohort of 258 age-sex matched conventionally treated (CT) patients was randomly selected. In transplanted patients the 30-year overall survival (OS) and thalassemia-free survival (TFS) were 82.6 ± 2.7% and 77.8 ± 2.9%, compared to the OS of 85.3 ± 2.7% in CT patients (P = NS); The incidence of grade II-IV acute and chronic graft versus host disease (GvHD) was 23.6% and 12.9% respectively. The probability of rejection was 6.9%. Transplant-related mortality (TRM) (13.8%) was similar to the probability of dying of cardiovascular events in CT patients (12.2%). High-risk Pesaro score (class 3) was associated with lower OS (OR = 1.99, 95% C.I.=1.31-3.03) and TFS (OR = 1.54, 95% C.I.=1.12-2.12). In adult patients, the 23-years OS and TFS after HSCT were 70 ± 5% and 67.3 ± 5%, compared to 71.2 ± 5% of OS in CT (P = NS). Finally, treosulfan was associated with lower risk of acute GvHD (P = .004; OR = 0.28, 95% C.I.=0.12-0.67). In conclusion, the 30-year survival rate of ex-thalassemia patients after HSCT was similar to that expected in CT thalassemia patients, with the vast majority of HSCT survivors cured from thalassemia. © 2017 Wiley Periodicals, Inc.
β-Thalassemia intermedia: a comprehensive overview and novel approaches.
Asadov, Chingiz; Alimirzoeva, Zohra; Mammadova, Tahira; Aliyeva, Gunay; Gafarova, Shahla; Mammadov, Jeyhun
2018-01-29
β-Thalassemia intermedia is a clinical condition of intermediate gravity between β-thalassemia minor, the asymptomatic carrier, and β-thalassemia major, the transfusion-dependent severe anemia. It is characterized by a significant clinical polymorphism, which is attributable to its genetic heterogeneity. Ineffective erythropoiesis, chronic anemia, and iron overload contribute to the clinical complications of thalassemia intermedia through stepwise pathophysiological mechanisms. These complications, including splenomegaly, extramedullary erythropoiesis, iron accumulation, leg ulcers, thrombophilia, and bone abnormalities can be managed via fetal hemoglobin induction, occasional transfusions, chelation, and in some cases, stem cell transplantation. Given its clinical diversity, thalassemia intermedia patients require tailored approaches to therapy. Here we present an overview and novel approaches to the genetic basis, pathophysiological mechanisms, clinical complications, and optimal management of thalassemia intermedia.
New Horizons: An Empowerment Program for Egyptian Adolescent Girls.
ERIC Educational Resources Information Center
Swanson, Julie Hanson
New Horizons is a nonschool program that demystifies and communicates essential information on basic life skills and reproductive health to Egyptian girls and young women aged 9-20. The program consists of 100 hour-long sessions, each including an introduction to a specific topic, review of group knowledge level, discussion around key points…
Endocrinopathies in thalassemia major patient
NASA Astrophysics Data System (ADS)
Lubis, D. A.; Yunir, E. M.
2018-03-01
Advanced in chelation therapy and regular blood transfusion have marked improvements in the life expectancy of patients with thalassemia major, however these patients still have to deal with several complications. We report a 19-year-old male, presented with multiple endocrine complication-related thalassemia; hypogonadism, short stature, osteoporosis with history of fracture, and subclinical hypothyroid.
Investigation of liquid wax components of Egyptian jojoba seeds.
El-Mallah, Mohammed Hassan; El-Shami, Safinaz Mohammed
2009-01-01
Egyptian jojoba seeds newly cultivated in Ismailia desert in Egypt promoted us to determine its lipid components. Fatty alcohols, fatty acids, wax esters and sterols patterns were determined by capillary GLC whereas, tocopherols profile, isopropenoid alcohols and sterylglycosides were determined by HPLC. The Egyptian seeds are rich in wax esters (55 %) with fatty alcohols C20:1 and C22:1 as major components and amounted to 43.0 % and 45.6 % respectively followed by C24:1 and C18:1(9.6 % and 1.3 % respectively). The fatty acids profile showed that C20:1 is the major constituent (60 %) followed by C18:1 and C22:1 (14.5 and 11.8 % respectively) whereas C24:1 was present at low concentration amounted to 1.6 %. In addition, the Egyptian jojoba wax contained C18:2 fatty acid at a level of 8.7 %. Wax esters composition showed that the local wax had C42 and C40 esters as major components amounted to 51.1 and 30.1 % respectively. Also, it had C44 and C38 at reasonable amounts (10.0 and 6.3 % respectively). Whereas C36 and C46 were present at lower concentrations amounted to 1.4 and 1.1 respectively. The sterols analysis showed the presence of campe-, stigma-, beta-sito-, and isofuco- sterol amounting to 18.4 %, 6.9 %, 68.7 %, and 6.0 % respectively. The tocopherols pattern revealed that the local seed wax contained gamma-tocopherol as major constituent (79.2 %) followed by alpha-tocopherol (20.3 %). beta-tocopherol as well as delta-tocopherol were found as minor constituents. The isopropenoid alcohols and the sterylglycosides (free and acylated) were not detected. The wax is proposed to be used in oleo chemistry and cosmetics.
Mitophagy is increased during erythroid differentiation in β-thalassemia.
Wu, Limei; Xu, Wei; Xu, Luhong; Kong, Qian; Fang, Jianpei
2017-02-01
Mitophagy is a selective degradation of mitochondria, which also plays a critical role in hematopoiesis. However, it is unclear what role, if any, this process plays in the pathogenesis of β-thalassemia. To determine the role of mitophagy in β-thalassemia, CD34 + hematopoietic progenitor cells (HPCs) were isolated from peripheral blood of β-thalassemia patients and healthy controls and differentiated into erythrocytes. We found that the ratio of mitochondrial membrane depolarization was significantly increased, and that mitochondria co-localize with lysosomes at a higher level in β-thalassemia compared with control. Furthermore, the expression of LC3-II and Nix, as well as degradation of p62, in β-thalassemia was higher than in the control. In sum, our data suggest that selective mitophagy is enhanced during erythrocyte differentiation in β-thalassemia.
Molecular Basis and Genetic Modifiers of Thalassemia.
Mettananda, Sachith; Higgs, Douglas R
2018-04-01
Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.
Liu, Dun; Zhang, Xinhua; Yu, Lihua; Cai, Ren; Ma, Xiaoxia; Zheng, Chengguang; Zhou, Yuqiu; Liu, Qiji; Wei, Xiaofeng; Lin, Li; Yan, Tizhen; Huang, Jiwei; Mohandas, Narla; An, Xiuli
2014-01-01
Mutations in human Krüppel-like factor 1 (KLF1) have recently been reported to be responsible for increased fetal hemoglobin (HbF) and hemoglobin A2 (HbA2). Because increased HbF and HbA2 levels are important features of β-thalassemia, we examined whether there is any relationship between KLF1 mutation and β-thalassemia in China. To do this, we first studied the incidence of KLF1 mutations in 2 Chinese populations: 3839 individuals from a thalassemia endemic region in south China and 1190 individuals from a nonthalassemia endemic region in north China. Interestingly, we found that the prevalence of KLF1 mutations is significantly higher in the thalassemia endemic region than that in nonthalassemia endemic region (1.25% vs 0.08%). Furthermore, we identified 7 functional variants including 4 previously reported (p.Gly176AlafsX179, p.Ala298Pro, p.Thr334Arg, and c.913+1G>A) and 3 novel variants (p.His299Asp, p.Cys341Tyr, and p.Glu5Lys) in southern China. The 2 most common mutations, p.Gly176AlafsX179 and p.His299Asp, accounted for 90.6% of the total. We found that zinc-finger mutations in KLF1 were selectively represented in 12 β-thalassemia intermedia patients and resulted in significantly different transfusion-free survival curves. Our findings suggest that KLF1 mutations occur selectively in the presence of β-thalassemia to increase the production of HbF, which in turn ameliorates the clinical severity of β-thalassemia. PMID:24829204
Musical Education and Egyptian Child's Psychological and Social Needs.
ERIC Educational Resources Information Center
Kenawy, Hoda Mohammed
The role played by music in Egyptian education in developing the character of the child is discussed. The first part of the paper discusses the characteristics of the elementary school child and examines how each can be developed through musical education. For example, young children have a fertile imagination that can be stimulated by music.…
Effect of transfusional iron intake on response to chelation therapy in beta-thalassemia major.
Cohen, Alan R; Glimm, Ekkehard; Porter, John B
2008-01-15
The success of chelation therapy in controlling iron overload in patients with thalassemia major is highly variable and may partly depend on the rate of transfusional iron loading. Using data from the 1-year phase III study of deferasirox, including volumes of transfused red blood cells and changes in liver iron concentration (LIC) in 541 patients, the effect of iron loading on achieving neutral or negative iron balance was assessed in patients receiving different doses of deferasirox and the comparator deferoxamine. After dose adjustment, reductions in LIC after 1 year of deferasirox or deferoxamine therapy correlated with transfusional iron intake. At a deferasirox dose of 20 mg/kg per day, neutral or negative iron balance was achieved in 46% and 75% of patients with the highest and lowest transfusional iron intake, respectively; 30 mg/kg per day produced successful control of iron stores in 96% of patients with a low rate of transfusional iron intake. Splenectomized patients had lower transfusional iron intake and greater reductions in iron stores than patients with intact spleens. Transfusional iron intake should be monitored on an ongoing basis in thalassemia major patients, and the rate of transfusional iron loading should be considered when choosing the appropriate dose of an iron-chelating agent. This study is registered at http://clinicaltrials.gov as NCT00061750.
Management of the Thalassemias
Olivieri, Nancy F.; Brittenham, Gary M.
2013-01-01
During the last 30 years, in addition to the considerable progress made in control and prevention of thalassemias3, there have also been major advances in their symptomatic management, at least in wealthier countries where appropriate facilities are available. Remarkable improvements in survival in the severe forms of thalassemia have followed the more judicious use of blood transfusion and, in particular, the ability to manage the iron accumulation resulting from transfusion with its severe and ultimately lethal effects on endocrine and cardiac function. PMID:23732853
Non-transfusion Dependent Thalassemias: A Developing Country Perspective.
Mukherjee, Somnath; Das, Rashmi R; Raghuwanshi, Babita
2015-01-01
Non-transfusion-dependent thalassemias (NTDT) encompass a group of hereditary chronic hemolytic anemia, which, as the name indicates, not require regular blood transfusion for survival. These include β-thalassemia intermedia, hemoglobin E/β-thalassemia, and Hemoglobin H disease (α- thalassemia intermedia). Individuals with structural variant of hemoglobin especially Hemoglobin S and Hemoglobin C associated with "α" or "β" thalassemia in heterozygous condition may also present with similar features of NTDT. NTDT patients are not immune to the development of transfusion unrelated complications in the long run. These hereditary chronic hemolytic anemias are still under-recognized in developing countries like India, where the disease burden might be high causing significant morbidity. The pathophysiologic hallmark that characterizes this group of disorders (ineffective erythropoiesis, hemolysis, chronic anemia) leads to a number of serious complications, similar to transfusion dependent thalassemia. So, timely diagnosis and institution of appropriate preventive/remedial measures as well as education of patient population can help decrease the morbidity to a significant extent. In the present review, focus will be on the pathophysiological mechanisms and available management options of NTDT from a developing country perspective like India.
β-Thalassemia Intermedia: A Clinical Perspective
Musallam, Khaled M.; Taher, Ali T.; Rachmilewitz, Eliezer A.
2012-01-01
Our understanding of the molecular and pathophysiological mechanisms underlying the disease process in patients with β-thalassemia intermedia has substantially increased over the past decade. Earlier studies observed that patients with β-thalassemia intermedia experience a clinical-complications profile that is different from that in patients with β-thalassemia major. In this article, a variety of clinical morbidities are explored, and their associations with the underlying disease pathophysiology and risk factors are examined. These involve several organs and organ systems including the vasculature, heart, liver, endocrine glands, bone, and the extramedullary hematopoietic system. The effects of some therapeutic interventions on the development of clinical complications are also discussed. PMID:22762026
Economic Burden of Thalassemia Major in Iran, 2015.
Esmaeilzadeh, Firooz; Azarkeivan, Azita; Emamgholipour, Sara; Akbari Sari, Ali; Yaseri, Mehdi; Ahmadi, Batoul; Ghaffari, Mohtasham
2016-01-01
Major Thalassemia is an autosomal recessive disease with complications, mortality and serious pathology. Today, the life expectancy of patients with major thalassemia has increased along with therapeutic advances. Therefore, they need lifelong care, and caring for them would incur many costs. Being aware of the patients' costs can be effective for controlling and managing the costs and providing efficient treatments for the care of patients. Hence, this study was conducted to estimate the economic burden of the patients with major thalassemia. Totally, 198 patients with major thalassemia were randomly selected from among the patients with major thalassemia in Tehran, Iran in 2015. The economic burden of the patients was estimated from a social perspective and through a bottom-up, prevalence-based approach. The average annual cost per patient was estimated $ 8321.8 regardless of the cost of lost welfare. Of this amount, $ 7286.8 was related to direct medical costs, $ 461.4 to direct non-medical costs, and $ 573.5 to indirect costs. In addition, the annual cost per patient was estimated $ 1360.5 due to the distress caused by the disease CONCLUSIONS: Considering the high costs of the treatment of patients with major thalassemia, adopting new policies to reduce the costs that patients have to pay seems necessary. In addition, making new decisions regarding thalassemia screening, even with higher costs than the usual screening costs, can be useful since the costs of treatment are high.
Genetics Home Reference: alpha thalassemia X-linked intellectual disability syndrome
... thalassemia X-linked intellectual disability syndrome Alpha thalassemia X-linked intellectual disability syndrome Printable PDF Open All ... view the expand/collapse boxes. Description Alpha thalassemia X-linked intellectual disability syndrome is an inherited disorder ...
Cai, Ren; Liu, Jingzhong; Wang, Lirong; Liang, Xin; Xiao, Bai; Su, Liu; Zhou, Yan; Pan, Lizhen
2004-01-01
Guangxi is one of the provinces of Southern China with the highest incidence of alpha-thalassemia (thal). Liuzhou is the second biggest city in Guangxi. To find out the incidence of the various alpha-thal genotypes, and their distribution in the Liuzhou area, an F820 Blood Cell Analysis System was used to measure the parameters of red blood cells. A SPIFE Rapid Auto-Electrophoresis System was used to analyze the normal and abnormal hemoglobins (Hbs). Multiplex polymerase chain reaction (mPCR) was used to detect the alpha-globin genotypes. Thirty-two (2.05%) out of 7805 young couples undergoing pre-marriage counseling, were diagnosed as having an Hb H (beta4) disease. The study of 1228 cord blood samples revealed 138 newborn children carrying an alpha-thal determinant with nine different genotypes, thus making the total incidence of alpha-thal 11.24%. Among 185 cases of Hb H, 119 (64.1%) were confirmed as being deletional, and 66 cases (35.7%) nondeletional types. The severity of the Hb H diseases could be classified in the following order: alphaCSalpha/--SEA (alphaConstant (Spring)alpha/--Southeast Asia); alpha(-4.2)/--SEA; alpha(-3.7)/--SEA. Ten cases of alpha-thal determinants were found in combination with beta-thal. The mPCR technique can detect all kinds of combinations of the three common large deletions (--SEA, alpha(-4.2) and alpha(-3.7)) accurately and conveniently.
Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang
2015-05-01
The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.
Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan
2016-08-01
To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia
Al-Kuraishy, Hayder M.; Al-Gareeb, Ali I.
2017-01-01
INTRODUCTION: Beta-thalassemias are a cluster of inherited (autosomal recessive) hematological disorders prevalent in the Mediterranean area due to defects in synthesis of β chains of hemoglobin. The aim of present study was to compare the effects of deferasirox and deferoxamine on iron overload and immunological changes in patients with blood transfusion-dependent β-thalassemia major and intermedia. PATIENTS AND METHODS: This study involved 64 patients with known cases of β-thalassemia major or intermedia that has been treated with blood transfusion and iron chelators. Serum ferritin, serum iron, serum total iron binding, unsaturated iron-binding capacity (UIBC), and immunological parameters were assessed in deferoxamine and deferasirox-treated patients. RESULTS: In deferoxamine-treated patients, serum ferritin levels were high (8160.33 ± 233.75 ng/dL) compared to deferasirox-treated patients (3000.62 ± 188.23 ng/dL; P < 0.0001), also there were significant differences in serum iron, total iron-binding capacity and UIBC (P < 0.0001) in deferasirox-treated patients compared to deferoxamine-treated patients. Immunological changes between two treated groups showed insignificant differences in levels of complements (C3 and C4) and immunoglobulin levels (IgM, IgG, and IgA) P > 0.05. CONCLUSION: This study indicated that deferasirox is more effective than deferoxamine regarding the iron overload but not in the immunological profile in patients with blood transfusion-dependent β-thalassemia. PMID:28316434
Al-Kuraishy, Hayder M; Al-Gareeb, Ali I
2017-01-01
Beta-thalassemias are a cluster of inherited (autosomal recessive) hematological disorders prevalent in the Mediterranean area due to defects in synthesis of β chains of hemoglobin. The aim of present study was to compare the effects of deferasirox and deferoxamine on iron overload and immunological changes in patients with blood transfusion-dependent β-thalassemia major and intermedia. This study involved 64 patients with known cases of β-thalassemia major or intermedia that has been treated with blood transfusion and iron chelators. Serum ferritin, serum iron, serum total iron binding, unsaturated iron-binding capacity (UIBC), and immunological parameters were assessed in deferoxamine and deferasirox-treated patients. In deferoxamine-treated patients, serum ferritin levels were high (8160.33 ± 233.75 ng/dL) compared to deferasirox-treated patients (3000.62 ± 188.23 ng/dL; P < 0.0001), also there were significant differences in serum iron, total iron-binding capacity and UIBC ( P < 0.0001) in deferasirox-treated patients compared to deferoxamine-treated patients. Immunological changes between two treated groups showed insignificant differences in levels of complements (C3 and C4) and immunoglobulin levels (IgM, IgG, and IgA) P > 0.05. This study indicated that deferasirox is more effective than deferoxamine regarding the iron overload but not in the immunological profile in patients with blood transfusion-dependent β-thalassemia.
Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...
Pardalos, G; Kanakoudi-Tsakalidis, F; Malaka-Zafiriu, M; Tsantali, H; Athanasiou-Metaxa, M; Kallinikos, G; Papaevangelou, G
1987-01-01
Immunological abnormalities have been observed in many haemophiliacs receiving clotting factor concentrates. To determine whether similar changes also occur after repeated blood transfusions we estimated T cell subsets and cutaneous delayed hypersensitivity (CDH) in 50 multitransfused children with beta-thalassemia major (beta-TM). All patients were also tested for anti-HTLV-III/LAV antibodies. A diminished percentage of T lymphocytes (E-rosettes, T3+), and T4+ cells and a low T4/T8 ratio was found in patients as compared to age and sex matched controls (P less than 0.001). Negative CDH tests to specific antigens (Multi-test) were also found in a significantly larger proportion of beta-TM children (P less than 0.01). Antibodies against HTLV-III/LAV were negative in all patients. Decreased T4/T8 ratio in beta-TM children was primarily due to a reduction of T4+ cells and was inversely correlated to the patients' age, number of units of transfused blood (P less than 0.05) and especially to ferritin serum levels and annual iron balance (P less than 0.001). These findings indicate that immunological abnormalities in beta-TM patients appear to be acquired, transfusion-associated and related to iron load which depends on the appropriate chelation therapy. PMID:3498564
Altered erythropoiesis and iron metabolism in carriers of thalassemia
Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria
2014-01-01
The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880
Rapid Screening for Deleted Form of β-thalassemia by Real-Time Quantitative PCR.
Ke, Liang-Yin; Chang, Jan-Gowth; Chang, Chao-Sung; Hsieh, Li-Ling; Liu, Ta-Chih
2017-01-01
Thalassemia is the most common single gene disease in human beings. The prevalence rate of β-thalassemia in Taiwan is approximately 1-3%. Previously methods to reveal and diagnose severe deleted form of α- or β-thalassemia were insufficient and inappropriate for prenatal diagnosis. A real-time quantitative PCR method was set up for rapid screening of the deleted form of β-thalassemia. Our results show that ΔΔCt between deleted form of β-thalassemia and normal individuals were 1.0674 ± 0.0713. On the contrary, mutation form β-thalassemia showed no difference with normal healthy control. The HBB/CCR5 ratio for deleted form of β-thalassemia patients was 0.48, whether normal individuals and mutation form of β-thalassemia was 1.0. This RQ-PCR technique is an alternative rapid screening assay for deleted form of β-thalassemia. In addition, it could also identify undefined type. Our technique by using RQ-PCR to quantify gene copies is a reliable and time-saving method that can screen deleted form of β-thalassemia. © 2016 Wiley Periodicals, Inc.
Pirayeshfard, Leila; Sharifi, Zohreh; Amini-Kafiabad, Sedigheh; Haghnazari Sadaghiani, Nasrin
2018-04-16
Human T-cell lymphoma virus (HTLV) has been associated with various disease types. Since the discovery of the virus in 1980, seven subtypes of the virus have been identified. HTLV is widespread and endemic in some regions, such as Japan, Africa, South America, and northeast Iran. This study aimed to identify HTLV-1 genotype and also to analyze the nucleotide sequence of the LTR region in three groups, including blood donors, HIV-1+ patients, and β-thalassemia patients. In this cross-sectional study, 2200 samples were collected from blood donors in Tehran (2000 samples), HIV-1+ patients (100 samples) and β-thalassemia patients (100 samples). All samples were screened for anti-HTLV-I&II antibodies by ELISA. Then, genomic DNA was extracted from repeatedly positive samples, and nested PCR was performed for both the TAX and LTR regions. Purified PCR products were sequenced and analyzed, and finally, a phylogenetic tree was constructed using Mega7 software. The prevalence of the anti-HTLV-I&II antibody among blood donors and HIV-1+ patients was 1.7% (34/2000) and 12% (12/100), respectively. The PCR results confirmed that 0.05% (1/2000) of blood donors, 5% (5/100) of HIV-1+ patients, and 8% (8/100) of β-thalassemia patients were HTLV-I positive. All sequences were matched to HTLV-1 subtype a, subgroup A. Our phylogenetic analysis revealed that all sequenced samples belong to the endemic clusters of Iran. HTLV-1 genotypes in all samples were similar in three groups and were derived from the strains, which had been previously reported from Iran (AF00300/Mashhad and KT190712.1/Sabzevar). © 2018 Wiley Periodicals, Inc.
Thalassemia: a prevalent disease yet unknown term among college students in Saudi Arabia.
Olwi, Duaa Ibrahim; Merdad, Leena Adnan; Ramadan, Eman Kamal
2017-12-14
Thalassemia is a life-threatening blood disorder that has a high prevalence in Saudi Arabia despite the implementation of mandatory premarital testing and the availability of genetic counseling. This study aimed to assess college students' knowledge of thalassemia. A cross-sectional survey of a random sample of 920 senior students enrolled at King Abdulaziz University was conducted. A self-administered questionnaire was used to collect information about thalassemia and socio-demographic characteristics. Of the 920 students, 445 (48%) had ever heard of thalassemia. Despite the mandatory premarital testing for thalassemia, only 50% of married students stated having heard of the disease. The mean thalassemia knowledge score was 4.4 ± 2.2 out of a maximum of 12. Knowledge was significantly influenced by university faculty, gender, and education outside of Saudi Arabia. Those who had heard of thalassemia had misconceptions about the disease characteristics and pattern of inheritance such as associating thalassemia with low iron levels. A substantial proportion of the participants had a low knowledge of thalassemia. This lack of awareness requires a reassessment of the goals and success of the premarital testing program, including the genetic counseling services, and also indicates the importance of emphasizing thalassemia in school curricula and promoting and scaling up existing thalassemia campaigns in the region.
Caring for adults with thalassemia in a pediatric world.
Compagno, Laurice M
2005-01-01
Improved technology and medical advances have increased the life span for patients with thalassemia. Therefore, serious consideration must now be given to adult issues such as fertility, employment opportunities, medical insurance, and long-term coping with chronic illness. Since thalassemia is a childhood illness, most adults are seen in pediatric hospitals-often, in centers with a specialty for thalassemia. Compared to a decade ago, many more patients in thalassemia centers are adolescents or older. Unfortunately, pediatric hospitals are not fully equipped to meet the changing and complex needs of adults. Emergency room care, hospital admissions, decentralized care, comprehensive care, and psychosocial issues are current challenges that must be addressed. In this study, six adult patients were asked to keep track of their care for one month to further examine self-care for thalassemia, a high-maintenance disease. From a qualitative perspective, the issues and challenges that adults face are examined and solutions for improved care are discussed.
Blood transfusion transmitted infections in multiple blood transfused patients of Beta thalassaemia.
Vidja, Prakash J; Vachhani, J H; Sheikh, S S; Santwani, P M
2011-06-01
Transfusion Transmitted Infection (TTI) continue to be a problem in many parts of world and multi-transfused patients of beta thalassaemia major are at a particularly increased risk of TTI. This study is aimed to estimate the prevalence of blood TTI in multiple blood transfused patients of beta thalassaemia major. Cross-sectional study of 200 multi-transfused patients of beta thalassaemia major, who were interviewed using a structured questionnaire and history was taken regarding sero-status of HIV (Human Immunodeficiency Virus), HBV (Hepatitis B Virus), HCV (Hepatitis C Virus) infection from their case papers. This study was conducted at the department of Pathology, M.P. Shah medical college, Jamnagar and Thalassemia ward, G.G. Hospital, Jamnagar (Gujarat, India) from March to May 2010. Out of 200 multiple blood transfused patients 7% patients were infected with TTI. Total 9 male patients and 5 female patients were infected with TTI. The seroreactivity for HIV was 3% (06/200); 1% (02/200) were males and 2% (04/200) were females. The seroreactivity for HBV was 2% (04/200) all were males. The seroreactivity for HCV was 2% (04/200); 1.5% (03/200) were males and 0.5% (01/200) was female. HIV, HBV, HCV infections are most prevalent TTI among multiple blood transfused patients of beta thalassemia major, and remains a major health problem for these patients.
Keowmani, Thamron; Lee, Lily Wong Lee
2016-01-01
To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI) in Sabah's adult thalassemia patients. This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach's alpha. The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913. This study was unable to replicate the internal structure of the Greek STQOLI in Sabah's adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.
Faulkner, Lawrence B
2013-07-01
In many South Asian countries there is shortage of centers providing care for pediatric malignancies. This report describes the experience of the Cure2Children Foundation (C2C) in supporting, both financially and professionally, the startup of two bone marrow transplant (BMT) centers, one in Pakistan and one in India, for the cure of transfusion-dependent thalassemia. Even though transplantation is generally considered as a more complex and advanced step relatively to basic pediatric cancer care, the authors argue that BMT for low-risk thalassemia patients with a matched sibling is a relatively simple procedure amenable to focused training. Since 2008 the C2C, an Italian Nongovernmental Organization (NGO), has supported a BMT network in Pakistan. The primary aim of this project was to assess feasibility, outcomes, and costs of matched-related BMT for thalassemia in young low-risk children employing a well established and quite tolerable strategy employed in Italy. This initiative relied primarily on focused training and task-shift strategies within a structured cooperation program. The initial success of that strategy led to its replication in India with 100 total BMTs performed over the past 4 years, 91 of which were for thalassemia major. Low-risk matched-related BMT in children younger than 5 years could deliver a 92% thalassemia-free survival with 100% performance score and no extensive chronic graft versus host disease (GVHD), for an average cost of 10,000 USD per BMT. Within an existing hospital facility, 50,000 USD were sufficient to renovate and fully equip a 2-3 bedded start up BMT unit capable of performing safe low-risk compatible marrow transplantation. In low resource settings matched-related low-risk BMT for thalassemia can be performed with outcomes comparable to richer countries and with a fraction of the costs. Within structured and intensive cooperation, good outcomes can be obtained from the very beginning. This observation may have important
ERIC Educational Resources Information Center
Radwan, M. M.; And Others
Three papers on the Egyptian educational system were delivered at the World Assembly of the International Council of Education for Teaching in Cairo, Egypt, in 1981. The first paper, "Recent Educational Reforms in Egypt," by M. M. Radwan, describes the changes in Egyptian education since 1952, including the adoption of universal basic…
Molecular characterization of α- and β-thalassemia in the Yulin region of Southern China.
He, Sheng; Li, Jihui; Li, Dong Ming; Yi, Shang; Lu, Xiongcai; Luo, Yudi; Liang, Yi; Feng, Chunfeng; Chen, Biyan; Zheng, Chenguang; Qiu, Xiaoxia
2018-05-20
Thalassemia is one of the most common hereditary blood disorders. Epidemiological data regarding the prevalence and distribution of mutations is important for planning a thalassemia control program. To reveal the prevalence of thalassemia and mutation spectrum in the Yulin region of southern China, we screened 130,318 individuals from Yulin region by hematological and genetic analysis. Totally, 24,886 (19.10%) subjects were diagnosed with thalassemia, including 16,308 (12.51%) subjects with α-thalassemia alone, 6658 (5.11%) subjects with β-thalassemia alone and 1920 (1.47%) subjects with both α- and β-thalassemia. Ten α-thalassemia mutations were identified in the α-thalassemia subjects, with the common α-thalassemia mutations being -- SEA mutation (51.91%), -α 3.7 (19.90%), α CS α (10.58%), -α 4.2 (8.13%), α WS α (7.67%). Thirteen β-thalassemia mutations and 31 genotypes were characterized in the β-thalassemia subjects. The seven common mutations [CD41-42 (-CTTT) (43.31%), CD17 (A > T) (34.58%), CD26 (G > A) (6.86%), CD71-72 (+A) (4.25%), -28 (A > G) (3.90%), IVS-II-654 (C > T) (3.53%) and IVS-I-1 (G > T) (2.22%)] accounted for 98.65% of all β-thalassemia defects. Furthermore, 6 cases of α-triplication and 3 cases of mutation -α 2.4 were first identified in this region. Our data illustrated that there was great heterogeneity and extensive spectrum of thalassemias in the Yulin populations. The findings will contribute an available reference for prevention of thalassemia in this region. Copyright © 2018 Elsevier B.V. All rights reserved.
Relationship between β-Thalassemia minor and Helicobacter pylori infection
Zamani, Mohammad; Vahedi, Amin; Tamaddoni, Ahmad; Bijani, Ali; Bagherzade, Mojgan; Shokri-Shirvani, Javad
2018-01-01
Background: Until now, no study has been reported investigating the association between β-thalassemia minor and Helicobacter pylori (H. pylori) infection. This study was designed to compare H. pylori infection rate between β-thalassemia minor patients and healthy controls. Methods: A number of 100 β-thalassemia minor patients (50 males, 50 females) and 100 gender-matched healthy controls were prospectively recruited in this study in a period of 3 months. The study population consisted of the people who referred to a health center in Babol, North of Iran, for premarital counseling. H. pylori status was assessed by measuring the anti-H. pylori IgG antibodies using enzyme-linked immunosorbent assay. Demographic information and informed consent were collected from all participants. Results: The overall H. pylori infection rate was 43%. The infection was significantly more prevalent in thalassemia patients (53%) than in the controls (33%) in both univariate (OR=2.29, 95% CI: 1.3-4.06) and multivariable analyses (OR=2.05, 95% CI: 1.12-3.76). Age was the only significant factor which was positively correlated with the infection in β-thalassemia minor cases (OR=1.11, 95% CI: 1.02-1.2). Gender, blood groups, residency, and education level were not related to the infection. Conclusions: According to the results, it can be concluded that β-thalassemia minor patients are possibly more susceptible to H. pylori infection than healthy people. Further studies are needed to discover more about the exact mechanisms of increased susceptibility to H. pylori infection in β-thalassemia minor patients. PMID:29387320
[Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].
Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco
2008-04-05
The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.
Hassan, Mohamed Abdel Malik; Tolba, Omar Atef
2016-01-01
Introduction Iron overload is the primary cause of mortality and morbidity in thalassemia major (TM) despite advances in chelation therapy. The aim of this study was to compare the effectiveness and safety of deferasirox (DFX) and deferoxamine (DFO) as iron-chelating agents in patients with transfusion-dependent β-thalassemia major. Methods This prospective randomized study included 60 patients with transfusion-dependent β-TM during the period from September 2014 to September 2015. Their ages were ≥ 6 years, and they had serum ferritin above 1500 μg/L and were on irregular DFO therapy. Patients had regular packed red cell transfusion in a dose of 10 mL/kg/session. They were randomized to receive DFX (single oral daily dose of 20–40 mg/kg/day) or DFO (20–50 mg/kg/day via subcutaneous infusion over 8–10 hours, 5 days a week). Iron overload was determined by serum ferritin level. The primary endpoint was decrease of serum ferritin level below 1500 μg/L. The secondary endpoint was drug safety. Results Both drugs significantly reduced serum ferritin (p < 0.001). At the end of follow-up, there were no significant differences between the two groups in serum ferritin levels (p = 0.673) and in percent reduction of ferritin (p = 0.315). There were no significant differences between the two groups in the total amount of blood transfusion (p = 0.166) and average iron intake (p = 0.227). There were no mortalities or any serious adverse effects, neutropenia, arthropathy, or pulmonary toxicity. Gastrointestinal upset and skin rash occurred more frequently with DFX than with DFO (p = 0.254 and 0.095, respectively). Conclusion With appropriate dosing and compliance with drugs, both DFX and DFO are generally well tolerated, safe, and effective in reducing serum ferritin levels in iron-overloaded, regularly-transfused thalassemia major patients. Therefore, oral DFX is recommended for more convenience and adherence to the treatment regimen. PMID:27382454
Hassan, Mohamed Abdel Malik; Tolba, Omar Atef
2016-05-01
Iron overload is the primary cause of mortality and morbidity in thalassemia major (TM) despite advances in chelation therapy. The aim of this study was to compare the effectiveness and safety of deferasirox (DFX) and deferoxamine (DFO) as iron-chelating agents in patients with transfusion-dependent β-thalassemia major. This prospective randomized study included 60 patients with transfusion-dependent β-TM during the period from September 2014 to September 2015. Their ages were ≥ 6 years, and they had serum ferritin above 1500 μg/L and were on irregular DFO therapy. Patients had regular packed red cell transfusion in a dose of 10 mL/kg/session. They were randomized to receive DFX (single oral daily dose of 20-40 mg/kg/day) or DFO (20-50 mg/kg/day via subcutaneous infusion over 8-10 hours, 5 days a week). Iron overload was determined by serum ferritin level. The primary endpoint was decrease of serum ferritin level below 1500 μg/L. The secondary endpoint was drug safety. Both drugs significantly reduced serum ferritin (p < 0.001). At the end of follow-up, there were no significant differences between the two groups in serum ferritin levels (p = 0.673) and in percent reduction of ferritin (p = 0.315). There were no significant differences between the two groups in the total amount of blood transfusion (p = 0.166) and average iron intake (p = 0.227). There were no mortalities or any serious adverse effects, neutropenia, arthropathy, or pulmonary toxicity. Gastrointestinal upset and skin rash occurred more frequently with DFX than with DFO (p = 0.254 and 0.095, respectively). With appropriate dosing and compliance with drugs, both DFX and DFO are generally well tolerated, safe, and effective in reducing serum ferritin levels in iron-overloaded, regularly-transfused thalassemia major patients. Therefore, oral DFX is recommended for more convenience and adherence to the treatment regimen.
Recent trends in the gene therapy of β-thalassemia
Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto
2015-01-01
The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641
Genetics Home Reference: sickle cell disease
... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...
Medium-based noninvasive preimplantation genetic diagnosis for human α-thalassemias-SEA.
Wu, Haitao; Ding, Chenhui; Shen, Xiaoting; Wang, Jing; Li, Rong; Cai, Bing; Xu, Yanwen; Zhong, Yiping; Zhou, Canquan
2015-03-01
To develop a noninvasive medium-based preimplantation genetic diagnosis (PGD) test for α-thalassemias-SEA. The embryos of α-thalassemia-SEA carriers undergoing in vitro fertilization (IVF) were cultured. Single cells were biopsied from blastomeres and subjected to fluorescent gap polymerase chain reaction (PCR) analysis; the spent culture media that contained embryo genomic DNA and corresponding blastocysts as verification were subjected to quantitative-PCR (Q-PCR) detection of α-thalassemia-SEA. The diagnosis efficiency and allele dropout (ADO) ratio were calculated, and the cell-free DNA concentration was quantitatively assessed in the culture medium. The diagnosis efficiency of medium-based α-thalassemias-SEA detection significantly increased compared with that of biopsy-based fluorescent gap PCR analysis (88.6% vs 82.1%, P < 0.05). There is no significant difference regarding ADO ratio between them. The optimal time for medium-based α-thalassemias-SEA detection is Day 5 (D5) following IVF. Medium-based α-thalassemias-SEA detection could represent a novel, quick, and noninvasive approach for carriers to undergo IVF and PGD.
Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.
Sabath, Daniel E
2017-07-01
To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Ancient Egyptian surgical heritage.
Saber, Aly
2010-12-01
Egyptian medicine influenced the medicine of neighboring cultures, including the culture of ancient Greece. From Greece, its influence spread onward, thereby affecting Western civilization significantly. The oldest extant Egyptian medical texts are six papyri: The Edwin Smith Surgical Papyrus and the Ebers Medical Papyrus are famous.
Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar
2018-01-02
Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and
De Sanctis, Vincenzo; Soliman, Ashraf T.; Elsedfy, Heba; Skordis, Nicos; Kattamis, Christos; Angastiniotis, Michael; Karimi, Mehran; Yassin, Mohd Abdel Daem Mohd; El Awwa, Ahmed; Stoeva, Iva; Raiola, Giuseppe; Galati, Maria Concetta; Bedair, Elsaid M.; Fiscina, Bernadette; El Kholy, Mohamed
2013-01-01
The current management of thalassemia includes regular transfusion programs and chelation therapy. It is important that physicians be aware that endocrine abnormalities frequently develop mainly in those patients with significant iron overload due to poor compliance to treatment, particularly after the age of 10 years. Since the quality of life of thalassemia patients is a fundamental aim, it is vital to monitor carefully their growth and pubertal development in order to detect abnormalities and to initiate appropriate and early treatment. Abnormalities should be identified and treatment initiated in consultation with a pediatric or an adult endocrinologist and managed accordingly. Appropriate management shall put in consideration many factors such as age, severity of iron overload, presence of chronic liver disease, thrombophilia status, and the presence of psychological problems. All these issues must be discussed by the physician in charge of the patient's care, the endocrinologist and the patient himself. Because any progress in research in the field of early diagnosis and management of growth disorders and endocrine complications in thalassemia should be passed on to and applied adequately to all those suffering from the disease, on the 8 May 2009 in Ferrara, the International Network on Endocrine Complications in Thalassemia (I-CET) was founded in order to transmit the latest information on these disorders to the treating physicians. The I-CET position statement outlined in this document applies to patients with transfusion-dependent thalassemia major to help physicians to anticipate, diagnose, and manage these complications properly. PMID:23776848
Ineffective Erythropoiesis in β-Thalassemia
Ribeil, Jean-Antoine; Arlet, Jean-Benoit; Dussiot, Michael; Cruz Moura, Ivan; Courtois, Geneviève; Hermine, Olivier
2013-01-01
In humans, β-thalassemia dyserythropoiesis is characterized by expansion of early erythroid precursors and erythroid progenitors and then ineffective erythropoiesis. This ineffective erythropoiesis is defined as a suboptimal production of mature erythrocytes originating from a proliferating pool of immature erythroblasts. It is characterized by (1) accelerated erythroid differentiation, (2) maturation blockade at the polychromatophilic stage, and (3) death of erythroid precursors. Despite extensive knowledge of molecular defects causing β-thalassemia, less is known about the mechanisms responsible for ineffective erythropoiesis. In this paper, we will focus on the underlying mechanisms leading to premature death of thalassemic erythroid precursors in the bone marrow. PMID:23606813
The Representation of Women in Street Songs: A Critical Discourse Analysis of Egyptian Mahraganat
ERIC Educational Resources Information Center
El-Falaky, Mai Samir
2015-01-01
The study investigates the representation of male and female gender identities in Egyptian street songs called "Mahraganat." The study discusses the issue with reference to two common songs spreading among young commoners. Since the songs are written by writers who descend from low-standard social group, the analysis exhibits both…
Ekwattanakit, Supachai; Siritanaratkul, Noppadol; Viprakasit, Vip
2018-05-01
Recently, complications in patients with nontransfusion-dependent thalassemia (NTDT), in particular those with β-thalassemia intermedia (β-TI), were found to be significantly different from those in patients with transfusion dependent thalassemia (TDT), mainly β-thalassemia major (β-TM). However, this information is rather limited in other forms of NTDT. In this prospective study, adult Thai NTDT patients were interviewed and clinically evaluated for thalassemia related complications. Fifty-seven NTDT patients (age 18-74 years), 59.6% Hb E/β-thalassemia and 40.4% Hb H disease, were recruited; 26.4% were splenectomized. The most common complications were gallstones (68.4%), osteoporosis (26.3%), and pulmonary hypertension (15.8%). Splenectomy was associated with higher rate of gallstones and serious infection (P = .001 and .052, respectively), consistent with a multivariate analysis (RR = 9.5, P = .044, and RR = 15.1, P = .043, respectively). In addition, a higher hemoglobin level was inversely associated with gallstones in both univariate and multivariate analyses (P = .01 and .022, respectively). Serum ferritin was associated with abnormal liver function (P = .002). In contrast to the previous study, the prevalence of thrombosis was less common in our population (1.7%), probably due to differences in transfusion therapy, ethnicity, and underlying genotypes. For the first time, this prospective study provided the current prevalence of NTDT related complications in a Southeast Asian population with a different underlying genetic basis compared with previous studies. Although individual prevalence of each complication might differ from other studies, several important clinical factors such as splenectomy, degree of anemia, and iron overload seem to be determining risks of developing these complications consistently across different ethnicities. © 2018 Wiley Periodicals, Inc.
Wiengkum, Thanatcha; Srithep, Sarinee; Chainoi, Isarapong; Singboottra, Panthong; Wongwiwatthananukit, Sanchai
2011-01-01
Background Prevention and control of thalassemia requires simple, rapid, and accurate screening tests for carrier couples who are at risk of conceiving fetuses with severe thalassemia. Methods Single-tube multiplex real-time PCR with SYBR Green1 and high-resolution melting (HRM) analysis were used for the identification of α-thalassemia-1 Southeast Asian (SEA) and Thai type deletions and β-thalassemia 3.5-kb gene deletion. The results were compared with those obtained using conventional gap-PCR. DNA samples were derived from 28 normal individuals, 11 individuals with α-thalassemia-1 SEA type deletion, 2 with α-thalassemia-1 Thai type deletion, and 2 with heterozygous β-thalassemia 3.5-kb gene deletion. Results HRM analysis indicated that the amplified fragments from α-thalassemia-1 SEA type deletion, α-thalassemia-1 Thai type deletion, β-thalassemia 3.5-kb gene deletion, and the wild-type β-globin gene had specific peak heights at mean melting temperature (Tm) values of 86.89℃, 85.66℃, 77.24℃, and 74.92℃, respectively. The results obtained using single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis showed 100% consistency with those obtained using conventional gap-PCR. Conclusions Single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis is a potential alternative for routine clinical screening of the common types of α- and β-thalassemia large gene deletions, since it is simple, cost-effective, and highly accurate. PMID:21779184
Clinical Features of β-Thalassemia and Sickle Cell Disease.
McGann, Patrick T; Nero, Alecia C; Ware, Russell E
2017-01-01
Sickle cell disease (SCD) and β-thalassemia are among the most common inherited diseases, affecting millions of persons globally. It is estimated that 5-7% of the world's population is a carrier of a significant hemoglobin variant. Without early diagnosis followed by initiation of preventative and therapeutic care, both SCD and β-thalassemia result in significant morbidity and early mortality. Despite great strides in the understanding of the molecular basis and pathophysiology of these conditions, the burden of disease remains high, particularly in limited resource settings. Current therapy relies heavily upon the availability and safety of erythrocyte transfusions to treat acute and chronic complications of these conditions, but frequent transfusions results in significant iron overload, as well as challenges from acquired infections and alloimmunization. Hydroxyurea is a highly effective treatment for SCD but less so for β-thalassemia, and does not represent curative therapy. As technology and use of cellular and gene therapies expand, SCD and thalassemia should be among the highest disease priorities.
Hsu, Chien-Chang; Cheng, Ching-Wen; Chiu, Yi-Shiuan
2017-02-15
Electroencephalograms can record wave variations in any brain activity. Beta waves are produced when an external stimulus induces logical thinking, computation, and reasoning during consciousness. This work uses the beta wave of major scale working memory N-back tasks to analyze the differences between young musicians and non-musicians. After the feature analysis uses signal filtering, Hilbert-Huang transformation, and feature extraction methods to identify differences, k-means clustering algorithm are used to group them into different clusters. The results of feature analysis showed that beta waves significantly differ between young musicians and non-musicians from the low memory load of working memory task. Copyright © 2017 Elsevier B.V. All rights reserved.
α-Globin as a molecular target in the treatment of β-thalassemia
Mettananda, Sachith; Gibbons, Richard J.
2015-01-01
The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286
Anemia in patients with coinherited thalassemia and glucose-6-phosphate dehydrogenase deficiency.
Pornprasert, Sakorn; Phanthong, Siratcha
2013-01-01
Thalassemia and glucose-6-phosphate dehydrogenase (G-6-PD) deficiency are genetic disorders that cause hemolytic anemia. In areas with high frequencies of both hematological disorders, coinheritance of G-6-PD deficiency with thalassemia can be found. Whether G-6-PD deficiency, coinherited with thalassemia, enhances severe anemia is still unclear. Hematological parameters between thalassemia carriers with G-6-PD deficiency and those without G-6-PD deficiency were compared. The G-6-PD deficiency was diagnosed in 410 blood samples from thalassemia patients using a fluorescent spot test. The levels of hemoglobin (Hb), packed cell volume (PCV), mean corpuscular volume (MCV) and Hb A2/Hb E [β26(B8)Glu→Lys; HBB: c.79G>A] were measured using an automated blood counter and high performance liquid chromatography (HPLC), respectively. The G-6-PD deficiency was found in 37 samples (9.02%). Mean levels of Hb, PCV, MCV and Hb A2/E were similar between the two groups. Thus, G-6-PD deficiency did not enhance red blood cell pathology or induce more anemic severity in thalassemia patients.
The prevention of thalassemia.
Cao, Antonio; Kan, Yuet Wai
2013-02-01
The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods that are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus.
Cao, Antonio; Kan, Yuet Wai
2013-01-01
The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598
Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda
2015-07-01
The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.
Development of Gene Therapy for Thalassemia
Nienhuis, Arthur W.; Persons, Derek A.
2012-01-01
Retroviral vector–mediated gene transfer into hematopoietic stem cells provides a potentially curative therapy for severe β-thalassemia. Lentiviral vectors based on human immunodeficiency virus have been developed for this purpose and have been shown to be effective in curing thalassemia in mouse models. One participant in an ongoing clinical trial has achieved transfusion independence after gene transfer into bone marrow stem cells owing, in part, to a genetically modified, dominant clone. Ongoing efforts are focused on improving the efficiency of lentiviral vector–mediated gene transfer into stem cells so that the curative potential of gene transfer can be consistently achieved. PMID:23125203
Ke, Peifeng; Liu, Jiawei; Chao, Yan; Wu, Xiaobin; Xiong, Yujuan; Lin, Li; Wan, Zemin; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang
2017-01-01
Introduction Thalassemia could interfere with some assays for haemoglobin A1c (HbA1c) measurement, therefore, it is useful to be able to screen for thalassemia while measuring HbA1c. We used Capillarys 2 Flex Piercing (Capillarys 2FP) HbA1c programme to simultaneously measure HbA1c and screen for thalassemia. Materials and methods Samples from 498 normal controls and 175 thalassemia patients were analysed by Capillarys 2FP HbA1c programme (Sebia, France). For method comparison, HbA1c was quantified by Premier Hb9210 (Trinity Biotech, Ireland) in 98 thalassaemia patients samples. For verification, HbA1c from eight thalassaemia patients was confirmed by IFCC reference method. Results Among 98 thalassaemia samples, Capillarys 2FP did not provide an HbA1c result in three samples with HbH due to the overlapping of HbBart’s with HbA1c fraction; for the remaining 95 thalassaemia samples, Bland-Altman plot showed 0.00 ± 0.35% absolute bias between two systems, and a significant positive bias above 7% was observed only in two HbH samples. The HbA1c values obtained by Capillarys 2FP were consistent with the IFCC targets (relative bias below ± 6%) in all of the eight samples tested by both methods. For screening samples with alpha (α-) thalassaemia silent/trait or beta (β-) thalassemia trait, the optimal HbA2 cut-off values were ≤ 2.2% and > 2.8%, respectively. Conclusions Our results demonstrated the Capillarys 2FP HbA1c system could report an accurate HbA1c value in thalassemia silent/trait, and HbA2 value (≤ 2.2% for α-thalassaemia silent/trait and > 2.8% for β-thalassemia trait) and abnormal bands (HbH and/or HbBart’s for HbH disease, HbF for β-thalassemia) may provide valuable information for screening. PMID:28900367
Ke, Peifeng; Liu, Jiawei; Chao, Yan; Wu, Xiaobin; Xiong, Yujuan; Lin, Li; Wan, Zemin; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang
2017-10-01
Thalassemia could interfere with some assays for haemoglobin A 1c (HbA 1c ) measurement, therefore, it is useful to be able to screen for thalassemia while measuring HbA 1c . We used Capillarys 2 Flex Piercing (Capillarys 2FP) HbA 1c programme to simultaneously measure HbA 1c and screen for thalassemia. Samples from 498 normal controls and 175 thalassemia patients were analysed by Capillarys 2FP HbA 1c programme (Sebia, France). For method comparison, HbA 1c was quantified by Premier Hb9210 (Trinity Biotech, Ireland) in 98 thalassaemia patients samples. For verification, HbA 1c from eight thalassaemia patients was confirmed by IFCC reference method. Among 98 thalassaemia samples, Capillarys 2FP did not provide an HbA 1c result in three samples with HbH due to the overlapping of HbBart's with HbA 1c fraction; for the remaining 95 thalassaemia samples, Bland-Altman plot showed 0.00 ± 0.35% absolute bias between two systems, and a significant positive bias above 7% was observed only in two HbH samples. The HbA 1c values obtained by Capillarys 2FP were consistent with the IFCC targets (relative bias below ± 6%) in all of the eight samples tested by both methods. For screening samples with alpha (α-) thalassaemia silent/trait or beta (β-) thalassemia trait, the optimal HbA 2 cut-off values were ≤ 2.2% and > 2.8%, respectively. Our results demonstrated the Capillarys 2FP HbA 1c system could report an accurate HbA 1c value in thalassemia silent/trait, and HbA 2 value (≤ 2.2% for α-thalassaemia silent/trait and > 2.8% for β-thalassemia trait) and abnormal bands (HbH and/or HbBart's for HbH disease, HbF for β-thalassemia) may provide valuable information for screening.
Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach
Shah, Parth S; Shah, Nidhi D; Ray, Hari Shankar P; Khatri, Nikunj B; Vaghasia, Ketan K; Raval, Rutvik J; Shah, Sandip C; Rao, Mandava V
2017-01-01
Background β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0(2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. PMID:28546763
Surveys of Thalassemia and Other Blood Defects in Spain
on the incidence of thalassemia trait and G6PD deficiency in Spain, with particular reference to the former incidence of malaria. They find no...correlation, in the case of thalassemia trait. The G6PD deficiency gene they believe to be uniformly distributed in Spain. They have failed to find any
Fermo, Elisa; Vercellati, Cristina; Marcello, Anna Paola; Zaninoni, Anna; van Wijk, Richard; Mirra, Nadia; Curcio, Cristina; Cortelezzi, Agostino; Zanella, Alberto; Barcellini, Wilma; Bianchi, Paola
2017-01-01
Hereditary xerocytosis (HX) is a rare disorder caused by defects of RBC permeability, associated with haemolytic anaemia of variable degree and iron overload. It is sometimes misdiagnosed as hereditary spherocytosis or other congenital haemolytic anaemia. Splenectomy is contraindicated due to increased risk of thromboembolic complications. We report the clinical, haematological, and molecular characteristics of four patients from two unrelated Italian families affected by HX, associated with beta-thalassemia trait and heterozygous pyruvate kinase deficiency, respectively. Two patients had been splenectomised and displayed thrombotic episodes. All patients had iron overload in the absence of transfusion, two of them requiring iron chelation. The diagnosis of HX was confirmed by LoRRca Osmoscan analysis showing a left-shifted curve. PIEZO1 gene sequencing revealed the presence of mutation p.E2496ELE, showing that this is one of the most frequent mutations in this disease. The concomitant defects did not aggravate the clinical phenotype; however, in one patient, the initial diagnosis of pyruvate kinase deficiency delayed the correct diagnosis of HX for many years and resulted in splenectomy followed by thrombotic complications. The study underlines the importance of a precise diagnosis in HX, particularly in view of splenectomy, and the need of a molecular confirmation of suspected RBC enzymopathy.
Vercellati, Cristina; Marcello, Anna Paola; Zaninoni, Anna; van Wijk, Richard; Mirra, Nadia; Curcio, Cristina; Cortelezzi, Agostino; Zanella, Alberto; Barcellini, Wilma; Bianchi, Paola
2017-01-01
Hereditary xerocytosis (HX) is a rare disorder caused by defects of RBC permeability, associated with haemolytic anaemia of variable degree and iron overload. It is sometimes misdiagnosed as hereditary spherocytosis or other congenital haemolytic anaemia. Splenectomy is contraindicated due to increased risk of thromboembolic complications. We report the clinical, haematological, and molecular characteristics of four patients from two unrelated Italian families affected by HX, associated with beta-thalassemia trait and heterozygous pyruvate kinase deficiency, respectively. Two patients had been splenectomised and displayed thrombotic episodes. All patients had iron overload in the absence of transfusion, two of them requiring iron chelation. The diagnosis of HX was confirmed by LoRRca Osmoscan analysis showing a left-shifted curve. PIEZO1 gene sequencing revealed the presence of mutation p.E2496ELE, showing that this is one of the most frequent mutations in this disease. The concomitant defects did not aggravate the clinical phenotype; however, in one patient, the initial diagnosis of pyruvate kinase deficiency delayed the correct diagnosis of HX for many years and resulted in splenectomy followed by thrombotic complications. The study underlines the importance of a precise diagnosis in HX, particularly in view of splenectomy, and the need of a molecular confirmation of suspected RBC enzymopathy. PMID:28367341
Altuntas, Yuksel; Bilir, Muammer; Ucak, Sema; Gundogdu, Sadi
2005-04-01
Reactive hypoglycemia (RH), which is a postprandial hypoglycemic state, occurs within 2-5 h after food intake. It is classified as idiopathic, alimentary, or diabetic reactive hypoglycemia. We studied the incidence of reactive hypoglycemia and looked for any correlations between it and the presence of insulin sensitivity and/or beta cell function in young lean polycystic ovary syndrome (PCOS) patients. This study was designed as a cross-sectional study in 64 lean young women with PCOS (BMI < or = 25 kg/m2). Various indices of insulin sensitivity and beta cell function derived from the oral glucose tolerance test (OGTT) results were used. We found the rate of RH to be 50% in lean young women with PCOS. DHEA-S and PRL levels were found to be lower in subjects with RH (P < 0.05 and P > 0.05, respectively). Beta cell function indices such as the insulinogenic index (at 120 min), CIR (at 120 min) and HOMA beta cell index were found to be insignificantly higher in the RH group than the nonreactive hypoglycemia (NRH) group. The 4 h glucose level, but not the 3 h glucose level, was significantly correlated with insulin resistance indices, such as fasting insulin level, HOMA-IR, Quicky index, and FIRI in the RH group. Significantly decreased DHEA-S levels were an interesting finding. In conclusion, there is an urgent need to investigate RH in lean young women with PCOS. Our results indicate that more definite insulin resistance occurs in subjects with RH in the fourth hour of the OGTT than those with RH in the third hour. In addition, RH in the fourth hour together with a low DHEA-S level may be predictive of future diabetes in young women with PCOS even when they are not obese.
Hematopoietic Stem Cell Transplantation in Thalassemia and Sickle Cell Anemia
Lucarelli, Guido; Isgrò, Antonella; Sodani, Pietro; Gaziev, Javid
2012-01-01
The globally widespread single-gene disorders β-thalassemia and sickle cell anemia (SCA) can only be cured by allogeneic hematopoietic stem cell transplantation (HSCT). HSCT treatment of thalassemia has substantially improved over the last two decades, with advancements in preventive strategies, control of transplant-related complications, and preparative regimens. A risk class–based transplantation approach results in disease-free survival probabilities of 90%, 84%, and 78% for class 1, 2, and 3 thalassemia patients, respectively. Because of disease advancement, adult thalassemia patients have a higher risk for transplant-related toxicity and a 65% cure rate. Patients without matched donors could benefit from haploidentical mother-to-child transplantation. There is a high cure rate for children with SCA who receive HSCT following myeloablative conditioning protocols. Novel non-myeloablative transplantation protocols could make HSCT available to adult SCA patients who were previously excluded from allogeneic stem cell transplantation. PMID:22553502
Probing the young circumplanetary environment of Beta Pic b during transit egress
NASA Astrophysics Data System (ADS)
Wang, Jason
2017-08-01
Among the thousands of known exoplanets, Beta Pic b is the only directly imaged exoplanet with a nearly edge-on orbit. We show that the latest astrometric measurements rule out a transit by the planet at 10-sigma significance, but we are certain that the Hill sphere of the planet will transit. With a period of 22 years and no other system like it, this Hill sphere transit provides a rare opportunity to study the evolving circumplanetary environment of a young and well-characterized exoplanet. To compliment GO-14621, our Cycle 25 proposal to monitor the ingress of the Hill sphere, we propose a modest HST program to photometrically search for signatures of the planet's large scale circumplanetary material during the egress of the Hill sphere transit. The existence of such material is plausible given that Beta Pic's young age is similar to that of the ring-bearing J1407b system. Combined with GO-14621 and less-precise but dedicated ground-based monitoring, these observations will give us a comprehensive set of observations about this young circumplanetary environment. Given the sparse observational data of circumplanetary environments, non-detections will also be valuable for constraining the timescales relevant to circumplanetary material and moon formation. If photometric variations are detected with HST, these results would yield empirical information concerning the dynamics of the system and the evolution of planetary systems as a whole.
Investigating the use of Egyptian blue in Roman Egyptian portraits and panels from Tebtunis, Egypt
NASA Astrophysics Data System (ADS)
Ganio, Monica; Salvant, Johanna; Williams, Jane; Lee, Lynn; Cossairt, Oliver; Walton, Marc
2015-11-01
The use of the pigment Egyptian blue is investigated on a corpus of fifteen mummy portraits and Roman-period paintings from Tebtunis, Egypt, housed in the Phoebe A. Hearst Museum of Anthropology at the University of California, Berkeley. Egyptian blue has a strong luminescence response in the near infrared that can be exploited to created wide-field images noninvasively showing the distribution of the pigment on a work of art. A growing body of publications in the last decade highlights the increasing use of this tool and its sensitive detection limits. However, the technique is not wavelength specific. Both excitation and emission occur in a broad range. Although Egyptian blue has a strong emission in the NIR, a myriad of other compounds may emit light in this spectral region when excited in the visible. The limited number of studies including complementary analysis to verify the presence of Egyptian blue does not allow its identification on the basis of NIR luminescence alone. Through the use of in situ X-ray fluorescence and X-ray diffraction, and scanning electron microscopy/energy-dispersive spectroscopy of cross sections, this paper confirms the identification of Egyptian blue by NIR luminescence in unexpected areas, i.e., those not blue in appearance.
Assessing posterior ocular structures in β-thalassemia minor.
Arifoglu, Hasan Basri; Kucuk, Bekir; Duru, Necati; Altunel, Orhan; Gulhan, Ahmet; Ozen, Mustafa; Aygun, Bilal; Atas, Mustafa
2018-02-01
The aim of this study was to investigate the effect of β-thalassemia minor on choroidal, macular, and peripapillary retinal nerve fiber layer thickness. To form the sample, we recruited 40 patients with β-thalassemia minor and 44 healthy participants. We used spectral-domain optical coherence tomography to take all measurements of ocular thickness, as well as measured intraocular pressure, axial length, and central corneal thickness. We later analyzed correlations of hemoglobin levels with ocular parameters. A statistically significant difference emerged between patients with β-thalassemia minor and the healthy controls in terms of mean values of subfoveal, nasal, and temporal choroidal thickness (p = 0.001, p = 0.016, and p = 0.010, respectively). Except for central macular thickness, differences in paracentral macular thicknesses between the groups were also significant (superior: p < 0.001, inferior: p = 0.007, temporal: p = 0.001, and nasal: p = 0.005). Also, no statistically significant differences were noted for retinal nerve fiber layer thickness between two groups. Mean values of subfoveal, nasal, temporal choroidal, and macular thickness for the four quadrants were significantly lower in patients with β-thalassemia minor than in healthy controls.
Mehdi, Syed Riaz; Al Dahmash, Badr Abdullah
2011-01-01
BACKGROUND AND AIMS: Saudi Arabia falls in the high prevalent zone of αα and β thalassemias. Early screening for the type of thalassemia is essential for further investigations and management. The study was carried out to differentiate the type of thalassemia based on red cell indices and other hematological parameters. MATERIALS AND METHODS: The study was carried out on 991 clinically suspected cases of thalassemias in Riyadh, Saudi Arabia. The hematological parameters were studied on Coulter STKS. Cellulose acetate hemoglobin electrophoresis and high-performance liquid chromatography (HPLC) were performed on all the blood samples. Gene deletion studies were carried out by restriction fragment length polymorphism (RFLP) technique using the restriction endonucleases Bam HI. STATISTICAL ANALYSIS: Statistical analysis was performed on SPSS 11.5 version. RESULTS: The hemoglobin electrophoresis and gene studies revealed that there were 406 (40.96%) and 59 (5.95 %) cases of β thalassemia trait and β thalassemia major respectively including adults and children. 426 cases of various deletion forms of α thalassemias were seen. Microcytosis was a common feature in β thalassemias trait and (-α/-α) and (--/αα) types of α thalassemias. MCH was a more significant distinguishing feature among thalassemias. β thalassemia major and α thalassemia (-α/αα) had almost normal hematological parameters. CONCLUSION: MCV and RBC counts are not statistically significant features for discriminating between α and β thalassemias. There is need for development of a discrimination index to differentiate between α and β thalassemias traits on the lines of discriminatory Indices available for distinguishing β thalassemias trait from iron deficiency anemia. PMID:22345994
Mehdi, Syed Riaz; Al Dahmash, Badr Abdullah
2011-09-01
Saudi Arabia falls in the high prevalent zone of αα and β thalassemias. Early screening for the type of thalassemia is essential for further investigations and management. The study was carried out to differentiate the type of thalassemia based on red cell indices and other hematological parameters. The study was carried out on 991 clinically suspected cases of thalassemias in Riyadh, Saudi Arabia. The hematological parameters were studied on Coulter STKS. Cellulose acetate hemoglobin electrophoresis and high-performance liquid chromatography (HPLC) were performed on all the blood samples. Gene deletion studies were carried out by restriction fragment length polymorphism (RFLP) technique using the restriction endonucleases Bam HI. Statistical analysis was performed on SPSS 11.5 version. The hemoglobin electrophoresis and gene studies revealed that there were 406 (40.96%) and 59 (5.95 %) cases of β thalassemia trait and β thalassemia major respectively including adults and children. 426 cases of various deletion forms of α thalassemias were seen. Microcytosis was a common feature in β thalassemias trait and (-α/-α) and (--/αα) types of α thalassemias. MCH was a more significant distinguishing feature among thalassemias. β thalassemia major and α thalassemia (-α/αα) had almost normal hematological parameters. MCV and RBC counts are not statistically significant features for discriminating between α and β thalassemias. There is need for development of a discrimination index to differentiate between α and β thalassemias traits on the lines of discriminatory Indices available for distinguishing β thalassemias trait from iron deficiency anemia.
Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung
2015-04-01
Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction. This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities.
Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li
2010-08-01
Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.
Rago, Anna; Russo, Vincenzo; Papa, Andrea Antonio; Ciardiello, Carmine; Pannone, Bruno; Mayer, Maria Carolina; Cimmino, Giovanni; Nigro, Gerardo
2017-03-01
Paroxysmal atrial tachyarrhythmias frequently occur in beta-thalassemia major (β-TM) patients. The aim of the current study was to evaluate the atrial electromechanical delay (AEMD) in a large β-TM population with normal cardiac function and its relationship to atrial fibrillation (AF) onset. Eighty β-TM patients (44 men, 36 women), with a mean age of 36.2 ± 11.1 years, and 80 healthy subjects used as controls, matched for age and gender, were studied for the occurrence of AF during a 5-year follow-up, through 30-day external loop recorder (ELR) monitoring performed every 6 months. Intra-AEMD and inter-AEMD of both atria were measured through tissue Doppler echocardiography. P-wave dispersion (PD) was carefully measured using 12-lead electrocardiogram (ECG). Compared to the healthy control group, the β-TM patients showed a statistically significant increase in inter-AEMD, intra-left AEMD, maximum P-wave duration, and PD. Dividing the β-TM group into two subgroups (patients with or without AF), the inter-AEMD, intra-left AEMD, maximum P-wave duration, and PD were significantly higher in the subgroup with AF compared to the subgroup without AF. There were significant good correlations of intra-left AEMD and inter-AEMD with PD. A cut-off value of 40.1 ms for intra-left AEMD had a sensitivity of 76.2% and a specificity of 97.5% in identifying β-TM patients with AF risk. A cut-off value of 44.8 ms for inter-AEMD had a sensitivity of 81.2% and a specificity of 98.7% in identifying this category of patients. Our results showed that the echocardiographic atrial electromechanical delay indices (intra-left and inter-AEMD) and the PD were significantly increased in β-TM subjects with normal cardiac function. PD and AEMD represent non-invasive, inexpensive, useful, and simple parameters to assess the AF risk in β-TM patients.
Mitochondrial genome sequence of Egyptian swift Rock Pigeon (Columba livia breed Egyptian swift).
Li, Chun-Hong; Shi, Wei; Shi, Wan-Yu
2015-06-01
The Egyptian swift Rock Pigeon is a breed of fancy pigeon developed over many years of selective breeding. In this work, we report the complete mitochondrial genome sequence of Egyptian swift Rock Pigeon. The total length of the mitogenome was 17,239 bp and its overall base composition was estimated to be 30.2% for A, 24.0% for T, 31.9% for C and 13.9% for G, indicating an A-T (54.2%)-rich feature in the mitogenome. It contained the typical structure of 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and a non-coding control region (D-loop region). The complete mitochondrial genome sequence of Egyptian swift Rock Pigeon would serve as an important data set of the germplasm resources for further study.
Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated
2017-01-01
Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE), various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term. PMID:28135306
Al Sabbah, Haleama; Khan, Sarah; Hamadna, Abdallah; Abu Ghazaleh, Lamia; Dudin, Anwar; Karmi, Bashar Adnan
2017-01-01
Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Convenience sampling was used to select 32 women (72 fetuses) who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Among the fetuses screened, 36 (50%) were thalassemia carriers and 20 (28%) had β-thalassemia; 17 (85%) affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus ( p <0.05). A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world.
Abuamer, S; Shome, D K; Jaradat, A; Radhi, A; Bapat, J P; Sharif, K A; Al-Touq, J; Al-Asheeri, A; Al-Ajami, A
2017-02-01
Bahrain has high prevalence rates of sickle cell and thalassemia in the population. This study reports the frequencies and phenotypic characteristics of α- and/or β-thalassemia associated with sickle-cell disease (SCD) in a tertiary care hospital. Adult SCD patients (n = 200) were screened for the common α- and β-thalassemia alleles prevalent in the region using molecular techniques. Results of CBC, hemoglobin analysis, and average annual frequencies of severe pain episodes and numbers of transfused red cell units were documented. Patients were grouped on the basis of molecular studies as sickle-cell anemia (SS, n = 131), SS/α-thalassemia with three normal genes (n = 27), SS/α-thalassemia with two normal genes (n = 11), sickle-β-thalassemia (Sβ, n = 23), and Sβ with co-inherited α-thalassemia (n = 8). Identified α-thalassemia determinants were -α 3.7 (n = 52), -α 4.2 (n = 4), α T-Saudi α (n = 1), and α Hph α (n = 1). All β-thalassemia alleles were β 0 defects. Sickle-thalassemia association resulted in higher hemoglobin, hematocrit, and erythrocyte counts with reduced MCV and reticulocytes. Significant clinical associations were as follows: increased severe pain frequency with α-thalassemia (three-gene group); red cell transfusion with β-thalassemia alleles and female gender. One-third of patients with SCD co-inherited α- and/or β-thalassemia alleles and these associations explained some of the observed phenotypic variability. A low prevalence of nondeletion α-thalassemia alleles was observed in these patients. The most significant disease amelioration occurred in SCD associated with two α-thalassemia alleles. © 2016 John Wiley & Sons Ltd.
MiR-155 enhances phagocytic activity of β-thalassemia/HbE monocytes via targeting of BACH1.
Srinoun, Kanitta; Nopparatana, Chamnong; Wongchanchailert, Malai; Fucharoen, Suthat
2017-11-01
Abnormal red blood cell (RBC) clearance in β-thalassemia is triggered by activated monocytes. Recent reports indicate that miRNA (miR-) plays a role in monocyte activation. To study phagocytic function, we co-cultured monocytes of normal, non-splenectomized and splenectomized β-thalassemia/HbE individuals with RBCs obtained from normal, non-splenectomized and splenectomized β-thalassemia/HbE individuals. The phagocytic activity of β-thalassemia/HbE monocytes co-cultured with β-thalassemia/HbE RBCs was significantly higher than that of normal monocytes co-cultured with normal RBCs. Upregulation of monocyte miR-155 was observed in β-thalassemia/HbE patients. Increased miR-155 was associated with reductions in BTB and CNC Homology1 (BACH1) target gene expression and increased phagocytic activity of β-thalassemia/HbE monocytes. Taken together, these findings suggested that increased miR-155 expression in activated monocytes leads to enhanced phagocytic activity via BACH-1 regulation in β-thalassemia/HbE. This provides novel insights into the phagocytic clearance of abnormal RBCs in β-thalassemia/HbE.
Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark
2006-08-15
The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.
Effects of α-Thalassemia on HbA1c Measurement.
Xu, Anping; Ji, Ling; Chen, Weidong; Xia, Yong; Zhou, Yu
2016-11-01
α-Thalassemia is a benign condition that is often present in patients with diabetes mellitus. Here, we evaluated the effects of different genotypes α-thalassemia on HbA 1c measurement. A total of 189 samples from nondiabetic patients were analyzed. HbA 1c analysis was performed by ion-exchange high-performance liquid chromatography, boronate affinity HPLC, immunoassay, and capillary electrophoresis. Fasting glucose, fructosamin, and HbA 2 were also performed. All samples were confirmed by genotyping for thalassemia. In patients with two or three functional α-genes, HbA 1c values were not significantly different from those of controls (P > 0.05); however, in individuals with α-thalassemia with one functional α-gene (i.e., HbH disease), HbA 1c levels were significantly different from those of controls (P < 0.01). HbA 1c values were significantly lower in individuals with HbH disease than in control individuals and patients in the other two α-thalassemia groups. For patients with HbH disease, there were no significant differences in the four HbA 1c measurement systems (P > 0.05). In this study, HbA 1c values in samples from individuals with two or three functional α-genes basically reflected the normal mean blood glucose level, while those in samples from individuals with one functional α-gene did not. © 2016 Wiley Periodicals, Inc.
MRI for Iron Overload in Thalassemia.
Fernandes, Juliano Lara
2018-04-01
MRI is a key tool in the current management of patients with thalassemia. Given its capability of assessing iron overload in different organs noninvasively and without contrast, it has significant advantages over other metrics, including serum ferritin. Liver iron concentration can be measured either with relaxometry methods T2*/T2 or signal intensity ratio techniques. Myocardial iron can be assessed in the same examination through T2* imaging. In this review, we focus on showing how MRI evaluates iron in both organs and the clinical applications as well as practical approaches to using this tool by clinicians taking care of patients with thalassemia. Copyright © 2017 Elsevier Inc. All rights reserved.
Al Sabbah, Haleama; Khan, Sarah; Hamadna, Abdallah; Abu Ghazaleh, Lamia; Dudin, Anwar; Karmi, Bashar Adnan
2017-01-01
Purpose Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Methods Convenience sampling was used to select 32 women (72 fetuses) who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Results Among the fetuses screened, 36 (50%) were thalassemia carriers and 20 (28%) had β-thalassemia; 17 (85%) affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus (p<0.05). Conclusion A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world. PMID:29026336
Pengon, Jutharat; Svasti, Saovaros; Kamchonwongpaisan, Sumalee; Vattanaviboon, Phantip
2018-03-01
Glucose-6-phosphate dehydrogenase (G-6-PD) deficiency and thalassemia are genetically independent hemolytic disorders. Co-inheritance of both disorders may affect red blood cell pathology to a greater extent than normally seen in either disorder alone. This study determines the prevalence and evaluates hematological changes of G-6-PD deficiency and thalassemia co-inheritance. G-6-PD deficiency was screened from 200 male thalassemia blood samples using a fluorescent spot test. Hematological parameters and red blood cell morphology were evaluated among G-6-PD deficiency/thalassemia co-inheritance, G-6-PD deficiency alone, thalassemia alone, and normal individuals. G-6-PD deficiency was detected together with hemoglobin (Hb) E heterozygote, Hb E homozygote, β-thalassemia trait, and β-thalassemia/Hb E, α-thalassemia-2 trait, and Hb H disease. Hb level, hematocrit, mean cell volume, and mean cell Hb of G-6-PD deficiency co-inherited with asymptomatic thalassemia carriers show significantly lower mean values compared to carriers with only the same thalassemia genotypes. Higher mean red blood cell distribution width was observed in G-6-PD deficiency co-inherited with Hb E heterozygote, as with numbers of hemighost cells in G-6-PD deficiency/thalassemia co-inheritance compared to those with either disorder. Apart from Hb level, hematological parameters of co-inheritance disorders were not different from individuals with a single thalassemia disease. G-6-PD deficiency co-inherited with thalassemia in males was present in 10% of the participants, resulting in worsening of red blood cell pathology compared with inheritance of thalassemia alone. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.
He, Sheng; Qin, Qian; Yi, Shang; Wei, Yuan; Lin, Li; Chen, Shaoke; Deng, Jianping; Xu, Xianmin; Zheng, Chenguang; Chen, Biyan
2017-07-01
Thalassemia is one of the most common hereditary blood disorders. Epidemiological data regarding the occurrence and distribution of thalassemia is important for designing appropriate prevention strategies. The objective of this study was to update and reveal the prevalence of thalassemia and mutation spectrum in the Baise region of southern China. We screened 47,500 individuals from Baise region by hematological and genetic analysis. Totally, 11,432 (24.07%) subjects were diagnosed as being carriers and patients of thalassemia, including 7290 (15.35%) subjects with α-thalassemia, 3152 (6.64%) subjects with β-thalassemia and 990 (2.08%) subjects with both α-thalassemia and β-thalassemia. Ten α-thalassemia mutations and 31 genotypes were identified in the α-thalassemia carriers and patients. Meanwhile, 13 β-thalassemia mutations and 26 genotypes were characterized in the β-thalassemia carriers and patients. Furthermore, the true prevalence of nondeletional mutations and Thailand type (-THAI) deletion mutation were first reported in this study. In addition, three cases of αα/ααα3.7, five cases of HKαα/αα and two rare β-globin mutations, -86 (G>C) and CD 121 (G>T) were first identified in the Chinese Zhuang ethnic populations. Our data indicated that there was great heterogeneity and extensive spectrum of thalassemias in the Baise populations. The findings will be useful for genetic counseling and prevention of severe thalassemia in this region. Copyright © 2016 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosatelli, M.C.; Faa, V.; Sardu, R.
This study reports the molecular characterization of [beta]-thalassemia in the Sardinian population. Three thousand [beta]-thalassemia chromosomes from prospective parents presenting at the genetic service were initially analyzed by dot blot analysis with oligonucleotide probes complementary to the most common [beta]-thalassemia mutations in the Mediterranean at-risk populations. The mutation which remained uncharacterized by this approach were defined by denaturing gradient gel electrophoresis (DGGE) followed by direct sequence analysis on amplified DNA. The authors reconfirmed that the predominant mutation in the Sardinian population is the codon 39 nonsense mutation, which accounts for 95.7% of the [beta]-thalassemia chromosomes. The other two relatively commonmore » mutations are frameshifts at codon 6 (2.1%) and at codon 76 (0.7%), relatively uncommon in other Mediterranean-origin populations. In this study they have detected a novel [beta]-thalassemia mutation, i.e., a frameshift at codon 1, in three [beta]-thalassemia chromosomes. The DGGE procedure followed by direct sequencing on amplified DNA is a powerful approach for the characterization of unknown mutations in this genetic system.« less
Refractive errors and ocular biometry components in thalassemia major patients.
Heydarian, Samira; Jafari, Reza; Karami, Hosein
2016-04-01
The aim of this study is to determine and compare biometric and refractive characteristics of thalassemia major patients and normal individuals. In this cross-sectional study, 54 thalassemia major patients were selected randomly as case group, and 54 age- and sex-matched healthy subjects were regarded as control group. Refractive errors, corneal curvature and ocular components were measured by autokeratorefractometery and A-scan ultrasonography, respectively. Mean spherical equivalent was -0.0093 ± 0.86 D in thalassemia patients and -0.22 ± 1.33 D in the normal group. The prevalence of myopia, Hyperopia, and emmetropia among thalassemia patients was 16.7, 19.4, and 63.9 %, respectively. While in the control group, 26.9 % were myopic, 25 % were hyperopic, and 48.1 % were emmetropic. The prevalence of astigmatism in case group was 22.2 %, which was not significantly different from that in control group, (27.8 %, p = 0.346). Mean axial length in thalassemia patients was 22.89 ± 0.70 which was significantly lower than that in normal group (23.37 ± 0.91, p = 0.000). The flattest meridian of the cornea (R1) was significantly steeper in thalassemia patients (7.77 ± 0.24) in comparison to normal individuals (7.85 ± 0.28). Although thalassemic patients had significantly smaller axial length and vitreous chamber depth in comparison to normal group, which could be due to their abnormal physical growth, there was no significant difference between the mean of spherical equivalent among two groups. This can be due to their steeper corneal curvature that overcomes the refractive disadvantage of their shorter axial length.
The Wall Drawings of Egyptian Children.
ERIC Educational Resources Information Center
Wilson, Brent
1982-01-01
Discusses murals done by Egyptian children. Differences in the drawing styles of American and Egyptian children are discussed. The author states that the significance of the wall drawings is that they represent a rich social setting in which children learn to produce art. (AM)
Molecular diagnosis of α-thalassemia in a multiethnic population.
Gilad, Oded; Shemer, Orna Steinberg; Dgany, Orly; Krasnov, Tanya; Nevo, Michal; Noy-Lotan, Sharon; Rabinowicz, Ron; Amitai, Nofar; Ben-Dor, Shifra; Yaniv, Isaac; Yacobovich, Joanne; Tamary, Hannah
2017-06-01
α-Thalassemia, one of the most common genetic diseases, is caused by deletions or point mutations affecting one to four α-globin genes. Molecular diagnosis is important to prevent the most severe forms of the disease. However, the diagnosis of α-thalassemia is complex due to a high variability of the genetic defects involved, with over 250 described mutations. We summarize herein the findings of genetic analyses of DNA samples referred to our laboratory for the molecular diagnosis of α-thalassemia, along with a detailed clinical description. We utilized a diagnostic algorithm including Gap-PCR, to detect known deletions, followed by sequencing of the α-globin gene, to identify known and novel point mutations, and multiplex ligation-dependent probe amplification (MLPA) for the diagnosis of rare or novel deletions. α-Thalassemia was diagnosed in 662 of 975 samples referred to our laboratory. Most commonly found were deletions (75.3%, including two novel deletions previously described by us); point mutations comprised 25.4% of the cases, including five novel mutations. Our population included mostly Jews (of Ashkenazi and Sephardic origin) and Muslim Arabs, who presented with a higher rate of point mutations and hemoglobin H disease. Overall, we detected 53 different genotype combinations causing a spectrum of clinical phenotypes, from asymptomatic to severe anemia. Our work constitutes the largest group of patients with α-thalassemia originating in the Mediterranean whose clinical characteristics and molecular basis have been determined. We suggest a diagnostic algorithm that leads to an accurate molecular diagnosis in multiethnic populations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The molecular basis of α-thalassemia.
Higgs, Douglas R
2013-01-01
The globin gene disorders including the thalassemias are among the most common human genetic diseases with more than 300,000 severely affected individuals born throughout the world every year. Because of the easy accessibility of purified, highly specialized, mature erythroid cells from peripheral blood, the hemoglobinopathies were among the first tractable human molecular diseases. From the 1970s onward, the analysis of the large repertoire of mutations underlying these conditions has elucidated many of the principles by which mutations occur and cause human genetic diseases. This work will summarize our current knowledge of the α-thalassemias, illustrating how detailed analysis of this group of diseases has contributed to our understanding of the general molecular mechanisms underlying many orphan and common diseases.
Two cloned β thalassemia genes are associated with amber mutations at codon 39
Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur
1981-01-01
Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453
'Rakter dosh'--corrupting blood: The challenges of preventing thalassemia in Bengal, India.
Chattopadhyay, Sreeparna
2006-11-01
Thalassemia is an inherited blood disorder that has been receiving increasing attention in India. However, prevention of thalassemia in India continues to be difficult despite efforts of public health professionals and the government. Using West Bengal as a case study, this paper attempts to unravel some of the barriers to the prevention campaign and the consequent under utilization of the program. Lack of access, low awareness, low-risk perception and poverty are all important proximate constraints; however, one of the greatest barriers to the program is rooted in cultural notions of blood, marriage, identity, personhood and kinship in Bengali society. Blood is so deeply valued in the Bengali kinship system that this genetic mutation is perceived to be corrupting the blood (rakter dosh). Being a thalassemia carrier (i.e., having thalassemia minor) renders an individual unfit as a suitable marriage partner because of beliefs related to purity of blood, its association with the continuity of the lineage, and subsequent transmission of desirable traits to future generations. The risk of non-marriage affects women disproportionately, and parents are not inclined to test their daughters because of the possibility of not being able to marry them off to eligible suitors. The stigma associated with having thalassemia minor (TMI) is a deterrent to the disclosure of thalassemia status as well as to testing. Using anthropological theories and ethnographic methods, this paper focuses on the gendered process by which the diagnosis of a thalassemia carrier 'spoils' identities, thereby creating a disjuncture between the goals of the prevention program and people's need for social conformity, and ultimately between medical desirability and social desirability. The paper also suggests policies for enhancing the utilization of the program. Finally the conclusions from this study have potential applications for public health prevention programs that confront problems of stigma in
Decreased nitrite levels in erythrocytes of children with β-thalassemia/hemoglobin E.
Suvachananonda, Thitiwat; Wankham, Amara; Srihirun, Sirada; Tanratana, Pansakorn; Unchern, Supeenun; Fucharoen, Suthat; Chuansumrit, Ampaiwan; Sirachainan, Nongnuch; Sibmooh, Nathawut
2013-09-01
Nitrite anion is bioactive nitric oxide (NO) species circulating in blood, and represents the NO bioavailability and endothelial function. In this study, we aimed to investigate the nitrite levels and the correlation with hemolysis and severity in β-thalassemia/hemoglobin E (β-thal/HbE). 38 Children (12.0±1.9 years of age) with a diagnosis of mild, moderate and severe β-thalassemia were enrolled in the study. The blood nitrite levels and potential plasma NO consumption were measured by the chemiluminescence method. The nitrite levels in whole blood and erythrocytes of the severe thalassemia subjects were lower than those of the control subjects. At day 7 after transfusion of packed erythrocytes, the nitrite levels in erythrocytes increased. The plasma hemoglobin and NO consumption increased in the severe thalassemia subjects. The nitrite levels in erythrocytes inversely correlated with plasma hemoglobin, lactate dehydrogenase activity, potential NO consumption, and lipid peroxidation. Our studies demonstrate the decreased NO bioavailability in thalassemia, which could result from endothelial dysfunction, the increased potential NO consumption in plasma by cell-free hemoglobin and oxidative stress. Copyright © 2013 Elsevier Inc. All rights reserved.
Egyptian government broadens ban on female genital mutilation.
1996-01-01
An estimated 70-90% of girls in Egypt are subjected to female genital mutilation (FGM) before reaching puberty. Many Egyptians believe the practice to be ordained by Islam. Whether this is true, however, remains an issue of debate among Muslim scholars. Some Egyptian Christians also secure FGM for their girls. Egyptian law prohibits anyone without medical training from performing FGM, and any physician or health worker who causes permanent damage to a girl may face 3-10 years of hard labor. However, the law is frequently ignored, especially in rural areas, where village barbers and midwives perform the operations. In October 1995, Egyptian state hospitals were banned from performing FGM. Egypt has since broadened its ban to bar all health care workers in both state-run hospitals and private clinics from performing the procedure. No health care worker affiliated with the Ministry of Health is therefore allowed to perform FGM. Almost all Egyptian doctors are affiliated with the Ministry. While this recent move by the Health Minister is laudable, it remains to be seen whether he can enforce it. The secretary-general of the Egyptian Organization for Human Rights has urged parliament to enact legislation criminalizing FGM.
Effect of health education on severe thalassemia prevention and control in communities in Cambodia.
Cheng, Kimhaung; Fucharoen, Supan; Sanchaisuriya, Kanokwan; Fucharoen, Goonnapa; Sanchaisuriya, Pattara; Jetsrisuparb, Arunee
2018-01-01
Severe thalassemia diseases are a major health problem in Southeast Asia. In Cambodia, there has never been a significant program for prevention or control of severe thalassemia. We, therefore, studied the effect of a health education program on severe thalassemia prevention and control in Phnom Penh, Cambodia. A quasi-experimental study in several communities around Phnom Penh was done. The respective intervention and control group comprised 124 and 117 people, between 18 and 40 years of age, male and female. Pre- and post-tests using a validated and reliable questionnaire were performed in the intervention group and one test was done in the control group. A health education program was organized to give important information to the intervention group and, at the end of the process, to the control group. The outcomes were evaluations of their knowledge and attitude vis-à-vis severe thalassemia prevention and control, and participating in thalassemia screening. Among participants in the intervention group, 105 (84.7%) considered undergoing blood screening vs. 65 (55.6%) in the control group ( p -value < 0.001). In the intervention group, the respective mean scores for knowledge and attitude to a prevention and control program for severe thalassemia before and after health education were 2.6 VS 6.5 ( p -value < 0.001) and 4.6 VS 6.5 ( p -value < 0.001). The intention to undergo screening was significantly higher in the intervention group than the control group. Knowledge and attitude towards prevention and control of severe thalassemia was significantly improved in the intervention group. Health education clearly heightens awareness and improves consideration of screening for prevention and control of severe thalassemia.
The Egyptian Military Elite: An Operational Code
1977-09-01
17 Jan 1955. 6. Salem, Major Salah, "Mehalla’s Great Welcome For Major Salem," Egyptian Gazette, p. 1, 7 Jan 1955. 7. Muhieldin, Lt. Col. Zakaria, "The...Wheel of Reform Will Not Turn Back," Egyptian Gazette, p. 1, 26 Jan 1955. 8. Gohar, Lt. Col. Salah, "Imaginary Incident Explored," Egyptian Gazette...Says Army is Fully Prepared," Al Akhbar , FBIS Vol. 172, p. Al, 4 Sept 1956. 12. Sadat, Anwar al, "Western Powers Determined to Grab Canal," Al
Moghaddam, Hassan Mottaghi; Badiei, Zahra; Eftekhari, Kambiz; Shakeri, Reza; Farhangi, Hamid
2015-07-01
There are various clinical symptoms of thalassemia intermedia, and they lie roughly between those of major and minor forms of the disease. Patients with thalassemia intermedia occasionally require blood transfusions. This renders them susceptible to pulmonary arterial hypertension (PAH) syndrome, which is one of the most significant complications in patients with thalassemia intermedia. PAH is more common in in thalassemia intermedia than in thalassemia major, and it may cause cardiac complications in patients who are older than 30. The objective of this study was to estimate the prevalence of PAH in thalassemia intermedia patients so that they can be referred expeditiously for treatment, thereby preventing the complications that occur later. This cross sectional study was conducted under the supervision of hematology department of Mashhad Medical University. Forty-one patients with thalassemia intermedia were examined at the Sarvar Thalassemia and Hemophilia Clinic of Mashhad. Electrocardiography, chest radiography, and echocardiography tests were performed for all of the patients by the same pediatric cardiologist. The data were processed by SPSS software, version 11.5, and the results were analyzed using chi-squared, Student's t, and Mann-Whitney tests. The mean age of the patients was 21.93±8.34. They had been under pediatric heart specialists' constant examination and treatment since their childhood when they were diagnosed with TI, and continue to receive regular follow-up care. The prevalence of pulmonary hypertension was 24% in our study population. In patients with thalassemia intermedia, the left ventricular (LV) mass indices were about 3-5 times higher than would be expected in a normal population. Patients with higher LV mass indices have a greater risk of developing pulmonary hypertension, and those with serum ferritin levels below 1000 ng/ml are less susceptible to diastolic dysfunction. Pulmonary hypertension is common in patients with thalassemia
Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia
Calloway, Cassandra
2016-01-01
BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P < 0.001, respectively). ΔmtDNA4977 was increased in the presence of either liver iron concentration > 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* < 20 ms) was present in 0%, 22%, and 46% of subjects with ΔmtDNA4977 frequency < 20, 20–40, and > 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305
Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia
Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.
2013-01-01
Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047
Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein
2018-03-01
β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.
Diverse hematological phenotypes of β-thalassemia carriers.
Luo, Hong-Yuan; Chui, David H K
2016-03-01
Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.
Investigation of FoxO3 dynamics during erythroblast development in β-thalassemia major
Thanuthanakhun, Naruchit; Nuntakarn, Lalana; Sampattavanich, Somponnat; Anurathapan, Usanarat; Phuphanitcharoenkun, Suphanun; Pornpaiboonstid, Savichaya; Hongeng, Suradej
2017-01-01
The FoxO3 transcription factor is a key regulator of oxidative stress and erythroid maturation during erythropoiesis. In this study, we explored the involvement of FoxO3 in severe β-thalassemia. Using primary CD34+ hematopoietic progenitor cells from patients with β-thalassemia major, we successfully developed an in vitro model of ineffective erythropoiesis. Based on this model, FoxO3 activity was quantified in single cells using high throughput imaging flow cytometry. This study revealed a significant reduction of FoxO3 activity during the late stage of erythroblast differentiation in β-thalassemia, in contrast to erythropoiesis in normal cells that maintain persistent activation of FoxO3. In agreement with the decreased FoxO3 activity in β-thalassemia, the expression of FoxO3 target genes was also found to decrease, concurrent with elevated phosphorylation of AKT, most clearly at the late stage of erythroid differentiation. Our findings provide further evidence for the involvement of FoxO3 during terminal erythropoiesis and confirm the modulation of the PI3K/AKT pathway as a potential therapeutic strategy for β-thalassemia. PMID:29099866
Investigation of FoxO3 dynamics during erythroblast development in β-thalassemia major.
Thanuthanakhun, Naruchit; Nuntakarn, Lalana; Sampattavanich, Somponnat; Anurathapan, Usanarat; Phuphanitcharoenkun, Suphanun; Pornpaiboonstid, Savichaya; Borwornpinyo, Suparerk; Hongeng, Suradej
2017-01-01
The FoxO3 transcription factor is a key regulator of oxidative stress and erythroid maturation during erythropoiesis. In this study, we explored the involvement of FoxO3 in severe β-thalassemia. Using primary CD34+ hematopoietic progenitor cells from patients with β-thalassemia major, we successfully developed an in vitro model of ineffective erythropoiesis. Based on this model, FoxO3 activity was quantified in single cells using high throughput imaging flow cytometry. This study revealed a significant reduction of FoxO3 activity during the late stage of erythroblast differentiation in β-thalassemia, in contrast to erythropoiesis in normal cells that maintain persistent activation of FoxO3. In agreement with the decreased FoxO3 activity in β-thalassemia, the expression of FoxO3 target genes was also found to decrease, concurrent with elevated phosphorylation of AKT, most clearly at the late stage of erythroid differentiation. Our findings provide further evidence for the involvement of FoxO3 during terminal erythropoiesis and confirm the modulation of the PI3K/AKT pathway as a potential therapeutic strategy for β-thalassemia.
Food habits of the Egyptians: newly emerging trends.
Hassan-Wassef, H
2004-11-01
Accelerated changes are taking place in the food habits of the present day Egyptians. Examples are drawn from foods that continue to be consumed by those considered guardians of the Egyptian tradition (Coptic Christians and isolated farming communities) and from interpretation of archaeological evidence. Recent decades have witnessed the progressive erosion of the traditional Egyptian diet and the introduction of new foods and eating habits. Sociocultural and economic changes are accelerating this erosion. The main features of the traditional Egyptian way of eating are presented along with a review of the emerging trends and of some of the important factors underlying food consumption patterns. Attention is drawn to the potential risk to health that these new trends represent, in particular to child nutrition and development.
Thalidomide has a significant effect in patients with thalassemia intermedia.
Li, YunShuan; Ren, Quan; Zhou, Yali; Li, Pingping; Lin, Wanhua; Yin, Xiaolin
2018-01-01
To investigate the effect of thalidomide in patients with thalassemia intermedia. We observed the effect of thalidomide in seven patients with thalassemia intermedia requiring blood transfusion. Four of the patients were transfusion-independent, and three patients were transfusion-dependent. For the four transfusion-independent patients, hemoglobin concentration increased significantly (≥2 g/dl) in three and moderately (1-2 g/dl) in one. After 3 months of treatment, hemoglobin concentration increased 3.2 ± 1.2 g/dl compared to pretreatment. Among the three transfusion-dependent patients, transfusion was terminated after one month of treatment in one patient and decreased >50% in the other two patients, accompanied by an increase in the average hemoglobin concentration. Thalidomide had a significant effect in patients with thalassemia intermedia. Further studies of a larger scale and more rigorous design are warranted.
Hepcidin suppression in β-thalassemia is associated with the down-regulation of atonal homolog 8.
Upanan, Supranee; McKie, Andrew T; Latunde-Dada, Gladys O; Roytrakul, Sittiruk; Uthaipibull, Chairat; Pothacharoen, Peraphan; Kongtawelert, Prachya; Fucharoen, Suthat; Srichairatanakool, Somdet
2017-08-01
Atonal homolog 8 (ATOH8) is defined as a positive regulator of hepcidin transcription, which links erythropoietic activity with iron-sensing molecules. In the present study, we investigated the association between hepcidin and ATOH8 expression in β-thalassemia. We found that inhibition of hepcidin expression in β-thalassemia is correlated with reduced ATOH8 expression. Hepatic hepcidin 1 (Hamp1) and Atoh8 mRNA expression were down-regulated in β-thalassemic mice. Hepcidin (HAMP) and ATOH8 mRNA expression were consistently suppressed in Huh7 cells cultured in medium supplemented with β-thalassemia patient serum. The Huh7 cells, which were transfected with ATOH8-FLAG expression plasmid and cultured in the supplemented medium, exhibited increased levels of ATOH8 mRNA, ATOH8-FLAG protein, pSMAD1,5,8, and HAMP mRNA. Interestingly, over-expression of ATOH8 reversed the effects of hepcidin suppression induced by the β-thalassemia patient sera. In conclusion, hepcidin suppression in β-thalassemia is associated with the down-regulation of ATOH8 in response to anemia. We, therefore, suggest that ATOH8 is an important transcriptional regulator of hepcidin in β-thalassemia.
Urrechaga, Eloísa; Hoffmann, Johannes J M L
2017-08-28
Many discriminant formulas have been reported for distinguishing thalassemia trait from iron deficiency in patients with microcytic anemia. Independent verification of several discriminant formulas is deficient or even lacking. Therefore, we have retrospectively investigated discriminant formulas in a large, well-characterized patient population. The investigational population consisted of 2664 patients with microcytic anemia: 1259 had iron deficiency, 1196 'pure' thalassemia trait (877 β- and 319 α-thalassemia), 150 had thalassemia trait with concomitant iron deficiency or anemia of chronic disease, and 36 had other diseases. We investigated 25 discriminant formulas that only use hematologic parameters available on all analyzers; formulas with more advanced parameters were disregarded. The diagnostic performance was investigated using ROC analysis. The three best performing formulas were the Jayabose (RDW index), Janel (11T), and Green and King formulas. The differences between them were not statistically significant (p>0.333), but each of them had significantly higher area under the ROC curve than any other formula. The Jayabose and Green and King formulas had the highest sensitivities: 0.917 both. The highest specificity, 0.925, was found for the Janel formula, which is a composite score of 11 other formulas. All investigated formulas performed significantly better in distinguishing β- than α-thalassemia from iron deficiency. In our patient population, the Jayabose RDW index, the Green and King formula and the Janel 11T score are superior to all other formulas examined for distinguishing between thalassemia trait and iron deficiency anemia. We confirmed that all formulas perform much better in β- than in α-thalassemia carriers and also that they incorrectly classify approximately 30% of thalassemia carriers with concomitant other anemia as not having thalassemia. The diagnostic performance of even the best formulas is not high enough for making a final
Tawfik, Safaa; El Koofy, Nehal; Moawad, Eman Mohamed Ibraheim
2016-01-01
The aim of this study was to investigate the pattern of basic and sport nutrition as well as perspectives of young Egyptian athletes. Structured interview survey measuring knowledge, attitudes, beliefs and behaviors about basic and sport nutrition was administered to adolescent athletes recruited from 4 sport clubs and 2 fitness centers in Greater Cairo governorate. A total of 358 participants aged 13–18 years completed questionnaires. Basic nutrition knowledge was reasonable in almost all domains except fast food. Fixed breakfast (78.5%), home meals (lunch, 70.7%), and healthy snacks (55.8%) were the most positive features of the basic dietary pattern. More than 70% perceived themselves as knowledgeable about sport nutrition. The prevalence rate of sport supplement intake was (48.9%, n = 175), predominantly sport drinks (66.9%) and creatine (54.3%). Coaches were the primary source of sport nutrition information. Forty-four percent of participants (n = 77/175) reported supplement consumption during competition seasons only. Better physical appearance and enhancement of athletic performance were the major motivations for supplement intake. These findings indicate the necessity of a comprehensive nutrition education program targeting not only athletes and parents, but also coaching staff, health trainers and all sport team officials. PMID:27529492
Atherosclerosis in ancient and modern Egyptians: the Horus study.
Allam, Adel H; Mandour Ali, Mohamed A; Wann, L Samuel; Thompson, Randall C; Sutherland, M Linda; Sutherland, James D; Frohlich, Bruno; Michalik, David E; Zink, Albert; Lombardi, Guido P; Watson, Lucia; Cox, Samantha L; Finch, Caleb E; Miyamoto, Michael I; Sallam, Sallam L; Narula, Jagat; Thomas, Gregory S
2014-06-01
Although atherosclerosis is usually thought of as a disease of modernity, the Horus Team has previously reported atherosclerotic vascular calcifications on computed tomographic (CT) scans in ancient Egyptians. The purpose of this study was to compare patterns and demographic characteristics of this disease among Egyptians from ancient and modern eras. We compared the presence and extent of vascular calcifications from whole-body CT scans performed on 178 modern Egyptians from Cairo undergoing positron emission tomography (PET)/CT for cancer staging to CT scans of 76 Egyptian mummies (3100 bce to 364 ce). The mean age of the modern Egyptian group was 52.3 ± 15 years (range 14 to 84) versus estimated age at death of ancient Egyptian mummies 36.5 ± 13 years (range 4 to 60); p < 0.0001. Vascular calcification was detected in 108 of 178 (60.7%) of modern patients versus 26 of 76 (38.2%) of mummies, p < 0.001. Vascular calcifications on CT strongly correlated to age in both groups. In addition, the severity of disease by number of involved arterial beds also correlated to age, and there was a very similar pattern between the 2 groups. Calcifications in both modern and ancient Egyptians were seen peripherally in aortoiliac beds almost a decade earlier than in event-related beds (coronary and carotid). The presence and severity of atherosclerotic vascular disease correlates strongly to age in both ancient and modern Egyptians. There is a striking correlation in the distribution of the number of vascular beds involved. Atherosclerotic calcifications are seen in the aortoiliac beds almost a decade earlier than in the coronary and carotid beds. Copyright © 2014. Published by Elsevier B.V.
Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.
Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R
2017-01-01
Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.
Turn-of-the-Century Egyptian School Days.
ERIC Educational Resources Information Center
Reid, Donald M.
1983-01-01
Traces the evolution of Egyptian government secondary schools from the 1880s to the 1920s, showing how their austerity and elitism declined after 1906 and analyzing the interaction of Egyptian, English, and French educational traditions. Explains how the secondary school environment shaped Egypt's political, cultural, and professional leaders…
McGovern, Patrick E.; Mirzoian, Armen; Hall, Gretchen R.
2009-01-01
Chemical analyses of ancient organics absorbed into pottery jars from the beginning of advanced ancient Egyptian culture, ca. 3150 B.C., and continuing for millennia have revealed that a range of natural products—specifically, herbs and tree resins—were dispensed by grape wine. These findings provide chemical evidence for ancient Egyptian organic medicinal remedies, previously only ambiguously documented in medical papyri dating back to ca. 1850 B.C. They illustrate how humans around the world, probably for millions of years, have exploited their natural environments for effective plant remedies, whose active compounds have recently begun to be isolated by modern analytical techniques. PMID:19365069
X-ray scattering signatures of β-thalassemia
NASA Astrophysics Data System (ADS)
Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.
2009-08-01
X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.
Elalfy, M S; Aly, R H; Azzam, H; Aboelftouh, K; Shatla, R H; Tarif, M; Abdatty, M; Elsayed, R M
2017-12-01
To evaluate the impact of iron chelating drugs and serum ferritin on the neurocognitive functions of patients with β thalassemia major (β-TM), using psychometric, neurophysiologic and radiologic tests. Eighty children with β-TM were enrolled into the study and were compared to 40 healthy controls. All participants were evaluated by measuring serum ferritin, neurocognitive assessment by Benton Visual Retention Test, Wechsler Intelligence Scale for Children, Wisconsin Card Sort Test, P300 and magnetic resonance spectroscopy (MRS). WISC in our study showed that 40% of cases were borderline mental function as regards total IQ. Neurophysiologic tests were significantly impaired in patients compared to control group, with significant impairment in those receiving desferrioxamine (DFO). P300 amplitude was significantly lower in cases compared to controls (2.24 and 4.66 uv, respectively), recording the shortest amplitude in patients receiving DFO. Altered metabolic markers in the brain were detected by MRS in the form of reduced N-acetylaspartate to creatine ratio in 78.3% of our cases. There were significant correlations between psychometric tests and both neurophysiologic (P300) and radiologic (MRS) tests. β-TM is associated with neurocognitive impairment that can be assessed by psychometric, neurophysiologic and radiologic tests. The role of hemosiderosis and iron chelation therapy on cognitive functioning still need more research. β-TM: beta thalassemia major; DFO: Dysferal; DFP: Deferiprone; DFX: Deferasirox; WISC: Wechsler Intelligence Scale for Children; VIQ: verbal IQ; PIQ: performance IQ; TIQ: total IQ; BVRT: Benton Visual Retention Test; WCST: Wisconsin Card Sort Test; MRS: Magnetic resonant spectroscopy; NAA/Cr ratio: N-acetylaspartate to creatine ratio.
Fetal hemoglobin regulation in β-thalassemia: heterogeneity, modifiers and therapeutic approaches.
Sripichai, Orapan; Fucharoen, Suthat
2016-12-01
Stress erythropoiesis induces fetal hemoglobin (HbF) expression in β-thalassemias, however the level of expression is highly variable. The last decade has seen dramatic advances in our understanding of the molecular regulators of HbF production and the genetic factors associated with HbF levels, leading to the promise of new methods of the clinical induction of HbF. Areas covered: This article will review the heterogeneity and genetic modifiers of HbF and HbF induction therapy in β-thalassemia. Expert commentary: One promising curative β-thalassemia therapy is to induce HbF synthesis in β-thalassemic erythrocytes to therapeutic levels before clinical symptom occurs. Further understanding of HbF level variation and regulation is needed in order to predict the response from HbF-inducing approaches.
Dasanu, Constantin A
2010-01-01
Inherited alpha-thalassemia genotypes have been shown to have a rather high prevalence in some patient populations of African heritage. These genotypes lead to mild anemia with microcytic indices and a normal hemoglobin electrophoresis. In our outpatient department, we analyzed 54 consecutive patients of African descent with longstanding microcytic anemia, but no evidence of iron deficiency. We detected alpha-thalassemia gene deletions in 94 percent of these patients. Alpha-thalassemia genetic testing appears cost-effective in an otherwise unexplained, longstanding microcytic anemia in patients of African origin.
Extraordinarily Egyptian Jewelry Fit for a Pharaoh.
ERIC Educational Resources Information Center
Patterson, Berniece
1999-01-01
Presents an art lesson for sixth-grade students in which the students study the Egyptians' jewelry techniques and designs and create their own amulets. Provides background information on the importance of life after death to the Egyptians and how religion influenced the designing of their amulets. Describes the jewelry-making procedure. (CMK)
Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R
2017-09-04
β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.
Accreditation and Quality Assurance in the Egyptian Higher Education System
ERIC Educational Resources Information Center
Schomaker, Rahel
2015-01-01
Purpose: This study aims to analyze the quality of the Egyptian accreditation system. With a view on the high competition in the domestic labor market as well as with regards to the international competitiveness of Egyptian graduates and the potential role of Egyptian universities in the international market for higher education, a high quality of…
Yu, Luxin; Wu, Wei; Lie, Puchang; Liu, Yunhua; Zeng, Lingwen
2013-11-01
A rapid and reliable screening test for thalassemia carrier couples is the most effective strategy to decrease the risk of conceiving fetuses with severe thalassemia. We present an approach based on the isothermal strand-displacement polymerase reaction and the use of a lateral flow strip for the visual detection of an α-thalassemia Southeast Asian-type deletion. This assay was used to evaluate 86 clinical samples (72 cases of Southeast Asian-type deletions and 14 cases of other types of thalassemia), and the results obtained were 100% consistent with those obtained using conventional gap-PCR. The approach thus provides a simple, sensitive, rapid, and cost-effective method for the diagnosis of thalassemia genotypes. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Mohanty, D; Colah, R B; Gorakshakar, A C; Patel, R Z; Master, D C; Mahanta, J; Sharma, S K; Chaudhari, U; Ghosh, M; Das, S; Britt, R P; Singh, S; Ross, C; Jagannathan, L; Kaul, R; Shukla, D K; Muthuswamy, V
2013-01-01
The population of India is extremely diverse comprising of more than 3,000 ethnic groups who still follow endogamy. Haemoglobinopathies are the commonest hereditary disorders in India and pose a major health problem. The data on the prevalence of β-thalassemias and other haemoglobinopathies in different caste/ethnic groups of India is scarce. Therefore the present multicentre study was undertaken in six cities of six states of India (Maharashtra, Gujarat, West Bengal, Assam, Karnataka and Punjab) to determine the prevalence of haemoglobinopathies in different caste/ethnic groups using uniform methodology. Fifty-six thousand seven hundred eighty individuals (college students and pregnant women) from different caste/ethnic groups were screened. RBC indices were measured on an automated haematology counter while the percentage of HbA(2), HbF and other abnormal Hb variants were estimated by HPLC on the Variant Hemoglobin Testing System. The overall prevalence of β-thalassemia trait was 2.78 % and varied from 1.48 to 3.64 % in different states, while the prevalence of β-thalassemia trait in 59 ethnic groups varied from 0 to 9.3 %. HbE trait was mainly seen in Dibrugarh in Assam (23.9 %) and Kolkata in West Bengal (3.92 %). In six ethnic groups from Assam, the prevalence of HbE trait varied from 41.1 to 66.7 %. Few subjects with δβ-thalassemia, HPFH, HbS trait, HbD trait, HbE homozygous and HbE β-thalassemia as well as HbS homozygous and HbS-β-thalassemia (<1 %) were also identified. This is the first large multicentre study covering cities from different regions of the country for screening for β-thalassemia carriers and other haemoglobinopathies where uniform protocols and methodology was followed and quality control ensured by the co-ordinating centre. This study also shows that establishment of centres for screening for β-thalassemia and other haemoglobinopathies is possible in medical colleges. Creating awareness, screening and counselling can be
Rivella, Stefano
2011-01-01
β-thalassemia is a disease characterized by anemia and is associated with ineffective erythropoiesis and iron dysregulation resulting in iron overload. The peptide hormone hepcidin regulates iron metabolism, and insufficient hepcidin synthesis is responsible for iron overload in minimally transfused patients with this disease. Understanding the crosstalk between erythropoiesis and iron metabolism is an area of active investigation in which patients with and models of β-thalassemia have provided significant insight. The dependence of erythropoiesis on iron presupposes that iron demand for hemoglobin synthesis is involved in the regulation of iron metabolism. Major advances have been made in understanding iron availability for erythropoiesis and its dysregulation in β-thalassemia. In this review, we describe the clinical characteristics and current therapeutic standard in β-thalassemia, explore the definition of ineffective erythropoiesis, and discuss its role in hepcidin regulation. In preclinical experiments using interventions such as transferrin, hepcidin agonists, and JAK2 inhibitors, we provide evidence of potential new treatment alternatives that elucidate mechanisms by which expanded or ineffective erythropoiesis may regulate iron supply, distribution, and utilization in diseases such as β-thalassemia. PMID:21768301
Molecular characterization of eimeria species naturally infecting egyptian baldi chickens.
Gadelhaq, Sahar M; Arafa, Waleed M; Aboelhadid, Shawky M
2015-01-01
Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens.
Molecular Characterization of Eimeria Species Naturally Infecting Egyptian Baldi Chickens
GADELHAQ, Sahar M; ARAFA, Waleed M; ABOELHADID, Shawky M
2015-01-01
Background: Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Methods: Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. Results: The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. Conclusion: This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens. PMID:25904950
Rakholia, R; Chaturvedi, P
2013-01-01
To determine the prevalence of β thalassemia in Sindhi community of Wardha and evaluation of risk factors. To give genetic counseling to those diagnosed as carriers. Cross-sectional (prevalence study). Sindhi community residing in and around Wardha. 18 months. A total of 578 individuals belonging to Sindhi community residing in and around Wardha in India were selected by systemic randomization. Those who fulfilled the inclusion criteria and voluntarily gave consent were subject to Naked Eye Single Tube Rapid Osmotic Fragility Test (Nestroft). Those found positive by Nestroft were labeled carriers and advised to undergo Hemoglobin A 2 (HbA 2 ) quantification for confirmation of carrier status. Carriers thus identified were given genetic counseling. The mean age of study population was 15.06 years with a range of 3-28 years. The largest group consisted of those between 12 and 18 years. The prevalence of β thalassemia carrier state as diagnosed by Nestroft is 36.36% (200/550) and incidence of carrier state by HbA 2 quantification in the study population was 17.2% (95/550). Prevalence of β thalassemia in the Sindhi community of Wardha is higher than in other studies and equal to the highest prevalent communities in India. Thus, we recommend that urgent measures to increase awareness and control the disease be taken.
Senol, Sefika Pinar; Tiftik, Eyup Naci; Unal, Selma; Akdeniz, Aydan; Tasdelen, Bahar; Tunctan, Bahar
2016-03-01
There is a need to remove excess iron with iron chelation therapy (ICT) to avoid the serious clinical sequelae associated with iron overload in patients with beta thalassemia major (BTM) and sickle cell anemia (SCA). Due to the effects of the diseases and their treatments, ICT is still a major reason for unsatisfactory compliance. The aim of this single-center observational study was to evaluate the quality of life, clinical effectiveness, and satisfaction in pediatric and adult patients with BTM and SCA receiving deferasirox (DFX) chelation therapy. In this study, 37 pediatric and 35 adult patients with BTM or SCA receiving DFX for at least 6 months participated. Upon receipt of Informed Consent Form, Case Report Form, Demographic Data Collection Form, Child Health Questionnaire-Parent Form, Life Quality Survey Short Form-36, and ICT Satisfaction Survey were used to obtain data for the effectiveness of ICT and parameters that may affect compliance to treatment and life quality of the participants. As a main index for the effectiveness of DFX chelation therapy, serum ferritin levels were higher than the normal values in the patients receiving DFX. The increased ferritin levels were also associated with hematological and biochemical abnormalities. Our findings regarding quality of life and satisfaction with DFX chelation therapy indicated that the patients with BTM or SCA had lower scores. Overall, problems with treatment regimen and side effects appeared to be common causes of poor compliance to DFX chelation therapy. Our findings suggest that health care providers should be aware of the importance of monitoring iron load with timely initiation of DFX chelation therapy and ongoing adjustments to chelation regimens and/or transfusion methods to decrease hospitalizations and improve compliance to ICT of the patients with BTM and SCA.
Facts about Sickle Cell Disease
... from many parts of the world? HbS beta thalassemia People who have this form of SCD inherit ... from one parent and one gene for beta thalassemia, another type of anemia, from the other parent. ...
Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.
Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R
2016-03-01
Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.
Sulovska, Lucie; Holub, Dusan; Zidova, Zuzana; Divoka, Martina; Hajduch, Marian; Mihal, Vladimir; Vrbkova, Jana; Horvathova, Monika; Pospisilova, Dagmar
2016-06-01
Erythropoiesis is closely related to iron metabolism in a balanced homeostasis. Analyses of diverse erythroid and iron metabolism disorders have shown that disrupted erythropoiesis negatively affects iron homeostasis and vice versa. The aim of this study was to characterize the relationship between erythropoietic activity and iron homeostasis in pediatric patients with erythrocyte membrane defects and thalassemia traits. Selected markers of erythropoietic activity (erythropoietin, soluble transferrin receptor - sTfR and growth differentiation factor 15) and iron status parameters (serum iron, ferritin and hepcidin) were evaluated in pediatric patients with erythrocyte membrane defects and thalassemia traits. The patients with erythrocyte membrane defects and thalassemia traits had altered iron homeostasis due to disturbed erythropoiesis. In comparison with healthy controls, they had a normal to low hepcidin/ferritin ratio and concomitantly elevated sTfR. The findings suggest that pediatric patients with erythrocyte membrane defects and thalassemia traits are more susceptible to iron overload than the general population and that the (hepcidin/ferritin)/sTfR ratio can be used to monitor any worsening of the disease.
Neufeld, Ellis J.
2006-01-01
For nearly 30 years, patients with transfusional iron overload have depended on nightly deferoxamine infusions for iron chelation. Despite dramatic gains in life expectancy in the deferoxamine era for patients with transfusion-dependent anemias, the leading cause of death for young adults with thalassemia major and related disorders has been cardiac disease from myocardial iron deposition. Strategies to reduce cardiac disease by improving chelation regimens have been of the highest priority. These strategies have included development of novel oral iron chelators to improve compliance, improved assessment of cardiac iron status, and careful epidemiologic assessment of European outcomes with deferiprone, an oral alternative chelator available for about a decade. Each of these strategies is now bearing fruit. The novel oral chelator deferasirox was recently approved by the Food and Drug Administration (FDA); a randomized clinical trial demonstrates that deferasirox at 20 to 30 mg/kg/d can maintain or improve hepatic iron in thalassemia as well as deferoxamine. A randomized trial based on cardiac T2* magnetic resonance imaging (MRI) suggests that deferiprone can unload myocardial iron faster than deferoxamine. Retrospective epidemiologic data suggest dramatic reductions in cardiac events and mortality in Italian subjects exposed to deferiprone compared with deferoxamine. These developments herald a new era for iron chelation, but many unanswered questions remain. PMID:16627763
Prevention of β Thalassemia in Northern Israel - a Cost-Benefit Analysis
Koren, Ariel; Profeta, Lora; Zalman, Luci; Palmor, Haya; Levin, Carina; Zamir, Ronit Bril; Shalev, Stavit; Blondheim, Orna
2014-01-01
Background β Thalassemia major is characterized by hemolytic anemia, ineffective erythropoiesis and hemosiderosis. About 4% of the world population carries a Thalassemia gene. Management includes blood transfusions and iron chelation. However, this treatment is costly, and population screening may be significantly more cost beneficial. Purpose The purpose of the current study is to analyze the cost of running a prevention program for β Thalassemia in Israel and to compare it to the actual expenses incurred by treating Thalassemia patients. Methods Three cost parameters were analyzed and compared: the prevention program, routine treatment of patients and treatment of complications. An estimation of the expenses needed to treat patients who present with complications was calculated based on our ongoing experience in treating deteriorating patients. Results and Conclusions The cost of preventing one affected newborn was $63,660 compared to $1,971,380 for treatment of a patient during 50 years (mean annual cost: $39,427). Thus, the prevention of 45 affected newborns over a ten year period represents a net saving of $88.5 million to the health budget. Even after deducting the cost of the prevention program ($413.795/year), the program still represents a benefit of $76 million over ten years. Each prevented case could pay the screening and prevention program for 4.6 years. PMID:24678389
Plasma microRNA-451 as a novel hemolytic marker for β0-thalassemia/HbE disease
Leecharoenkiat, Kamonlak; Tanaka, Yuka; Harada, Yasuko; Chaichompoo, Porntip; Sarakul, Orawan; Abe, Yasunobu; Smith, Duncan Richard; Fucharoen, Suthat; Svasti, Saovaros; Umemura, Tsukuru
2017-01-01
In Southeast Asia, particularly in Thailand, β0-thalassemia/hemoglobin E (HbE) disease is a common hereditary hematological disease. It is associated with pathophysiological processes, such as the intramedullary destruction of immature erythroid cells and peripheral hemolysis of mature red blood cells. MicroRNA (miR) sequences, which are short non-coding RNA that regulate gene expression in a suppressive manner, serve a crucial role in human erythropoiesis. In the present study, the plasma levels of the erythroid-expressed miRNAs, miR-451 and miR-155, were analyzed in 23 patients with β0-thalassemia/HbE and 16 control subjects. Reverse transcription-quantitative polymerase chain reaction analysis revealed significantly higher levels of plasma miR-451 and miR-155 in β0-thalassemia/HbE patients when compared to the control subjects. Notably, among the β0-thalassemia/HbE patients, a significant increase in miR-451 levels was detected in severe cases when compared with mild cases. The levels of plasma miR-451 correlated with reticulocyte and platelet counts. The results suggest that increased plasma miR-451 levels may be associated with the degree of hemolysis and accelerated erythropoiesis in β0-thalassemia/HbE patients. In conclusion, miR-451 may represent a relevant biomarker for pathological erythropoiesis associated with β0-thalassemia/HbE. PMID:28447765
Lin, Chung-King; Chen, Ling-Ping; Chang, Hsiu-Lin; Sung, Yung-Chuan
2014-08-01
Some physicians neglect the possible coexistence of an iron deficiency with a thalassemia minor and do not treat the iron deficiency accordingly. This motivated us to conduct this study. We retrospectively reviewed the records of 3892 patients who visited our clinics and had hemoglobin (Hb) electrophoreses performed in our hematologic laboratory from August 1, 2007 to December 31, 2012. The thalassemia minors were identified by characteristic complete blood count (CBC) parameters obtained from an autoanalyzer and Hb electrophoresis, and some cases were confirmed with molecular tests. Then, we checked iron studies [ferritin and/or serum iron with total iron-binding capacity (TIBC)] to determine the coexistence of an iron deficiency with a thalassemia minor and a response to iron, if such treatments were given. We found 792 cases with thalassemia minors, and excluded those without iron studies, with 661 cases as our sample. A total of 202/661 cases (31%) also had iron deficiencies. They had lower red blood cell (RBC) counts, Hb, and ferritin levels as compared to those thalassemia minor cases without coexistence of iron deficiencies. We concluded that the thalassemia minor patients did not have iron overload complications in our population. On the contrary, iron deficiencies commonly coexist in the clinical visits. We propose that if Hb < 11.5 g/dL in a case of thalassemia minor, one should screen for iron deficiency simultaneously. The sensitivity is 79.8% and the specificity is 82.6%. Therefore, physicians should be aware of this coexisting condition, and know how to recognize and treat it accordingly. Copyright © 2014. Published by Elsevier B.V.
Platania, Silvia; Gruttadauria, Stefania; Citelli, Giulia; Giambrone, Loris; Di Nuovo, Santo
2017-01-01
The present research analyzed the elements of thalassemia which affect the patient’s perceived quality of life. Three hundred patients with Thalassemia Major (males = 165, 55%; females = 135, 45%; Mage = 36.13, standard deviation = 8.54) were the sample. Analysis of multiple mediations revealed a direct effect of self-efficacy on the Satisfaction with Life Scale that is mediated only by social support.The findings suggest a need to accentuate help and support to patients with Thalassemia Major. PMID:29379628
Coinheritance of hemoglobin D-Punjab and β0-thalassemia 3.4 kb deletion in a Thai girl
Panyasai, Sitthichai; Rahad, Sarinna; Pornprasert, Sakorn
2017-01-01
Hemoglobin (Hb) D. Punjab [β121(GH4) Glu→Gln; HBB: C.364G>C] and β0-thalassemia 3.4 kb deletion are very rare in the Thai population. For the first time, the coinheritance of HbD-Punjab with β0-thalassemia 3.4 kb deletion was reported in a 7-year-old Thai girl. She had mild anemia (Hb 115.0 g/L and mean corpuscular hemoglobin 18.1 pg) with red blood cell microcytosis (mean corpuscular volume 52.5 fL). By capillary electrophoresis (CE), HbD-Punjab was found at a migration position of 180 s with the value of 81.9% while the level of HbA2 was 7.3%. Based on the elevated HbA2, the molecular analysis for detection of β0-thalassemia mutations was performed. The 490 bp amplified fragments from β0-thalassemia 3.4 kb deletion was observed. Thus, the coinheritance of HbD-Punjab with β0-thalassemia can be found in the Thai population. The HbA2 measured on CE is a reliable parameter for differentiating the homozygote of HbD-Punjab and compound heterozygote of HbD-Punjab and β0-thalassemia. PMID:28970692
Assessment of pubertal development in Egyptian girls.
Hosny, Laila A; El-Ruby, Mona O; Zaki, Moushira E; Aglan, Mona S; Zaki, Maha S; El Gammal, Mona A; Mazen, Inas M
2005-06-01
Puberty is a significant event of human growth and maturation associated with marked physiological and psychological changes. The aim of this study was to assess normal pubertal development in Egyptian girls to define normal, precocious and delayed puberty. The present study included a cross-sectional sample of 1,550 normal Egyptian girls of high and middle socioeconomic class living in Cairo. Their ages ranged from 6.5 to 18.5 years. Pubertal assessment was made according to Tanner staging. The mean menarcheal age (MMA) was estimated using probit analysis. Weight and height were measured and body mass index (BMI) was calculated. The mean age at breast bud stage (B2) was 10.71+/-1.6, pubic hair stage (PH2) was 10.46+/-1.36, while axillary hair stage (A2) was 11.65+/-1.62 and MMA was 12.44 years. The mean age at attainment of puberty was compared with those of other Egyptian studies and other populations. Girls of the present study started pubertal development and achieved menarche earlier than those of previous Egyptian studies confirming a secular trend. Differences between the present study and other worldwide studies can be attributed to various genetic, racial, geographical, nutritional, and secular trend factors.
Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina
2015-01-01
The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435
Thongnoppakhun, Wanna; Jiemsup, Surasak; Yongkiettrakul, Suganya; Kanjanakorn, Chompunut; Limwongse, Chanin; Wilairat, Prapon; Vanasant, Anusorn; Rungroj, Nanyawan; Yenchitsomanus, Pa-Thai
2009-07-01
A number of common mutations in the hemoglobin beta (HBB) gene cause beta-thalassemia, a monogenic disease with high prevalence in certain ethnic groups. As there are 30 HBB variants that cover more than 99.5% of HBB mutant alleles in the Thai population, an efficient and cost-effective screening method is required. Three panels of multiplex primer extensions, followed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry were developed. The first panel simultaneously detected 21 of the most common HBB mutations, while the second panel screened nine additional mutations, plus seven of the first panel for confirmation; the third panel was used to confirm three HBB mutations, yielding a 9-Da mass difference that could not be clearly distinguished by the previous two panels. The protocol was both standardized using 40 samples of known genotypes and subsequently validated in 162 blind samples with 27 different genotypes (including a normal control), comprising heterozygous, compound heterozygous, and homozygous beta-thalassemia. Results were in complete agreement with those from the genotyping results, conducted using three different methods overall. The method developed here permitted the detection of mutations missed using a single genotyping procedure. The procedure should serve as the method of choice for HBB genotyping due to its accuracy, sensitivity, and cost-effectiveness, and can be applied to studies of other gene variants that are potential disease biomarkers.
Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida
2013-06-01
Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.
Preventing thalassemia in Lebanon: successes and challenges in a developing country.
Abi Saad, Michele; Haddad, Anthony G; Alam, Elie S; Aoun, Sanaa; Maatouk, Pascale; Ajami, Najat; Khairallah, Therese; Koussa, Suzanne; Musallam, Khaled M; Taher, Ali T
2014-01-01
Thalassemia continues to be a major health burden. The chronicity of the disease and the high cost of life-long treatment make prevention strategies crucial in the management of this disease. In this article, we revisit different successful prevention strategies, and underline the Lebanese model. The Chronic Care Center (CCC), Beirut, is the only specialized center in Lebanon for the treatment and prevention of thalassemia. The current number of patients registered up to August 2013 was 724, representing cases from all over Lebanon. In 1994, the center launched a national prevention program following the World Health Organization (WHO) recommendations. The major activities of the program include awareness campaigns, screening for thalassemia carriers in the general population and high risk groups, registry of new cases and follow-up on the mandatory premarital law (established at the same time). Screening programs showed a carrier rate of around 2.3% in the general population, and 4.0-41.0% in high risk groups. The major pitfall in the law is that only persons with a mean corpuscular volume (MCV) of >70.0 fL are asked to perform further hemoglobin (Hb) testing. A significant decrease in the number of new cases of thalassemia patients in Lebanon reflects the efforts deployed in the prevention of the disease. However, some limitations are faced in reaching a complete eradication of the disease, mainly due to the fact that abortion is illegal and due to pitfalls and incorrect implementation of the premarital law.
Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia.
Thompson, Alexis A; Walters, Mark C; Kwiatkowski, Janet; Rasko, John E J; Ribeil, Jean-Antoine; Hongeng, Suradej; Magrin, Elisa; Schiller, Gary J; Payen, Emmanuel; Semeraro, Michaela; Moshous, Despina; Lefrere, Francois; Puy, Hervé; Bourget, Philippe; Magnani, Alessandra; Caccavelli, Laure; Diana, Jean-Sébastien; Suarez, Felipe; Monpoux, Fabrice; Brousse, Valentine; Poirot, Catherine; Brouzes, Chantal; Meritet, Jean-François; Pondarré, Corinne; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Teachey, David T; Anurathapan, Usanarat; Ho, P Joy; von Kalle, Christof; Kletzel, Morris; Vichinsky, Elliott; Soni, Sandeep; Veres, Gabor; Negre, Olivier; Ross, Robert W; Davidson, David; Petrusich, Alexandria; Sandler, Laura; Asmal, Mohammed; Hermine, Olivier; De Montalembert, Mariane; Hacein-Bey-Abina, Salima; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina
2018-04-19
Donor availability and transplantation-related risks limit the broad use of allogeneic hematopoietic-cell transplantation in patients with transfusion-dependent β-thalassemia. After previously establishing that lentiviral transfer of a marked β-globin (β A-T87Q ) gene could substitute for long-term red-cell transfusions in a patient with β-thalassemia, we wanted to evaluate the safety and efficacy of such gene therapy in patients with transfusion-dependent β-thalassemia. In two phase 1-2 studies, we obtained mobilized autologous CD34+ cells from 22 patients (12 to 35 years of age) with transfusion-dependent β-thalassemia and transduced the cells ex vivo with LentiGlobin BB305 vector, which encodes adult hemoglobin (HbA) with a T87Q amino acid substitution (HbA T87Q ). The cells were then reinfused after the patients had undergone myeloablative busulfan conditioning. We subsequently monitored adverse events, vector integration, and levels of replication-competent lentivirus. Efficacy assessments included levels of total hemoglobin and HbA T87Q , transfusion requirements, and average vector copy number. At a median of 26 months (range, 15 to 42) after infusion of the gene-modified cells, all but 1 of the 13 patients who had a non-β 0 /β 0 genotype had stopped receiving red-cell transfusions; the levels of HbA T87Q ranged from 3.4 to 10.0 g per deciliter, and the levels of total hemoglobin ranged from 8.2 to 13.7 g per deciliter. Correction of biologic markers of dyserythropoiesis was achieved in evaluated patients with hemoglobin levels near normal ranges. In 9 patients with a β 0 /β 0 genotype or two copies of the IVS1-110 mutation, the median annualized transfusion volume was decreased by 73%, and red-cell transfusions were discontinued in 3 patients. Treatment-related adverse events were typical of those associated with autologous stem-cell transplantation. No clonal dominance related to vector integration was observed. Gene therapy with autologous CD34
Liem, Robert I; Gilgour, Brynnan; Pelligra, Stephanie A; Mason, Maryann; Thompson, Alexis A
2011-01-01
To describe the challenges, including sociocultural and socioeconomic barriers, faced by an urban immigrant population in the United States affected by thalassemia major. Ethnographic, semi-structured, 1-on-1 interviews using an interview guide developed for this study. Digital recordings were transcribed and data analyzed using constant comparative method. University-based, Comprehensive Thalassemia Program at Children's Memorial Hospital, Chicago, IL, USA. Fourteen Southeast Asian and Asian Indian parents of children with transfusion dependent thalassemia. Qualitative descriptions of parental experiences, frequency of codes applied to interviews and emergent themes. Thalassemia has its greatest impact on the emotional and social well-being of affected children and their parents. Current and future concerns were related to disease-specific complications and challenges with management such as transfusions and chelation therapy. These perceptions were tied to parental hope for a cure, a frequently coded coping mechanism. Despite their availability, few parents relied on support systems beyond immediate family members due to perceived public knowledge gaps about thalassemia. Culturally based past experiences and barriers did not emerge as dominant themes in our analysis. The impact of thalassemia is tremendous for affected children and their parents and is due more to factors that were either disease-specific or common to other chronic disease models rather than those influenced by culture. The unmet needs of these families require additional investigation to facilitate the development of initiatives aimed at improving quality of life and lessening overall impact of thalassemia
Zhang, Jie; He, Jing; Zeng, Xiao-Hong; Su, Jie; Chen, Hong; Xu, Yong-Mei; Pu, Jian; Zhu, Bao-Sheng
2016-02-01
To investigate the gene mutation spectrum of β-thalassemia in Dai ethnic population of 2 border region in Chinese Yunnan Province. The patients with β-thalassemia in Dai ethnic population of Dehong and Xishuangbanna autonamic prefecture were screened by using blood routine detection and capillary electrophoresis. The β-globin gene mutation in patients with β-thalassemia were detected by using PCR reverse dot-blot hybridization (PCR-RDB), the constitutive rate of gene mutation in patients with β-thalassemia of Dai ethnic population in two border regions was analyzed and compared. A total of 186 patients with gene mutation of β-thalassemia were confirmed. Among them, 10 gene mutation were found, and the 5 main gene mutations were CD26 (62.56%), CD41-42 (18.97%), CD17 (14.36%), CD71-72 (2.05%) and IVS-II-654 (1.54%). Among Dai ethinic population in Dehong region, 4 gene mutations were found including CD26 (80.31%), CD17 (11.02%), CD41-42 (6.30%) and CD71-72 (2.36%). Among Dai ethinic population in Xishuangbanna region, 6 gene mutations were found, out of them the more common gene mutations were CD41-42 (42.64%), CD26 (29.41%) and CD17 (20.59%). The gene mutations of β-thalassemia in Dai ethinic population of Yunnan province has been confirmed to be more genetic heterogenicity, the spectrums of β-thalassemia mutations in Dai ethinic population of different regions were significant different.
Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor
2016-01-01
Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702
Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.
Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin
2017-08-01
Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.
Comparison of arch forms between Egyptian and North American white populations.
Bayome, Mohamed; Sameshima, Glenn T; Kim, Yoonji; Nojima, Kunihiko; Baek, Seung-Hak; Kook, Yoon-Ah
2011-03-01
The aim of this study was to evaluate the morphologic differences in the mandibular arches of Egyptian and North American white subjects. The sample included 94 Egyptian subjects (35 Class I, 32 Class II, and 27 Class III) and 92 white subjects (37 Class I, 29 Class II, and 26 Class III). The subjects were grouped according to arch form types (tapered, ovoid, and square) to compare their frequency distribution between ethnic groups in each Angle classification. The most facial portions of 13 proximal contact areas were digitized on scanned images of mandibular casts to estimate the corresponding clinical bracket point for each tooth. Four linear and 2 proportional measurements were taken. In comparing arch dimensions, intermolar width was narrower in Egyptians than in the whites (P = 0.001). There was an even frequency distribution of the 3 arch forms in the Egyptian group. On the other hand, the most frequent arch form was ovoid followed by tapered and square in the white group; the square arch form was significantly less frequent than the tapered and ovoid arch forms (P = 0.029). The arch forms of Egyptians are narrower than those of whites. The distribution of the arch form types in Egyptians showed similar frequency, but the square arch form was less frequent in whites. It is recommended to select narrower archwires from the available variations to suit many Egyptian patients. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
Marziali, Marco; Isgrò, Antonella; Gaziev, Javid; Lucarelli, Guido
2009-01-01
Hematopoietic stem cell transplantation (HSCT) still remains the only definitive cure currently available for patients with thalassemia and sickle cell anemia. Results of transplant in thalassemia and in sickle cell anemia have steadily improved over the last two decades due to improvements in preventive strategies, and effective control of transplant-related complications. From 2004 through 2009, 145 consecutive patients with thalassemia and sickle cell anemia, ethnically heterogeneous from Mediterranean and Middle East countries, were given HSCT in the International Center for Transplantation in Thalassemia and Sickle Cella Anemia in Rome. This experience is characterized by two peculiarities: patients were ethnically very heterogeneous and the vast majority of these patients were not regularly transfesed/chelated and therefore were highly sensitized due to RBC transfusions without leukodepletion filters. Consequently, they could have a high risk of graft rejection as a result of sensitization to HLA antigens. The Rome experience of SCT in patients with thalassemia and sickle cell anemia confirmed the results obtained in Pesaro, and most importantly showed the reproducibility of these results in other centers. PMID:21415995
Alizade, Hesam; Sharifi, Hamid; Naderi, Zahedeh; Ghanbarpour, Reza; Bamorovat, Mehdi; Aflatoonian, Mohammad Reza
This study was conducted on patients with thalassemia and HIV-infected patients to determine the frequency of diarrheagenic Escherichia coli in Kerman, Iran. We analyzed 68 and 49 E coli isolates isolated from healthy fecal samples of patients with thalassemia and HIV-infected patients, respectively. The E coli isolates were studied using a multiplex polymerase chain reaction to identify the enterotoxigenic E coli (ETEC), enterohemorrhagic E coli (EHEC), and enteropathogenic E coli (EPEC) groups. Statistical analysis was carried out to determine the correlation of diarrheagenic E coli between HIV-infected patients and patients with thalassemia using Stata 11.2 software. The frequency of having at least 1 diarrheagenic E coli was more common in patients with thalassemia (67.64%) than in HIV-infected patients (57.14%; P = .25), including ETEC (67.64% versus 57.14%), EHEC (33.82% versus 26.53%), and EPEC (19.11% versus 16.32%). The results of this study indicate that ETEC, EHEC, and EPEC pathotypes are widespread among diarrheagenic E coli isolates in patients with thalassemia and HIV-infected patients.
Cranial trepanation in The Egyptian.
Collado-Vázquez, S; Carrillo, J M
2014-09-01
Medicine and literature have been linked from ancient times; proof of this shown by the many doctors who have made contributions to literature and the many writers who have described medical activities and illnesses in their works. An example is The Egyptian, the book by Mika Waltari that provides a masterly narration of the protagonist's medical activity and describes the trepanation technique. The present work begins with the analysis of trepanations since prehistory and illustrates the practice of the trepanation in The Egyptian. The book mentions trepanation frequently and illustrates how to practice it and which instruments are required to perform it. Trepanation is one of the oldest surgical interventions carried out as treatment for cranial trauma and neurological diseases, but it also had the magical and religious purpose of expelling the evil spirits which caused the mental illness, epilepsy, or migraine symptoms. Trepanation is a surgical practice that has been carried out since prehistory to treat post-traumatic epilepsy, migraine, and psychiatric illness. The Egyptian is a book that illustrates the trepan, the trepanation technique, and the required set of instruments in full detail. Copyright © 2010 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.
Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan; Shirzad, Hedayatolah
2016-01-01
Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients.
Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan
2016-01-01
Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients. PMID:27095931
Rifampicin Serum Level in Egyptian Tuberculous Patients
1973-01-01
F-- 00 TECHNICAL/ SCIENTIFIC REPORT ~i2 17-75 IR FAM4PICIN SERUM LEVEL IN EGYPTIAN TUBERCULOUS PATIENTS By H.H. Youssef, J. SIppel, K. Sorensen...Best Avai~lable copy •vo Reprinted from Ain Shams Medical Journal Vol. 25, No. 1, January 1974 Rifampicin Serum Level in Egyptian Tuberculous Patients... Tuberculous Patients: Hassan Hosny Youssef,* J. Sippel,** K. Sorensen,** Isis A. Mikhail,** M. E. Mahmoud,+ A. El Maraghi,+ and Adly Robert ± of RMP serum
ERIC Educational Resources Information Center
Journal of College Science Teaching, 2005
2005-01-01
This brief article describes an archaeological expedition to the Red Sea coast area of Egypt in 2004. Kathryn Bard, an associate professor of archaeology at Boston University, along with her team, discovered the well-preserved cedar timbers of an ancient Egyptian seafaring vessel near the entrance to a large man-made cave. Limestone tablets with…
Occupational stress, anxiety and depression among Egyptian teachers.
Desouky, Dalia; Allam, Heba
2017-09-01
Occupational stress (OS) among teachers predispose to depression and anxiety. No study was done to assess these problems among Egyptian teachers. This study aimed to assess the prevalence of OS, depression and anxiety among Egyptian teachers. A cross sectional study was done on 568 Egyptian teachers. The respondents filled a questionnaire on personal data, and the Arabic version of the Occupational Stress Index (OSI), the Arabic validated versions of Taylor manifest anxiety scale and the Beck Depression Inventory (BDI) were used to assess OS, anxiety and depression respectively. The prevalence of OS, anxiety and depression among teachers was (100%, 67.5% and 23.2%) respectively. OS, anxiety and depression scores were significantly higher among teachers with an age more than 40years, female teachers, primary school teachers, those with inadequate salary, higher teaching experience, higher qualifications and higher workload. A significant weak positive correlation was found between OS scores and anxiety and depression scores. This study indicated the need for future researches to address risk factors of OS and mental disorders among Egyptian teachers, and the need of periodical medical evaluation of teachers and medical and psychological support for the identified cases. Copyright © 2017. Published by Elsevier Ltd.
Klotho, a new marker for osteoporosis and muscle strength in β-thalassemia major.
Baldan, Alessandro; Giusti, Andrea; Bosi, Cristina; Malaventura, Cristina; Musso, Marco; Forni, Gian Luca; Volpato, Stefano; Zuliani, Giovanni; Borgna-Pignatti, Caterina
2015-12-01
Aim of this study was to compare plasma levels of the secreted protein Klotho in β-thalassemia major patients and in healthy controls. Also, we examined the existence of correlations between the protein level and osteoporosis, poor muscle strength and fractures. A total of 106 patients with β-thalassemia major and 95 healthy blood donors were enrolled. Klotho level in plasma was measured by mean of an ELISA test and the hand-grip strength using a dynamometer. Intact parathyroid hormone (PTH), 25-hydroxy vitamin D (Vitamin D), serum calcium (Ca), phosphate (P), total alkaline phosphatase (ALP), ferritin, creatinine were measured by standard clinical techniques. DXA was used to measure bone mineral density (BMD) at the lumbar spine (L2-L4), femoral neck and total hip. We found that the Klotho protein concentration was lower in the blood of patients with β-thalassemia major than in healthy controls, and it was directly correlated to the hand-grip strength. In β-thalassemia major patients, the secreted Klotho was lower than in healthy controls. The preliminary investigation into the correlation between markers of osteo- and sarcopenia and Klotho demonstrated a decreased Klotho concentration in β-TM patients and a higher probability of having had fragility fractures. Copyright © 2015 Elsevier Inc. All rights reserved.
Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.
Thein, Swee Lay
2017-01-01
β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.
El-Tantawy, Nora; Darwish, Ahmad; Eissa, Eman
2018-05-14
Children with β-thalassemia major who regularly receive blood transfusion are at risk of developing transfusion-transmitted infection. Toxoplasmosis is a common and a serious parasitic disease with high prevalence and could be transmitted through blood transfusion from healthy asymptomatic donors. However, screening Toxoplasma gondii before blood donation has not been considered. To determine the prevalence of T. gondii antibodies among thalassemia children undergoing blood transfusion. In a case-control study, serum samples from 211 thalassemia children and 100 control children were investigated for Toxoplasma IgM and IgG using the enzyme-linked immunosorbent assay (ELISA). Positive serum samples for IgG antibodies to T. gondii were further subjected to IgG avidity ELISA. The seroprevalence of Toxoplasma infection among thalassemia children was 23.2% and 53.6% for IgM and IgG anti-Toxoplasma antibodies, respectively. Whereas in the contro group, the prevalence was 5% and 18% for IgM and IgG anti-Toxoplasma antibodies, respectively. There is a significant statistical difference between thalassemia and control groups regarding the prevalence of toxoplasmosis. From these positive IgG samples, 65.5% have low avidity indicating recent infection while 38.73% have high avidity indicating past infection. Due to the high serologic infection rate of toxoplasmosis among thalassemia pediatric population in this study with no existing effective therapies and no available T. gondii vaccine, appropriate strategies are critical for reducing the risk of that infection. Screening of blood for T. gondii antibodies should be considered before transmission to those children especially in countries with a high prevalence of toxoplasmosis.
Vayá, Amparo; Alis, Rafael; Suescún, Marta; Rivera, Leonor; Murado, Julian; Romagnoli, Marco; Solá, Eva; Hernandez-Mijares, Antonio
2015-01-01
Increased red blood distribution width (RDW) in anemia is related to disturbances in the cellular surface/volume ratio, usually accompanied by morphological alterations, while it has been shown in inflammatory diseases that the activity of pro-inflammatory cytokines disturbing erythropoiesis increases RDW. Recently it has been reported that higher RDW is related with decreased erythrocyte deformability, and that it could be related with the association of RDW and increased risk of cardiovascular diseases. In order to analyze the influence of morphological alterations and proinflammatory status on the relationship between RDW and erythrocyte deformability, we analyzed erythrocyte deformability along with RDW and other hematological and biochemical parameters in 36 α-thalassemia, 20 β-thalassemia, 20 δβ-thalassemia trait carriers, 61 metabolic syndrome patients and 76 morbidly obese patients. RDW correlated inversely with erythrocyte deformability in minor β-thalassemia (r =-0.530, p < 0.05), and directly in both metabolic syndrome and morbidly obese patients (ρ= 0.270, p < 0.05 and ρ= 0.258, p < 0.05, respectively). Minor β-thalassemia is often accompanied by more marked cell-shaped perturbations than other thalassemia traits. This could be the reason for this negative association only in this setting. Higher anisocytosis seems to be associated with greater morphologic alterations (shape/volume), which reduce erythrocyte deformability. The proinflammatory profile in metabolic patients can be related to the positive association of RDW with erythrocyte deformability found in these patients. However, further research is needed to explain the mechanisms underlying this association.
The epidemiologic transition of thalassemia and associated hemoglobinopathies in southern Taiwan.
Wang, Hui-Ching; Hsieh, Li-Ling; Liu, Yi-Chang; Hsiao, Hui-Hua; Lin, Shu-Kai; Tsai, Wen-Chan; Liu, Ta-Chih
2017-02-01
Since 1993, following the National Thalassemia Major Prevention Program and an increase in immigration and interracial marriages, especially in southern Taiwan, the distribution of hemoglobinopathies may have changed. This study investigates the epidemiologic transition of hemoglobinopathies. We analyzed 1870 specimens collected between 2003 and 2012 in southern Taiwan, used gap-polymerase chain reaction and PCR-restriction fragment length polymorphism-based methods, and confirmed genotypes of hemoglobinopathies by DNA sequencing. We found a 91% reduction in the incidence of thalassemia major compared with samples from between 1986 and 1995. The most common genotypes of α-thalassemia and α Hb variants were the SEA type (69.4%) and Hb Quong Sze (1.54%). The most common genotypes of β-thalassemia and β Hb variants were IVS-II-654 (46.2%) and Hb E (2.2%), respectively. Compared with studies performed in different areas of and time intervals in Taiwan, a higher prevalence of -α 3.7 , Hb Quong Sze, and Hb E and a lower prevalence of the SEA type were found in this study. However, the SEA type remained the most common genotype observed. In addition, an increasing number of cases with an -α 3.7 type carrier, Hb Quong Sze carrier, and G γ (A γ δβ)° were identified following a peak of interracial marriages between 2003 and 2005, reflecting a regional difference and the impact of interracial marriage. In conclusion, global migration and international marriage have changed the distribution of hemoglobinopathies in Taiwan. A more comprehensive prenatal screening for new immigrants with a longer follow-up is warranted.
An Explosion of Creativity in a Remote Egyptian Village.
ERIC Educational Resources Information Center
Osman, Siham A.
1985-01-01
The Egyptian architect Wissa Wassef believed artistry in crafts to be an innate human characteristic that would be universally expressed under the right conditions, i.e., the practice of the craft from early childhood. When he had Egyptian peasant children with no previous art experience weave tapestries, the results astounded the world. (RM)
Kolios, Marios; Korantzopoulos, Panagiotis; Vlahos, Antonios P; Kapsali, Eleni; Briasoulis, Evangelos; Goudevenos, John A
2016-10-15
There seems to be a significant arrhythmia burden in β-thalassemia major (TM) patients without overt cardiomyopathy. Apart from conventional electrocardiographic (ECG) and arrhythmic risk markers we studied novel markers of ventricular repolarization and autonomic imbalance both at rest and after exercise testing. We studied 47 adult TM patients without systolic heart failure and 47 age and sex-matched healthy control subjects. The median age of the studied population was 36 [32-43] years, 57% men. Baseline demographic and clinical characteristics were recorded while 12-lead electrocardiograms, 24-hour ECG Holter recordings, and treadmill exercise stress tests were analyzed. TM patients exhibited increased QTc intervals in both 12-lead ECG recordings and in 24-hour Holter recordings. In addition, they had increased indexes of ventricular repolarization heterogeneity such as QT dispersion, and T peak-to-end/QT ratios. Furthermore, TM patients had decreased indexes of heart rate variability while the heart rate recovery after exercise was significantly attenuated compared to controls. Also, they had increased P wave and QRS duration while the QRS fragmentation was very prevalent. Finally, premature atrial extrasystoles and paroxysmal atrial fibrillation episodes were more frequent in TM patients. TM patients with preserved left ventricular systolic function have several ECG abnormalities including alterations in ventricular depolarization and repolarization. Also, cardiac autonomic dysfunction is evident in 24-hour ECG monitoring as well as in the recovery phase after exercise testing. The prognostic value of specific arrhythmic risk indexes in this setting remains to be elucidated. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Roth, Idit Lachover; Lachover, Boaz; Koren, Guy; Levin, Carina; Zalman, Luci; Koren, Ariel
2018-01-01
Background β-thalassemia major is a severe disease with high morbidity. The world prevalence of carriers is around 1.5–7%. The present study aimed to find a reliable formula for detecting β-thalassemia carriers using an extensive database of more than 22,000 samples obtained from a homogeneous population of childbearing age women with 3161 (13.6%) of β-thalassemia carriers and to check previously published formulas. Methods We applied a mathematical method based on the support vector machine (SVM) algorithm in the search for a reliable formula that can differentiate between thalassemia carriers and non-carriers, including normal counts or counts suspected to belong to iron-deficient women. Results Shine’s formula and our SVM formula showed >98% sensitivity and >99.77% negative predictive value (NPV). All other published formulas gave inferior results. Conclusions We found a reliable formula that can be incorporated into any automatic blood counter to alert health providers to the possibility of a woman being a β-thalassemia carrier. A further simple hemoglobin characterization by HPLC analysis should be performed to confirm the diagnosis, and subsequent family studies should be carried out. Our SVM formula is currently limited to women of fertility age until further analysis in other groups can be performed. PMID:29326805
Chu, Na-Li; Wu, Zhi-kui; Zhang, Xin-Hua; Fang, Su-Ping; Wang, Wen-Juan; Cheng, Yan-Ling
2014-01-01
The objective of this study was to investigate the therapeutic biological mechanism of Yisui Shengxue Granule (YSSXG), a complex Chinese medicine, on the hemolysis and anemia of erythrocytes from patient with thalassemia disease. Sixteen patients with thalassemia (8 cases of α-thalassemia and 8 cases of β-thalassemia) disease were collected and treated with YSSXG for 3 months. The improvements of blood parameter demonstrated that YSSXG had a positive clinical effect on patients with thalassemia disease. For patients with α-thalassemia disease, RT-PCR showed that YSSXG upregulated the relative mRNA expression level of α-globin to β-globin and downregulated DNMT1, DNMT3a, and DNMT3b mRNA compared with pretreatment. Western blotting showed that YSSXG downregulated the expression of DNMT1 and DNMT3a. For patients with β-thalassemia disease, the relative expression level of A γ-globin to α-globin had an increasing trend and the level of BCL11A mRNA expression obviously increased. For all patients, RT-PCR showed that YSSXG upregulated mRNA expression of SPTA1 and SPTB. Activities of SOD and GSH-Px significantly increased and MDA obviously reduced on erythrocyte and blood serum after YSSXG treatment. TEM showed that YSSXG decreased the content of inclusion bodies. Activities of Na+K+-ATPtase and T-ATPtase of erythrocyte increased significantly after YSSXG treatment. This study provides the basis for mechanisms of YSSXG on thalassemia suffering with hemolysis and anemia of erythrocytes from patient. PMID:25574177
Torque Teno Virus and Hepatitis C Virus Co-Infection in Iranian Pediatric Thalassemia Patients
Alavi, Samin; Valeshabad, Ali Kord; Sharifi, Zohreh; Nourbakhsh, Kazem; Arzanian, Mohammad Taghi; Navidinia, Masoumeh; Seraj, Siamak Mehdizadeh
2012-01-01
Objective: Torque teno virus (TTV) infects patients at risk for parenteral exposure and chronic blood transfusion, such as those with β-thalassemic. This study aimed to assess the prevalence of TTV infection and co-infection of TTV and hepatitis C virus (HCV) in pediatric thalassemia patients receiving chronic blood transfusion. Material and Methods: The study included 90 pediatric thalassemia patients receiving chronic blood transfusion that presented to the Mofid Children’s Hospital, Tehran, Iran. The control group included 90 healthy volunteer children. Serum TTV DNA detection via semi-nested PCR and HCV Ab were performed in all the participants. Demographic characteristics and clinical data were collected from each participant for statistical analysis. Results: In all, 64.4% of the patients had TTV infection, versus 24.4% of the controls (P < 0.01). The thalassemia patients had a greater probability of having TTV and HCV infections than the controls, with a common OR of 5.60 (95% CI: 2.94-10.69) and 2.15 (95% CI: 1.83-2.50), respectively. In total, 17.2% (10/58) of the patients that were TTV positive were also HCV positive, whereas 6.3% (2/32) of the TTV-negative patients were anti-HCV antibody (Ab) positive (P = 0.14). Conclusion: The prevalence of TTV and HCV infection was higher in the Iranian thalassemia patients on chronic transfusion therapy than in the controls. The high prevalence of TTV in pediatric thalassemia patients on chromic transfusion therapy may indicate the superiority of the parenteral route compared to other routs of TTV transmission. PMID:24744647
My Story: Real Stories of People Living with Thalassemia
... My Story Recommend on Facebook Tweet Share Compartir Real Stories from People living with Thalassemia On this ... blood diseases. Eventually, I would really like to travel the world and treat patients in places where ...
β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.
Crielaard, Bart J; Rivella, Stefano
2014-06-01
β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.
Rafii, Zahra; Ahmadi, Fazlollah; Nourbakhsh, Sayed Mohamad Kazem; Hajizadeh, Ebrahim
2016-09-01
Introduction: Medical advances have improved life expectancy and survival of patients with thalassemia. However, as getting older, patients with thalassemia experience different complications which impair their quality of life. The aim of this study was to examine the effects of a nurse-implemented orientation program on quality of life in patients with thalassemia. Methods: A convenience sample of 55 patients with thalassemia were recruited in this quasi-experimental study. Patients were randomly allocated to control or experimental groups. A demographic questionnaire, Thalassemia quality of life questionnaire, and 36-item short form health survey were used for data collection before and one month after the intervention. In the intervention group, 1.5-month orientation program including of the three steps of inauguration, implementation, and closure was implemented, while the control group received routine care. The Chi-square, independent t-test and paired-samples t-test were used for data analysis by using SPSS ver.13 software. Results: The intervention and control group did not differ significantly from each other regarding demographic characteristics. Moreover, no significant difference was observed between the two groups regarding the quality of life scores after the implementation of orientation program. Conclusion: Implementing a short-term orientation program was not effective in enhancing the quality of life in patients with thalassemia; hence, developing long-term multimodal strategies may result in better improvement.
[Early Egyptian forerunners of the Paranatellonta?].
Quack, J F
1999-01-01
The term "paranatellonta" is well-known in greek astrological literature. It designates stars either rising together with the sun or being in other conspicuous positions to it. Tentatively, a forerunner of this conception is identified in an egyptian depiction attested several times from the 13th century BC onwards. There, "gods" are depicted who are defined by their positions in regard to the sun-god. It seems possible to connect their positions with the typical meanings of the word paranatellonta. Some reflections on the contribution of Egypt to hellenistic astrology are added, including some references to the largely unpublished corpus of demotic egyptian astrological texts.
Hip morphologic measurements in an Egyptian population.
Aly, Tarek A
2011-04-11
The study of acetabular morphology has shown that there are geographic differences in the morphology and prevalence of acetabular dysplasia among different ethnic groups. However, few data exist on the shape of the acetabulum in various populations around the world. In this study, we examined samples of pelvic radiographs from Egyptian adults. Acetabular dysplasia in adults is characterized by a shallow and relatively vertical acetabulum.The aim of this study was to examine acetabular morphology to determine the prevalence of hip dysplasia in adult Egyptians. This included 244 adults, 134 men and 110 women between 18 and 60 years, who were used to measure center edge angle, acetabular Sharp angle, acetabular head index on anteroposterior radiographic views of the hip joints, and vertical center anterior margin angle on false profile views. The radiographs were taken of patients with no hip complaints at Tanta University Hospital.The results were statistically studied according to the age, height, and weight of patients. The prevalence of acetabular dysplasia was 2.25% for Egyptian men and 3.6% for women with respect to center edge angles, vertical center anterior margin angle, and acetabular head index.We concluded that gender variations in the morphology of the acetabulum and sex influences geometrical measurements of the acetabulum. Egyptian women were more dysplastic than men using the 4 parameters of hip measurements. There are also racial variations in hip morphology. Copyright 2011, SLACK Incorporated.
Clinical anatomy as practiced by ancient Egyptians.
Loukas, Marios; Hanna, Michael; Alsaiegh, Nada; Shoja, Mohammadali M; Tubbs, R Shane
2011-05-01
Egypt is famously known for its Nile and pyramids, yet not many people know that Egypt made possible the origin of the anatomical sciences. Several ancient papyri guide us through the Egyptians' exploration of the human body and how they applied anatomical knowledge to clinical medicine to the best of their knowledge. It is through records, such as the Edwin Smith, Ebers, and Kahun papyri and other literature detailing the work of the Egyptian embalmers, physicians, and Greek anatomists, that we are able to take a glimpse into the evolution of the anatomical sciences from 3000 B.C. to 250 B.C. It is through the Egyptian embalmer that we were able to learn of some of the first interactions with human organs and their detailed observation. The Egyptian physician's knowledge, being transcribed into the Ebers and Edwin Smith papyri, enabled future physicians to seek reference to common ailments for diagnosing and treating a variety of conditions ranging from head injuries to procedures, such as trans-sphenoidal surgery. In Alexandria, Herophilus, and Erasistratus made substantial contributions to the anatomical sciences by beginning the practice of human dissection. For instance, Herophilus described the anatomy of the heart valves along with Erasistratus who demonstrated how blood was prevented from flowing retrograde under normal conditions. Hence, from various records, we are able to unravel how Egypt paved the road for study of the anatomical sciences. Copyright © 2011 Wiley-Liss, Inc.
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Dhawan, Hari Krishan; Kumawat, Vijay; Marwaha, Neelam; Sharma, Ratti Ram; Sachdev, Suchet; Bansal, Deepak; Marwaha, Ram Kumar; Arora, Satyam
2014-01-01
Background: The development of anti-red blood cell antibodies (both allo-and autoantibodies) remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC) alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. Materials and Methods: The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland) respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d) gel cards. Results: Eighteen patients out of total 319 patients (5.64%) developed alloantibodies and 90 (28.2%) developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042). Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-Cw = 9%), 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Conclusion: Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen). Early institution of transfusion therapy after diagnosis is another means of decreasing alloimmunization. PMID
Dhawan, Hari Krishan; Kumawat, Vijay; Marwaha, Neelam; Sharma, Ratti Ram; Sachdev, Suchet; Bansal, Deepak; Marwaha, Ram Kumar; Arora, Satyam
2014-07-01
The development of anti-red blood cell antibodies (both allo-and autoantibodies) remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC) alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland) respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d) gel cards. Eighteen patients out of total 319 patients (5.64%) developed alloantibodies and 90 (28.2%) developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042). Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-C(w) = 9%), 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen). Early institution of transfusion therapy after diagnosis is another means of decreasing alloimmunization.
Siwaponanan, Panjaree; Siegers, Jurre Ynze; Ghazali, Razi; Ng, Thian; McColl, Bradley; Ng, Garrett Zhen-Wei; Sutton, Philip; Wang, Nancy; Ooi, Isabelle; Thiengtavor, Chayada; Fucharoen, Suthat; Chaichompoo, Pornthip; Svasti, Saovaros; Wijburg, Odilia; Vadolas, Jim
2017-06-08
β-Thalassemia is associated with several abnormalities of the innate immune system. Neutrophils in particular are defective, predisposing patients to life-threatening bacterial infections. The molecular and cellular mechanisms involved in impaired neutrophil function remain incompletely defined. We used the Hbb th3/+ β-thalassemia mouse and hemoglobin E (HbE)/β-thalassemia patients to investigate dysregulated neutrophil activity. Mature neutrophils from Hbb th3/+ mice displayed a significant reduction in chemotaxis, opsonophagocytosis, and production of reactive oxygen species, closely mimicking the defective immune functions observed in β-thalassemia patients. In Hbb th3/+ mice, the expression of neutrophil CXCR2, CD11b, and reduced NAD phosphate oxidase components (p22phox, p67phox, and gp91phox) were significantly reduced. Morphological analysis of Hbb th3/+ neutrophils showed that a large percentage of mature phenotype neutrophils (Ly6G hi Ly6C low ) appeared as band form cells, and a striking expansion of immature (Ly6G low Ly6C low ) hyposegmented neutrophils, consisting mainly of myelocytes and metamyelocytes, was noted. Intriguingly, expression of an essential mediator of neutrophil terminal differentiation, the ets transcription factor PU.1, was significantly decreased in Hbb th3/+ neutrophils. In addition, in vivo infection with Streptococcus pneumoniae failed to induce PU.1 expression or upregulate neutrophil effector functions in Hbb th3/+ mice. Similar changes to neutrophil morphology and PU.1 expression were observed in splenectomized and nonsplenectomized HbE/β-thalassemia patients. This study provides a mechanistic insight into defective neutrophil maturation in β-thalassemia patients, which contributes to deficiencies in neutrophil effector functions. © 2017 by The American Society of Hematology.
Muslim Egyptian and Lebanese Students' Conceptions of Biological Evolution
NASA Astrophysics Data System (ADS)
Boujaoude, Saouma; Wiles, Jason R.; Asghar, Anila; Alters, Brian
2011-09-01
In this study, we investigated distinctions among the diversity of religious traditions represented by Lebanese and Egyptian Muslim high school students regarding their understanding and acceptance of biological evolution and how they relate the science to their religious beliefs. We explored secondary students' conceptions of evolution among members of three Muslim sects—Sunni, Shiite, and Druze—in two cultural contexts; one in which the overwhelming majority of the population is Muslim (Egypt) and another in which there is a sizable Christian community (Lebanon). Data were collected via surveys that examined students' scientific and religious understandings of evolution among 162 Egyptian students (all Sunni Muslims; 63% females and 37% males) and 629 Lebanese students (38.5% Sunni, 38% Shiite, and 23.5% Druze; 49% females and 51% males). Additional data were collected via semi-structured interviews with 30 Lebanese students to allow triangulation of data for accuracy and authenticity. Results indicate that many Egyptian and Lebanese Muslim students have misconceptions about evolution and the nature of science which often lead to rejection of evolution. Also, Lebanese Sunni and Shiite students and Egyptian Sunni students tend to exhibit high levels of religiosity, and these students report that their religious beliefs influence their positions regarding evolution. Finally, Sunni and Shiite Lebanese students have religious beliefs, conceptions of evolution, and positions regarding evolution similar to those of Sunni Egyptian students. These conceptions and positions, however, are substantially different from those of Druze Lebanese students.
High resolution DNA melting analysis: an application for prenatal control of alpha-thalassemia.
Sirichotiyakul, Supatra; Wanapirak, Chanane; Saetung, Rattika; Sanguansermsri, Torpong
2010-04-01
To report the use of real-time gap-PCR using SYTO9 with high-resolution melting analysis (HRMA) in prenatal diagnosis of alpha-thalassemia 1. Real-time gap-PCR using SYTO9 with HRMA was performed in 33 DNA samples from chorionic villi sampling (8 normal, 16 heterozygous, and 9 homozygous) to determine the alpha-thalassemia 1 gene [normal and Southeast Asia (-SEA) allele]. The dissociation curve analysis in normal and - SEA allele gave a peak of T(m) at 91.80 +/- 0.14 degrees C and 88.67 +/- 0.08 degrees C, respectively. Normal genotype and homozygous alpha-thalassemia 1 showed a single peak of T(m) that corresponded to their alleles. The heterozygotes gave both peaks with higher normal peak and smaller - SEA peak. Thirty one samples showed consistent results with the conventional gap-PCR. Two samples with ambiguous results were confirmed to be maternal DNA contamination on real-time quantitative PCR and microsatellite assay. HRMA from both samples showed similar pattern to that of heterozygotes. However, they showed much smaller normal peak compared with the - SEA peak, which is in contrast to those of heterozygotes and can readily be distinguished. HRMA with SYTO9 is feasible for prenatal diagnosis of alpha-thalassemia. It had potential advantage of prompt detection maternal DNA contamination. Copyright (c) 2010 John Wiley & Sons, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ngo, K.Y.; Liu, D.; Lee, J.
During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less
Shaw, Jyoti; Chakraborty, Ayan; Nag, Arijit; Chattopadyay, Arnab; Dasgupta, Anjan K; Bhattacharyya, Maitreyee
2017-11-01
To investigate the cause and effects of intracellular iron overload in lymphocytes of thalassemia major patients. Sixty-six thalassemia major patients having iron overload and 10 age-matched controls were chosen for the study. Blood sample was collected, and serum ferritin, oxidative stress; lymphocyte DNA damage were examined, and infective episodes were also counted. Case-control analysis revealed significant oxidative stress, iron overload, DNA damage, and rate of infections in thalassemia cases as compared to controls. For cases, oxidative stress (ROS) and iron overload (serum ferritin) showed good correlation with R 2 = 0.934 and correlation between DNA damage and ROS gave R 2 = 0.961. We also demonstrated that intracellular iron overload in thalassemia caused oxidative damage of lymphocyte DNA as exhibited by DNA damage assay. The inference is further confirmed by partial inhibition of such damage by chelation of iron and the concurrent lowering of the ROS level in the presence of chelator deferasirox. Therefore, intracellular iron overload caused DNA fragmentation, which may ultimately hamper lymphocyte function, and this may contribute to immune dysfunction and increased susceptibility to infections in thalassemia patients as indicated by the good correlation (R 2 = 0.91) between lymphocyte DNA damage and rate of infection found in this study. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Study on Mössbauer spectra of hemoglobin in thalassemia
NASA Astrophysics Data System (ADS)
Xuanhui, Guo; Nanming, Zhao; Xiufang, Zhang; Naifei, Gao; Youwen, Huang; Rongxin, Wang
1988-02-01
The57Fe Mössbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed.
Diagnosis and treatment of cardiac iron overload in transfusion-dependent thalassemia patients.
Siri-Angkul, Natthaphat; Chattipakorn, Siriporn C; Chattipakorn, Nipon
2018-05-18
Thalassemia is among the most common genetic diseases. Patients with severe forms of the disease are transfusion-dependent, leading to iron overload. A condition which can eventually develop in the iron-loaded heart is iron overload cardiomyopathy, a debilitating disease that accounts for the majority of deaths in thalassemia patients. Areas covered: This review article provides a comprehensive summary of the diagnosis and treatment of cardiac iron overload in transfusion-dependent thalassemia patients, with discussion covering current weak points and potential improvements of the relevant diagnostic and therapeutic strategies. Expert commentary: Current limitations of various diagnostic techniques for iron overload cardiomyopathy include suboptimal accuracy, untimely detection, or inadequate accessibility, and novel modalities are required to overcome these shortcomings. Treatment should address key pathophysiologic mechanisms of iron overload cardiomyopathy, which include cardiac iron mishandling and iron-induced oxidative injury. Apart from the promotion of iron removal by chelators, prevention of cardiac iron deposition and attenuation of oxidative damage should also be rigorously investigated on a cell-to-bedside basis.
Claus, Gabriel Machado; Redkva, Paulo Eduardo; Brisola, Gabriel Mota Pinheiro; Malta, Elvis Sousa; de Araujo Bonetti de Poli, Rodrigo; Miyagi, Willian Eiji; Zagatto, Alessandro Moura
2017-05-01
The purpose of this study was to investigate the effects of beta-alanine supplementation on specific tests for water polo. Fifteen young water polo players (16 ± 2 years) underwent a 200-m swimming performance, repeated-sprint ability test (RSA) with free throw (shooting), and 30-s maximal tethered eggbeater kicks. Participants were randomly allocated into two groups (placebo × beta-alanine) and supplemented with 6.4g∙day -1 of beta-alanine or a placebo for six weeks. The mean and total RSA times, the magnitude based inference analysis showed a likely beneficial effect for beta-alanine supplementation (both). The ball velocity measured in the throwing performance after each sprint in the RSA presented a very like beneficial inference in the beta-alanine group for mean (96.4%) and percentage decrement of ball velocity (92.5%, likely beneficial). Furthermore, the percentage change for mean ball velocity was different between groups (beta-alanine=+2.5% and placebo=-3.5%; p = .034). In the 30-s maximal tethered eggbeater kicks the placebo group presented decreased peak force, mean force, and fatigue index, while the beta-alanine group maintained performance in mean force (44.1%, possibly beneficial), only presenting decreases in peak force. The 200-m swimming performance showed a possibly beneficial effect (68.7%). Six weeks of beta-alanine supplementation was effective for improving ball velocity shooting in the RSA, maintaining performance in the 30-s test, and providing possibly beneficial effects in the 200-m swimming performance.
Treating iron overload in patients with non-transfusion-dependent thalassemia
Taher, Ali T; Viprakasit, Vip; Musallam, Khaled M; Cappellini, M Domenica
2013-01-01
Despite receiving no or only occasional blood transfusions, patients with non-transfusion-dependent thalassemia (NTDT) have increased intestinal iron absorption and can accumulate iron to levels comparable with transfusion-dependent patients. This iron accumulation occurs more slowly in NTDT patients compared to transfusion-dependent thalassemia patients, and complications do not arise until later in life. It remains crucial for these patients' health to monitor and appropriately treat their iron burden. Based on recent data, including a randomized clinical trial on iron chelation in NTDT, a simple iron chelation treatment algorithm is presented to assist physicians with monitoring iron burden and initiating chelation therapy in this group of patients. Am. J. Hematol. 88:409–415, 2013. © 2013 Wiley Periodicals, Inc. PMID:23475638
PROBLEMS OF AMERICANS IN MASTERING THE PRONUNCIATION OF EGYPTIAN ARABIC.
ERIC Educational Resources Information Center
KENNEDY, NANCY M.
THE DIFFICULTIES ENCOUNTERED BY SPEAKERS OF AMERICAN ENGLISH IN ATTEMPTING TO MASTER THE PRONUNCIATION OF EGYPTIAN ARABIC WERE ANALYZED DURING THE REPORTED RESEARCH. THE LANGUAGE UNDER CONSIDERATION WAS THE URBAN COLLOQUIAL ARABIC OF THE EGYPTIAN DELTA. THIS STUDY DEALT WITH THE SEGMENTAL PHONEMES ONLY, WITH SOME REFERENCE TO STRESS AND…
Homer and Herodotus to Egyptian medicine.
Rossi, Marco
2010-12-01
Egyptian medicine is the base of Greek medicine. Egyptian people and their medical knowledge are often mentioned in the Iliad and Odyssey of Homer (VIII sec. BCE). Many Greek doctors, such as Melampus, Asclepius as well as Hippocrates visited Egypt to study and understand medicine. This work intends to focus particularly on Homer, Herodotus and Plutarch's letters, where the importance of Egypt in religion, science and medicine is clear. Herodotus (484-420 BCE) in the second book of "The Histories" describes Egypt and the medical knowledge of its doctors. Plutarch (I-II sec CE) in "The virtues of Sparta" and "Life of Lycurgus", tells about an energy beverage, named nepenthe, made with drugs from Egypt.
Musharraf, Syed Ghulam; Iqbal, Ayesha; Ansari, Saqib Hussain; Parveen, Sadia; Khan, Ishtiaq Ahmad; Siddiqui, Amna Jabbar
2017-01-01
β-Thalassemia is one of the most prevalent forms of congenital blood disorders characterized by reduced hemoglobin levels with severe complications, affecting all dimensions of life. The mechanisms underlying the phenotypic heterogeneity of β-thalassemia are still poorly understood. We aimed to work over metabolite biomarkers to improve mechanistic understanding of phenotypic heterogeneity and hence better management of disorder at different levels. Untargeted serum metabolites were analyzed after protein precipitation and SPE (solid phase extraction) from 100 β-thalassemia patients and 61 healthy controls using GC-MS. 40 metabolites were identified having a significance difference between these two groups at probability of 0.05 and fold change >1.5. Out of these 40 metabolites, 17 were up-regulated while 23 were down-regulated. PCA and PLS-DA model was also created that revealed a fine separation with a sensitivity of 70% and specificity of 100% on external validation of samples. Metabolic pathway analysis revealed alteration in multiple pathways including glycolysis, pyruvate, propanoate, glycerophospholipid, galactose, fatty acid, starch and sucrose metabolism along with fatty acid elongation in mitochondria, glycerolipid, glyoxylate and dicarboxylate metabolism pointing towards the shift of metabolism in β-thalassemia patients in comparison to healthy individuals. PMID:28198811
Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth
2006-10-01
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.
Global burden, distribution and prevention of β-thalassemias and hemoglobin E disorders.
Colah, Roshan; Gorakshakar, Ajit; Nadkarni, Anita
2010-02-01
The β-thalassemias, including the hemoglobin E disorders, are not only common in the Mediterranean region, South-East Asia, the Indian subcontinent and the Middle East but have now become a global problem, spreading to much of Europe, the Americas and Australia owing to migration of people from these regions. Approximately 1.5% of the global population are heterozygotes or carriers of the β-thalassemias. While the overall frequencies of carriers of these disorders are known in most countries, there have been few attempts at micromapping and wherever this has been done, significant variations are seen even within small geographic regions. Thus, the figures for the estimated numbers of births each year of homozygous β-thalassemia and the severe compound states involving other hemoglobin disorders may be an underestimate. Screening strategies have varied from premarital to antenatal in different countries depending on socio-cultural and religious customs in different populations. Prenatal diagnosis programs are ongoing in many countries and the knowledge of the distribution of mutations has facilitated the establishment of successful control programs. Many of these were through North-South partnerships and networking. Yet, there are many countries in Asia where they are lacking, and South-South partnerships are now being developed in South-East Asia and the Indian subcontinent to link centers with expertise to centers where expertise needs to be developed. Although the carrier frequencies will remain unaltered, this will eventually help to bring down the burden of the birth of affected children with β-thalassemias and hemoglobin E disorders in Asia.
Knowledge, attitude, and practice of reproductive behavior in Iranian minor thalassemia couples.
Kosaryan, Mehrnoosh; Vahidshahi, Koorosh; Siami, Rita; Nazari, Meisam; Karami, Hosein; Ehteshami, Sara
2009-06-01
To investigate the knowledge, attitude, and practice of reproductive behavior in Iranian minor thalassemia couples in Ghaemshahr City, Mazandaran, Iran. This is a cross-sectional descriptive survey conducted in 2006. Birth rates from 1997-2005 and the number of newly registered patients from at risk couples was recorded. Tools for data collection were a valid questionnaire containing epidemiologic characteristics of couples, knowledge (20 questions), attitude 20 statements, and practice by studying the family file in health centers. Questionnaires were completed by husband and wife separately. Actual versus expected numbers of patients born in that period were compared. The data were analyzed using the Statistical Package for Social Science version 13.00, and p<0.05 was interpreted as significant. Of the 240 at risk couples, 100 were studied. Of them, 82% had good knowledge of thalassemia, and 68.5% had a positive attitude toward thalassemia prevention program. Correlations of knowledge with attitude were significant (p<0.001), and 50% of the couples had unfavorable practice including unplanned pregnancy, fetal abortion without prenatal diagnosis (PND), delivery without PND, and having a child affected by thalassemia major (TM). Without PND, 4 TM patients were born. Ninety-eight episodes of unfavorable practice were reported. Meanwhile, the contraceptive method used by 12% of couples was unsafe. Suspected TM patients with no prevention program were 25; thus, the birth of 2 TM was prevented (92% reduction). We achieved great success during the last 9 years in the region, and TM prevention program improved knowledge, attitude, and practice in high-risk couples and carrier families.
Egyptian plant species as new ozone indicators.
Madkour, Samia A; Laurence, J A
2002-01-01
The aim of this study was to test and select one or more highly sensitive, specific and environmentally successful Egyptian bioindicator plants for ozone (O3). For that purpose more than 30 Egyptian species and cultivars were subjected to extensive screening studies under controlled environmental and pollutant exposure conditions to mimic the Egyptian environmental conditions and O3 levels in urban and rural sites. Four plant species were found to be more sensitive to O3 than the universally used O3-bioindicator, tobacco Bel W3, under the Egyptian environmental conditions used. These plant species, jute (Corchorus olitorius c.v. local), clover (Trifolium alexandrinum L. c.v. Masry), garden rocket (Eruca sativa c.v. local) and alfalfa (Medicago sativa L. c.v. local), ranked in order of decreasing sensitivity, exhibited typical O3 injury symptoms faster and at lower 03 concentrations than Bel W3. Three variables were tested in search of a reliable tool for the diagnosis and prediction of O3 response prior to the appearance of visible foliar symptoms: pigment degradation, stomatal conductance (g(s)) and net photosynthetic CO2 assimilation (Pnet). Pigment degradation was found to be unreliable in predicting species sensitivity to O3. Evidence supporting stomatal conductance involvement in 03 tolerance was found only in tolerant species. A good correlation was found between g(s), restriction of O3 and CO2 influx into the mesophyll tissues, and Pnet. Changes in Pnet seemed to depend largely on fluctuations in g(s).
Survival and complications in thalassemia.
Borgna-Pignatti, C; Cappellini, M D; De Stefano, P; Del Vecchio, G C; Forni, G L; Gamberini, M R; Ghilardi, R; Origa, R; Piga, A; Romeo, M A; Zhao, H; Cnaan, A
2005-01-01
The life expectancy of patients with thalassemia major has significantly increased in recent years, as reported by several groups in different countries. However, complications are still frequent and affect the patients' quality of life. In a recent study from the United Kingdom, it was found that 50% of the patients had died before age 35. At that age, 65% of the patients from an Italian long-term study were still alive. Heart disease is responsible for more than half of the deaths. The prevalence of complications in Italian patients born after 1970 includes heart failure in 7%, hypogonadism in 55%, hypothyroidism in 11%, and diabetes in 6%. Similar data were reported in patients from the United States. In the Italian study, lower ferritin levels were associated with a lower probability of experiencing heart failure and with prolonged survival. Osteoporosis and osteopenia are common and affect virtually all patients. Hepatitis C virus antibodies are present in 85% of multitransfused Italian patients, 23% of patients in the United Kingdom, 35% in the United States, 34% in France, and 21% in India. Hepatocellular carcinoma can complicate the course of hepatitis. A survey of Italian centers has identified 23 such cases in patients with a thalassemia syndrome. In conclusion, rates of survival and complication-free survival continue to improve, due to better treatment strategies. New complications are appearing in long-term survivors. Iron overload of the heart remains the main cause of morbidity and mortality.
β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint
De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael
2017-01-01
Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pirastu, M.; Galanello, R.; Doherty, M.A.
The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.
Pornprasert, Sakorn; Sukunthamala, Kanyakan
2010-11-01
The β⁰-thalassemia/Hb-E causes a wide range of severe conditions. A high medical cost is incurred in severe cases. Thus, the prevention of new cases of β⁰-thalassemia/Hb-E is required. The aim of this study is to use the SYTO9 and SYBR GREEN1 high-resolution melting (HRM) analysis for prenatal diagnosis of β⁰-thalassemia/Hb-E. DNA samples were extracted from amniotic fluid or cord blood of 11 pregnancies whose fetuses were at risk for β-thalassemia/Hb-E. PCR products from multiplex amplification refractory mutation system PCR for the detection of β⁰-thalassemia mutations at codons 17(A>T), 41/42(-TCTT), and 71/72(+A) and from amplification refractory mutation system PCR for the detection of Hb-E were characterized by SYTO9 HRM analysis. Moreover, β⁰-thalassemia 3.5- kb deletion was detected using real-time PCR with SYBR GREEN1 HRM analysis. Seven of 11 fetuses (64%) were diagnosed as β⁰-thalassemia/Hb-E (4 fetuses with mutation at codon 17, 2 with mutation at codon 41/42, and 1 with 3.5- kb deletion). Results from HRM analysis were completely consistent with those from fetal blood samplings analyzed at the time of delivery or pregnancy termination using HPLC. Therefore, the HRM analysis is easy to use. It is simple, flexible, non-destructive and has superb sensitivity and specificity. This approach might facilitate the laboratory diagnosis and genetic counseling for regions with a high prevalence of β⁰-thalassemia/Hb-E. © 2010 John Wiley & Sons A/S.
ERIC Educational Resources Information Center
Weisensee, Marilyn
1990-01-01
Describes a relief printmaking unit for sixth graders with the objective of decorating the inside of a pyramid. Ancient Egyptian imagery was used to help students become familiar with the style. Students designed and printed linoleum prints in different colors. They then critiqued their work and made their selection for the pyramid. (KM)
A new strategy for prenatal diagnosis of homozygous alpha(0)-thalassemia.
Leung, K Y; Liao, C; Li, Q M; Ma, S Y; Tang, M H Y; Lee, C P; Chan, V; Lam, Y H
2006-08-01
We have shown previously that ultrasound examination performed by one experienced operator can be useful to exclude homozygous alpha(0)-thalassemia in a tertiary referral center. This study aimed to determine whether the technique was still applicable when performed by several operators and in different centers. At the Maternal and Neonatal Hospital of Guangzhou (MNH) and Tsan Yuk Hospital of Hong Kong (TYH), women at risk of homozygous alpha(0)-thalassemia were given the option of a non-invasive approach (using serial ultrasound examinations at 12-15, 16-20 and 25-30 weeks' gestation) to exclude an affected pregnancy. The fetal cardiothoracic ratio (CTR) was measured at each of these examinations and the placental thickness was measured at 12-15 weeks' gestation. The operators of MNH received training on the ultrasound examination techniques at TYH and the quality of the subsequent ultrasound examinations was checked regularly. The final diagnosis of homozygous alpha(0)-thalassemia was confirmed using an invasive test. Of 832 at-risk pregnancies studied in the two hospitals, 168 (20.2%) were affected. The overall sensitivity and specificity of the non-invasive approach was 100% and 95.6%, respectively. At MNH, the need for an invasive test was reduced by 80.8%, and all the affected pregnancies were diagnosed before 24 weeks' gestation. The results achieved at MNH were comparable with those at TYH. The at-risk pregnancies including the affected ones presented at a more advanced gestational age at MNH. At each hospital, one affected pregnancy was missed at the 12-week scan but this was subsequently detected at the 15-18-week scan. This non-invasive approach to exclude homozygous alpha(0)-thalassemia can be applicable when it is performed by several operators and in different centers.
Egyptian Art Institutions and Art Education from 1908 to 1951
ERIC Educational Resources Information Center
Kane, Patrick
2010-01-01
This study of Egyptian aesthetics interprets the historical and political context of artistic discourse in the early twentieth century. In a period marked by intense struggle between landlords and rural laborers during the Depression and World War II, the author compares the rise of the Egyptian Surrealists, from the late 1930s, and the…
Merrill, Rebecca D; Shamim, Abu Ahmed; Ali, Hasmot; Labrique, Alain B; Schulze, Kerry; Christian, Parul; West, Keith P
2012-01-01
Iron deficiency was absent in a recent population assessment of rural Bangladeshi women exhibiting anemia (57%), suggesting other causes of low hemoglobin. We assessed the relative influence on anemia of thalassemia, groundwater arsenic and iron, and diet among women of reproductive age living in rural Bangladesh. Women (n=207) sampled from a previous antenatal nutrient intervention trial in rural Bangladesh were visited during two seasons in 2008. Collected data included 7-day dietary and 24-hour drinking water intake recalls, 7-day morbidity recall, anthropometry, and drinking water arsenic and iron concentrations. Capillary blood was analyzed for iron (plasma ferritin, soluble transferrin receptor), inflammation (C-reactive protein) and thalassemia (β thalassemia and Hb E) status. In stratified, adjusted analyses, only parity was associated with anemia (odds ratio, OR (95% CI): 11.34 (1.94, 66.15)) for those with thalassemia (28% prevalent). In contrast, groundwater iron intake (>30 mg/d, 0.48 (0.24, 0.96)) and wasting (2.32 (1.17, 4.62)) were associated with anemia among those without thalassemia. Elevated groundwater arsenic (>50 μg/L, 12% of tubewells) and a diverse diet were unrelated to anemia regardless of thalassemia diagnosis (p>0.70 and >0.47, respectively). Among women in this typical rural Bangladeshi area, the prevalence of thalassemia was high and, unlike iron deficiency which was absent most likely due to high iron intake from groundwater, contributed to the risk of anemia. In such settings, the influence of environmental sources of iron and the role of thalassemias in contributing to anemia at the population level may be underappreciated.
Mahmoud, Hanan Mohamed; Shoeib, Ahmed Al-Saiid Hamed; Abd El Ghany, Shereen Mohamed; Reda, Marwa Mohamed; Ragab, Iman Ahmed
2015-12-01
The α hemoglobin stabilizing protein (AHSP) binds α-Hb and prevents its precipitation limiting free α-Hb toxicities. Our aim was to study AHSP expression in β thalassemia syndromes in relation to their clinical severity and to compare it with its level in sickle cell anemia. We compared patients with β-thalassemia (n=37) (β-thalassemia major (BTM) (n=19) and β-thalassemia intermedia (BTI) (n=18)) with 12 patients with sickle cell anemia as regards clinical severity, age at presentation, transfusion dependency, mean pre-transfusion hemoglobin level, use of hydroxyurea and AHSP expression by real time quantitative PCR. Median (and IQR) AHSP expression was significantly higher in patients with sickle cell anemia 2275 (3898) compared to thalassemia 283 (718), P=0.001, with no significant difference between BTM and BTI (P=0.346). It was also significantly higher in non-transfusion dependent patients with β thalassemia (NTDT) compared to transfusion dependent ones (P=0.019), and in patients on hydroxyurea therapy (P<0.001). However, there was no significant difference in its level according to clinical severity score (P=0.946) or splenectomy status (P=0.145). AHSP expression was higher in patients with sickle cell anemia versus thalassemia, with no significant difference between BTM and BTI. Expression was higher in patients with NTDT and on hydroxyurea therapy. Copyright © 2015 Elsevier Inc. All rights reserved.
Diagnosis of thalassemia and iron deficiency anemia using confocal and atomic force microscopy
NASA Astrophysics Data System (ADS)
Tariq, Saira; Bilal, Muhammad; Shahzad, Shaheen; Firdous, Shamaraz; Aziz, Uzma; Ahmed, Mushtaq
2017-11-01
Anemia is the most prevalent blood disorder, categorized into thalassemia and iron deficiency anemia. In anemia, the morphology of erythrocytes is disturbed, thus leading to abnormal functioning of the erythrocytes. Globally, thalassemia affects 1.3% of individuals and is one of the most widespread monogenic disorders in Pakistan. All over the World, women and children are most frequently affected by a type of nutritional deficiency known as iron deficiency anemia. The morphological changes that occur in erythrocytes due to these diseases are investigated in this study at the nano-scale level. Fifty samples of blood from individuals suffering from thalassemia or iron deficiency anemia were obtained from different hospitals in Rawalpindi and Islamabad. The blood samples were scanned using atomic force microscopy (AFM) and laser scanning confocal microscopy (LSCM) to check the morphological changes in both types of anemia. According to the present study, thalassemia is most prevalent in females in the age group between 5 and 15 years old, and iron deficiency is most prevalent in females in the age groups of 16-25 and 36-45 years old. Erythrocyte morphology is the significant determinant for diagnosing and discriminating between these two types of diseases. The study reports deformed erythrocytes in anemic patients, which were different from the ones that existed in the control. Thalassemia erythrocytes showed a crenated shape, iron deficiency anemia erythrocytes showed an elliptocyte shape and healthy erythrocytes showed a biconcave disk shape when using AFM and LSCM. These techniques seem to be very promising, cheap and less time consuming in determining the structure-function relationship of erythrocytes of thalassemic and iron deficiency anemic patients. The results of LSCM and AFM are quite useful in determining the morphological changes in erythrocytes and to study the disease at the molecular level within short period of time. Hence, we encourage employing
El-Ghorab, Ahmed; El-Massry, Khaled F; Shibamoto, Takayuki
2007-10-31
A total of 36 compounds, which comprised 99.4% of the extract, were identified by gas chromatography and mass spectrometry (GC-MS) in the volatile dichloromethane extract obtained from Egyptian corn silk. The main constituents of the volatile extract were cis-alpha-terpineol (24.22%), 6,11-oxidoacor-4-ene (18.06%), citronellol (16.18%), trans-pinocamphone (5.86%), eugenol (4.37%), neo-iso-3-thujanol (2.59%), and cis-sabinene hydrate (2.28%). Dried Egyptian corn silk was also directly extracted with petroleum ether, ethanol, and water. All extracts from solvent extraction and the volatile extract described above exhibited clear antioxidant activities at levels of 50-400 microg/mL in the 2,2-diphenyl-1-picrylhydrazyl (DPPH)/linoleic acid assay. The ethanol extract inhibited DPPH activity by 84% at a level of 400 microg/mL. All samples tested via the beta-carotene bleaching assay also exhibited satisfactory antioxidant activity with clear dose responses. This study indicates that corn silk could be used to produce novel natural antioxidants as well as a flavoring agent in various food products.
[The medical literature of the Egyptian campaign].
Hutin, Jean-François
2012-01-01
Bonaparte's Egyptian Campaign (1798 - 1801), like all other episodes from the Napoleonic era, gave rise to an extensive literature on the subject, but most of all a significant medical literature. This fact is due to many reasons:--an important health service for this expeditionary corps of more than 36.000 men, with two main figures at its hea, Desgenettes and Larrey--but also with valuable subordinates like Assalini, Savaresi, Balme, Pugnet or Barbès.--A Commission for Science and Art, of which a few doctors and surgeons were members, but most of all pharmacists like Boudet or Rouyer--The presence in the field of Ludwig Frank, the nephew of the famous Johann Peter Frank.--The creation in Cairo of an Egyptian Institute and the publication of the masterly Description of Egypt and the establishment of printing houses.--The emergence of the myth of the Orient and its mysteries.--An extensive array of indigenous pathologies, which is characteristic of those countries. For instance: plague, dysentery, yellow fever, Egyptian ophthalmia, as well as more common diseases like tetanus, scurvy or venereal diseases. The main medical works that cover this period and its pathologies are skimmed.
Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto
2017-01-01
The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086
ERIC Educational Resources Information Center
Moll, Emily
2012-01-01
The topic of Egypt is one that students are naturally intrigued and enthusiastic about. In this article, fifth graders create mosaic and mixed-media collaged chairs in their visual arts class as part of their overall study of the art and culture of ancient Egypt. The idea was to embellish a contemporary chair with Egyptian colors, themes, and…
Nakavachara, Pairunyar; Petchkul, Jaturat; Jeerawongpanich, Krittha; Kiattisakthavee, Pornpimol; Manpayak, Teerarat; Netsakulnee, Parichat; Chaichanwattanakul, Katharee; Pooliam, Julaporn; Srichairatanakool, Somdet; Viprakasit, Vip
2018-01-01
Low bone mass is common among adolescents with transfusion-dependent β-thalassemia despite adequate transfusion and iron chelation. However, there are few reports regarding bone mineral density (BMD) among adolescents with nontransfusion-dependent thalassemia (NTDT). Indeed, only BMD data in patients with nontransfusion-dependent (NTD) β-thalassemia intermedia have been reported. No previous study has investigated BMD among adolescents with NTD hemoglobin (Hb) E/β-thalassemia. To determine the prevalence of low bone mass among adolescents with NTD Hb E/β-thalassemia and factors relating to low bone mass. We investigated BMD of lumbar spine (L2-L4; BMDLS) and total body (BMDTB), as measured by dual-energy X-ray absorptiometry, in 22 adolescents (aged 13.2-20 years) with NTD Hb E/β-thalassemia. Low bone mass was found to be 18.2% and 22.7% at the lumbar spine (BMDLS Z-score adjusted for bone age and height age) and 13.6% and 9.1% at the total body (BMDTB Z-score adjusted for bone age and height age). Patients with mean Hb level <8 g/dl were more likely to have low bone mass (BMDLS and BMDTB Z-scores adjusted for bone age) compared to those with Hb level ≥ 8 g/dl. Mean Hb level correlated with BMDLS and BMDTB Z-scores adjusted for bone age. We demonstrated that a low Hb level was associated with low bone mass among adolescents with NTD Hb E/β-thalassemia. A significant proportion of low bone mass among these patients highlights the importance of appropriate management, including red cell transfusion, vitamin D and calcium supplementation for improved long-term bone health. © 2017 Wiley Periodicals, Inc.
Folkloric Art in Egyptian Schools.
ERIC Educational Resources Information Center
Osman, Siham
1983-01-01
Theories in art education with a western origin have been applied in Egypt to support the revival of folkloric art. There are three important phases in the teaching of a unit on applique, a decorative craft dating back to the earliest Egyptian history. (AM)
Genetic diversity in Egyptian and Italian goat breeds measured with microsatellite polymorphism.
Agha, S H; Pilla, F; Galal, S; Shaat, I; D'Andrea, M; Reale, S; Abdelsalam, A Z A; Li, M H
2008-06-01
Seven microsatellite markers were used to study genetic diversity of three Egyptian (Egyptian Baladi, Barki and Zaraibi) and two Italian (Maltese and Montefalcone) goat breeds. The microsatellites showed a high polymorphic information content (PIC) of more than 0.5 in most of the locus-breed combinations and indicated that the loci were useful in assessing within- and between-breed variability of domestic goat (Capra hircus). The expected heterozygosity of the breeds varied from 0.670 to 0.792. In the geographically wider distributed Egyptian Baladi breed there were indications for deviations from random breeding. Analysis of genetic distances and population structure grouped the three Egyptian goat breeds together, and separated them from the two Italian breeds. The studied Mediterranean breeds sampled from African and European populations seem to have differentiated from each other with only little genetic exchange between the geographically isolated populations.
Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh
2018-04-01
The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P < 0.01) but not with carboxymethyl-lysine. The NTBI was markedly increased in the β-thalassemia patients, and its levels correlated significantly with both carboxymethyl-lysine and pentosidine (P < 0.05). Our findings confirm the oxidative status generated by the iron overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thein, S.L.; Hesketh, C.; Wood, W.G.
Analysis of the molecular basis of dominantly inherited {beta}-thalassemia in four families has revealed different mutations involving exon 3 of the {beta}-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of {beta}-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation.
Papapetrou, Eirini P
2017-01-01
In recent years, breakthroughs in human pluripotent stem cell (hPSC) research, namely cellular reprogramming and the emergence of sophisticated genetic engineering technologies, have opened new frontiers for cell and gene therapy. The prospect of using hPSCs, either autologous or histocompatible, as targets of genetic modification and their differentiated progeny as cell products for transplantation, presents a new paradigm of regenerative medicine of potential tremendous value for the treatment of blood disorders, including beta-thalassemia (BT) and sickle cell disease (SCD). Despite advances at a remarkable pace and great promise, many roadblocks remain before clinical translation can be realistically considered. Here we discuss the theoretical advantages of cell therapies utilizing hPSC derivatives, recent proof-of-principle studies and the main challenges towards realizing the potential of hPSC therapies in the clinic.
The Marskhod Egyptian Drill Project
NASA Astrophysics Data System (ADS)
Shaltout, M. A. M.
We describe a possible participation of Egypt in a future Mars rover Mission. It was suggested that Egypt participate through involvement in the design, building and testing of a drill to obtain sub-surface samples. The Space Research Institute of the Russian Academy of Sciences (IKI), formally invited the Egyptian Ministry of Scientific Research to study the concept for potential use on the Russian Mars 2001 Mission. As one of the objectives of the Marskhod mission was the analysis of sub-surface samples, a drilling mechanism in the payload would be essential. The Egyptian expertise in drill development is associated with the archaeological exploration of the Pyramids. A sophisticated drilling system perforated limestone to a depth of 2 m without the use of lubricants or cooling fluids that might have contaminated the Pit's environment. This experience could have been applied to a drill development Mars 2001 mission, which was unfortunately canceled due to economic problems.
Chawla, Swati; Singh, Rajnish Kumar; Lakkakula, Bhaskar V K S; Vadlamudi, Raghavendra Rao
2017-07-01
β-thalassemia is an autosomal recessive blood disorder caused by gene mutations that affect all aspects of β-globin production. In majority of Asian countries including India, the frequency of β-thalassemia is closely intertwined with social, cultural, and religious issues of the respective country. Several national level screening programs imparted education regarding β-thalassemia, but follow-up evaluation revealed that education was not effective. It has been hypothesized that the beliefs and attitudes, carrier screening, and education among "high risk communities" will have far-reaching implications towards β-thalassemia prevention in the country. The present study is aimed to investigate attitudes, intention, and behavior of β-thalassemia high- and low-risk ethnic groups towards carrier screening and education. A structured questionnaire on knowledge, attitude, and practice regarding β-thalassemia was administered on 926 individuals belong to Arora, a high-risk ethnic group for β-thalassemia (347 rural (AR) and 202 urban (AU)) and 377 cosmopolitan commoners (CC) aged above 18 years of both sexes. To understand the relationship between various questions, Pearson's correlation test and factor analysis was performed. The responses were further categorized into the theory of planned behavior (TPB) constructs with the measures of the main constructs reported as a mean. Various dimensions of knowledge, attitude, and practice reveal that the urban groups (AU and CC) are better aware of the disease "β-thalassemia" than the rural group (AR) who witness suffering at close quarters. The AR group is more positive for preventive measures than the urban groups. Significant correlations and factor analysis show "intentions" for premarital and prenatal screening highly loaded as outcome behaviors. The Ajzen's "Theory of planned behavior" support that the "intention" and "perceived behavior control" are better predictors of "outcome behavior" compared to "attitude
Al-Nood, Hafiz; Al-Hadi, Abdulrahman
2013-01-01
In Yemen, the prevalence of sickle cell trait and β-thalassemia trait are high. The aim of this premarital program is to identify sickle cell and thalassemia carrier couples in Yemen before completing marriages proposal, in order to prevent affected birth. This can be achieved by applying a low-cost premarital screening program using simple blood tests compatible with the limited health resources of the country. If microcytosis or positive sickle cell is found in both or one partner has microcytosis and the other has positive sickle cell, so their children at high risk of having sickle cell or/and thalassemia diseases. Carrier couples will be referred to genetic counseling. The outcomes of this preventive program are predicted to decrease the incidence of affected birth and reduce the health burden of these disorders. The success of this program also requires governmental, educational and religious supports. PMID:25003062
NASA Astrophysics Data System (ADS)
Chen, Jiemei; Peng, Lijun; Han, Yun; Yao, Lijun; Zhang, Jing; Pan, Tao
2018-03-01
Near-infrared (NIR) spectroscopy combined with chemometrics was applied to rapidly analyse haemoglobin A2 (HbA2) for β-thalassemia screening in human haemolysate samples. The relative content indicator HbA2 was indirectly quantified by simultaneous analysis of two absolute content indicators (Hb and Hb • HbA2). According to the comprehensive prediction effect of the multiple partitioning of calibration and prediction sets, the parameters were optimized to achieve modelling stability, and the preferred models were validated using the samples not involved in modelling. Savitzky-Golay smoothing was firstly used for the spectral pretreatment. The absorbance optimization partial least squares (AO-PLS) was used to eliminate high-absorption wave-bands appropriately. The equidistant combination PLS (EC-PLS) was further used to optimize wavelength models. The selected optimal models were I = 856 nm, N = 16, G = 1 and F = 6 for Hb and I = 988 nm, N = 12, G = 2 and F = 5 for Hb • HbA2. Through independent validation, the root-mean-square errors and correlation coefficients for prediction (RMSEP, RP) were 3.50 g L- 1 and 0.977 for Hb and 0.38 g L- 1 and 0.917 for Hb • HbA2, respectively. The predicted values of relative percentage HbA2 were further calculated, and the calculated RMSEP and RP were 0.31% and 0.965, respectively. The sensitivity and specificity for β-thalassemia both reached 100%. Therefore, the prediction of HbA2 achieved high accuracy for distinguishing β-thalassemia. The local optimal models for single parameter and the optimal equivalent model sets were proposed, providing more models to match possible constraints in practical applications. The NIR analysis method for the screening indicator of β-thalassemia was successfully established. The proposed method was rapid, simple and promising for thalassemia screening in a large population.
Patanè, Salvatore; Marte, Filippo
2010-01-21
Thalassemia is a congenital hemoglobinopathy leading to anemia because of impaired erythropoiesis and peripheral hemolysis. Thalassemia major patients are transfusion dependent and it results in iron accumulation. The heart is one of the major organs affected with iron overload and iron induced cardiac dysfunction (pump and conduction abnormalities) remains the number one cause of death among thalassemia major patients. It has been reported that a high ferritin concentration is related to high troponin levels in hemodialysis patients receiving more intravenous iron sucrose. Abnormal troponin I levels have also been reported without acute coronary syndrome. We present a case of abnormal troponin I levels in Thalassemia major patient with high ferritin concentration, permanent atrial fibrillation and without acute coronary syndrome. To our knowledge, this is the first report of abnormal troponin I levels in a Thalassemia major patient with high ferritin concentration and without acute coronary syndrome and also this case focuses attention on the importance of the correct evaluation of abnormal troponin I levels. Copyright (c) 2008 Elsevier Ireland Ltd. All rights reserved.
Evaluation of municipal solid waste management in egyptian rural areas.
El-Messery, Mamdouh A; Ismail, Gaber A; Arafa, Anwaar K
2009-01-01
A two years study was conducted to evaluate the solid waste management system in 143 villages representing the Egyptian rural areas. The study covers the legal responsibilities, service availability, environmental impacts, service providers, financial resources, private sector participation and the quality of collection services. According to UN reports more than 55% of Egyptian population lives in rural areas. A drastic change in the consumption pattern altered the quantity and quality of the generated solid wastes from these areas. Poor solid waste management systems are stigmata in most of the Egyptian rural areas. This causes several environmental and health problems. It has been found that solid waste collection services cover only 27% of the surveyed villages, while, the statistics show that 75% of the surveyed villages are formally covered. The service providers are local villager units, private contractors and civil community associations with a percentage share 71%, 24% and 5% respectively. The operated services among these sectors were 25%, 71% and 100% respectively. The share of private sector in solid waste management in rural areas is still very limited as a result of the poverty of these communities and the lack of recyclable materials in their solid waste. It has been found that direct throwing of solid waste on the banks of drains and canals as well as open dumping and uncontrolled burning of solid waste are the common practice in most of the Egyptian rural areas. The available land for landfill is not enough, pitiable designed, defectively constructed and unreliably operated. Although solid waste generated in rural areas has high organic contents, no composting plant was installed. Shortage in financial resources allocated for valorization of solid waste management in the Egyptian rural areas and lower collection fees are the main points of weakness which resulted in poor solid waste management systems. On the other hand, the farmer's participation
Nephrogenic diabetes insipidus with intracranial calcification in a child with thalassemia minor.
Dimple, Jain; Alka, Jadhav; Mona, Gajre; Atul, Deshmukh
2013-09-01
There are numerous causes for intracranial calcification in children. We describe an unusual cause of intracranial calcification in a child, namely, nephrogenic diabetes insipidus (NDI). A 12-year-old boy presented with seizures and developmental delay. MRI of the brain revealed intracranial calcification. Evaluation showed findings suggestive of NDI. The lack of evidence of any other metabolic defect suggests that these calcifications were secondary to NDI. He also had anemia for which he was investigated and diagnosed as thalassemia minor. Detailed literature review failed to reveal any reported association between NDI and thalassemia minor. We report this case to emphasize the importance of early diagnosis and treatment of NDI to prevent organic brain damage.
Hemolysis area: A new parameter of erythrocyte osmotic fragility for screening of thalassemia trait
Tatu, Thanusak; Sweatman, Denis
2018-01-01
BACKGROUND: One-tube osmotic fragility test (OFT) is widely used for screening thalassemia traits. Interobserver variation may occur with 0.36% NaCl-based OFT due to the naked eye result reading style. PURPOSE: The purpose of this study was to establish and evaluate the novel numerical OFT-based parameter, so-called hemolysis area (HA), in screening thalassemia traits. MATERIALS AND METHODS: The portable spectrophotometer was invented capable of calculating the HA values. The HA values were then compared among 69, 156, and 19 blood samples having positive, negative, and suspicious 0.36% NaCl-based OFT results, respectively; 109 and 135 blood samples having mean corpuscular volume (MCV) ≤80 fL and >80 fL, respectively; and 138 and 106 blood samples having mean corpuscular hemoglobin (MCH) ≤27 pg and >27 pg, respectively. In addition, the HA values were compared in 166 blood samples having different globin gene genotypes. Finally, the HA cutoff value was determined by receiver operation curve (ROC) analysis. RESULTS: The HA values in samples having positive, suspicious, and negative 0.36% NaCl-based OFT were 33.3 ± 14.4, 42.9 ± 10.5, and 65.3 ± 13.4, respectively; in sample having MCV ≤80 fL and >80 fL were 43.1 ± 19.6 and 63.8 ± 14.5, respectively; and in samples having MCH ≤27 pg and >27 pg were 46.7 ± 20.1 and 64.8 ± 14.2, respectively. The HA values in normal, hemoglobin E, SEA-α thalassemia 1, and β-thalassemia traits were 67.1 ± 12.6, 36.4 ± 13.9, 20.2 ± 4.8, and 18.6 ± 1.1, respectively. All were significantly different. ROC analysis established 52.4 as the HA cutoff that had comparable effectiveness to the conventional screening tests. CONCLUSION: The new HA value was effective and could be an alternative choice for screening thalassemia traits. PMID:29692590
Satitthummanid, Sudarat; Uaprasert, Noppacharn; Songmuang, Smonporn Boonyaratavej; Rojnuckarin, Ponlapat; Tosukhowong, Piyaratana; Sutcharitchan, Pranee; Srimahachota, Suphot
2017-09-01
Mechanisms of vascular disorders in β-thalassemia/HbE patients remain poorly understood. In the present study, we aimed to determine the presence of endothelial dysfunction and its association with altered vascular mediators in this population. Forty-three β-thalassemia/HbE patients without clinically documented vascular symptoms and 43 age-sex-matched healthy controls were enrolled. Endothelial function was assessed using flow-mediated dilatation (FMD) before and after administration of nitroglycerine (NTG). β-Thalassemia/HbE patients showed a significant endothelial dysfunction using FMD. The percentage change in the brachial artery diameter before NTG was significantly lower in the thalassemia group compared to the control (5.0 ± 5.9 vs. 9.0 ± 4.0%, p < 0.01) while no significant differences after NTG (18.4 ± 8.3 vs. 17.8 ± 6.3%, p = 0.71). Plasma nitric oxide metabolites (NO x ) and prostaglandin E 2 (PGE 2 ) levels were significantly decreased in β-thalassemia/HbE (117.2 ± 27.3 vs. 135.8 ± 11.3 µmol/L, p < 0.01) and (701.9 ± 676.0 vs. 1374.7 ± 716.5 pg/mL, p < 0.01), respectively, while a significant elevation in soluble thrombomodulin levels in β-thalassemia/HbE (3587.7 ± 1310.0 vs. 3093.9 ± 583.8 pg/mL, p = 0.028). NO x and PGE 2 levels were significantly correlated with FMD (r = 0.27, p = 0.025) and (r = 0.35, p = 0.003), respectively. These findings suggest roles for endothelial mediators and a new mechanism underlying endothelial dysfunction in β-thalassemia/HbE patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rund, D.; Cohen, T.; Filon, D.
{beta}-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the {beta}-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of {beta}-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered inmore » any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of {beta}-thalassemia in this small ethnic isolate.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rogers, Z.R.; Powars, D.R.; Williams, W.D.
Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individualsmore » is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.« less
Ottoman Perception of Egyptian Students
ERIC Educational Resources Information Center
Yilmaz, Ali
2015-01-01
This research was carried out before the period described as "Arab Spring" in Egypt which is one of the highly effective countries of Middle East in political, economic and demographic structuring. The aim was to determine the Ottoman Turks image of Egyptian secondary school third grade students. Descriptive scanning model out of…
Vatte, Chittibabu; Borgio, J. Francis; Al-Rubaish, Abdullah; Nasserullah, Zaki A.; Jarrash, Sana Al; Sulaiman, Ahmed; Qutub, Hatem; Alsaleem, Hassan; Alzahrani, Alhusain J.; Steinberg, Martin H.
2017-01-01
Background and Objectives. β-Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β-globin chain production, respectively. The elevation of fetal hemoglobin (HbF) can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs), BCL11A, HBG2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β-thalassemia patients. Materials and Methods. A total of 174 transfusion-dependent β-thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs) from the three QTL regions using TaqMan assay on real-time PCR. Results. Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p = 0.0009, rs9399137C p = 0.008, rs4895441G p = 0.004, rs9389269C p = 0.008, rs9402686A p = 0.008, and rs9494142C p = 0.002) were predominantly associated with β-thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p = 0.022) and HBG2 (GTT p = 0.009) were also predominantly associated with β-thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion. The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β-thalassemia. PMID:28280727
Cyrus, Cyril; Vatte, Chittibabu; Borgio, J Francis; Al-Rubaish, Abdullah; Chathoth, Shahanas; Nasserullah, Zaki A; Jarrash, Sana Al; Sulaiman, Ahmed; Qutub, Hatem; Alsaleem, Hassan; Alzahrani, Alhusain J; Steinberg, Martin H; Ali, Amein K Al
2017-01-01
Background and Objectives . β -Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β -globin chain production, respectively. The elevation of fetal hemoglobin (HbF) can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs), BCL11A , HBG 2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β -thalassemia patients. Materials and Methods . A total of 174 transfusion-dependent β -thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs) from the three QTL regions using TaqMan assay on real-time PCR. Results . Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p = 0.0009, rs9399137C p = 0.008, rs4895441G p = 0.004, rs9389269C p = 0.008, rs9402686A p = 0.008, and rs9494142C p = 0.002) were predominantly associated with β -thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p = 0.022) and HBG 2 (GTT p = 0.009) were also predominantly associated with β -thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion . The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β -thalassemia.
Assessing Egyptian Public Support for Security Crackdowns in the Sinai
2015-02-01
Leadership and Development contributes to the education of world class senior leaders, develops expert knowledge, and provides solutions to...case when the Ottoman army invaded it in the early stages of World War I, and when the Israelis invaded it in 1956 and 1967). Former Egyptian...much of the Arab world for concluding a so-called “separate peace” with Israel, Sadat and most Egyptian citizens held the view that Egypt had made
Sahli, Chaima Abdelhafidh; Ben Salem, Ikbel; Jouini, Latifa; Laouini, Naouel; Dabboubi, Rym; Hadj Fredj, Sondes; Siala, Hajer; Othmeni, Rym; Dakhlaoui, Boutheina; Fattoum, Slaheddine; Bibi, Amina; Messaoud, Taieb
2016-09-01
β-Thalassemia is one of the most prevalent worldwide autosomal recessive disorders. It presents a great molecular heterogeneity resulting from more than 200 causative mutations in the β-globin gene. In Tunisia, β-thalassemia represents the most prevalent monogenic hemoglobin disorder with 2.21% of carriers. Efficient and reliable mutation-screening methods are essential in order to establish appropriate prevention programs for at risk couples. The aim of the present study is to develop an efficient method based on the denaturing high-performance liquid chromatography (DHPLC) in which the whole β-globin gene (HBB) is screened for mutations covering about 90% of the spectrum. We have performed the validation of a DHPLC assay for direct genotyping of 11 known β-thalassemia mutations in the Tunisian population. DHPLC assay was established based on the analysis of 62 archival β-thalassemia samples previously genotyped then validated with full concordance on 50 tests with blind randomized samples previously genotyped with DNA sequencing and with 96% of consistency on 40 samples as a prospective study. Compared to other genotyping techniques, the DHPLC method can meet the requirements of direct genotyping of known β-thalassemia mutations in Tunisia and to be applied as a powerful tool for the genetic screening of prenatal and postnatal individuals. © 2016 Wiley Periodicals, Inc.
β-Globin chain abnormalities with coexisting α-thalassemia mutations
Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan
2012-01-01
Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075
DOE Office of Scientific and Technical Information (OSTI.GOV)
Popp, R.A.; Popp, D.M.; Johnson, F.M.
Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less
Rivella, Stefano
2015-04-01
β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.
β-Thalassemia: HiJAKing Ineffective Erythropoiesis and Iron Overload
Melchiori, Luca; Gardenghi, Sara; Rivella, Stefano
2010-01-01
β-thalassemia encompasses a group of monogenic diseases that have in common defective synthesis of β-globin. The defects involved are extremely heterogeneous and give rise to a large phenotypic spectrum, with patients that are almost asymptomatic to cases in which regular blood transfusions are required to sustain life. As a result of the inefficient synthesis of β-globin, the patients suffer from chronic anemia due to a process called ineffective erythropoiesis (IE). The sequelae of IE lead to extramedullary hematopoiesis (EMH) with massive splenomegaly and dramatic iron overload, which in turn is responsible for many of the secondary pathologies observed in thalassemic patients. The processes are intimately linked such that an ideal therapeutic approach should address all of the complications. Although β-thalassemia is one of the first monogenic diseases to be described and represents a global health problem, only recently has the scientific community started to focus on the real molecular mechanisms that underlie this disease, opening new and exciting therapeutic perspectives for thalassemic patients worldwide. PMID:20508726
Chen, Diyu; Zuo, Yangjin; Zhang, Xinhua; Ye, Yuhua; Bao, Xiuqin; Huang, Haiyan; Tepakhan, Wanicha; Wang, Lijuan; Ju, Junyi; Chen, Guangfu; Zheng, Mincui; Liu, Dun; Huang, Shuodan; Zong, Lu; Li, Changgang; Chen, Yajun; Zheng, Chenguang; Shi, Lihong; Zhao, Quan; Wu, Qiang; Fucharoen, Supan; Zhao, Cunyou; Xu, Xiangmin
2017-07-06
A delayed fetal-to-adult hemoglobin (Hb) switch ameliorates the severity of β-thalassemia and sickle cell disease. The molecular mechanism underlying the epigenetic dysregulation of the switch is unclear. To explore the potential cis-variants responsible for the Hb switching, we systematically analyzed an 80-kb region spanning the β-globin cluster using capture-based next-generation sequencing of 1142 Chinese β-thalassemia persons and identified 31 fetal hemoglobin (HbF)-associated haplotypes of the selected 28 tag regulatory single-nucleotide polymorphisms (rSNPs) in seven linkage disequilibrium (LD) blocks. A Ly1 antibody reactive (LYAR)-binding motif disruptive rSNP rs368698783 (G/A) from LD block 5 in the proximal promoter of hemoglobin subunit gamma 1 (HBG1) was found to be a significant predictor for β-thalassemia clinical severity by epigenetic-mediated variant-dependent HbF elevation. We found this rSNP accounted for 41.6% of β-hemoglobinopathy individuals as an ameliorating factor in a total of 2,738 individuals from southern China and Thailand. We uncovered that the minor allele of the rSNP triggers the attenuation of LYAR and two repressive epigenetic regulators DNA methyltransferase 3 alpha (DNMT3A) and protein arginine methyltransferase 5 (PRMT5) from the HBG promoters, mediating allele-biased γ-globin elevation by facilitating demethylation of HBG core promoter CpG sites in erythroid progenitor cells from β-thalassemia persons. The present study demonstrates that this common rSNP in the proximal A γ-promoter is a major genetic modifier capable of ameliorating the severity of thalassemia major through the epigenetic-mediated regulation of the delayed fetal-to-adult Hb switch and provides potential targets for the treatment of β-hemoglobinopathy. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Correction of β-thalassemia mutant by base editor in human embryos.
Liang, Puping; Ding, Chenhui; Sun, Hongwei; Xie, Xiaowei; Xu, Yanwen; Zhang, Xiya; Sun, Ying; Xiong, Yuanyan; Ma, Wenbin; Liu, Yongxiang; Wang, Yali; Fang, Jianpei; Liu, Dan; Songyang, Zhou; Zhou, Canquan; Huang, Junjiu
2017-11-01
β-Thalassemia is a global health issue, caused by mutations in the HBB gene. Among these mutations, HBB -28 (A>G) mutations is one of the three most common mutations in China and Southeast Asia patients with β-thalassemia. Correcting this mutation in human embryos may prevent the disease being passed onto future generations and cure anemia. Here we report the first study using base editor (BE) system to correct disease mutant in human embryos. Firstly, we produced a 293T cell line with an exogenous HBB -28 (A>G) mutant fragment for gRNAs and targeting efficiency evaluation. Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB -28 (A>G) homozygous mutation. Data showed that base editor could precisely correct HBB -28 (A>G) mutation in the patient's primary cells. To model homozygous mutation disease embryos, we constructed nuclear transfer embryos by fusing the lymphocyte or skin fibroblast cells with enucleated in vitro matured (IVM) oocytes. Notably, the gene correction efficiency was over 23.0% in these embryos by base editor. Although these embryos were still mosaic, the percentage of repaired blastomeres was over 20.0%. In addition, we found that base editor variants, with narrowed deamination window, could promote G-to-A conversion at HBB -28 site precisely in human embryos. Collectively, this study demonstrated the feasibility of curing genetic disease in human somatic cells and embryos by base editor system.
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
Martino, F; Di Mauro, R; Paciaroni, K; Gaziev, J; Alfieri, C; Greco, L; Floris, R; Di Girolamo, S; Di Girolamo, M
2018-03-01
Sickle cell anemia (SCA) and β -thalassemia major are well-recognized beta-globin gene disorders of red blood cells associated to mortality and morbidity included bone morbidities due to ineffective erythropoiesis and bone marrow expansion, which affect every part of the skeleton. While there are an abundance of described disease manifestations of the head and neck, the manner of paranasal sinuses involvement and its relations to β-thalassemia and SCA process was not studied yet. Therefore, the aim of this study was to investigate a possible increased risk of rhinosinusitis and the real pathogenetic mechanism of it, comparing these two hematological diseases using msCT, gold standard for paranasal sinuses evaluation. A retrospective analysis of 90 patients affected by β-thalassemia major or SCA (respectively 59 and 31) underwent allogeneic bone marrow transplantation (BMT), and 44 control subjects was performed. Both patient categories and control group have been subjected to hematological and radiological evaluation using 64-multidetector-row CT scanner without contrast injection. Statistical analysis reveals that patients of the two study groups exhibit a significantly increased risk of sinusitis in comparison with the normal controls (RR: 3.55 for β-thalassemic pediatric subjects; RR: 3.35 for SCA pediatric subjects). A significant difference (p < 0,5) was found between the β -thalassemic patients on the one side, and SCA and control group on the other side, with regard to the evaluation of the typical anatomic alteration of maxillary sinus: β-thalassemic children had significant increase in the bone thickness of anterior and lateral sinus walls and significant reduction in volume and density compared to SCA patients and control group, with normal conditions of these parameters. In these hematological patients, there is an increased incidence of sinonasal infections due their therapy-induced immunosuppression post transplantation. In
Anaemia among Egyptian Children between 2000 and 2005: trends and predictors.
Austin, Anne M; Fawzi, Wafaie; Hill, Allan G
2012-10-01
Anaemia remains the most prevalent nutritional disorder among women and children in the Middle East and North Africa region. We examined anaemia trends using data from the Egyptian Demographic and Health Surveys. Between 2000 and 2005, the prevalence of anaemia (defined as haemoglobin concentrations <11 g dL(-1) ) increased from 37.04% to over 52% among Egyptian children between 12 months and 36 months of age. We examined the associations of these changes with food consumption, vitamin A administration, recent illness, immunization status, socio-demographic factors and a child's anaemic status. Children under the age of 24 months who had recently been sick and those who resided in Upper Egypt were significantly more likely to be anaemic. Despite significant improvements in water and sanitation facilities, maternal education and asset-based household wealth, there were marked declines in the consumption of nutritive foods and increases in the prevalence of childhood diarrhoea between 2000 and 2005. Placing these analyses in the broader context of Egyptian economic trends suggests that the nutritional basket consumed by Egyptian households between 2000 and 2005 may have shifted towards less nutritive foods with lower costs per calorie, probably in response to economic difficulties and increasing food prices. Shifts in dietary consumption, in conjunction with increases in diarrhoea, are likely contributing to the rapid increase in childhood anaemia in Egypt between 2000 and 2005. National-level fortification efforts may be one way to combat rising levels of anaemia among Egyptian women and children. © 2011 Blackwell Publishing Ltd.
Delta-Beta Thalassaemia in a Pathan Family.
Ahmad, Saqib Qayyum; Zafar, Saerah Iffat; Malik, Hamid Saeed; Ahmed, Suhaib
2017-11-01
Delta-beta-thalassaemia (δβ-thalassaemia) is a rare type of thalassaemia which mostly results from deletion of δ and β genes with preservation of γ genes. δβ-thalassaemia is classified into (δβ)+ and (δβ)0 types. The (δβ)0-thalassemia is further divided into GγAγ(δβ)0-thalassaemia and Gγ(Aγδβ)0-thalassaemia. In heterozygous state, (δβ)0mutations give rise to phenotype resembling β-thalassaemia trait but with raised Hb-F, ranging from 5 to 20%, without a rise in Hb-A2. In homozygotes, the clinical picture is usually that of thalassaemia intermedia and the patients have 100% Hb-F. Workup of a 1-year child suffering from pallor, chronic ill health, and splenomegaly referred to our laboratory with the suspicion of β-thalassaemia, ultimately resulted in a diagnosis on polymerase chain reaction as having homozygous inversion/deletion Gγ(Aγδβ)0-thalassaemia. Her family members were also investigated.
Tapsoba, Issa; Arbault, Stéphane; Walter, Philippe; Amatore, Christian
2010-01-15
Lead-based compounds were used during antiquity as both pigments and medicines in the formulation of makeup materials. Chemical analysis of cosmetics samples found in Egyptians tombs and the reconstitution of ancient recipes as reported by Greco-Roman authors have shown that two non-natural lead chlorides (laurionite Pb(OH)Cl and phosgenite Pb(2)Cl(2)CO(3)) were purposely synthesized and were used as fine powders in makeup and eye lotions. According to ancient Egyptian manuscripts, these were essential remedies for treating eye illness and skin ailments. This conclusion seems amazing because today we focus only on the well-recognized toxicity of lead salts. Here, using ultramicroelectrodes, we obtain new insights into the biochemical interactions between lead(II) ions and cells, which support the ancient medical use of sparingly soluble lead compounds. Submicromolar concentrations of Pb(2+) ions are shown to be sufficient for eliciting specific oxidative stress responses of keratinocytes. These consist essentially of an overproduction of nitrogen monoxide (NO degrees ). Owing to the biological role of NO degrees in stimulating nonspecific immunological defenses, one may argue that these lead compounds were deliberately manufactured and used in ancient Egyptian formulations to prevent and treat eye illnesses by promoting the action of immune cells.
Pornprasert, Sakorn; Tookjai, Monthathip; Punyamung, Manoo; Pongpunyayuen, Panida; Jaiping, Kanokwan
2016-01-01
To date, the hemoglobin (Hb) typing control materials for laboratory investigation of thalassemia with low (1.8%-3.2%) and high (4%-6%) levels of HbA2 are available but there are no Hb typing quality control materials for analysis of thalassemia and hemoglobinopathies which are highly prevalent in South-East Asian countries. The main aim of the present study was to develop the lyophilized Hb typing control materials for laboratory investigation of thalassemia and hemoglobinopathies that are commonly found in South-East Asia. Erythrocytes of blood samples containing Hb Bart's, HbH, HbE, HbF, Hb Constant Spring (CS), Hb Hope, and Hb Q-Thailand were washed and dialysed with 0.85% saline solution. The erythrocytes were then lysed in 5% sucrose solution. The lyophilized Hb typing control materials were prepared by using a freeze drying (lyophilization) method. The high performance liquid chromatography (HPLC) analysis of lyophilized Hb was performed after the storage at -20 °C for 1 year and also after reconstitution and storage at 4 or -20 °C for 30 days. In addition, the Hb analysis was compared between the three different methods of HPLC, low pressure liquid chromatography (LPLC) and capillary electrophoresis (CE). Following a year of storage at -20 °C, the HPLC chromatograms of lyophilized Hb typing control materials showed similar patterns to the equivalent fresh whole blood. The stability of reconstituted Hb typing control materials was also observed through 30 days after reconstitution and storage at -20 °C. Moreover, the Hb typing control materials could be analyzed by three methods, HPLC, LPLC and CE. Even a degraded peak of HbCS was found on CE electropherogram. The lyophilized Hb typing control materials could be developed and used as control materials for investigation of thalassemia and hemoglobinopathies.
Casale, Maddalena; Meloni, Antonella; Filosa, Aldo; Cuccia, Liana; Caruso, Vincenzo; Palazzi, Giovanni; Gamberini, Maria Rita; Pitrolo, Lorella; Putti, Maria Caterina; D'Ascola, Domenico Giuseppe; Casini, Tommaso; Quarta, Antonella; Maggio, Aurelio; Neri, Maria Giovanna; Positano, Vincenzo; Salvatori, Cristina; Toia, Patrizia; Valeri, Gianluca; Midiri, Massimo; Pepe, Alessia
2015-08-01
Cardiovascular magnetic resonance (CMR) plays a key role in the management of thalassemia major patients, but few data are available in pediatric population. This study aims at a retrospective multiparametric CMR assessment of myocardial iron overload, function, and fibrosis in a cohort of pediatric thalassemia major patients. We studied 107 pediatric thalassemia major patients (61 boys, median age 14.4 years). Myocardial and liver iron overload were measured by T2* multiecho technique. Atrial dimensions and biventricular function were quantified by cine images. Late gadolinium enhancement images were acquired to detect myocardial fibrosis. All scans were performed without sedation. The 21.4% of the patients showed a significant myocardial iron overload correlated with lower compliance to chelation therapy (P<0.013). Serum ferritin ≥2000 ng/mL and liver iron concentration ≥14 mg/g/dw were detected as the best threshold for predicting cardiac iron overload (P=0.001 and P<0.0001, respectively). A homogeneous pattern of myocardial iron overload was associated with a negative cardiac remodeling and significant higher liver iron concentration (P<0.0001). Myocardial fibrosis by late gadolinium enhancement was detected in 15.8% of the patients (youngest children 13 years old). It was correlated with significant lower heart T2* values (P=0.022) and negative cardiac remodeling indexes. A pathological magnetic resonance imaging liver iron concentration was found in the 77.6% of the patients. Cardiac damage detectable by a multiparametric CMR approach can occur early in thalassemia major patients. So, the first T2* CMR assessment should be performed as early as feasible without sedation to tailor the chelation treatment. Conversely, late gadolinium enhancement CMR should be postponed in the teenager age. © 2015 American Heart Association, Inc.
Education and employment status of children and adults with thalassemia in North America.
Pakbaz, Zahra; Treadwell, Marsha; Kim, Hae-Young; Trachtenberg, Felicia; Parmar, Nagina; Kwiatkowski, Janet L; Cunningham, Melody J; Martin, Marie; Sweeters, Nancy; Neufeld, Ellis J; Giardina, Patricia J; Olivieri, Nancy; Yamashita, Robert C; Vichinsky, Elliott
2010-10-01
Advances in the management of thalassemia have resulted in increased life expectancy and new challenges. We conducted the first survey of education and employment status of people with thalassemia in North America. A total of 633 patients (349 adults and 284 school age children) enrolled in the Thalassemia Clinical Research Network (TCRN) registry in Canada and the U.S. were included in the data analysis. Predictors considered for analysis were age, gender, race/ethnicity, site of treatment (Canada vs. United States), transfusion and chelation status, serum ferritin, and clinical complications. Seventy percent of adults were employed of which 67% reported working full-time. Sixty percent had a college degree and 14% had achieved some post-college education. Eighty-two percent of school age children were at expected grade level. In a multivariate analysis for adults, Whites (OR = 2.76, 95% CI: 1.50-5.06) were more likely to be employed compared to Asians. Higher education in adults was associated with older age (OR = 1.67, 95% CI: 1.29-2.15), female gender (OR = 2.08, 95% CI: 1.32-3.23) and absence of lung disease (OR = 14.3, 95% CI: 2.04-100). Younger children (OR = 5.7 for 10-year increments, 95% CI: 2.0-16.7) and Canadian patients (OR = 5.6, 95% CI: 1.5-20) were more likely to be at the expected education level. Neither transfusion nor chelation was associated with lower employment or educational achievement. Individuals with thalassemia in North America can achieve higher education; however, full-time employment remains a problem. Transfusion and chelation do not affect employment or education status of this patient population. Copyright 2010 Wiley-Liss, Inc.
2,000 Year old β-thalassemia case in Sardinia suggests malaria was endemic by the Roman period.
Viganó, Claudia; Haas, Cordula; Rühli, Frank J; Bouwman, Abigail
2017-10-01
The island of Sardinia has one of the highest incidence rates of β-thalassemia in Europe due to its long history of endemic malaria, which, according to historical records, was introduced around 2,600 years ago by the Punics and only became endemic around the Middle Ages. In particular, the cod39 mutation is responsible for more than 95% of all β-thalassemia cases observed on the island. Debates surround the origin of the mutation. Some argue that its presence in the Western Mediterranean reflects the migration of people away from Sardinia, others that it reflects the colonization of the island by the Punics who might have carried the disease allele. The aim of this study was to investigate β-globin mutations, including cod39, using ancient DNA (aDNA) analysis, to better understand the history and origin of β-thalassemia and malaria in Sardinia. PCR analysis followed by sequencing were used to investigate the presence of β-thalassemia mutations in 19 individuals from three different Roman and Punic necropolises in Sardinia. The cod39 mutation was identified in one male individual buried in a necropolis from the Punic/Roman period. Further analyses have shown that his mitochondrial DNA (mtDNA) and Y-chromosome haplogroups were U5a and I2a1a1, respectively, indicating the individual was probably of Sardinian origin. This is the earliest documented case of β-thalassemia in Sardinia to date. The presence of such a pathogenic mutation and its persistence until present day indicates that malaria was likely endemic on the island by the Roman period, earlier than the historical sources suggest. © 2017 Wiley Periodicals, Inc.
The Problem of the Pyramid or Egyptian Mathematics from a Postmodern Perspective
ERIC Educational Resources Information Center
Shutler, Paul M. E.
2009-01-01
We consider Egyptian mathematics from a postmodern perspective, by which we mean suspending judgement as to strict correctness in order to appreciate the genuine mathematical insights which they did have in the context in which they were working. In particular we show that the skill which the Egyptians possessed of obtaining the general case from…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.
The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with ({sup 3}H)N-ethylmaleimide. This pool of soluble alpha chains was 0.067 {plus minus} 0.017% of hemoglobin in blood of normal adult, 0.11 {plus minus} 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% inmore » the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using ({sup 3}H)N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups.« less
Parsaee, Mozhgan; Saedi, Sedigheh; Joghataei, Pegah; Azarkeivan, Azita; Alizadeh Sani, Zahra
2017-10-01
β-Thalassemia is an inherited hemoglobin disorder resulting in chronic hemolytic anemia requiring chronic transfusion therapy. Cardiac involvement is the main cause of death in patients with thalassemia major. The narrow border is between overt myocardial dysfunction and clinically silent left ventricular (LV) dysfunction in patients with thalassemia. Therefore, we need novel parameters in different imaging techniques to discover cardiac involvement in an early and subtle stage. We explore to find a novel, straightforward and informative parameter in echocardiography as a noninvasive, economical and really routine in clinical practice. In this prospective study, 55 patients, who are known cases of β-thalassemia major, receiving long-term blood transfusions and undergoing iron chelation therapy were enrolled. Ferritin level, cardiac magnetic resonance (CMR) T2 * value, full conventional echocardiography and speckle tracking, LV regional circumferential and longitudinal strain values (%) and time-to-peak strain (ms) of 17 segments cardiac model in eyeball tomogram were measured. There was a significant reduction in global longitudinal strain (GLS) (-20.9% ± 1.9 vs. -22.2 ± 1.03) and also basal segments longitudinal strain compared to normal subjects group (-17.4% ± 2.7 vs. -19.6% ± 1.2). There was no significant difference in circumferential strain value between thalassemia patients and normal control group. Interestingly, there was no significant correlation between GLS and CMR T2 * values showing no association between cardiac iron load and longitudinal strain. Speckle tracking echocardiography could be used as a feasible method for evaluating subclinical myocardial dysfunction in patients with thalassemia major. Echocardiography, using GLS, could predict clinically silent myocardial dysfunction independent of CMR (T2 * value) and extension of iron deposition. Our study also puts forward other causes such as chronic tissue hypoxia resulting
Zohaib, Muhammad; Ansari, Saqib H; Hashim, Zehra; Shamsi, Tahir S; Zarina, Shamshad
2016-07-01
β-Thalassemia is the most common hereditary disorder characterized by reduced production of β-globin chains of hemoglobin A (HbA). In recent years, hydroxyurea (HU) has shown promising therapeutic benefits in patients with β-thalassemia by fetal hemoglobin augmentation. We have analyzed effects of hydroxyurea treatment on oxidative stress in β-thalassemia patients by assessing activities of paraoxonase (PON) and arylesterase along with malondialdehyde (MDA) and total reactive oxygen species (ROS) concentrations. Blood samples from 159 individuals including 56 HU-treated and 58 untreated β-thalassemia patients and 45 healthy controls were analyzed. PON activity was found to be highest in healthy individuals (177.76 ± 4.44 U/mL) as compared to treated (52.67 ± 3.65 U/mL) and untreated (55.11 ± 3.26 U/mL) patients. A similar trend was observed in the case of arylesterase activity in normal, β-thalassemia-treated, and untreated (210.0 ± 11.25 U/mL, 163.03 ± 9.04 U/mL, 139.77 ± 10.10 U/mL) subjects. Serum MDA concentrations (2.59 ± 0.09 nmol/mL, 2.45 ± 0.08 nmol/mL, and 1.15 ± 0.05 nmol/mL) and total ROS concentrations (3.73 ± 0.20 nmol/mL, 3.54 ± 0.23 nmol/mL, and 2.45 ± 0.14 nmol/mL) were significantly elevated in both groups (untreated and treated) as compared to healthy individuals (P < .01). Oxidative stress was found to be markedly elevated in β-thalassemia patients as compared to healthy controls. Insignificant differences were, however, observed in mean concentrations of PON1 paraoxonase and arylesterase activities, serum MDA concentration and total ROS concentrations between HU-treated and untreated patients. We propose that HU therapy alone seems to be ineffective in managing oxidative stress and is likely to offer a better clinical outcome when supplemented with efficient iron chelation therapy and antioxidants. © 2015, The American College of Clinical Pharmacology.
β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.
Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal
2016-11-01
β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.
Allen, Angela; Fisher, Christopher; Premawardhena, Anuja; Bandara, Dayananda; Perera, Ashok; Allen, Stephen; St Pierre, Timothy; Olivieri, Nancy
2012-01-01
During investigations of the phenotypic diversity of hemoglobin (Hb) E β thalassemia, a patient was encountered with persistently high levels of methemoglobin associated with a left-shift in the oxygen dissociation curve, profound ascorbate deficiency, and clinical features of scurvy; these abnormalities were corrected by treatment with vitamin C. Studies of erythropoietin production before and after treatment suggested that, as in an ascorbate-deficient murine model, the human hypoxia induction factor pathway is not totally dependent on ascorbate levels. A follow-up study of 45 patients with HbE β thalassemia showed that methemoglobin levels were significantly increased and that there was also a significant reduction in plasma ascorbate levels. Haptoglobin levels were significantly reduced, and the high frequency of the 2.2 haptoglobin genotype may place an additional pressure on ascorbate as a free-radical scavenger in this population. There was, in addition, a highly significant correlation between methemoglobin levels, splenectomy, and factors that modify the degree of globin-chain imbalance. Because methemoglobin levels are modified by several mechanisms and may play a role in both adaptation to anemia and vascular damage, there is a strong case for its further study in other forms of thalassemia and sickle-cell anemia, particularly when splenic function is defective. PMID:22885163
Banyatsuppasin, Wansa; Jindadamrongwech, Sumalee; Limrungsikul, Anchalee; Butthep, Punnee
Thalassemias and glucose-6-phosphate dehydrogenase (G6PD) deficiency are the most common inherited blood disorders. They are distributed among populations living in malaria endemic regions resulting in survival advantage from severe malaria disease. The aims of this study were to analyze the prevalence of thalassemias and G6PD deficiency at the Ramathibodi Hospital, Bangkok, Thailand. A total of 616 adult and 174 cord blood samples were collected and analyzed for red blood cell (RBC) parameters, hemoglobin (Hb) typing and DNA analysis for G6PD mutations and α-thalassemia (α-thal). The two most prominent types of thalassemia were heterozygous Hb E (HBB: c.79G>A), (19.5% in newborns and 35.6% in adults) followed by heterozygous α-thal-2 [-α 3.7 (rightward) deletion] at 18.7% in newborns and 19.5% in adults. After performing G6PD genotyping using multiplex amplification refractory mutation system-polymerase chain reaction (multiplex ARMS-PCR) for 10 G6PD mutations, the prevalence of G6PD mutation was found in 12.0% of newborns and 11.7% of adults. The G6PD Viangchan [871 (G>A)] is the most common G6PD mutation in newborns (42.9%) and adults (52.8%). In addition, coinheritance of various types of thalassemia with G6PD deficiency were found. The results indicated that heterozygous Hb E and G6PD Viangchan are predominant both in newborns and adults in this study.
Farooq, Sabiha; Mazhar, Wardah; Siddiqui, Amna Jabbar; Ansari, Saqib Hussain; Musharraf, Syed Ghulam
2018-01-31
β-Thalassemia is one of the most common inherited disorders and is widely distributed throughout the world. Owing to severe deficiencies in red blood cell production, blood transfusion is required to correct anemia for normal growth and development but causes additional complications owing to iron overload. The aim of this study is to quantify the biometal dysregulations in β-thalassemia patients as compared with healthy controls. A total of 17 elements were analyzed in serum samples of β-thalassemia patients and healthy controls using ICP-MS followed by chemometric analyses. Out of these analyzed elements, 14 showed a significant difference between healthy and disease groups at p < 0.05 and fold change >3. A PLS-DA model revealed an excellent separation with 89.8% sensitivity and 97.2% specificity and the overall accuracy of the model was 92.2%. This metallomic study revealed that there is major difference in metallomic profiling of β-thalassemia patients specifically in Co, Mn, Ni, V and Ba, whereas the fold changes in Co, Mn, V and Ba were found to be greater than that in Fe, providing evidence that, in addition to Fe, other metals are also altered significantly and therefore chelation therapy for other metals may also needed in β-thalassemia patients. Copyright © 2018 John Wiley & Sons, Ltd.
Partial Splenectomy in the treatment of an adult with β thalassemia intermedia: A case report.
Correia, João Guardado; Moreira, Nídia; Costa Almeida, Carlos Eduardo; Reis, Luís Simões
2017-01-01
Thalassemia is a common disease which treatment is often based on splenectomy. The risks associated with total splenectomy stimulated partial splenectomy as a potentially alternative therapy. A 45 year-old female patient with long term follow-up for β thalassemia intermedia started to develop signs of hypersplenism and iron overload. A partial splenectomy was performed and was observed a marked hematologic improvement while preserving the desired splenic function. Partial splenectomy proved to provide a persistent decrease in hemolytic rate while preserving the integrity of splenic phagocytic function, presenting itself as an effective alternative to total splenectomy. After being subjected to partial splenectomy, our patient experienced a sustained control of hemolysis and showed no signs of hypersplenism or iron overload. No splenic regrowth or infectious complications were observed. The major drawbacks of partial splenectomy are the increased risk of intra- and postoperative bleeding, splenic remnant torsion and splenic regrowth. Partial splenectomy is an alternative to total splenectomy for the treatment of adult β Thalassemia intermedia patients avoiding the risks associated with total splenectomy.
Zangiabadi, Nasser; Yarahmadi, Fahimeh; Darekordi, Ali; Shabani, Mohammad; Dadgar, Mehrak Memaran
2013-01-01
The present study aimed at investigating and comparing patients suffering from β-thalassemia (β-thal) minor with normal individuals in regard to their performances in the short version of the Wechsler Adult Intelligence Scale (WAIS) test. Patients with β-thal minor are carriers of β-thal genes. They have mild microcytic and hypochromic anemia and are usually asymptomatic. In this cross-sectional study, a total of 60 individuals were divided into two equal groups of β-thal minor and normal subjects; they were then studied by the WAIS subscales. The mean performance scores of the normal group in the subtests of arithmetic and vocabulary (p <0.01) and picture completion (p <0.05) were higher than those of the thalassemia group. The mean performance score and ability of the normal group on the verbal scale was higher in comparison to the thalassemia group (p <0.05), while on the non verbal scale, there was no significant difference between the two groups. It can be concluded that β-thal minor negatively influences verbal fluency, reasoning and conceptualization, and sequencing tasks, perceptual skill, prediction of social situations and abstract thinking.
[Symptomatic extramedullary haematopoiesis in β-thalassemia: A retrospective single centre study].
Maazoun, F; Gellen Dautremer, J; Boutekadjirt, A; Pissard, S; Habibi, A; Bachir, D; Rahmouni, A; Bartolucci, P; Debbache, K; Lagrange, J-L; Michel, M; Galacteros, F
2016-01-01
Symptomatic extramedullary hematopoiesis (EH) is a rare but potentially severe phenomenon which occurs in β-thalassemia. There are no treatment guidelines. Retrospective single centre study including the cases of symptomatic EH encountered between 1997 and 2014 in a unit specialised in red blood cell genetic disorders. Description of clinical, biological and radiological characteristics of the patients, treatments received, and outcomes. Among 182 β-thalassemia patients followed during the study period, 7 cases of symptomatic EH were diagnosed. They were 5 men and 2 women, and their mean age was 37 years. Four patients were splenectomised, two patients were regularly transfused, and four patients had already received erythropoietin. EH was localised in intravertebral areas and responsible for dorsal spinal cord compression in 5 patients, in paravertebral dorsal area in 1 patient, and in presacral area in 1 patient. The mean hemoglobin level at diagnosis was 7.9 g/dL. Treatment administered included: red cell transfusion in 6 cases, associated with hydroxyurea in 5 cases and/or radiotherapy in 3 patients. One patient was treated with surgery and HU. After a median follow-up of 41 months, clinical recovery was complete in 2 patients and partial in 5 patients. EH must be suspected in β-thalassemia in patients presenting clinical signs of organ compression, and a typical radiological aspect. The functional prognosis depends on the rapidity of treatment, which includes red blood cell transfusion, hydroxyurea, radiotherapy, and rarely surgery. Long-term outcome is uncertain. Copyright © 2015. Published by Elsevier SAS.
Investigation of Ancient Egyptian Baking and Brewing Methods by Correlative Microscopy
Samuel
1996-07-26
Ancient Egyptian methods of baking and brewing are investigated by optical and scanning electron microscopy of desiccated bread loaves and beer remains. The results suggest that current conceptions about ancient Egyptian bread and beer making should be modified. Bread was made not only with flour from raw grain, but sometimes also with malt and with yeast. Brewing blended cooked and uncooked malt with water; the mixture was strained free of husk before inoculation with yeast.
Growth and Endocrine Function in Tunisian Thalassemia Major Patients.
Dhouib, Naouel Guirat; Ben Khaled, Monia; Ouederni, Monia; Besbes, Habib; Kouki, Ridha; Mellouli, Fethi; Bejaoui, Mohamed
2018-01-01
β-thalassemia major (β-TM) is among the most common hereditary disorders imposing high expenses on health-care system worldwide. The patient's survival is dependent on lifetime blood transfusion which leads to iron overload and its toxicity in various organs including endocrine glands. This article provides an overview of endocrine disorders in beta-TM patients. This single center investigation enrolled 28 β-TM patients (16 males, 12 females) regularly transfused with packed red cell since early years of life. For each patient were determined: age, sex, number of transfusions received, history of splenectomy and anthropometric parameters. All patients underwent an evaluation of hormonal status including growth, gonadal, thyroid, adrenal cortex, and parathyroid glands. Dual-energy X-ray absorptiometry was used to diagnose low bone mass. Assessment of iron overload status was performed by measuring the serum ferritin concentration and the results of magnetic resonance imaging T 2 *. Growth retardation was found in 16 of the 28 studied patients (57 %). Thirteen among them had delayed puberty. Spontaneous puberty was achieved in 16 cases. Growth hormone (GH) deficiency was found in 10 cases (35 %). Seventeen among the studied patients (60 %) developed disorders of glucose homeostasis. Subclinical hypothyroidism was found in six patients (21 %). Intensive chelation therapy had allowed the reversibility of this complication in five cases. Adrenal Insufficiency was observed in 9 cases (32%). Hypoparathyroidism has occurred in one case. Ten of the 28 studied patients had low bone mass (35%). Twenty-three of the 28 studied patients (82%) had at least one endocrine complication.
Klaihmon, Phatchanat; Phongpao, Kunwadee; Kheansaard, Wasinee; Noulsri, Egarit; Khuhapinant, Archrob; Fucharoen, Suthat; Morales, Noppawan Phumala; Svasti, Saovaros; Pattanapanyasat, Kovit; Chaichompoo, Pornthip
2017-02-01
Thromboembolic events including cerebral thrombosis, deep vein thrombosis, and pulmonary embolism are major complications in β-thalassemia. Damaged red blood cells and chronic platelet activation in splenectomized β-thalassemia/HbE patients were associated with increased microparticles (MPs) releases into blood circulation. MPs are small membrane vesicles, which play important roles on coagulation. However, the role of MP in thalassemia is poorly understood. In this study, the effects of splenectomized-MPs on platelet activation and aggregation were investigated. The results showed that isolated MPs from fresh platelet-free plasma of patients and normal subjects directly induce platelet activation, platelet aggregation, and platelet-neutrophil aggregation in a dose-dependent manner. Interestingly, MPs obtained from splenectomized patients are more efficient in induction of platelet activation (P-selectin + ) when compared to MPs from normal subjects (P < 0.05), tenfold lower than pathophysiological level, at 1:0.1 platelet MP ratio. Co-incubation of splenectomized-MPs with either normal-, non-splenectomized- or splenectomized-platelets at 1:10 platelet MP ratio increased platelet activation up to 5.1 ± 2.2, 5.6 ± 3.7, and 9.5 ± 3.0%, respectively, when normalized with individual baseline. These findings suggest that splenectomized patients were proned to be activated by MPs, and splenectomized-MPs could play an important role on chronic platelet activation and aggregation, leading to thrombus formation in β-thalassemia/HbE patients.
Khodeir, Mona S; Hegazi, Mona A; Saleh, Marwa M
2018-03-19
The aim of this study was to standardize an Egyptian Arabic Pragmatic Language Test (EAPLT) using linguistically and socially suitable questions and pictures in order to be able to address specific deficits in this language domain. Questions and pictures were designed for the EAPLT to assess 3 pragmatic language subsets: pragmatic skills, functions, and factors. Ten expert phoniatricians were asked to review the EAPLT and complete a questionnaire to assess the validity of the test items. The EAPLT was applied in 120 typically developing Arabic-speaking Egyptian children (64 females and 56 males) randomly selected by inclusion and exclusion criteria in the age range between 2 years, 1 month, 1 day and 9 years, 12 months, 31 days. Children's scores were used to calculate the means and standard deviations and the 5th and 95th percentiles to determine the age of the pragmatic skills acquisition. All experts have mostly agreed that the EAPLT gives a general idea about children's pragmatic language development. Test-retest reliability analysis proved the high reliability and internal consistency of the EAPLT subsets. A statistically significant correlation was found between the test subsets and age. The EAPLT is a valid and reliable Egyptian Arabic test that can be applied in order to detect a pragmatic language delay. © 2018 S. Karger AG, Basel.
Salvatori, Francesca; Pappadà, Mariangela; Breveglieri, Giulia; D'Aversa, Elisabetta; Finotti, Alessia; Lampronti, Ilaria; Gambari, Roberto; Borgatti, Monica
2018-05-15
Nonsense mutations promote premature translational termination, introducing stop codons within the coding region of mRNAs and causing inherited diseases, including thalassemia. For instance, in β 0 39 thalassemia the CAG (glutamine) codon is mutated to the UAG stop codon, leading to premature translation termination and to mRNA destabilization through the well described NMD (nonsense-mediated mRNA decay). In order to develop an approach facilitating translation and, therefore, protection from NMD, ribosomal read-through molecules, such as aminoglycoside antibiotics, have been tested on mRNAs carrying premature stop codons. These findings have introduced new hopes for the development of a pharmacological approach to the β 0 39 thalassemia therapy. While several strategies, designed to enhance translational read-through, have been reported to inhibit NMD efficiency concomitantly, experimental tools for systematic analysis of mammalian NMD inhibition by translational read-through are lacking. We developed a human cellular model of the β 0 39 thalassemia mutation with UPF-1 suppressed and showing a partial NMD suppression. This novel cellular model could be used for the screening of molecules exhibiting preferential read-through activity allowing a great rescue of the mutated transcripts.
Schuenemann, Verena J; Peltzer, Alexander; Welte, Beatrix; van Pelt, W Paul; Molak, Martyna; Wang, Chuan-Chao; Furtwängler, Anja; Urban, Christian; Reiter, Ella; Nieselt, Kay; Teßmann, Barbara; Francken, Michael; Harvati, Katerina; Haak, Wolfgang; Schiffels, Stephan; Krause, Johannes
2017-05-30
Egypt, located on the isthmus of Africa, is an ideal region to study historical population dynamics due to its geographic location and documented interactions with ancient civilizations in Africa, Asia and Europe. Particularly, in the first millennium BCE Egypt endured foreign domination leading to growing numbers of foreigners living within its borders possibly contributing genetically to the local population. Here we present 90 mitochondrial genomes as well as genome-wide data sets from three individuals obtained from Egyptian mummies. The samples recovered from Middle Egypt span around 1,300 years of ancient Egyptian history from the New Kingdom to the Roman Period. Our analyses reveal that ancient Egyptians shared more ancestry with Near Easterners than present-day Egyptians, who received additional sub-Saharan admixture in more recent times. This analysis establishes ancient Egyptian mummies as a genetic source to study ancient human history and offers the perspective of deciphering Egypt's past at a genome-wide level.
Schuenemann, Verena J.; Peltzer, Alexander; Welte, Beatrix; van Pelt, W. Paul; Molak, Martyna; Wang, Chuan-Chao; Furtwängler, Anja; Urban, Christian; Reiter, Ella; Nieselt, Kay; Teßmann, Barbara; Francken, Michael; Harvati, Katerina; Haak, Wolfgang; Schiffels, Stephan; Krause, Johannes
2017-01-01
Egypt, located on the isthmus of Africa, is an ideal region to study historical population dynamics due to its geographic location and documented interactions with ancient civilizations in Africa, Asia and Europe. Particularly, in the first millennium BCE Egypt endured foreign domination leading to growing numbers of foreigners living within its borders possibly contributing genetically to the local population. Here we present 90 mitochondrial genomes as well as genome-wide data sets from three individuals obtained from Egyptian mummies. The samples recovered from Middle Egypt span around 1,300 years of ancient Egyptian history from the New Kingdom to the Roman Period. Our analyses reveal that ancient Egyptians shared more ancestry with Near Easterners than present-day Egyptians, who received additional sub-Saharan admixture in more recent times. This analysis establishes ancient Egyptian mummies as a genetic source to study ancient human history and offers the perspective of deciphering Egypt's past at a genome-wide level. PMID:28556824
Akhlaghpoor, S; Ghahari, A; Morteza, A; Khalilzadeh, O; Shakourirad, A; Alinaghizadeh, M R
2012-09-01
Iron overload is a common clinical problem in patients with β-thalassemia major. The purpose of this study was to assess the presence of excess iron in certain areas of the brain (thalamus, midbrain, adenohypophysis and basal ganglia) in patients with β-thalassemia major and evaluate the association with serum ferritin and liver iron content. A cross-sectional study on 53 patients with β-thalassemia major and 40 healthy controls was carried out. All patients and healthy controls underwent magnetic resonance imaging (MRI) examinations of the brain and liver. Multiecho fast gradient echo sequence was used and T2* values were calculated based on the Brompton protocol. Correlations between T2* values in the brain with T2* values in the liver as well as serum ferritin levels were investigated. There were no significant differences between patients and healthy controls with respect to age and sex. Patients had significantly lower T2* values in basal ganglia (striatum), thalamus and adenohypophysis compared to controls while there were no differences in the midbrain (red nucleus). There were no significant correlations between liver T2* values or serum ferritin with T2* values of basal ganglia (striatum), thalamus and adenohypophysis in patients or healthy controls. There were no significant correlations between T2* values of adenohypophysis and thalamus or basal ganglia (striatum) while these variables were significantly correlated in healthy controls. Serum ferritin and liver iron content may not be good indicators of brain iron deposition in patients with β thalassemia major. Nevertheless, the quantitative T2* MRI technique is useful for evaluation of brain iron overload in β thalassemia major patients.
Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan
2014-01-01
Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.
Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar
2016-02-01
There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Abu Samra, Omayma; Auda, Wafaa; Kamhawy, Heba; Al-Tonbary, Youssef
2015-06-01
Objectives Thalassemia is the most common genetic disorder in Egypt, with an estimated carrier rate of 9-10%. It is a genetic blood disorder which can be fatal if proper chelation is not received. The introduction of chelating agents capable of removing excessive iron from the body has dramatically increased life expectancy and improved the overall quality of life. The aim of this study was to assess the impact of educational programmes regarding chelation therapy on the quality of life of thalassemic children. Methods The study was carried out at the Mansoura University Children's Hospital in the period between March 2010 and May 2011. It included 173 B-thalassemia children (84 boys and 89 girls) with age ranging between 8-18 years. The researcher used a predesigned interviewing questionnaire to collect data regarding children's knowledge about thalassemia and its management, especially regarding chelation therapy. The paediatric quality-of-life inventory tool (Peds QL 4.0 generic core) was also used to assess the studied children's quality of life. Results There was a significant statistical difference of the studied children's knowledge regarding chelation therapy and their quality of life. Conclusion There was a positive effect of the educational programme in improving children's knowledge score and their quality of life. Application of educational programmes for thalassemic children and their nurses regarding chelation therapy and its importance in preventing thalassemia complications is established.
Ansari, Arif M; Bhat, Kamalakshi G; Dsa, Smitha S; Mahalingam, Soundarya; Joseph, Nitin
2018-03-01
Complications like impaired glucose tolerance and diabetes mellitus due to iron overload need early identification in thalassemia. We studied the proportion of insulin resistance in thalassemia major patients on chronic transfusion, identified insulin resistance using homeostasis model assessment of insulin resistance (HOMA-IR) and triglyceride glucose (TYG) index, compared them and validated TYG index. In total, 73 thalassemia patients on regular transfusion for 3 years with serum ferritin >1500 ng/mL were studied. Serum ferritin, fasting blood glucose, triglycerides, and insulin levels were measured, HOMA-IR, and TYG index calculated and analyzed. Mean fasting glucose, triglyceride, and serum insulin values were 104 mg/dL, 164.18 mg/dL, and 19.6 m IU/mL, respectively. Mean serum ferritin was 5156 ng/mL. Insulin resistance was prevalent in one third of thalassemia patients and showed increase with age and serum ferritin. Insulin resistance by HOMA-IR was 32% as against 16% by TYG index with a cut-off value of 4.3. Using receiver operating charecteristic curve analysis, it was found that, by lowering the value of TYG index to 4.0215, sensitivity improved to 78.3% (from 39.13%) with specificity of 70%. Hence, we recommend a newer lower cut-off value of 4.0215 for TYG index for better sensitivity and specificity in identifying insulin resistance.
Hydroxyurea for nontransfusion-dependent β-thalassemia: A systematic review and meta-analysis.
Algiraigri, Ali H; Wright, Nicola A M; Paolucci, Elizabeth Oddone; Kassam, Aliya
2017-09-01
Nontransfusion-dependent β-thalassemia (NTDβT) syndromes consist of β-thalassemia intermedia and moderate hemoglobin E/β thalassemias. They are characterized by varying degrees of chronic anemia and a wide spectrum of complications due to ineffective erythropoiesis and iron overload from chronic transfusions. Hydroxyurea (HU), an oral chemotherapeutic drug, is anticipated to decrease disease severity. We performed a meta-analysis to evaluate the clinical efficacy and safety of HU in NTDβT patients of any age. MEDLINE, EMBASE, Cochrane databases, and major conference proceedings for studies that assessed HU in NTDβT patients were searched. Qualities of eligible studies were assessed by National Institutes of Health tools. Seventeen studies, collectively involving 709 patients, fulfilled the eligibility criteria. HU was associated with a significant decrease in transfusion need in severe NTDβT with complete and overall (≥50%) response rates of 42% and 79%, respectively. For mild NTDβT, HU was effective in raising hemoglobin by 1g/L in 64% of patients. HU appears to be effective, well tolerated, and associated with mild and transient adverse events. NTDβT patients may benefit from a trial of HU, although large randomized clinical trials assessing its efficacy should be conducted to confirm the findings of this meta-analysis and to assess its long-term toxicity and response sustainability. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.
Dental affinities of the C-group inhabitants of Hierakonpolis, Egypt: Nubian, Egyptian, or both?
Irish, J D; Friedman, R
2010-04-01
By c. 2050 BC a small community of C-Group Nubians was present deep within Egyptian territory at the city of Hierakonpolis. Their descendants stayed for the next 400 years. Today, the site of Hierakonpolis, 113 km north of Aswan, is known for its Egyptian deposits; however, it also contains a C-Group cemetery, which documents the northernmost occurrence of this culture. Sixty skeletons were excavated. Tombs feature Nubian architecture and goods, including leather garments, although the use of Egyptian mortuary practices and artifacts increased through time. Dates range from the early 11th Dynasty into the Second Intermediate period. During this time the Egyptian empire occupied Lower Nubia, and their state ideology vilified Nubians. Yet, at least in death, the C-Group inhabitants of Hierakonpolis proudly displayed their cultural heritage. Beyond discerning the reason(s) for their presence at the site (e.g., mercenaries, leather-workers, entertainers?), the focus of this report is to estimate their biological affinity. Were they akin to other Nubians, Egyptians, or both? And, was increasing 'Egyptianization' evident in the mortuary ritual accompanied by concomitant genetic influence? To address these queries, up to 36 dental morphological traits in the recovered individuals were compared to those in 26 regional comparative samples. The most influential traits were identified and phenetic affinities were calculated using the mean measure of divergence and other multivariate analyses. Assuming phenetic similarity provides an estimate of genetic relatedness, these affinities suggest the individuals comprising the C-Group sample were, and remained Nubian during their tenure at Hierakonpolis. Copyright 2010 Elsevier GmbH. All rights reserved.
ERIC Educational Resources Information Center
Abdou, Ehaab D.
2016-01-01
Egyptian history textbooks are examined through the prism of historical thinking dimensions and skills, utilizing a critical discourse analysis. The analysis focuses on how the textbooks portray two historically significant events: the advent of Christianity (ca. 33 CE) and Islam (ca. 641 CE) to Egypt. It reveals that the historical narrative…
Yanola, Jintana; Kongpan, Chatpat; Pornprasert, Sakorn
2014-07-01
The prevalaence of anemia, iron deficiency, thalassemia and glucose-6-phosphate dehydrogenase (G-6-PD) deficiency were examined among 265 hill-tribe school children, 8-14 years of age, from Omkoi District, Chiang Mai Province, Thailand. Anemia was observed in 20 school children, of whom 3 had iron deficiency anemia. The prevalence of G-6-PD deficiency and β-thalassemia trait [codon 17 (A>T), IVSI-nt1 (G>T) and codons 71/72 (+A) mutations] was 4% and 8%, respectively. There was one Hb E trait, and no α-thalassemia-1 SEA or Thai type deletion. Furthermore, anemia was found to be associated with β-thalassemia trait in 11 children. These data can be useful for providing appropriate prevention and control of anemia in this region of Thailand.
Paleoradiology: advanced CT in the evaluation of nine Egyptian mummies.
Hoffman, Heidi; Torres, William E; Ernst, Randy D
2002-01-01
Axial thin-collimation state-of-the-art spiral computed tomography (CT) was combined with sagittal and coronal reformatting, three-dimensional (3D) reconstruction, and virtual "fly-through" techniques to nondestructively study nine Egyptian mummies. These techniques provided important paleopathologic and historical information about mummification techniques, depicted anatomy in the most informative imaging plane, illustrated the soft-tissue preservation and physical appearance of mummies in superb detail, and generated an intriguing virtual tour through hollow mummified remains without harming the specimens themselves. Images generated with these methods can help archaeologists and Egyptologists understand these fascinating members of mankind and can serve as adjunct visual aids for laypersons who are interested in mummies. CT has emerged as the imaging modality of choice for the examination of Egyptian mummies due to its noninvasive cross-sectional nature and inherently superior contrast and spatial resolution. As multi-detector row CT and postprocessing tools evolve, the capabilities and applications of CT will continue to proliferate, attesting to the expanded versatility and utility of CT as a noninvasive research tool in the multidisciplinary study of Egyptian mummies. Copyright RSNA, 2002
Determinants of the Egyptian labour migration.
Kandil, M; Metwally, M
1992-03-01
The objective is to summarize the pattern of Egyptian migration to Arab oil-producing countries (AOPC), to review some factors that are important determinants of labor movement based on theory, and to empirically model the migration rate to AOPC and to Saudi Arabia. Factors are differentiated as to their relative importance. Push factors are the low wages, high inflation rate, and high population density in Egypt; pull factors are higher wages. It is predicted that an increase in income from destination countries has a significant positive impact on the migration rate. An increase in population density stimulates migration. An increase in inflation acts to increase out-migration with a 2-year lag, which accommodates departure preparation. Egypt's experience with labor migration is described for the pre-oil boom, and the post-oil boom. Several estimates of labor migration are given. Government policy toward migration is positive. Theory postulates migration to be determined by differences in the availability of labor, labor rewards between destination and origin, and the cost of migration. In the empirical model, push factors are population density, the current inflation rate, and the ratio of income/capita in AOPC to Egypt. The results indicate that the ratio of income/capita had a strong pull impact and population density had a strong push impact. The inflation rate has a positive impact with a lag estimated at 2 years. Prior to the Camp David Accord, there was a significant decrease in the number of Egyptian migrants due to political tension. The findings support the classical theory of factor mobility. The consequences of migration on the Egyptian economy have been adverse. Future models should disaggregate data because chronic shortages exist in some parts of the labor market. Manpower needs assessment would be helpful for policy makers.
Short report: cysticercosis in an Egyptian mummy of the late Ptolemaic period.
Bruschi, Fabrizio; Masetti, Massimo; Locci, Maria Teresa; Ciranni, Rosalba; Fornaciari, Gino
2006-04-01
We describe here an ancient case of cysticercosis that was discovered in an Egyptian mummy of a young woman of about 20 years of age who lived in the late Ptolemaic period (second to first centuries b.c.). On removal of the stomach and its rehydration, a cystic lesion in the stomach wall was observed by naked eye. Microscopical examination of sections of this lesion revealed a cystic structure, with a wall, with numerous projecting eversions, a characteristic feature of the larval stage (cysticercus) of the human tapeworm Taenia solium (or "pig tapeworm"). Immunohistochemical testing with serum from a T. solium-infected human confirmed the identity of the cyst. This finding is the oldest on record of the antiquity of this zoonotic parasite. This observation also confirms that, in Hellenistic Egypt, the farming of swine, along with man an intermediate host of this parasite, was present, and supports other archeological evidence.
Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros
2018-04-30
Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.
Zhao, Zhong-Ming; Yao, Li-Qin; Fan, Li-Mei; Zou, Tuan-Biao; Chen, Qian; Hu, Li-Sha; Yang, Fa-Bin; Liu, Jin-Tao; Wang, Xing-Tian
2011-04-01
To investigate the prevalence rate of thalassemia among children of 0 - 7 years old, from six ethnic groups in Xishuangbanna and Dehong, Yunnan province. 4973 blood samples from children under 7 years old were automatically undergone blood cell count, red cell osmotic fragility and hemoglobin electrophoresis testings. The incidence rates of thalassaemia, β-thalassemia was 37.4%, and α-thalassaemia were 22.6% and 14.7% respectively. The thalassaemia incidence rates were significantly different among age groups but not in gender. The incidence of α-thalassaemia was decreasing along with the increase of age, while the incidence of β-thalassaemia was increasing along with the increase of age. Xishuangbanna had the higher incidence than in Dehong and the differences were significant between counties, The incidence of thalassemia of Mengla ranked the first (52.2%) in Xishuangbanna, The differences between different regions and different nationalities were significant, with β-thalassemia of Achang ranked the first (40.6%), The incidence of α-thalassemia among Han ranked the first as 45.5% while α-thalassaemia and β-thalassemia were different in regions. α-thalassaemia and β-thalassemia were significantly different between different ethnic people in the same regions. Multiple factor analysis showed that region seemed to be a risk factor and the mother's ethnicity was a protective factor and dependent variable on thalassaemia. The incidence of thalassaemia in Yunnan Xishuangbanna and Dehong was high among children under the age of 7 and were related to ethnic and regional differences in the areas. Specific genes were proliferated along with the extension of time. Our data provided valuable information on prevention and genetic studies on thalassaemia in the minorities of Xishuangbanna and Dehong in Yunnan province.
Factors affecting health-related quality of life in Thai children with thalassemia
2010-01-01
Background Knowledge of the factors associated with health-related quality of life (HRQOL) among patients with thalassemia is essential in developing more suitable clinical, counseling, and social support programs to improve treatment outcomes of these patients. In light of the limited research in this area, this study aims to examine factors associated with HRQOL among children and adolescents with thalassemia in Thailand. Methods A cross-sectional survey was conducted in three selected hospitals in Thailand during June to November 2006. PedsQL™ 4.0 Generic Core Scale (Thai version) was used to assess HRQOL in 315 thalassemia patients between 5 and 18 years of age. Other related clinical characteristics of the patients were collected via medical record review. Results The mean (SD) of the total summary score was 76.67 (11.40), while the means (SD) for the Physical Health Summary score and Psychosocial Health Summary score were 78.24 (14.77) and 75.54 (12.76), respectively. The school functioning subscale scored the lowest, with a mean of 67.89 (SD = 15.92). The following factors significantly affected the HRQOL of the patients: age; age at onset of anemia and age at first transfusion; pre-transfusion hemoglobin (Hb) level; receiving a blood transfusion during the previous three months; and disease severity. In addition, iron chelation therapy had a significant negative effect on HRQOL in the school functioning subscale. In contrast, serum ferritin level, frequency of blood transfusions per year, and gender were not significantly related to HRQOL among these patients. The results from multivariate analysis also confirmed these findings. Conclusions To improve HRQOL of thalassemia patients, suitable programs aimed at providing psychosocial support and a link between the patient, school officials, the family and the physician are important, especially in terms of improving the school functioning score. The findings also confirmed the importance of maintaining a pre
Chromatographic measurements of hemoglobin A2 in blood samples that contain sickle hemoglobin.
Shokrani, M; Terrell, F; Turner, E A; Aguinaga, M D
2000-04-01
In the sickle cell syndromes, Hb A2 measurements aid in the differential diagnosis of sickle cell anemia from sickle-beta-thalassemia. The purpose of this study is to assess the Hb A2 levels in samples containing sickle hemoglobin (Hb S) by the use of an automated high performance liquid chromatography system (HPLC-Variant beta-thalassemia Short Program). The blood samples analyzed were from individuals of African descent living in the state of Tennessee who had either sickle cell trait (Hb AS), sickle cell disease (Hb SS), or sickle cell-hemoglobin C disease (Hb SC). Interestingly, the Hb A2 levels determined by HPLC were found elevated in samples containing Hb S. The Hb A2 mean in Hb AS samples (n=146) is 4.09% (SD +/- 0.42, range 2.20 to 5.20%); in Hb SS samples (n=33) it is 3.90% (SD +/- 1.08, range 0.60 to 5.90%); and in Hb SC samples (n=27) it is 4.46% (SD +/- 0.70, range 2.30 to 5.91%). The Hb A2 mean by HPLC in normal individuals (Hb AA, n=70) is 2.57% (SD +/- 0.25, range 2.1 to 3.0%), and the Hb A2 range in beta-thalassemia carriers is 4 to 9%. Our results show that the Hb A2 levels in Hb S-containing samples partially overlap with those expected from beta-thalassemia carriers. The hemoglobinopathy laboratory should be aware of this apparent elevation in Hb A2 levels determined by HPLC in individuals carrying Hb S. Other factors, such as family history and clinical symptoms, should be taken into account before a diagnosis of sickle cell trait, sickle-beta-thalassemia, or sickle cell anemia is made.
Abdel Aziz, Manal H; Badr El Dine, Fatma M M; Saeed, Nourhan M M
2016-11-01
Identification of sex and ethnicity has always been a challenge in the fields of forensic medicine and criminal investigations. Fingerprinting and DNA comparisons are probably the most common techniques used in this context. However, since they cannot always be used, it is necessary to apply different and less known techniques such as lip prints. Is to study the pattern of lip print in Egyptian and Malaysian populations and its relation to sex and populations difference. Also, to develop equations for sex and populations detection using lip print pattern by different populations (Egyptian and Malaysian). The sample comprised of 120 adults volunteers divided into two ethnic groups; sixty adult Egyptians (30 males and 30 females) and sixty adult Malaysians (30 males and 30 females). The lip prints were collected on a white paper. Each lip print was divided into four compartments and were classified and scored according to Suzuki and Tsuchihashi classification. Data were statistically analyzed. The results showed that type III lip print pattern (intersected grooves) was the predominant type in both the Egyptian and Malaysian populations. Type II and III were the most frequent in Egyptian males (28.3% each), while in Egyptian females type III pattern was predominant (46.7%). As regards Malaysian males, type III lip print pattern was the predominant one (41.7%), while type II lip print pattern was predominant (30.8%) in Malaysian females. Statistical analysis of different quadrants showed significant differences between males and females in the Egyptian population in the third and fourth quadrants. On the other hand, significant differences were detected only in the second quadrant between Malaysian males and females. Also, a statistically significant difference was present in the second quadrant between Egyptian and Malaysian males. Using the regression analysis, four regression equations were obtained. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal
NASA Astrophysics Data System (ADS)
Radi Abdel Kader, R.; Sayed Mohamed, S.
2013-07-01
Egypt is considered one of the most countries which contain a lot of cultural heritage; the Ancient Egyptian used a lot of stones for his life like: limestone, sandstone, granite and Egyptian Alabaster. The Egyptian Alabaster is used for his daily and eternal life, he made a lot of funerary furniture from this stone like: vessels, statues, Architectural elements in the temples, tombs and canopic jars to preserve his viscera from decomposition like: stomach, liver … etc in the mummification process. Egyptian Alabaster is a sedimentary rock especially chemical- origin sedimentary rocks, it deposits inside caves and around springs which consists of calcium carbonates (CaCO3), they are very fragile "hardness = 3 in Mohs hardness scale". The Egyptian Alabaster vessels expose to a lot of deterioration factors in the burial and exposure environment after excavation. The study case vessels are made of Egyptian alabaster stone and belong to the early era (First and second Egyptian dynasties) in Atfiyah museum store, these vessels exposed to a lot of deterioration factors in the burial and exposure environment like: soil pressure, air temperature variety, relative humidity and salts. The vessels are conserved at the restoration laboratory in Atfiyah museum store by a lot of restoration and conservation processes like: cleaning - consolidation - assembling process for the separated parts and completion for the lost parts.
An Evaluation of the Navy’s Health Promotion Videotapes
1990-04-30
1263. Fisher, L., Rowley, P. T., & Lipkin. M. (1981). Genetic counseling for beta- thalassemia trait following health screening in a health maintenence...counseling for x, ta- thalassemia trait in a population unselected for interest: Effects on knowledge and m ,ood. American Journal of Human Genetics
Fulminant Liver Failure in a Child With β-Thalassemia on Deferasirox: A Case Report.
Ramaswami, Archie; Rosen, Danya J; Chu, Jaime; Wistinghausen, Birte; Arnon, Ronen
2017-04-01
Deferesirox (DFX), an oral chelating agent, is used to treat chronic iron overload in several hematological diseases such as β-thalassemia, sickle cell disease, and myelodysplastic anemia. DFX is generally well tolerated with the exception of gastrointestinal disturbances and rash, although cases of renal toxicity, as well as acute and chronic liver failure, have been reported in adults and children. Here we describe a 3-year-old girl with β-thalassemia undergoing treatment with DFX who presented with acute liver failure and Fanconi's syndrome. It is important for pediatric gastroenterologists, hepatologists, and hematologists to be aware that the commonly used drug DFX can lead to acute liver failure in children, and liver function should be monitored closely in all patients taking DFX.
De Sanctis, Vincenzo; Soliman, Ashraf T.; Elsedfy, Heba; Yaarubi, Saif AL; Skordis, Nicos; Khater, Doaa; El Kholy, Mohamed; Stoeva, Iva; Fiscina, Bernadette; Angastiniotis, Michael; Daar, Shahina; Kattamis, Christos
2016-01-01
Iron overload in patients with thalassemia major (TM) affects glucose regulation and is mediated by several mechanisms. The pathogenesis of glycaemic abnormalities in TM is complex and multifactorial. It has been predominantly attributed to a combination of reduced insulin secretory capacity and insulin resistance. The exact mechanisms responsible for progression from norm glycaemia to overt diabetes in these patients are still poorly understood but are attributed mainly to insulin deficiency resulting from the toxic effects of iron deposited in the pancreas and insulin resistance. A group of endocrinologists, haematologists and paediatricians, members of the International Network of Clinicians for Endocrinopathies in Thalassemia and Adolescence Medicine (ICET-A) convened to formulate recommendations for the diagnosis and management of abnormalities of glucose homeostasis in thalassemia major patients on the basis of available evidence from clinical and laboratory data and consensus practice. The results of their work and discussions are described in this article. PMID:27872738
Genetic Drift. The ancient Egyptian dwarfs of the Walters Art Museum.
Kozma, Chahira
2010-10-01
The ancient Egyptians left an impressive artistic legacy documenting many aspects of their society including the existence of dwarfs as highly valued members. In previous publications in the Journal, I discussed dwarfs and skeletal dysplasia in ancient Egypt. In this study, I examined the ancient Egyptian representations of dwarfs of the Walters Art Museum in Baltimore, Maryland. One of the highlights of the collection is a group of five ivory figurines from Predynastic Times (pre 3500-3100 BCE) depicting a couple, a man with a child, and two females. Representations from other periods include ordinary as well as dwarf deities. The dwarf gods, Bes and Ptah, are frequently depicted holding or biting snakes or standing on crocodiles symbolizing their ability to ward off dangers. A couple of statuettes from the Greco-Roman Period that, in contrast to earlier Egyptian Periods, depict harsh physical anomalies, twisted bodies, and facial pain. The artistic impression can be interpreted as either tragic or humorous. The grotesque depiction of dwarfs during the Greco-Roman Period in ancient Egypt is believed to be due to a greater infusion of Hellenistic influence. This study provides a microcosm of the legacy of dwarfs in ancient Egypt and supports the premise that dwarfs were accepted and integrated in the ancient Egyptian society, and with a few exceptions, their disorder was not depicted as a physical handicap. Copyright © 2010 Wiley-Liss, Inc.
Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Charoenwijitkul, Patnaree; Maneesarn, Jitpanu; Xu, Xiangmin; Fucharoen, Supan
2017-08-01
α 0 -thalassemia of SEA deletion (- SEA ) is common among Southeast Asian and Chinese. Using haplotype and phylogenetic analyses, we examined the origin of this defect in Southeast Asian populations. Study was done on both normal and α 0 -thalassemia alleles in 3 ethnic groups including 96 Thai, 52 Laotian and 21 Cambodian. Five SNPs encompassing the (- SEA ) including (rs3760053 T>G), (rs1211375 A>C), (rs3918352 A>G), (rs1203974 A>G) and (rs11248914 C>T) were examined using high-resolution melting assays. It was found that 94.0% of Thai, 100% of Laotian and 100% of Cambodian α 0 -thalassemia alleles were linked to the same haplotype: the haplotype H4 (AAGC), representing an Asian specific origin. An G allele of the (rs3760053) was found to be in strong linkage disequilibrium with the α 0 -thalassemia allele in these populations. A multiplex PCR assay was developed to detect simultaneously the (- SEA ) allele and genotyping of a linked (rs3760053) to improve accuracy of prenatal diagnosis of α 0 -thalassemia. Application of this multiplex PCR assay for routine prenatal diagnosis of α 0 -thalassemia in 12 families revealed a 100% concordant result with conventional gap-PCR assay. Therefore, a single genetic origin is responsible for the spread and high prevalence of the (- SEA ) in the region. The multiplex PCR assay developed should provide a double-check PCR system for more accurate diagnosis and allow the monitoring of possible maternal contamination at prenatal diagnosis of this important genetic disorder.
Identification of Mediterranean mutation in Egyptian favism patients.
Osman, H G; Zahran, F M; El-Sokkary, A M A; El-Said, A; Sabry, A M
2014-10-01
Identify and screen the G6PD Mediterranean mutation in favism patients by applying a Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR). A total of 114 unrelated Egyptians patients were included in the present study; their ages ranged between (2-9) years with male to female ratio 4.5:1. G6PD activity was determined qualitatively from red cell hemolysate during attack. The G6PD Mediterranean mutation in patients has been identified by ARMS-PCR. G6PD deficiency was detected in 87.7%, (n=100). The frequency of G6PD Mediterranean mutation was (94.7%), (n=108). The association between G6PD deficiency and Mediterranean mutation was a highly significant. Glucose-6-phosphate dehydrogenase Mediterranean mutation is one of the most common mutations causing G6PD deficiency among Egyptian children with favism.
Wahidiyat, Pustika Amalia; Liauw, Felix; Sekarsari, Damayanti; Putriasih, Siti Ayu; Berdoukas, Vasili; Pennell, Dudley J
2017-09-01
Recent advancements have promoted the use of T2* magnetic resonance imaging (MRI) in the non-invasive detection of iron overload in various organs for thalassemia major patients. This study aims to determine the iron load in the heart and liver of patients with thalassemia major using T2* MRI and to evaluate its correlation with serum ferritin level and iron chelation therapy. This cross-sectional study included 162 subjects diagnosed with thalassemia major, who were classified into acceptable, mild, moderate, or severe cardiac and hepatic iron overload following their T2* MRI results, respectively, and these were correlated to their serum ferritin levels and iron chelation therapy. The study found that 85.2% of the subjects had normal cardiac iron stores. In contrast, 70.4% of the subjects had severe liver iron overload. A significant but weak correlation (r = -0.28) was found between cardiac T2* MRI and serum ferritin, and a slightly more significant correlation (r = 0.37) was found between liver iron concentration (LIC) and serum ferritin. The findings of this study are consistent with several other studies, which show that patients generally manifest with liver iron overload prior to cardiac iron overload. Moreover, iron accumulation demonstrated by T2* MRI results also show a significant correlation to serum ferritin levels. This is the first study of its kind conducted in Indonesia, which supports the fact that T2* MRI is undoubtedly valuable in the early detection of cardiac and hepatic iron overload in thalassemia major patients.
Zou, Yong; Song, Zhi-Xing; Lu, Ying; Liang, Xiao-Li; Yuan, Qing; Liao, Si-Hong; Bao, Jun-Jie
2016-08-01
Accumulating evidence has shown that allogeneic blood transfusions can induce significant immunosuppression in recipients, and thereby increase the risk of postoperative infection and/or tumor relapse. Although it is well known that natural killer (NK) cells are responsible for the immunodepression effects of transfusion, the underlying mechanisms remain obscure. In this study, we investigated the role of NK cells in transfusion-induced immunodepression in β-thalassemia major. The proportion of circulating NK cells and the expression of NK receptors (NKG2A, CD158a, NKP30, NKP46 and NKG2D) as well as CD107a were detected by multicolor flow cytometry. IFN-γ production by circulating NK cells was detected by intracellular cytokine staining. Our results showed that the proportion and cytotoxicity (CD107a expression) of circulating NK cells in transfusion-dependent β-thalassemia major patients were remarkably lower than those of β-thalassemia minor patients or healthy volunteers. Expression of NKG2A inhibitory receptor on circulating NK cells in patients with β-thalassemia major was remarkably up-regulated, but there were no significant differences in the expression levels of NKP30, NKP46, NKG2D, CD158a and IFN-γ. These results indicate NKG2A inhibitory receptor may play a key role in transfusion-induced immunodepression of NK cells in patients with β-thalassemia major.
Ou, Zhanhui; Niu, Xiaohua; He, Wenyin; Chen, Yuchang; Song, Bing; Xian, Yexing; Fan, Di; Tang, Daolin; Sun, Xiaofang
2016-09-01
β-thalassemia results from point mutations or small deletions in the β-globin (HBB) gene that ultimately cause anemia. The generation of induced pluripotent stem cells (iPSCs) from the somatic cells of patients in combination with subsequent homologous recombination-based gene correction provides new approaches to cure this disease. CRISPR/Cas9 is a genome editing tool that is creating a buzz in the scientific community for treating human diseases, especially genetic disorders. Here, we reported that correction of β-thalassemia mutations in patient-specific iPSCs using the CRISPR/Cas9 tool promotes hematopoietic differentiation in vivo. CRISPR/Cas9-corrected iPSC-derived hematopoietic stem cells (HSCs) were injected into sublethally-irradiated NOD-scid-IL2Rg-/- (NSI) mice. HBB expression was observed in these HSCs after hematopoietic differentiation in the NSI mice. Importantly, no tumor was found in the livers, lungs, kidneys, or bone marrow at 10 weeks in the NSI mice after implantation with these HSCs. Collectively, our findings demonstrated that CRISPR/Cas9 successfully corrects β-thalassemia mutations in patient-specific iPSCs. These CRISPR/Cas9-corrected iPSC-derived HSCs express normal HBB in mice without tumorigenic potential, suggesting a safe strategy for personalized treatment of β-thalassemia.
Mashhadi, Mohammad Ali; Sepehri, Zahra; Heidari, Zahra; Shirzaee, Eghbal; Kiani, Zohre
2014-08-01
There are different and controversial reports about zinc deficiency in patients with major thalassemia. The aim of this study was to evaluate zinc status in patients with major thalassemia in Sistan and Baluchistan province, southeastern Iran. The study was performed in Ali Asghar Hospital, a specialized governmental hospital located in Zahedan, Iran. In this cross-sectional study, 369 patients with a history of major thalassemia for more than 5 years entered the study using convenience sampling method. Thirty-six subjects were excluded from the study based on our exclusion criteria. Zinc level was measured in all patients after 12 hours fasting using atomic absorption spectrometry method in 2012. Of 369 cases, 333 patients were eligible and evaluated. The mean age was 15.63 ± 7.4 years. One hundred ninety two cases were male and others were female (141 cases). About 27% (90) of the cases were 5-10 years-old, 24% (80) were 10-15 years-old and 49% were older than 15 years old. Iron chelator in 65.46% was Desferrioxamine, in 28.2% was Deferasirox and in 19.5% was combination of Desferrioxamine and Deferiprone. All cases had zinc deficiency, and 98.5% had severe zinc deficiency. Others (1.5%) had mild deficiency. Our study on 333 patients with major thalassemia documented severe zinc deficiency in all cases. We had no cases with normal or increased zinc levels. It was different with other reports in the world.
Chen, Jian; Luo, Bi; Qi, Zhu; Huo, Pei-Dan; Zhang, Quan-Sheng; Wang, Hong
2010-06-01
This study was aimed to establish a method of PCR combination with PCR-RFLP for detecting the South-East Asian (SEA) deletion type alpha-thalassemia 1 and non-deletion mutation of Hb Constant Spring (CS), and to investigate the application value of this method. For the members of the families with alpha-thalassemia, SEA deletion mutation was detected by PCR, then the HbCS point mutation was screened by PCR-RFLP. The results indicated that 15 carriers with alpha-thalassemia (--(SEA)/) were found in 19 members from 7 families, and 2 families with genotype of --(SEA)/alpha(CS)alpha were screened out successfully. It is concluded that the PCR combination with PCR-RFLP is a simple, rapid, and reliable method for screening HbH disease with genotype of --(SEA)/alpha(CS)alpha.
Sildenafil therapy in thalassemia patients with Doppler-defined risk of pulmonary hypertension
Morris, Claudia R.; Kim, Hae-Young; Wood, John; Porter, John B.; Klings, Elizabeth S.; Trachtenberg, Felicia L.; Sweeters, Nancy; Olivieri, Nancy F.; Kwiatkowski, Janet L.; Virzi, Lisa; Singer, Sylvia T.; Taher, Ali; Neufeld, Ellis J.; Thompson, Alexis A.; Sachdev, Vandana; Larkin, Sandra; Suh, Jung H.; Kuypers, Frans A.; Vichinsky, Elliott P.
2013-01-01
Pulmonary hypertension is a common but often overlooked complication associated with thalassemia syndromes. There are limited data on the safety and efficacy of selective pulmonary vasodilators in this at-risk population. We, therefore, designed a 12-week, open-label, phase 1/2, pilot-scale, proof-of-principle trial of sildenafil therapy in 10 patients with β-thalassemia and at increased risk of pulmonary hypertension based on an elevated tricuspid regurgitant jet velocity >2.5 m/s on Doppler-echocardiography. Variables compared at baseline and after 12 weeks of sildenafil treatment included Doppler-echocardiographic parameters, 6-minute walked distance, Borg Dyspnea Score, New York Heart Association functional class, pulmonary function, and laboratory parameters. Treatment with sildenafil resulted in a significant decrease in tricuspid regurgitant jet velocity by 13.3% (3.0±0.7 versus 2.6±0.5 m/s, P=0.04), improved left ventricular end systolic/diastolic volume, and a trend towards a improved New York Heart Association functional class. No significant change in 6-minute walked distance was noted. Sildenafil was well tolerated, although minor expected adverse events were commonly reported. The total dose of sildenafil (mg) was strongly correlated with percent change in nitric oxide metabolite concentration in the plasma (ρ=0.80, P=0.01). There were also significant increases in plasma and erythrocyte arginine concentrations. Our study suggests that sildenafil is safe and may improve pulmonary hemodynamics in patients at risk of pulmonary hypertension; however, it was not demonstrated to improve the distance walked in 6 minutes. Clinical trials are needed to identify the best treatment strategy for pulmonary hypertension in patients with β-thalassemia. (clinicaltrials.gov identifier: NCT00872170) PMID:23585527
Thalassemia treatment and prevention in Uva Province, Sri Lanka: a public opinion survey.
Mudiyanse, Rasnayaka M
2006-01-01
Due to its excessive cost thalassemia management is a major health care problem in Sri Lanka. The majority of doctors are using only desferrioxamine (DFO), in grossly inadequate doses mainly because of its unavailability. Deferiprone (L1), which is more affordable, is not used due to fear of toxicity, as previously reported. Arthropathy attributed to L1 has been observed in some patients, and has led to the discontinuation of the drug in all patients, without scientific rationale. The proposed thalassemia prevention project for Uva Province is based on prevention of marriages between carriers. This could be achieved by carrier screening and counseling of teenagers and adolescents well before they select their partners. In Sri Lanka, people find their marriage partners at their work place or universities, by themselves, or with the help of professional marriage brokers (they are called Kapuwa), through relatives and close friends. This process of finding a partner may also be helped by paper advertisements. However, in addition to the appearance and attitude of the prospective partner, the caste, social background and horoscope are major considerations in selecting a partner. Even when they select partners on their own at the work place or university, they keep these factors in the back of their minds to ensure social acceptance. Many relationships are given up due to objections and advice from parents when the caste or social background does not match. A horoscope is a written document that almost every child gets, written by a professional horoscope reader and depending on the time of birth. It is believed, according to the horoscope, that a person's attitudes, desires, future prospects of finding a suitable partner, could be predicted. It is rare to proceed with a marriage if the horoscope does not match. These customs are considered less seriously among educated people when they find their partner at the work place or university. The concept of thalassemia risk
Aydınok, Yeşim; Oymak, Yeşim; Atabay, Berna; Aydoğan, Gönül; Yeşilipek, Akif; Ünal, Selma; Kılınç, Yurdanur; Oflaz, Banu; Akın, Mehmet; Vergin, Canan; Sezgin Evim, Melike; Çalışkan, Ümran; Ünal, Şule; Bay, Ali; Kazancı, Elif; İleri, Talia; Atay, Didem; Patıroğlu, Türkan; Kahraman, Selda; Söker, Murat; Akcan, Mediha; Akdeniz, Aydan; Büyükavcı, Mustafa; Alanoğlu, Güçhan; Bör, Özcan; Soyer, Nur; Özdemir Karadaş, Nihal; Uysalol, Ezgi; Türker, Meral; Akçay, Arzu; Ocak, Süheyla; Güneş, Adalet Meral; Tokgöz, Hüseyin; Ünal, Elif; Tiftik, Naci; Karakaş, Zeynep
2018-01-01
Objective: The Turkish Society of Pediatric Hematology set up a National Hemoglobinopathy Registry to demonstrate the demographic and disease characteristics of patients and assess the efficacy of a hemoglobinopathy control program (HCP) over 10 years in Turkey. Materials and Methods: A total of 2046 patients from 27 thalassemia centers were registered, of which 1988 were eligible for analysis. This cohort mainly comprised patients with β-thalassemia major (n=1658, 83.4%) and intermedia (n=215, 10.8%). Results: The majority of patients were from the coastal areas of Turkey. The high number of patients in Southeastern Anatolia was due to that area having the highest rates of consanguineous marriage and fertility. The most common 11 mutations represented 90% of all β-thalassemia alleles and 47% of those were IVS1-110(G->A) mutations. The probability of undergoing splenectomy within the first 10 years of life was 20%, a rate unchanged since the 1980s. Iron chelators were administered as monotherapy regimens in 95% of patients and deferasirox was prescribed in 81.3% of those cases. Deferasirox administration was the highest (93.6%) in patients aged <10 years. Of the thalassemia major patients, 5.8% had match-related hemopoietic stem cell transplantation with a success rate of 77%. Cardiac disease was detected as a major cause of death and did not show a decreasing trend in 5-year cohorts since 1999. Conclusion: While the HCP has been implemented since 2003, the affected births have shown a consistent decrease only after 2009, being at lowest 34 cases per year. This program failure resulted from a lack of premarital screening in the majority of cases. Additional problems were unawareness of the risk and misinformation of the at-risk couples. In addition, prenatal diagnosis was either not offered to or was not accepted by the at-risk families. This study indicated that a continuous effort is needed for optimizing the management of thalassemia and the development of
Aydınok, Yeşim; Oymak, Yeşim; Atabay, Berna; Aydoğan, Gönül; Yeşilipek, Akif; Ünal, Selma; Kılınç, Yurdanur; Oflaz, Banu; Akın, Mehmet; Vergin, Canan; Sezgin Evim, Melike; Çalışkan, Ümran; Ünal, Şule; Bay, Ali; Kazancı, Elif; İleri, Talia; Atay, Didem; Patıroğlu, Türkan; Kahraman, Selda; Söker, Murat; Akcan, Mediha; Akdeniz, Aydan; Büyükavcı, Mustafa; Alanoğlu, Güçhan; Bör, Özcan; Soyer, Nur; Özdemir Karadaş, Nihal; Uysalol, Ezgi; Türker, Meral; Akçay, Arzu; Ocak, Süheyla; Güneş, Adalet Meral; Tokgöz, Hüseyin; Ünal, Elif; Tiftik, Naci; Karakaş, Zeynep
2018-03-01
The Turkish Society of Pediatric Hematology set up a National Hemoglobinopathy Registry to demonstrate the demographic and disease characteristics of patients and assess the efficacy of a hemoglobinopathy control program (HCP) over 10 years in Turkey. A total of 2046 patients from 27 thalassemia centers were registered, of which 1988 were eligible for analysis. This cohort mainly comprised patients with β-thalassemia major (n=1658, 83.4%) and intermedia (n=215, 10.8%). The majority of patients were from the coastal areas of Turkey. The high number of patients in Southeastern Anatolia was due to that area having the highest rates of consanguineous marriage and fertility. The most common 11 mutations represented 90% of all β-thalassemia alleles and 47% of those were IVS1-110(G->A) mutations. The probability of undergoing splenectomy within the first 10 years of life was 20%, a rate unchanged since the 1980s. Iron chelators were administered as monotherapy regimens in 95% of patients and deferasirox was prescribed in 81.3% of those cases. Deferasirox administration was the highest (93.6%) in patients aged <10 years. Of the thalassemia major patients, 5.8% had match-related hemopoietic stem cell transplantation with a success rate of 77%. Cardiac disease was detected as a major cause of death and did not show a decreasing trend in 5-year cohorts since 1999. While the HCP has been implemented since 2003, the affected births have shown a consistent decrease only after 2009, being at lowest 34 cases per year. This program failure resulted from a lack of premarital screening in the majority of cases. Additional problems were unawareness of the risk and misinformation of the at-risk couples. In addition, prenatal diagnosis was either not offered to or was not accepted by the at-risk families. This study indicated that a continuous effort is needed for optimizing the management of thalassemia and the development of strategies is essential for further achievements in the
The ontogeny of seizures induced by leucine-enkephalin and beta-endorphin.
Snead, O C; Stephens, H
1984-06-01
Rats ranging in postnatal age from 6 hours to 28 days were implanted with cortical and depth electrodes as well as an indwelling cannula in the lateral ventricle. We then administered varying amounts of the opiate peptides leucine-enkephalin and beta-endorphin intracerebroventricularly with continuous electroencephalographic monitoring. Leucine-enkephalin produced electrical seizure activity in rats as young as 2 days. beta-Endorphin administration was associated with seizures at the fifth postnatal day, with a high incidence of apnea resulting in death in animals as young as 6 hours. An adult seizure response to beta-endorphin and leucine-enkephalin was seen at 15 and 28 days of age, respectively. Naloxone blocked the seizure produced by these opiate peptides in all age groups. The data indicate that the opiate peptides are potent epileptogenic compounds in developing brain, that seizures induced by leucine-enkephalin differ from those caused by beta-endorphin, and that petit mal-like seizure activity can be an adult response in the rodent.
Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri
2002-03-01
We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.
The radiographic investigation of two Egyptian mummies.
Fodor, J; Malott, J C; King, A Y
1983-01-01
Radiography is a well-recognized method of nondestructive analysis of art objects and ancient relics. The methods and techniques used in the examination of two ancient Egyptian mummies are presented here. Additionally, the use of radiographic findings to help substantiate alleged historical information and to establish sex, age, and pathology of each specimen is discussed.
Balouchi, Sima; Gharagozloo, Marjan; Esmaeil, Nafiseh; Mirmoghtadaei, Milad; Moayedi, Behjat
2014-08-01
Abstract Several immunological abnormalities have been characterized in β-thalassemia, many of which are linked to or identified with cytokines. In this study, we investigated the serum levels of TGF-β, IL-10, IL-17 and IL-23 in β-thalassemia major patients in comparison with healthy controls. The immunomodulatory effect of silymarin (a flavonoid complex obtained from Silybum marinum) on the serum levels of cytokines was further evaluated in thalassemia patients receiving silymarin (420 mg/day) and compared with patients treated with placebo for 6-month. Serum cytokines levels were measured by enzyme linked immunosorbent assay (ELISA). The results showed a significant higher concentration of TGF-β and IL-23 in the patient group than control group. Among studied cytokines, a significant reduction in serum IL-10 levels was found in patients treated with silymarin when compared with IL-10 values at baseline. However, no significant difference was observed between baseline values of cytokine compared with end values in placebo group. Our data suggest the presence of imbalanced immune condition involving inflammation and immunosuppression in thalassemia patients, which could be modulated to a more effective immune response by silymarin.
Yan, Miansheng; Gan, Xin; Liu, Min; Huang, Bin; Zhong, Liangying
2016-10-01
To analyze the genotype-phenotype correlation among carriers from Guangdong with co-inherited hemoglobin Hb Westmead (HbWS) and β-thalassemia. Twenty three patients (including 9 males and 14 females, aged 1-53 year old) were diagnosed by hematological analysis and genetic testing. Complete blood cell count and hemoglobin electrophoresis analysis were performed on a XE4000i automatic hemocyte analyzer. Hb, HbF and HbA2 were tested by high performance liquid chromatography (HPLC). Gap-PCR was adopted to detect three common thalassemia deletions. Reverse dot-blotting (RDB) assay was applied for detecting three common non-deletional α2 gene mutations and β-thalassemia. Among the 23 patients, 12 showed anemia, among whom 9 had mild anemia and 3 had moderate anemia. The lowest Hb was 68 g/L, and both mean corpuscular volume and mean corpuscular hemoglobin were lower than average, while HbA2 was higher than 3.5%. Genetic analysis confirmed that 5 cases had αWS-α/α-α, β CD654/β N (21.7%), 4 had α WS-α/α-α, β CD41-42/β N (17.4%), 5 had α WS-α/α-α, β CD17/β N (21.7%), 4 had α WS-α/α-α, β CD28/β N (17.4%), 1 had α WS-α/α-α, β CD71-72/β N (4.3%), 1 had αWS-α/α-α, β CD27-28/β N (4.3%), 1 had α WS-α/α-α, β CD41-42/β CD17 (4.3%), 2 had a concomitant β-thalassemia heterozygosity and -α 3.7 deletion. Patients with co-existing Hb WS and other β-thalassemia trait may show variable clinical features. Such compound heterozygotes are usually misdiagnosed during screening by hemoglobin electrophoresis, accurate diagnose should be attained by molecular diagnosis.
Thinking Egyptian: Active Models for Understanding Spatial Representation.
ERIC Educational Resources Information Center
Schiferl, Ellen
This paper highlights how introductory textbooks on Egyptian art inhibit understanding by reinforcing student preconceptions, and demonstrates another approach to discussing space with a classroom exercise and software. The alternative approach, an active model for spatial representation, introduced here was developed by adapting classroom…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Filon, D.; Oron, V.; Krichevski, S.
The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsensemore » codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.« less
Balgir, R S
2006-01-01
Tribal communities in India constitute the largest tribal population in the world. There are about 635 biological isolates (tribes and subtribes), which constituted 8.08% (about 84.3 million) of the total population of India as per the 2001 census. Out of 635 scheduled tribes (aborigines), 62 live in the state of Orissa alone forming about 10.8% of the tribal population of India. Orissa state occupies an important place, being the 3rd in rank for the highest concentration of tribal population in the country. In India, tribal communities are highly vulnerable to hereditary diseases and have a high degree of malnutrition, morbidity and mortality. The sickle cell haemoglobinopathy and glucose-6-phosphate dehydrogenase (G6PD) enzyme deficiency are important genetic and public health problems in Central-Eastern part of India. In order to map out these genetic disorders among the tribal people, a cross-section of 15 major tribal communities from different parts of Orissa was randomly screened for haemoglobin variants and G6PD deficiency. The high frequency of sickle cell haemoglobinopathy (0-22.4%) and G6PD deficiency (4.3-17.4%), with beta-thalassemia trait (0-8.5%) taking almost an intermediate position, was observed. For G6PD deficiency, hemizygous males as well as female heterozygotes and female homozygotes were detected. Twelve cases showed compound heterozygosity for sickle cell haemoglobinopathy and G6PD deficiency. There seems to be a trend towards an inverse relationship between the sickle cell allele and G6PD deficiency, and sickle cell and beta-thalassemia allele in a cross-section of malaria endemic (Plasmodium falciparum) tribal communities in Orissa. When the frequency of sickle cell allele decreases in a cross-section of malaria endemic tribal population, the frequency of G6PD enzyme deficiency and beta-thalassemia allele increases and vice versa. Natural selection had played a major role in favour of sickle cell, beta-thalassemia and G6PD mutation alleles
Azami, Milad; Sharifi, Ali; Norozi, Siros; Mansouri, Akram; Sayehmiri, Kourosh
2017-01-01
Background: This study aimed to investigate the prevalence of diabetes, impaired fasting glucose (IFG) and impaired glucose tolerance (IGT) in Iranian patients with thalassemia major. Methods: The current study has been conducted based on PRISMA guideline. To obtain the documents, Persian and English scientific databases such as Magiran, Iranmedex, SID, Medlib, IranDoc, Scopus, PubMed, ScienceDirect, Cochrane, Web of Science, Springer, Wiley Online Library as well as Google Scholar were searched until December 2015. All steps of the study were conducted by two authors independently. To the high heterogeneity of the studies, the random effect model was used to combine studies. Data were analyzed using STATA Version 11.1 software. Results: Thirty-two studies involving 3959 major thalassemia patients with mean age of 16.83 years were included in the meta-analysis. The prevalence of diabetes in Iranian patients with thalassemia major was estimated as 9% (95% CI: 6.8-10.5) and estimated rate was 12.6% (95% CI: 6.1-19.1) for males and 10.8% (95% CI: 8.2-14.5) for females. The prevalence of IFG and IGT were 12.9% (95% CI: 7-18.8) and 9.6% (95% CI: 6.6-12.5) respectively. No relationship between serum ferritin and development of diabetes was noted. Conclusion: The prevalence of diabetes, IFG, and IGT in patients with thalassemia major in Iran is high and accordingly requires new management strategies and policies to minimize endocrine disorders in Iranian patients with thalassemia major. Screening of patients for the early diagnosis of endocrine disorders particularly diabetes, IFG, and IGT is recommended. PMID:28503277
Whole genome sequencing and bioinformatics analysis of two Egyptian genomes.
ElHefnawi, Mahmoud; Jeon, Sungwon; Bhak, Youngjune; ElFiky, Asmaa; Horaiz, Ahmed; Jun, JeHoon; Kim, Hyunho; Bhak, Jong
2018-05-15
We report two Egyptian male genomes (EGP1 and EGP2) sequenced at ~ 30× sequencing depths. EGP1 had 4.7 million variants, where 198,877 were novel variants while EGP2 had 209,109 novel variants out of 4.8 million variants. The mitochondrial haplogroup of the two individuals were identified to be H7b1 and L2a1c, respectively. We also identified the Y haplogroup of EGP1 (R1b) and EGP2 (J1a2a1a2 > P58 > FGC11). EGP1 had a mutation in the NADH gene of the mitochondrial genome ND4 (m.11778 G > A) that causes Leber's hereditary optic neuropathy. Some SNPs shared by the two genomes were associated with an increased level of cholesterol and triglycerides, probably related with Egyptians obesity. Comparison of these genomes with African and Western-Asian genomes can provide insights on Egyptian ancestry and genetic history. This resource can be used to further understand genomic diversity and functional classification of variants as well as human migration and evolution across Africa and Western-Asia. Copyright © 2017. Published by Elsevier B.V.
Ghweeba, Mayada; Shishi, Sobhi; Abbas, Mostafa; Waheed, Amani; Amer, Shaymaa
2017-01-01
Background Over the last decade, the Internet has become an important source of health-related information for a wide range of users worldwide. Yet, little is known about the personal characteristics of Egyptian Internet users who search for online health information (OHI). Objective The aim of the study was to identify the personal characteristics of Egyptian OHI seekers and to determine any associations between their personal characteristics and their health information-seeking behavior. Methods This cross-sectional questionnaire study was conducted from June to October 2015. A Web-based questionnaire was sent to Egyptian users aged 18 years and older (N=1400) of a popular Arabic-language health information website. The questionnaire included (1) demographic characteristics; (2) self-reported general health status; and (3) OHI-seeking behavior that included frequency of use, different topics sought, and self-reported impact of obtained OHI on health behaviors. Data were analyzed using descriptive statistics and multiple regression analysis. Results A total of 490 participants completed the electronic questionnaire with a response rate equivalent to 35.0% (490/1400). Regarding personal characteristics, 57.1% (280/490) of participants were females, 63.4% (311/490) had a university level qualification, and 37.1% (182/490) had a chronic health problem. The most commonly sought OHI by the participants was nutrition-related. Results of the multiple regression analysis showed that 31.0% of the variance in frequency of seeking OHI among Egyptian adults can be predicted by personal characteristics. Participants who sought OHI more frequently were likely to be female, of younger age, had higher education levels, and good self-reported general health. Conclusions Our results provide insights into personal characteristics and OHI-seeking behaviors of Egyptian OHI users. This will contribute to better recognize their needs, highlight ways to increase the availability
Higher Education and Some Upper Egyptian Women's Negotiation of Self-Autonomy at Work and Home
ERIC Educational Resources Information Center
El-Halawany, Hanan Salah El-Deen
2009-01-01
This research aims to compare the effect of higher education on some Upper Egyptian women's practice of self autonomy at both work and home. The most important revelation this research makes is the fact that although no one can deny the importance and significance of higher education to Upper Egyptian women, yet it failed to challenge the…
Dejkhamron, Prapai; Wejaphikul, Karn; Mahatumarat, Tuanjit; Silvilairat, Suchaya; Charoenkwan, Pimlak; Saekho, Suwit; Unachak, Kevalee
2018-02-01
Vitamin D deficiency is common in patients with thalassemia. Vitamin D deficiency could be related to cardiac dysfunction. Increased parathyroid hormone (PTH) is also known to be associated with heart failure. To determine the prevalence of Vitamin D deficiency and to explore the impact of Vitamin D deficiency on cardiac iron and function in patients with transfusion-dependent thalassemia. A cross-sectional study in patients with Transfusion-dependent thalassemia was conducted. Patients with liver disease, renal disease, type 1 diabetes, malabsorption, hypercortisolism, malignancy, and contraindication for MRI were excluded. Calcium, phosphate, PTH, vitamin D-25OH were measured. CardiacT2 * and liver iron concentration (LIC) and left ventricular ejection fraction (LVEF) were determined. Results Sixty-one (33M/28F) patients with Transfusion-dependent thalassemia were enrolled. The prevalence of Vitamin D deficiency was 50.8%. Patients with cardiac siderosis had tendency for lower D-25OH than those without siderosis (15.9 (11.7-20.0) vs. 20.2 (15.85-22.3) ng/mL); p = 0.06). Serum calcium, phosphate, PTH, LIC, cardiac T2 * , and LVEF were not different between the groups with or without Vitamin D deficiency. Patients with Vitamin D deficiency had significantly lower hemoglobin levels compared to those without Vitamin D deficiency (7.5 (6.93-8.33) vs. 8.1 (7.30-8.50) g/dL; p = 0.04). The median hemoglobin in the last 12 months was significantly correlated with D-25OH. Cardiac T2 * had significant correlation with PTH. Vitamin D deficiency is prevalent in patients with Transfusion-dependent thalassemia. Vitamin D level is correlated with hemoglobin level. Vitamin D status should be routinely assessed in these patients. Low PTH is correlated with increased cardiac iron. This study did not demonstrate an association between Vitamin D deficiency and cardiac iron or function in patients with Transfusion-dependent thalassemia.
Mashhadi, Mohammad Ali; Sepehri, Zahra; Heidari, Zahra; Shirzaee, Eghbal; Kiani, Zohre
2014-01-01
Background: There are different and controversial reports about zinc deficiency in patients with major thalassemia. Objectives: The aim of this study was to evaluate zinc status in patients with major thalassemia in Sistan and Baluchistan province, southeastern Iran. Patients and Methods: The study was performed in Ali Asghar Hospital, a specialized governmental hospital located in Zahedan, Iran. In this cross-sectional study, 369 patients with a history of major thalassemia for more than 5 years entered the study using convenience sampling method. Thirty-six subjects were excluded from the study based on our exclusion criteria. Zinc level was measured in all patients after 12 hours fasting using atomic absorption spectrometry method in 2012. Results: Of 369 cases, 333 patients were eligible and evaluated. The mean age was 15.63 ± 7.4 years. One hundred ninety two cases were male and others were female (141 cases). About 27% (90) of the cases were 5-10 years-old, 24% (80) were 10-15 years-old and 49% were older than 15 years old. Iron chelator in 65.46% was Desferrioxamine, in 28.2% was Deferasirox and in 19.5% was combination of Desferrioxamine and Deferiprone. All cases had zinc deficiency, and 98.5% had severe zinc deficiency. Others (1.5%) had mild deficiency. Conclusions: Our study on 333 patients with major thalassemia documented severe zinc deficiency in all cases. We had no cases with normal or increased zinc levels. It was different with other reports in the world. PMID:25389495
Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2015-01-01
Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845
Islam in Egyptian Education: Grades K-12
ERIC Educational Resources Information Center
Neill, Charlotte M.
2006-01-01
This article explores the important role that the religion of Islam plays in the education of Egyptian children. The scrutiny under which the Islamic world finds itself in the after-math of September 11, 2001 has resulted in calls for educational reform, not only from the outside world, but also from the Muslim world itself. The author has a…
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi
2017-01-01
We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β 0 -thal appears as the cause of β-thal intermedia (β-TI) in our case.
1. PERSPECTIVE VIEW OF MAIN AND SIDE ELEVATION, SHOWING EGYPTIAN ...
1. PERSPECTIVE VIEW OF MAIN AND SIDE ELEVATION, SHOWING EGYPTIAN REVIVAL TOMB SITUATED WITHIN SURROUNDING GRAVES - Mount Pleasant Cemetery, George Opdyke Tomb, 375 Broadway Street, Newark, Essex County, NJ
Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.
Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca
2015-01-01
β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.
Hahalis, George; Zacharioglou, Evangelia; Xanthopoulou, Ioanna; Koniari, Ioanna; Kalogeropoulou, Chistina; Tsota, Irene; Rigopoulou, Aspasia; Diamantopoulos, Athanasios; Gkizas, Vasilios; Davlouros, Periklis; Akinosoglou, Karolina; Leopoulou, Marianna; Gogos, Charalampos; Alexopoulos, Dimitrios
2016-02-01
Thalassemic patients demonstrate an increased rate of extracardiac vascular complications and increased carotid wall intima-media thickness (cIMT), but very low prevalence of coronary artery disease (CAD). We investigated the atheroma burden by assessing the coronary artery calcium (CAC) and cIMT in these patients. We examined 37 patients with β-thalassemia and 150 healthy control volunteers with multi-detector computer tomography (CT) and ultrasonography to determine CAC score and cIMT, respectively. Propensity score matching (C-statistic: 0.88; 95% CI: 0.83-0.93) resulted in 27 pairs of patients; severe CAC was observed in 2 (7.4%) and 0 of β-thalassemia patients and healthy volunteers respectively (P = 0.5). Median calcium score was 0 (0-0) in β-thalassemia patients and 0 (0-4) in healthy volunteers (P = 0.8). Median intima-media thickness was higher in β-thalassemia patients compared to control group [0.45 (0.06-0.65) vs. 0.062 (0.054-0.086); P = 0.04]. Patients with β-thalassemia in comparison with healthy control subjects exhibit similar CAC score and increased cIMT. Our findings indicate a disparate rate of progression of atherosclerosis between coronary and extracardiac arteries in these patients lending support to the epidemiological evidence.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-15
... Determinations: ``The Dawn of Egyptian Art'' SUMMARY: Notice is hereby given of the following determinations... Egyptian Art,'' imported from abroad for temporary exhibition within the United States, are of cultural... of Art, New York, NY from on or about April 2, 2012, until on or about August 5, 2012, and at...
Back to the roots - dermatology in ancient Egyptian medicine.
Hartmann, Anke
2016-04-01
Although ancient Greek and Roman medicine is generally considered the origin of European medicine, there is evidence in ancient Egyptian texts suggesting a precursor role of ancient Egyptian medicine in this regard. What did Greek and Roman physicians learn from their Egyptian counterparts? Of the medical papyri discovered to date, the largest and most significant - the Ebers papyrus and the Smith papyrus - originate from the beginning of the New Kingdom, however, they were - at least in part - already written during the Old Kingdom. Considering the times, the spectrum of diseases treated as well as the range of conservative and surgical treatment methods was truly astounding. Taking a medical history, performing a thorough manual examination, and assessing clinical findings constituted key components in establishing a diagnosis. Apart from hygienic aspects, skin and hair disorders, the treatment of acute and chronic wounds and injuries as well as cosmetic procedures took on an important role. Even back then, physicians sought to assess inflammatory processes with respect to their cardinal features, implement graded wound therapy, and treat diseases with allopathic drugs. The 'channel theory' prevalent at that time, in which the unimpeded flow of bodily fluids was considered a fundamental prerequisite for health, may likely be regarded as precursor of ancient Greek humoral pathology. The latter became the basis for the subsequently established theory of the four humors, and was thus essential for the entire field of medieval medicine. © 2016 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
Cats of the Pharaohs: Genetic Comparison of Egyptian Cat Mummies to their Feline Contemporaries
Kurushima, Jennifer D.; Ikram, Salima; Knudsen, Joan; Bleiberg, Edward; Grahn, Robert A.; Lyons, Leslie A.
2012-01-01
The ancient Egyptians mummified an abundance of cats during the Late Period (664 - 332 BC). The overlapping morphology and sizes of developing wildcats and domestic cats confounds the identity of mummified cat species. Genetic analyses should support mummy identification and was conducted on two long bones and a mandible of three cats that were mummified by the ancient Egyptians. The mummy DNA was extracted in a dedicated ancient DNA laboratory at the University of California – Davis, then directly sequencing between 246 and 402 bp of the mtDNA control region from each bone. When compared to a dataset of wildcats (Felis silvestris silvestris, F. s. tristrami, and F. chaus) as well as a previously published worldwide dataset of modern domestic cat samples, including Egypt, the DNA evidence suggests the three mummies represent common contemporary domestic cat mitotypes prevalent in modern Egypt and the Middle East. Divergence estimates date the origin of the mummies’ mitotypes to between two and 7.5 thousand years prior to their mummification, likely prior to or during Egyptian Predyanstic and Early Dynastic Periods. These data are the first genetic evidence supporting that the ancient Egyptians used domesticated cats, F. s. catus, for votive mummies, and likely implies cats were domesticated prior to extensive mummification of cats. PMID:22923880
Relationship among chelator adherence, change in chelators, and quality of life in thalassemia.
Trachtenberg, Felicia L; Gerstenberger, Eric; Xu, Yan; Mednick, Lauren; Sobota, Amy; Ware, Hannah; Thompson, Alexis A; Neufeld, Ellis J; Yamashita, Robert
2014-10-01
Thalassemia, a chronic blood disease, necessitates life-long adherence to blood transfusions and chelation therapy to reduce iron overload. We examine stability of health-related quality of life (HRQOL) in thalassemia and adherence to chelation therapy over time, especially after changes in chelator choice. Thalassemia Longitudinal Cohort participants in the USA, UK, and Canada completed the SF-36v2 (ages 14+) and the PF-28 CHQ (parents of children <14 years). Chelation adherence was defined as self-reported percent of doses administered in the last 4 weeks. Two hundred and fifty-eight adults/adolescents (mean 29.7 years) and 133 children (mean 8.5 years) completed a mean of 2.8-years follow-up. Children made few chelator changes, whereas a mean of 2.2 changes was observed among the 37% of adults/adolescents who made chelator changes, mainly due to patient preference or medical necessity. Physical HRQOL improved among those with lower iron burden (better health status) at baseline who made a single change in chelator, but declined among participants with multiple changes and/or high iron burden (worse health status). Mental health improved among participants with lower iron burden, but iron overload was negatively associated with social functioning. Adherence did not significantly change over follow-up except for an increase after a change from deferoxamine (DFO) infusion to oral deferasirox (p = 0.03). Predictors of lower adherence for adults/adolescents at follow-up included side effects, smoking, younger age, problems preparing DFO, increased number of days per week DFO prescribed, and lower physical quality of life . Strategies to balance medical needs with family, work, and personal life may assist in adherence.
IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.
Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan
2017-01-01
Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.
Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-10-01
Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.
Seager, Dennis Craig; Kau, Chung How; English, Jeryl D; Tawfik, Wael; Bussa, Harry I; Ahmed, Abou El Yazeed M
2009-09-01
To compare the facial morphologies of an adult Egyptian population with those of a Houstonian white population. The three-dimensional (3D) images were acquired via a commercially available stereophotogrammetric camera capture system. The 3dMDface System photographed 186 subjects from two population groups (Egypt and Houston). All of the participants from both population groups were between 18 and 30 years of age and had no apparent facial anomalies. All facial images were overlaid and superimposed, and a complex mathematical algorithm was performed to generate a composite facial average (one male and one female) for each subgroup (EGY-M: Egyptian male subjects; EGY-F: Egyptian female subjects; HOU-M: Houstonian male subjects; and HOU-F: Houstonian female subjects). The computer-generated facial averages were superimposed based on a previously validated superimposition method, and the facial differences were evaluated and quantified. Distinct facial differences were evident between the subgroups evaluated, involving various regions of the face including the slant of the forehead, and the nasal, malar, and labial regions. Overall, the mean facial differences between the Egyptian and Houstonian female subjects were 1.33 +/- 0.93 mm, while the differences in Egyptian and Houstonian male subjects were 2.32 +/- 2.23 mm. The range of differences for the female population pairings and the male population pairings were 14.34 mm and 13.71 mm, respectively. The average adult Egyptian and white Houstonian face possess distinct differences. Different populations and ethnicities have different facial features and averages.
Wissa Wassef's Experiment: The Phoenix of Egyptian Weaving.
ERIC Educational Resources Information Center
Court, Elsbeth
1985-01-01
The gallery and weaving workshops of the Wissa Wassef School, located near Cairo, Egypt, are described. The school was started 30 years ago by the Egyptian architect Wissa Wassef, who believed in innate creativity and the need to encourage artistic creation by the practice of the craft from early childhood. (RM)
Language Teachers' Conceptions of Assessment: An Egyptian Perspective
ERIC Educational Resources Information Center
Gebril, Atta
2017-01-01
The current study investigates the assessment conceptions of both pre-service and in-service English teachers within a high-stakes, test-driven context in Egypt. For this purpose, 170 Egyptian pre-service and in-service teachers completed an assessment conceptions questionnaire. Quantitative and qualitative data analysis were employed to answer…
Egyptian Film: Gender and Class Violence Three Cycles.
ERIC Educational Resources Information Center
Al-Obaidi, Jabbar A.
2000-01-01
Examines the level of physical and verbal violence by gender and social class in Egyptian films in three cycles: romantic musicals and melodramas; war and political genres; and drug and gangster films. Concludes that the outrageous level of violence does not accurately reflect the real society. (Contains 20 references.) (LRW)
Eghbali, Aziz; Kazemi, Hamideh; Taherahmadi, Hassan; Ghandi, Yazdan; Rafiei, Mohammad; Bagheri, Bahador
2017-12-01
Cardiomyopathy due to iron overload can be fatal in patients with thalassemia major. Calcium channel blockers seem to be effective to reduce iron loading. Our goal was to study effects of amlodipine addition to chelators on iron loading in patients with thalassemia major. This randomized, controlled, and single-center trial was performed on 56 patients with thalassemia major. Patients were randomized 1:1 to combined group (iron chelator plus amlodipine) or control group (iron chelator) for 1 year. Iron content was measured by magnetic resonance imaging; heart T2*, and liver T2*. Serum ferritin was also measured. After 12 months of treatment, myocardial T2* values had significant improvement in combined group (21.9 ± 8.0 ms to 24.5 ± 7.6 ms; P < .05); Difference between two groups was significant (P = .02). Combined treatment had no effect on hepatic T2* value (9.6 ± 2.8 ms to 9.5 ± 3.6 ms); difference between two groups was not significant (P = .2). In addition, a significant reduction was seen in serum ferritin levels in two groups. Mild gastrointestinal upset was the most common untoward effect. Addition of amlodipine to iron chelators has beneficial effects for reduction of iron loading in patients with thalassemia major. This combination therapy seems safe. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Ghweeba, Mayada; Lindenmeyer, Antje; Shishi, Sobhi; Abbas, Mostafa; Waheed, Amani; Amer, Shaymaa
2017-06-22
Over the last decade, the Internet has become an important source of health-related information for a wide range of users worldwide. Yet, little is known about the personal characteristics of Egyptian Internet users who search for online health information (OHI). The aim of the study was to identify the personal characteristics of Egyptian OHI seekers and to determine any associations between their personal characteristics and their health information-seeking behavior. This cross-sectional questionnaire study was conducted from June to October 2015. A Web-based questionnaire was sent to Egyptian users aged 18 years and older (N=1400) of a popular Arabic-language health information website. The questionnaire included (1) demographic characteristics; (2) self-reported general health status; and (3) OHI-seeking behavior that included frequency of use, different topics sought, and self-reported impact of obtained OHI on health behaviors. Data were analyzed using descriptive statistics and multiple regression analysis. A total of 490 participants completed the electronic questionnaire with a response rate equivalent to 35.0% (490/1400). Regarding personal characteristics, 57.1% (280/490) of participants were females, 63.4% (311/490) had a university level qualification, and 37.1% (182/490) had a chronic health problem. The most commonly sought OHI by the participants was nutrition-related. Results of the multiple regression analysis showed that 31.0% of the variance in frequency of seeking OHI among Egyptian adults can be predicted by personal characteristics. Participants who sought OHI more frequently were likely to be female, of younger age, had higher education levels, and good self-reported general health. Our results provide insights into personal characteristics and OHI-seeking behaviors of Egyptian OHI users. This will contribute to better recognize their needs, highlight ways to increase the availability of appropriate OHI, and may lead to the
Ancient Egyptian chronology and the astronomical orientation of pyramids.
Spence, K
2000-11-16
The ancient Egyptian pyramids at Giza have never been accurately dated, although we know that they were built approximately around the middle of the third millennium BC. The chronologies of this period have been reconstructed from surviving lists of kings and the lengths of their reigns, but the lists are rare, seldom complete and contain known inconsistencies and errors. As a result, the existing chronologies for that period (the Old Kingdom) can be considered accurate only to about +/-100 years, a figure that radiocarbon dating cannot at present improve. Here I use trends in the orientation of Old Kingdom pyramids to demonstrate that the Egyptians aligned them to north by using the simultaneous transit of two circumpolar stars. Modelling the precession of these stars yields a date for the start of construction of the Great Pyramid that is accurate to +/-5 yr, thereby providing an anchor for the Old Kingdom chronologies.
Ancient Egyptian chronology and the astronomical orientation of pyramids
NASA Astrophysics Data System (ADS)
Spence, Kate
2000-11-01
The ancient Egyptian pyramids at Giza have never been accurately dated, although we know that they were built approximately around the middle of the third millennium BC. The chronologies of this period have been reconstructed from surviving lists of kings and the lengths of their reigns, but the lists are rare, seldom complete and contain known inconsistencies and errors. As a result, the existing chronologies for that period (the Old Kingdom) can be considered accurate only to about +/-100 years, a figure that radiocarbon dating cannot at present improve. Here I use trends in the orientation of Old Kingdom pyramids to demonstrate that the Egyptians aligned them to north by using the simultaneous transit of two circumpolar stars. Modelling the precession of these stars yields a date for the start of construction of the Great Pyramid that is accurate to +/-5 yr, thereby providing an anchor for the Old Kingdom chronologies.
13. Credit JTL: Detail, orthogonal view of Egyptian Revivial decorative ...
13. Credit JTL: Detail, orthogonal view of Egyptian Revivial decorative motifs used typically at midpoints of diagonals - Reading-Halls Station Bridge, U.S. Route 220, spanning railroad near Halls Station, Muncy, Lycoming County, PA
14. Credit JTL: Detail, oblique view of Egyptian Revival decorative ...
14. Credit JTL: Detail, oblique view of Egyptian Revival decorative motifs used typically at midpoints of diagonals - Reading-Halls Station Bridge, U.S. Route 220, spanning railroad near Halls Station, Muncy, Lycoming County, PA
Isolation of genetically diverse Marburg viruses from Egyptian fruit bats.
Towner, Jonathan S; Amman, Brian R; Sealy, Tara K; Carroll, Serena A Reeder; Comer, James A; Kemp, Alan; Swanepoel, Robert; Paddock, Christopher D; Balinandi, Stephen; Khristova, Marina L; Formenty, Pierre B H; Albarino, Cesar G; Miller, David M; Reed, Zachary D; Kayiwa, John T; Mills, James N; Cannon, Deborah L; Greer, Patricia W; Byaruhanga, Emmanuel; Farnon, Eileen C; Atimnedi, Patrick; Okware, Samuel; Katongole-Mbidde, Edward; Downing, Robert; Tappero, Jordan W; Zaki, Sherif R; Ksiazek, Thomas G; Nichol, Stuart T; Rollin, Pierre E
2009-07-01
In July and September 2007, miners working in Kitaka Cave, Uganda, were diagnosed with Marburg hemorrhagic fever. The likely source of infection in the cave was Egyptian fruit bats (Rousettus aegyptiacus) based on detection of Marburg virus RNA in 31/611 (5.1%) bats, virus-specific antibody in bat sera, and isolation of genetically diverse virus from bat tissues. The virus isolates were collected nine months apart, demonstrating long-term virus circulation. The bat colony was estimated to be over 100,000 animals using mark and re-capture methods, predicting the presence of over 5,000 virus-infected bats. The genetically diverse virus genome sequences from bats and miners closely matched. These data indicate common Egyptian fruit bats can represent a major natural reservoir and source of Marburg virus with potential for spillover into humans.
ERIC Educational Resources Information Center
Pasha, Talaat
2011-01-01
This study examines how Islamists are socially, discursively and linguistically represented in the Egyptian newspaper "al-Ahram." The main question of this study is what would the Egyptian government do to halt the Brothers' political growth and potential threat? To answer this question, the study uses Critical Discourse Analysis (CDA)…
HLA-matched sibling bone marrow transplantation for β-thalassemia major
Sabloff, Mitchell; Chandy, Mammen; Wang, Zhiwei; Logan, Brent R.; Ghavamzadeh, Ardeshir; Li, Chi-Kong; Irfan, Syed Mohammad; Bredeson, Christopher N.; Cowan, Morton J.; Gale, Robert Peter; Hale, Gregory A.; Horan, John; Hongeng, Suradej; Eapen, Mary
2011-01-01
We describe outcomes after human leukocyte antigen-matched sibling bone marrow transplantation (BMT) for 179 patients with β-thalassemia major. The median age at transplantation was 7 years and the median follow-up was 6 years. The distribution of Pesaro risk class I, II, and III categories was 2%, 42%, and 36%, respectively. The day 30 cumulative incidence of neutrophil recovery and day 100 platelet recovery were 90% and 86%, respectively. Seventeen patients had graft failure, which was fatal in 11. Six of 9 patients with graft failure are alive after a second transplantation. The day 100 probability of acute graft-versus-host disease and 5-year probability of chronic graft-versus-host disease was 38% and 13%, respectively. The 5-year probabilities of overall- and disease-free survival were 91% and 88%, respectively, for patients with Pesaro risk class II, and 64% and 62%, respectively, for Pesaro risk class III. In multivariate analysis, mortality risks were higher in patients 7 years of age and older and those with hepatomegaly before BMT. The leading causes of death were interstitial pneumonitis (n = 7), hemorrhage (n = 8), and veno-occlusive disease (n = 6). Proceeding to BMT in children younger than 7 years before development of end-organ damage, particularly in the liver, should improve results after BMT for β-thalassemia major. PMID:21119108
Miao, Yun; Xiong, Jun; Zhang, Xuelian; Huang, Huajie; Yu, Lixin; Chen, Jianfan; Deng, Wenfeng; Xu, Huiling; Liu, Rumin; Xiang, Chenglin; Xu, Xiangmin; Xiong, Fu
2017-10-01
Polycystic kidney disease (PKD) and Alport syndrome (AS) are serious inherited disorders associated with renal disease, and thalassemia is a hereditary blood disease with a high prevalence in south China. Here, we report an exceptional PKD coincidence of thalassemia minor and AS (diagnosed genetically) in a large Chinese family. Whole genome next-generation sequencing (NGS) was performed on the proband, and all family members underwent clinical evaluation. Sanger sequencing was used to validate the mutations distinguished by NGS. The pathogenic potential of the variants were evaluated by Polymorphism Phenotyping v2 (PolyPhen-2), Sorting Intolerant From Tolerant (SIFT) algorithm, and MutationTaster. Immunohistochemical, Western blot, immunofluorescent, and TdT-mediated dUTP nick-end labeling (TUNEL) analyses were performed to investigate polycystin 1 (PC1) expression, and cell proliferation and apoptosis in kidney tissues from the proband and normal control. A novel frameshift polycystic kidney disease 1 ( PKD1 ) mutation (c.3903delC, p.A1302Pfs) was identified to be responsible for renal disease in this family. PC1 expression, and cell proliferation and apoptosis were significantly increased in the kidney tissues of the proband. Moreover, a deletion of approximately 19.3 kb of DNA with α-globin genes ( _ _SEA ) was associated with thalassemia minor in the family. In addition, a collagen type IV α 5 chain ( COL4A5 ) variant (c.2858G>T, rs78972735), annotated as a pathogenic mutation in dbSNP and human gene mutation database (HGMD), was found in four family members with no clinical traits of AS. A novel pathogenic PKD1 mutation (c.3903delC) and ( _ _SEA ) thalassemia deletion were found to be responsible for the clinical symptoms in this family. The reported pathogenic COL4a5 variant (c.2858G>T, rs78972735) was not pathogenic alone. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Moftah, Marie; Abdel Aziz, Sayeda H.; Elramah, Sara; Favereaux, Alexandre
2011-01-01
The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?Barcoding%20Fish%20%28FishBOL%29). PMID:22087242
Student Involvement in the Egyptian Quality Assurance System
ERIC Educational Resources Information Center
Elassy, Noha
2015-01-01
Purpose: The purpose of this paper is to study the extent and the quality of student involvement in the quality assurance process (QAP) in Egyptian higher education institutions (HEIs). Design/methodology/approach: In this study, two qualitative methods were used to explore the extent and the quality of student involvement; these were focus groups…
ERIC Educational Resources Information Center
Swain, Julian; Monk, Martin; Johnson, Sally
1999-01-01
Explores Egyptian science teachers' views of (1) science education in London secondary schools and (2) how London schools influenced their teaching in Egypt. Explains that the Egyptian teachers were participating in a 12-week in-service course at King's College, London. Discusses the results. (CMK)
Stojanovski, Kristefer; Holla, Alaka; Hoxha, Ilir; Howell, Elizabeth; Janevic, Teresa
2017-12-01
The conflict in Kosovo created mass displacement and a fractured health system. Roma, Ashkali, and Balkan Egyptian communities are particularly vulnerable to discrimination and exclusion from institutions. We aimed to examine Roma, Ashkali, and Balkan Egyptian disparities in quantity and quality of antenatal care received. We conducted a cross-sectional study in August 2012 with 603 women aged 15 or older who had given birth in the previous two years. We measured quantity of antenatal care using number of visits and quality of care using antenatal checklists. We used linear regression with interaction terms of displacement and type of health institution (for example, Serbian or Kosovar) to assess ethnic disparities in antenatal care. Women from Roma, Ashkali, and Balkan Egyptian communities received poorer quantity and quality of antenatal care compared to Kosovar Albanian and Serbian women. In adjusted models, Roma, Ashkali, and Balkan Egyptian women scored 3.5 points lower [95% CI (-5.2, -1.8)] on the checklists. Roma, Ashkali, and Balkan Egyptian women who were displaced received even poorer quality of care. Ethnic disparities exist in quality of antenatal care. Women from Roma, Ashkali, and Balkan Egyptian communities receive the poorest quality of services. As Kosovo strives to build a multiethnic health care system, a focus on equity is important to ensure the right to health for Roma, Ashkali, and Balkan Egyptian women.
Mertel, Adam; Pospíšil, Zdeněk; Stachoň, Zdeněk; Chalupa, Aleš
2018-01-01
Early in the Ptolemaic era, Egyptian cults, particularly those of Isis and Sarapis, spread successfully to ports across the ancient Aegean Sea. Leading researchers in the field claim that the spread of these cults was influenced by multiple factors, ones that were mainly economic or political in character. However, the question of which factors had more weight or impact than others in the process of the early spread of Egyptian cults has not yet been answered in academic discussion. This could be related to the fact that the issue of the spread of religious innovations in the ancient Mediterranean has been addressed mainly by established historiographical methods such as the collection and critical analysis of archaeological and literary sources. Hypotheses and conclusions derived from these methods are, however, often unable to reflect the complexity of historical processes. A possible solution can be found in supplementing this established methodological apparatus by formalized methods, e.g. the coding of relevant datasets, statistics, geospatial modeling, and network analysis. To be able to compare the possible impacts of different factors on the spread of Egyptian cults in the Aegean Sea region, we 1) constructed a model of the ancient maritime transportation network as a platform for quantitative analysis, 2) transformed selected factors of possible influence into georeferenced parameters of the network, and 3) defined a mathematical model that allowed us to determine which parameters of the network explain the spatial dissemination of archaeological evidence connected to Egyptian cults. The results suggest that the most significant correlation is between the placement of Ptolemaic garrisons and the distribution of Egyptian temples and artefacts in the early Hellenistic Aegean Sea region. The interpretation would be that Egyptian military forces potentially played a significant role in the spread of Egyptian cults. PMID:29561857