Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations.

PubMed

Cardoso-Saldaña, G; De La Peña-Díaz, A; Zamora-González, J; Gomez-Ortega, R; Posadas-Romero, C; Izaguirre-Avila, R; Malvido-Miranda, E; Morales-Anduaga, M E; Anglés-Cano, E

2006-01-01

Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin binding with plasminogen, inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a) have been reported in several populations. The study examined the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin binding by immuno-enzymatic assay and short tandem repeat (STR) polymorphic marker genetic analysis by capillary electrophoresis. Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg dL(-1)) relative to Mazahuas (8.2 mg dL(-1)), Mayas (8.25 mg dL(-1)) and Mayos (6.5 mg dL(-1)). Phenotype distribution was different in Mayas and Mazahuas as compared with the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in the Native Mexican and the Mestizo group.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations

PubMed Central

Cardoso-Saldaña, Guillermo; De La Peña-Díaz, Aurora; Zamora-González, José; Gomez-Ortega, Rocio; Posadas-Romero, Carlos; Izaguirre-Avila, Raul; Malvido-Miranda, Elsa; Morales-Anduaga, Maria Elena; Angles-Cano, Eduardo

2006-01-01

Background Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin-binding with plasminogen inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a), have been reported in several populations. Aim To study the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. Methods We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin-binding by immuno-enzymatic assay and STR polymorphic markers genetic analysis by capillary electrophoresis. Results Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg/dL) relative to Mazahuas (8.2 mg/dL), Mayas (8.25 mg/dL) and Mayos (6.5 mg/dL). Phenotype distribution was different in Mayas and Mazahuas as compared to the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. Conclusion There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in Native Mexican and the Mestizo group. PMID:16684693

Intestinal microbiota assessment in cirrhotic patients from a Mexican mestizo population.

PubMed

Pérez-Monter, C; Escalona-Nandez, I; Estanes-Hernández, A; Noriega-López, L G; Torre-Delgadillo, A

2018-06-11

The intestinal microbiota is significantly altered in cirrhotic patients, but the composition of the intestinal microbiota in Mexican patients with the pathology has not been reported. The present study is an attempt to determine the type of intestinal microbiota in healthy subjects and in patients of Mexican mestizo origin that present with cirrhosis of the liver. Biochemical liver function parameters (ALT, AST, GGT, BIL-T, etc.) were determined in 23 cirrhotic patients and 21 control subjects. The intestinal microbiota was established through 16S ribosomal RNA gene sequencing. The cirrhotic patients had elevated levels of ALT, AST, GGT (105.2±77.7 vs. 20.99±8.5UI/L, 110±68.6 vs. 23.39±5.2, and 119.1±79.1 vs. 19.3±15.2UI/L, respectively), IL-6 (1.64±0.38pg/ml, P<.001), or TNFα (1.78±0.3, P<.05). The intestinal microbiota of the cirrhotic patients was less diverse, compared with that of the control subjects. At the level of the phylum, there was a significant increase in Proteobacteria and Bacteroidetes in the patients with cirrhosis, compared with the controls (6.2 vs. 4.9% and 44 vs. 46%, respectively, P<.01). In contrast, there was a decrease in Firmicutes, Actinobacteria, and Fusobacteria in the cirrhotic patients. There was an increase in the Campylobacter and Gemella families in the cirrhotic patients, whereas Streptococcus and Veillonella had a positive association with serum ALT or AST levels. To the best of our knowledge, the present study is the first to demonstrate the type of intestinal microbiota in Mexican patients with cirrhosis of the liver. The extension of the findings in a larger cohort of subjects and the metagenome analysis will enable the creation of data that can have relevant treatment implications for this group of patients in Mexico. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

PubMed

Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha

2010-01-01

Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.

Forensic parameters and admixture in Mestizos from five geographic regions of Mexico based on 20 autosomal STRs (Powerplex 21 system).

PubMed

Aguilar-Velázquez, J A; Martínez-Cortés, G; Inclán-Sánchez, A; Favela-Mendoza, A F; Velarde-Félix, J S; Rangel-Villalobos, H

2018-03-01

We analyzed Mestizo (admixed) population samples from different geographic regions of Mexico (n = 1283) with 20 autosomal STRs (PowerPlex® 21, Promega Corp.). Allele frequencies and forensic parameters from the Northwest, Northeast, West, Center, and Southeast regions are reported, as well as from the pooled Mexican population sample. The combined PD and PE for this 20 STR system were > 0.9999999999 and > 0.99999996593% in all five population samples, respectively. Analysis of molecular variance (AMOVA) of these Mexican population samples, plus Monterrey (Northeast) and Mexico (Center) Cities, showed low but significant differences among Mexican-Mestizos from the seven populations (Fst = 0.20%; p = 0.0000). Structure analysis showed the highest proportion of Native American ancestry in Mexico City, Center, and Southeast regions, respectively, which was in agreement with the estimated genetic distances represented in a MDS plot and a NJ tree. The best fit of population clusters (K = 4) obtained with the Structure software indicates that Mexican-Mestizos are mainly composed by European, African, and two Native American ancestries. The European and Native American ancestries displayed a contrary gradient, increasing toward the North-West and South-Southeast, respectively. These 20 autosomal STR loci improved the admixture estimation regarding previous studies with the 13 CODIS-STRs, as supported by the higher similarity with previous estimates based on genome-wide SNP. In brief, this study validates the confident use of the PowerPlex® 21 system for human identification purposes in Mestizo populations throughout the Mexican territory.

Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

PubMed

Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

2016-11-03

Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

Polymorphisms of APLN-APLNR system are associated with essential hypertension in Mexican-Mestizo individuals.

PubMed

Esteban-Martínez, Rosa Lilia; Pérez-Razo, Juan Carlos; Vargas-Alarcón, Gilberto; Martínez-Rodríguez, Nancy; Cano-Martínez, Luis Javier; López-Hernández, Luz Berenice; Rojano-Mejía, David; Canto, Patricia; Coral-Vazquez, Ramón Mauricio

2016-08-01

The aim of this study was to evaluate if polymorphisms of APLN and APLNR genes may play a role as susceptibility markers for hypertension in a group of Mexican-Mestizo patients. A case-control study was carried out including normotensive and hypertensive individuals. For these, two polymorphisms of APLN (rs3761581 and rs56204867) and two of APLNR () genes were genotyped by 5' exonuclease TaqMan assay in 400 normotensive individuals and 383 patients. The results showed that, under an additive model adjusted by BMI, HDL, triglycerides, glucose and family history of essential hypertension, the rs7119375 and rs10501367 polymorphisms of APLNR gene were associated significantly with a decreased risk of essential hypertension (P=0.039 and P=0.029, respectively). Besides, the haplotypes analysis of these polymorphisms showed that H1 haplotype was associated with an increased risk of essential hypertension (P=0.026), while the H2 haplotype was associated with a decreased risk (P=0.032). Contrary, the rs3761581 and rs56204867 polymorphisms of APLN gene were not associated with essential hypertension (P=0.1707 and P=0.0769, respectively). The data suggest that APLNR rs7119375 and rs10501367 are associated with a decreased risk of essential hypertension in our Mexican-Mestizo studied group, but further studies are warranted. Copyright © 2016 Elsevier Inc. All rights reserved.

Toxoplasmosis gondii and schizophrenia: a case control study in a low Toxoplasma gondii seroprevalence Mexican population

USDA-ARS?s Scientific Manuscript database

There are conflicting reports concerning the association of T. gondii infection and schizophrenia. Therefore, we determined such association in a Mexican population of Mestizo ethnicity. Through a case-control study design, 50 schizophrenic patients and 150 control subjects matched by gender, age, r...

Aldehyde dehydrogenase polymorphism in North American, South American, and Mexican Indian populations.

PubMed Central

Goedde, H W; Agarwal, D P; Harada, S; Rothhammer, F; Whittaker, J O; Lisker, R

1986-01-01

While about 40% of the South American Indian populations (Atacameños, Mapuche, Shuara) were found to be deficient in aldehyde dehydrogenase isozyme I (ALDH2 or E2), preliminary investigations showed very low incidence of isozyme deficiency among North American natives (Sioux, Navajo) and Mexican Indians (mestizo). Possible implications of such trait differences on cross-cultural behavioral response to alcohol drinking are discussed. PMID:3953578

Bone mineral density in postmenopausal Mexican-Mestizo women with normal body mass index, overweight, or obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Pedraza, Javier; Coral-Vázquez, Ramón Mauricio; Soriano, Ruth; García-García, Eduardo; Aguirre-García, María Del Carmen; Coronel, Agustín; Canto, Patricia

2013-05-01

Obesity and osteoporosis are two important public health problems that greatly impact mortality and morbidity. Several similarities between these complex diseases have been identified. The aim of this study was to analyze if different body mass indexes (BMIs) are associated with variations in bone mineral density (BMD) among postmenopausal Mexican-Mestizo women with normal weight, overweight, or different degrees of obesity. We studied 813 postmenopausal Mexican-Mestizo women. A structured questionnaire for risk factors was applied. Height and weight were used to calculate BMI, whereas BMD in the lumbar spine (LS) and total hip (TH) was measured by dual-energy x-ray absorptiometry. We used ANCOVA to examine the relationship between BMI and BMDs of the LS, TH, and femoral neck (FN), adjusting for confounding factors. Based on World Health Organization criteria, 15.13% of women had normal BMI, 39.11% were overweight, 25.96% had grade 1 obesity, 11.81% had grade 2 obesity, and 7.99% had grade 3 obesity. The higher the BMI, the higher was the BMD at the LS, TH, and FN. The greatest differences in size variations in BMD at these three sites were observed when comparing women with normal BMI versus women with grade 3 obesity. A higher BMI is associated significantly and positively with a higher BMD at the LS, TH, and FN.

More Evidence for the Genetic Susceptibility of Mexican Population to Nonalcoholic Fatty Liver Disease through PNPLA3.

PubMed

Chinchilla-López, Paulina; Ramírez-Pérez, Oscar; Cruz-Ramón, Vania; Canizales-Quinteros, Samuel; Domínguez-López, Aarón; Ponciano-Rodríguez, Guadalupe; Sánchez-Muñoz, Fausto; Méndez-Sánchez, Nahum

2018-03-01

The gene for patatin-like phospholipase domain containing 3 (PNPLA3) is associated with nonalcoholic fatty liver disease (NAFLD) development. We previously found that Mexican indigenous population had the highest frequency reported of the PNPLA3 148M risk allele. Further, we observed a relationship between M148M genotype with elevated ALT levels in individuals with normal weight, overweight and obese. We sought to investigate whether PNPLA3 polymorphism is associated with NAFLD development in Mexicans. We enrolled 189 Mexican patients with NAFLD and 201 healthy controls. Anthropometric, metabolic, and biochemical variables were measured, and rs738409 (Ile148Met substitution) polymorphism was genotyped by sequencing. Logistic regression analysis, using a recessive model, suggested that PNPLA3 polymorphism in Mexican population is significantly associated (OR = 1.711, 95% CI: 1.014-2.886; P = 0.044) with NAFLD. The PNPLA3 gene is associated with NAFLD in Mexican population. More studies are required to explain the high prevalence of PNPLA3 polymorphism in Mexican-Americans, Mexican-Indians, and Mexican-Mestizos.

EBV+ lymphoepithelial carcinoma of the parotid gland in Mexican Mestizo patients with chronic autoimmune diseases.

PubMed

Saqui-Salces, Milena; Martinez-Benitez, Braulio; Gamboa-Dominguez, Armando

2006-01-01

Lymphoepithelial carcinomas of the salivary gland are rare tumors constantly associated with Epstein-Barr virus (EBV) and mainly identified in Asiatic and Greenlander population. Four cases have been described in Caucasians, only two with EBV infection. We describe two cases of parotid gland lymphoepithelial carcinomas in Mexican mestizo women in which chronic latent EBV infection was documented by immunohistochemistry and in situ hybridization. One patient had primary Sjögren's syndrome and the other systemic lupus erythematosus of six and three years of evolution, respectively. Epithelial neoplastic cells showed latency pattern II (LMP1+, EBNA-2-, EBER+) with a dense inflammatory infiltrate composed mainly by CD8+ T lymphocytes. Follow-up excluded nasopharyngeal involvement in both patients. This report expands the ethnic groups in which salivary lymphoepithelial carcinomas associated with chronic latent EBV infection have been described, and illustrates for the first time its association with autoimmune diseases in two women living in a region non-endemic for this unusual neoplasm.

Phenotype-genotype analysis of CYP2C19 in Colombian mestizo individuals

PubMed Central

Isaza, Carlos; Henao, Julieta; Martínez, José H Isaza; Arias, Juan C Sepúlveda; Beltrán, Leonardo

2007-01-01

Background Omeprazole is metabolized by the hepatic cytochrome P450 (CYP) 2C19 enzyme to 5-hydroxyomeprazole. CYP2C19 exhibits genetic polymorphisms responsible for the presence of poor metabolizers (PMs), intermediate metabolizers (IMs) and extensive metabolizers (EMs). The defective mutations of the enzyme and their frequencies change between different ethnic groups; however, the polymorphism of the CYP2C19 gene has not been studied in Colombian mestizos. The aim of this study was to evaluate the genotype and phenotype status of CYP2C19 in Colombian mestizos, in order to contribute to the use of appropriate strategies of drug therapy for this population. Methods 189 subjects were genotyped using the multiplex SNaPshot technique and a subgroup of 44 individuals received 20 mg of omeprazole followed by blood collection at 3 hours to determine the omeprazole hydroxylation index by HPLC. Results 83.6%, 15.3% and 1.1% of the subjects were genotyped as EMs, IMs and PMs, respectively. The frequencies of the CYP2C29*1 and CYP2C19*2 alleles were 91.3% and 8.7% respectively whereas the *3, *4, *5, *6 and *8 alleles were not found. No discrepancies were found between the genotype and phenotype of CYP2C19. Conclusion The frequency of poor metabolizers (1.1%) in the Colombian mestizos included in this study is similar to that in Bolivian mestizos (1%) but lower than in Mexican-Americans (3.2%), West Mexicans (6%), Caucasians (5%) and African Americans (5.4%). The results of this study will be useful for drug dosage recommendations in Colombian mestizos. PMID:17623107

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population.

PubMed

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly- phenotype. Subjects with PPARG2 Ala- phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased.

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population

PubMed Central

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly− phenotype. Subjects with PPARG2 Ala− phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased. PMID:26185753

Contribution of Common Genetic Variants to Obesity and Obesity-Related Traits in Mexican Children and Adults

PubMed Central

Villalobos-Comparán, Marisela; Villarreal-Molina, Teresa; Romero-Hidalgo, Sandra; López-Contreras, Blanca; Gutiérrez-Vidal, Roxana; Vega-Badillo, Joel; Jacobo-Albavera, Leonor; Posadas-Romeros, Carlos; Canizalez-Román, Adrián; Río-Navarro, Blanca Del; Campos-Pérez, Francisco; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel

2013-01-01

Background Several studies have identified multiple obesity-associated loci mainly in European populations. However, their contribution to obesity in other ethnicities such as Mexicans is largely unknown. The aim of this study was to examine 26 obesity-associated single-nucleotide polymorphisms (SNP) in a sample of Mexican mestizos. Methods 9 SNPs in biological candidate genes showing replications (PPARG, ADRB3, ADRB2, LEPR, GNB3, UCP3, ADIPOQ, UCP2, and NR3C1), and 17 SNPs in or near genes associated with obesity in first, second and third wave GWAS (INSIG2, FTO, MC4R, TMEM18, FAIM2/BCDIN3, BDNF, SH2B1, GNPDA2, NEGR1, KCTD15, SEC16B/RASAL2, NPC1, SFRF10/ETV5, MAF, PRL, MTCH2, and PTER) were genotyped in 1,156 unrelated Mexican-Mestizos including 683 cases (441 obese class I/II and 242 obese class III) and 473 normal-weight controls. In a second stage we selected 12 of the SNPs showing nominal associations with obesity, to seek associations with quantitative obesity-related traits in 3 cohorts including 1,218 Mexican Mestizo children, 945 Mexican Mestizo adults, and 543 Indigenous Mexican adults. Results After adjusting for age, sex and admixture, significant associations with obesity were found for 6 genes in the case-control study (ADIPOQ, FTO, TMEM18, INSIG2, FAIM2/BCDIN3 and BDNF). In addition, SH2B1 was associated only with class I/II obesity and MC4R only with class III obesity. SNPs located at or near FAIM2/BCDIN3, TMEM18, INSIG2, GNPDA2 and SEC16B/RASAL2 were significantly associated with BMI and/or WC in the combined analysis of Mexican-mestizo children and adults, and FTO locus was significantly associated with increased BMI in Indigenous Mexican populations. Conclusions Our findings replicate the association of 8 obesity-related SNPs with obesity risk in Mexican adults, and confirm the role of some of these SNPs in BMI in Mexican adults and children. PMID:23950976

Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

PubMed

Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

2012-01-01

Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

Genetic variations in toll-like receptor 4 in Mexican-Mestizo patients with intra-abdominal infection and/or pneumonia.

PubMed

Rodriguez-Osorio, Carlos A; Lima, Guadalupe; Herrera-Caceres, Jaime O; Villegas-Torres, Beatriz E; Zuñiga, Joaquin; Ponce-de-Leon, Sergio; Llorente, Luis; Sifuentes-Osornio, Jose

2013-06-01

Sepsis is a leading cause of death around the world, and 73-83% of all sepsis cases requiring attention in intensive care units are linked to intra-abdominal infection (IAI) or pneumonia. The activation of innate immunity is central to the manifestation of sepsis, and toll-like receptor (TLR) 4 plays an important role in this activation process. The 299G and 399I alleles of TLR4 have been linked with an increased risk of Gram-negative bacteria (GNB) infections and septic shock in some populations. This case-control study evaluated the prevalence of D299G/T399I polymorphisms in Mexican patients with IAI and/or pneumonia and in healthy controls. Genotyping revealed that 1 in 44 patients (2.3%; CI 95%: 0.05-12.0%) and 4 in 126 controls (3.2%; CI 95%: 0.9-7.9%) were heterozygous for both the D299G and T399l polymorphisms (OR: 0.71, CI 95%: 0.01-7.44, p = NS), confirming the co-segregation of these alleles in this population. Furthermore, the patients with a GNB infection and severe sepsis were not carriers of the risk alleles. In summary, this report shows that the frequency of the D299G and T399I polymorphisms in Mexican-Mestizos is lower than anticipated in comparison with other ethnic groups, emphasizing the variable distribution of TLR4 polymorphisms among different populations. Consequently, this study was not able to detect associations between TLR4 polymorphisms and sepsis in this population. Copyright © 2013 Elsevier B.V. All rights reserved.

PPARGC1A and ADIPOQ polymorphisms are associated with aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity.

PubMed

Canto, Patricia; Granados, Jesús Benítez; Feria-Bernal, Guillermo; Coral-Vázquez, Ramón Mauricio; García-García, Eduardo; Tejeda, María Elena; Tapia, André; Rojano-Mejía, David; Méndez, Juan Pablo

2017-07-04

Obesity constitutes a risk factor for the development of aggressive forms of prostate cancer. It has been proposed, that prostate cancer has a genetic predisposition and that PPARGC1A and ADIPOQ polymorphisms play a role in the development of this condition. To analyse the association of two PPARGC1A and ADIPOQ polymorphisms as well as their haplotypes, with the development of aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity. Two hundred fifty seven men with prostate cancer of Mexican-Mestizo origin were included. Body mass index (BMI) was determined and the degree of prostate cancer aggressiveness by the D'Amico classification. DNA was obtained. Rs7665116 and rs2970870 of PPARGC1A, and rs266729 and rs1501299 of ADIPOQ were studied by real-time PCR allelic discrimination. Pairwise linkage disequilibrium, between single nucleotide polymorphisms was calculated and haplotype analysis was performed. A higher-risk (D'Amico classification) was observed in 21.8% of patients. An association of cancer aggressiveness with rs2970870 of PPARGC1A, and rs501299 of ADIPOQ, as well as with one haplotype of ADIPOQ was documented. This is the first study regarding the relationship of PPARGC1A and ADIPOQ polymorphisms, and the aggressiveness of prostate cancer in men with overweight or obesity.

Cultural and social determinants of health among indigenous Mexican migrants in the United States.

PubMed

Lee, Junghee; Donlan, William; Cardoso, Edgar Ezequiel Orea; Paz, Juan Jesus

2013-01-01

Despite growing numbers, indigenous Mexican migrants are relatively invisible to health practitioners who group them with nonindigenous, mestizo Mexican-origin populations. Associations between indigenous and mestizo cultural identifications with psychosocial characteristics and health indicators among indigenous Mexican migrants were examined. Results revealed gender differences in cultural identifications, perceived discrimination, self-esteem, self-efficacy, and various health indicators including depression severity, culture-bound syndromes, and self-rated health. Multivariate regression and structural equation path modeling demonstrated how indigenous cultural identification and perceived discrimination affects health. Findings suggest that interventions should utilize indigenous community-based activities designed to promote self-esteem and the value of indigenous culture, with a focus on females.

Evaluation of forensic and anthropological potential of D9S1120 in Mestizos and Amerindian populations from Mexico

PubMed Central

Rangel-Villalobos, Héctor; Sánchez-Gutiérrez, Viviana M; Botello-Ruiz, Miriam; Salazar-Flores, Joel; Martínez-Cortés, Gabriela; Muñoz-Valle, José F; Phillips, Christopher

2012-01-01

Aim To carry out a deeper forensic and anthropological evaluation of the short tandem repeat (STR) D9S1120 in five Mestizo populations and eight Amerindian groups from Mexico. Methods We amplified the STR D9S1120 based on primers and conditions described by Phillips et al, followed by capillary electrophoresis in the genetic analyzer ABI Prism 310. Genotypes were analyzed with the GeneMapper ID software. In each population we estimated statistical parameters of forensic importance and Hardy-Weinberg equilibrium. Heterozygosity and FST-values were compared with those previously obtained with nine STRs of the Combined DNA Index System (CODIS-STRs). Results Amerindian and Mestizo populations showed high frequencies of the allele 9 and 16, respectively. Population structure analysis (AMOVA) showed a significant differentiation between Amerindian groups (FST = 2.81%; P < 0.0001), larger than between Mestizos (FST = 0.44%; P = 0.187). D9S1120 showed less genetic diversity but better population differentiation estimates than CODIS-STRs between Amerindian groups and between Amerindians and Mestizos, but not between Mestizo groups. Conclusion This study evaluated the ability of D9S1120 to be used for human identification purposes and demonstrated its anthropological potential to differentiate Mestizos and Amerindian populations. PMID:23100204

Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

PubMed Central

Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

2016-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

Lactase non-persistence and general patterns of dairy intake in indigenous and mestizo chilean populations.

PubMed

Fernández, Catalina I; Montalva, Nicolás; Arias, Macarena; Hevia, Macarena; Moraga, Mauricio L; Flores, Sergio V

2016-01-01

Lactase persistence (LP) is a genetic trait that has been studied among different countries and ethnic groups. In Latin America, the frequencies of this trait have been shown to vary according to the degree of admixture of the populations. The objective of this study is to better understand the relationship between this genetic trait and dairy intake in a multiethnic context through a synthesis of studies conducted in four regions of Chile. Genotypes frequencies for the SNP LCT-13910C>T (rs4988235) and frequency of dairy consumption were obtained from four populations: Polynesians from Easter Island (Rapanui); Amerindians (Mapuche) and Mestizos from the Araucanía region; urban Mestizos from Santiago; and rural Mestizos from the Coquimbo region. Genetic differentiation and association between milk consumption and genotype frequencies were estimated. Genetic differentiation between Native and Mestizo populations was significant; the LP frequency in Mapuche and Rapanui was 10% and 25%, respectively, whereas among the Mestizos, LP frequency was near 40%. Dairy intake was below the nutritional recommendations for the four groups, and extremely below recommendations among the indigenous populations. Association between milk intake and LP was found in Santiago and Rapanui populations. Although the frequency of LP varies among the populations according to their degree of admixture, dairy consumption was very low across the populations. Given that the association between milk consumption and expected phenotype was found only in two of the populations analyzed, it seems that lactase non-persistence (LNP) is not the only cause for dairy avoidance. Thus, it is suggested that SES and cultural preferences are likely affecting dairy consumption. © 2015 Wiley Periodicals, Inc.

Distribution of CYP2D6 and CYP2C19 Polymorphisms Associated with Poor Metabolizer Phenotype in Five Amerindian Groups and Western Mestizos from Mexico

PubMed Central

Salazar-Flores, Joel; Torres-Reyes, Luis A.; Martínez-Cortés, Gabriela; Rubi-Castellanos, Rodrigo; Sosa-Macías, Martha; Muñoz-Valle, José F.; González-González, César; Ramírez, Angélica; Román, Raquel; Méndez, José L.; Barrera, Andrés; Torres, Alfredo; Medina, Rafael

2012-01-01

Background: The distribution of polymorphisms in the CYP2D6 and CYP2C19 genes allows inferring the potential risk for specific adverse drug reactions and lack of therapeutic effects in humans. This variability shows differences among human populations. The aim of this study was to analyze single-nucleotide polymorphisms related to a poor metabolizer (PM) phenotype in nonpreviously studied Amerindian groups and Mestizos (general admixed population) from Mexico. Methods: We detected by SNaPshot® different polymorphisms located in CYP2D6 (*3, *4, *6, *7, and *8) and CYP2C19 (*2, *3, *4 and *5) in western Mestizos (n=145) and five Amerindian groups from Mexico: Tarahumaras from the North (n=88); Purépechas from the Center (n=101); and Tojolabales (n=68), Tzotziles (n=88), and Tzeltales (n=20) from the Southeast. Genotypes were observed by capillary electrophoresis. The genetic relationships among these populations were estimated based on these genes. Results and Discussion: The wild-type allele (*1) of both genes was predominant in the Mexican populations studied. The most widely observed alleles were CYP2C19*2 (range, 0%–31%) and CYP2D6*4 (range, 1.2%–7.3%), whereas CYP2D6*3 was exclusively detected in Mestizos. Conversely, CYP2C19*4 and *5, as well as CYP2D6*3, *6, *7, and *8, were not observed in the majority of the Mexican populations. The Tarahumaras presented a high frequency of the allele CYP2C19*2 (31%) and of homozygotes *2/*2 (10.7%), which represent a high frequency of potentially PM phenotypes in this Amerindian group. The genetic distances showed high differentiation of Tarahumaras (principally for CYP2C19 gene). In general, a relative proximity was observed between most of the Amerindian, Mexican-Mestizo, and Latin-American populations. Conclusion: In general, the wild-type allele (*1) predominates in Mexican populations, outlining a relatively homogeneous distribution for CYP2C19 and CYP2D6. The exception is the Tarahumara group that displays a

Insulin resistance and β-cell function in Colombian mestizo and Embera-Chamí populations and their relation with adiposity degree.

PubMed

Caro-Gomez, María Antonieta; Naranjo-González, Andrés; Parra-Marín, María Victoria; Gallego-Lopera, Natalia; Valencia, Diana María; Rúa-Molina, Diana Carolina; Rosique-Gracia, Javier; García-Pineda, Andres Felipe; Gómez-Isaza, Luis Felipe; Pizano-Ramírez, Norman Diego; Arcos, Edgar Gerardo; Villegas-Perrasse, Alberto; Duque-Botero, Julieta; Bedoya-Berrío, Gabriel

2017-04-01

Insulin resistance (IR) is a condition favored by metabolic and endocrine changes experienced by adipose tissue in the context of obesity. The prevalence and the presentation of both IR and obesity vary among the populations, and may be affected by ancestral genetic composition among other factors. The aim of this study was to compare the presence of IR and obesity in Amerindians of the Embera-Chamí ethnicity and Colombian mestizo population. A sample of 630 individuals, 471 mestizos and 159 Amerindians of the Embera-Chamí ethnicity, from the general population of Colombia were studied. For each participant, anthropometric and biochemical measurements, as well as blood pressure and the Homeostatic Model Assessment (HOMA) of IR and β-cell function (%B) were recorded. These values were compared between the two populations. While prevalence of central obesity was similar in both populations (48.7% and 42.6% in the mestizo and Embera groups respectively; p=0.148), body mass index (BMI) values suggested a higher prevalence of overweight in the Embera than in mestizo population (43.4% Embera, 31.8% mestizo; p=0.027). Despite the similarities in the prevalence of HOMA-IR and HOMA-%B status between both populations, the Embera population had a significantly greater pancreatic β-cell function, higher insulin levels, and better glucose control, across BMI and central obesity categories, than the mestizo population. There are differences in aspects related to energy metabolism between the samples of the mestizo and Amerindian populations analyzed. Copyright © 2017 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

[Polymorphism g.37190613 G>A of the ELMO1 gene in the Mexican population: potential marker for clinical-surgical pathology].

PubMed

Topete-González, Luz Rosalba; Ramirez-Garcia, Sergio Alberto; Charles-Niño, Claudia; Villa-Ruano, Nemesio; Mosso-González, Clemente; Dávalos-Rodríguez, Nory Omayra

2014-01-01

ELMO1 is a gene located at locus 7p14.2-14.1 that codifies a regulatory protein involved in fibrogenesis, cell migration, phagocytosis and apoptosis. This gene presents a single nucleotide polymorphism, which appears to be linked with the development of diabetic nephropathy. Currently, there are no studies in regard to the presence of such polymorphism in the Mexican population. Therefore, the aim of this work was to estimate the frequency rate of alleles and genotypes of polymorphism rs1345365 from ELMO1 in Mexican mestizos who inhabit the west and the southeast regions of Mexico in order to generate reliable data for further association studies. There were 322 individuals who were screened for the identification of polymorphism rs1345365 using genomic DNA from leucocytes as a template for PCR-PASA reactions. Amplicons were separated in 7% PAGE and visualized after staining with silver nitrate. The reference allele (A) was the most frequent in both western and southeastern populations of Mexico. In addition, a different genotype distribution was found with respect to other populations. The results of this study indicate that both populations are in Hardy-Weinberg equilibrium. This study also reveals a low frequency rate of the ancestral genotype for the polymorphism rs1345365 in mestizos from the western and southeastern regions of Mexico.

Analysis of Polymorphisms in Genes (AGT, MTHFR, GPIIIa, and GSTP1) Associated with Hypertension, Thrombophilia and Oxidative Stress in Mestizo and Amerindian Populations of México

PubMed Central

Juárez-Velázquez, Rocio; Canto, Patricia; Canto-Cetina, Thelma; Rangel-Villalobos, Hector; Rosas-Vargas, Haydee; Rodríguez, Maricela; Canizales-Quinteros, Samuel; Velázquez Wong, Ana Claudia; Ordoñez-Razo, Rosa María; Vilchis-Dorantes, Guadalupe; Coral-Vázquez, Ramón Mauricio

2010-01-01

Several polymorphisms related to hypertension, thrombophilia, and oxidative stress has been associated with the development of cardiovascular disease. We analyzed the frequency of M235T angiotensinogen (AGT), A222V 5,10 methylenete-trahydrofolate reductase (MTHFR), L33P glycoprotein IIIa (GPIIIa), and I105V glutathione S-transferase P1 (GSTP1) polymorphisms in 285 individuals belonging to Mexican-Mestizo and five Amerindian population from México, by real time PCR allelic discrimination. Allele and genotype frequencies were compared using χ2 tests. All populations followed the Hardy Weinberg equilibrium for assay markers with the exception of the Triki, whose were in Hardy Weinberg dysequilibrium for the glutathione S-transferase P1 polymorphism. Interestingly, according to all the analyzed single nucleotide polymorphisms (SNPs), the Triki population was the most differentiated and homogeneous group of the six populations analyzed. A comparison of our data with those previously published for some Caucasian, Asian and Black populations showed quite significant differences. These differences were remarkable with all the Mexican populations having a lower frequency of the 105V allele of the glutathione S-transferase P1 and reduced occurrence of the 222A allele of the 5,10 methylenetetrahydrofolate reductase. Our results show the genetic diversity among different Mexican populations and with other racial groups. PMID:20592457

Analysis of betaS and betaA genes in a Mexican population with African roots.

PubMed

Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

2002-01-01

To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

Lactase persistence and dairy intake in Mapuche and Mestizo populations from southern Chile.

PubMed

Fernández, Catalina I; Flores, Sergio V

2014-11-01

Lactase persistence (LP) occurs at a very low frequency in indigenous populations from Latin America, offering an opportunity to understand the relationship between this genetic trait and patterns of dairy consumption. Here, the frequency of LP is analyzed from Mapuche and -an adjacent- mestizo population inhabiting the Araucanía region. In addition to genotyping for LP, participants were surveyed in relation to general perception and consumption habits of dairy products. Low LP frequency (10%) and very low dairy intake was found among the Mapuche population as compared with Mestizo populations inhabiting Chile. The survey reported that the main reasons for avoidance of dairy were the gastrointestinal symptoms after dairy intake and cultural dietary habits. The interaction between low LP genotype frequency, low dairy intake, and sociocultural determinants is here discussed in the light of their potential health outcomes. © 2014 Wiley Periodicals, Inc.

Susceptibility background for type 2 diabetes in eleven Mexican Indigenous populations: HNF4A gene analysis.

PubMed

Granados-Silvestre, M A; Ortiz-López, M G; Granados, J; Canizales-Quinteros, S; Peñaloza-Espinosa, Rosenda I; Lechuga, C; Acuña-Alonzo, V; Sánchez-Pozos, K; Menjivar, M

2017-12-01

The genetic risk of developing type 2 diabetes (T2D) increases in parallel with the proportion of Native American ancestry. Mestizo Mexicans have a 70% Native Amerindian genetic background. The T130I polymorphism in the HNF4A gene has been associated with early-onset T2D in mestizo Mexicans. Thus, the aim of the present study was to evaluate the frequency and relationship of the T130I variant in the HNF4A gene with risk factors for developing T2D in eleven indigenous groups from Mexico. In two groups, all exons of the HNF4A gene were directly sequenced; in the remaining the T130I polymorphism was analyzed by restriction fragment length polymorphism. Ancestry informative markers were assessed to confirm the Amerindian component. An additional analysis of EHH was carried out. Interestingly, HNF4A gene screening revealed only the presence of the T130I polymorphism. The range frequency of the risk allele (T) in the indigenous groups was from 2.7 to 16%. Genotypic frequencies (T130I/I130I) were higher and significantly different from those of all of the populations included in the HapMap Project (P < 0.005). EHH scores suggest a positive selection for T130I polymorphism. Metabolic traits indicate a relationship between the T130I/I130I genotypes with high triglyceride concentrations in the indigenous groups (P < 0.005). These results strongly suggest that the high frequency of the T130I polymorphism and its biological relationship with dysfunction in lipid metabolism in Mexican indigenous groups is a risk factor for the developing of T2D in Mexicans.

Forensic-paternity effectiveness and genetics population analysis of six non-CODIS mini-STR loci (D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and SE33 in Mestizo and Amerindian populations from Mexico.

PubMed

Burguete-Argueta, Nelsi; Martínez De la Cruz, Braulio; Camacho-Mejorado, Rafael; Santana, Carla; Noris, Gino; López-Bayghen, Esther; Arellano-Galindo, José; Majluf-Cruz, Abraham; Antonio Meraz-Ríos, Marco; Gómez, Rocío

2016-11-01

STRs are powerful tools intensively used in forensic and kinship studies. In order to assess the effectiveness of non-CODIS genetic markers in forensic and paternity tests, the genetic composition of six mini short tandem repeats-mini-STRs-(D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and the microsatellite SE33 in Mestizo and Amerindian populations from Mexico were studied. Using multiplex polymerase chain reactions and capillary electrophoresis, this study genotyped all loci from 870 chromosomes and evaluated the statistical genetic parameters. All mini-STRs studied were in agreement with HW and linkage equilibrium; however, an important HW departure for SE33 was found in the Mestizo population (p ≤ 0.0001). Regarding paternity and forensic statistical parameters, high values of combined power discrimination and mean power of exclusion were found using these seven markers. The principal co-ordinate analysis based on allele frequencies of three mini-STRs showed the complex genetic architecture of the Mestizo population. The results indicate that this set of loci is suitable to genetically identify individuals in the Mexican population, supporting its effectiveness in human identification casework. In addition, these findings add new statistical values and emphasise the importance of the use of non-CODIS markers in complex populations in order to avoid erroneous assumptions.

HLA Alleles are Genetic Markers for Susceptibility and Resistance towards Leprosy in a Mexican Mestizo Population.

PubMed

Aguilar-Medina, Maribel; Escamilla-Tilch, Monica; Frías-Castro, Luis Octavio; Romero-Quintana, Geovanni; Estrada-García, Iris; Estrada-Parra, Sergio; Granados, Julio; Arambula Meraz, Eliakym; Sánchez-Schmitz, Guzman; Khader, Shabaana Abdul; Rangel-Moreno, Javier; Ramos-Payán, Rosalío

2017-01-01

Despite the use of multidrug therapy, leprosy remains endemic in some countries. The association of several human leucocyte antigen (HLA) alleles and gene polymorphisms with leprosy has been demonstrated in many populations, but the major immune contributors associated to the spectrum of leprosy have not been defined yet. In this study, genotyping of HLA-A, -B, -DR, and -DQ alleles was performed in leprosy patients (n = 113) and control subjects (n = 117) from the region with the highest incidence for the disease in México. The odds of developing leprosy and lepromatous subtype were 2.12- and 2.74-fold higher in carriers of HLA-A*28, and 2.48- and 4.14-fold higher for leprosy and dimorphic subtype in carriers of DQB1*06. Interestingly, DQB1*07 was overrepresented in healthy individuals, compared to patients with leprosy (OR = 0.08) and the lepromatous subtype (OR = 0.06). These results suggest that HLA-A*28 is a marker for predisposition to leprosy and the lepromatous subtype and DQB1*06 to leprosy and the dimorphic subtype, while DQB1*07 might be a resistance marker in this Mestizo population. © 2016 John Wiley & Sons Ltd/University College London.

Tailoring Nutritional Advice for Mexicans Based on Prevalence Profiles of Diet-Related Adaptive Gene Polymorphisms

PubMed Central

Ojeda-Granados, Claudia; Panduro, Arturo; Gonzalez-Aldaco, Karina; Sepulveda-Villegas, Maricruz; Rivera-Iñiguez, Ingrid

2017-01-01

Diet-related adaptive gene (DRAG) polymorphisms identified in specific populations are associated with chronic disorders in carriers of the adaptive alleles due to changes in dietary and lifestyle patterns in recent times. Mexico’s population is comprised of Amerindians (AM) and Mestizos who have variable AM, European (EUR) and African genetic ancestry and an increased risk of nutrition-related chronic diseases. Nutritional advice based on the Mexican genome and the traditional food culture is needed to develop preventive and therapeutic strategies. Therefore, we aimed to provide a prevalence profile of several DRAG polymorphisms in the Mexican population, including Central West (CW) Mexico subpopulations. Geographic heat maps were built using ArcGIS10 (Esri, Redlands, CA, USA) software, based on the published data of the MTHFR C677T (rs1801133), ABCA1 Arg230Cys (rs9282541), APOE T388C (rs429358)/C526T (rs7412), LCT C-13910T (rs4988235) polymorphisms and AMY1 copy number variation (CNV). Also, new data obtained by allelic discrimination-real-time polymerase chain reaction (RT-PCR) assays for the MTHFR, ABCA1, and APOE polymorphisms as well as the AMY1 CNV in the CW Mexico subpopulations with different proportions of AM and EUR ancestry were included. In the CW region, the highest frequency of the MTHFR 677T, ABCA1 230C and APOE ε4 adaptive alleles was observed in the AM groups, followed by Mestizos with intermediate AM ancestry. The LCT-13910T allele frequency was highest in Mestizos-EUR but extremely low in AM, while the AMY1 diploid copy number was 6.82 ± 3.3 copies. Overall, the heat maps showed a heterogeneous distribution of the DRAG polymorphisms, in which the AM groups revealed the highest frequencies of the adaptive alleles followed by Mestizos. Given these genetic differences, genome-based nutritional advice should be tailored in a regionalized and individualized manner according to the available foods and Mexican traditional food culture that may lead

Metabolic effects of the contraceptive skin patch and subdermal contraceptive implant in Mexican women: A prospective study

PubMed Central

2014-01-01

Background The contraceptive skin patch (CSP) accepted by the U.S. FDA in 2001 includes ethinylestradiol and norelgestromine, whereas the subdermal contraceptive implant (SCI) has etonogestrel and is also approved by the FDA. In Mexico, both are now widely used for contraception but their effects on Mexican population are unknown. The objective of the study was to evaluate if these treatments induce metabolic changes in a sample of indigenous and mestizo Mexican women. Methods An observational, prospective, longitudinal, non-randomized study of women between 18 and 35 years of age assigned to CSP or SCI. We performed several laboratory tests: clinical chemistry, lipid profile, and liver and thyroid function tests. Also, serum levels of insulin, C-peptide, IGF-1, leptin, adiponectin, and C reactive protein were assayed. Results Sixty-two women were enrolled, 25 used CSP (0 indigenous; 25 mestizos) and 37 used SCI (18 indigenous; 19 mestizos). Clinical symptoms were relatively more frequent in the SCI group. Thirty-four contraceptive users gained weight without other clinical significant changes. After 4 months of treatment, significant changes were found in some biochemical parameters in both treatment groups. Most were clinically irrelevant. Interestingly, the percentage of users with an abnormal atherogenic index diminished from 75% to 41.6% after follow-up. Conclusions The CSP slightly modified the metabolic variables. Most changes were nonsignificant, whereas for SCI users changes were more evident and perhaps beneficial. Results of this attempt to evaluate the effects of contraceptives in mestizo and native-American populations show that clinical symptoms are frequent in Mexican users of CSP and SCI. Although these medications may affect some metabolic variables, these changes seem clinically irrelevant. Induction of abnormalities in other physiological pathways cannot be ruled out. PMID:24767248

Genetic admixture of eight Mexican indigenous populations: based on five polymarker, HLA-DQA1, ABO, and RH loci.

PubMed

Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Salamanca-Gómez, Fabio; Cerda-Flores, Ricardo M

2008-01-01

This study explores the genetic admixture of eight Mexican indigenous populations (Otomi-Ixmiquilpan, Otomi-Actopan, Tzeltales, Nahua-Milpa-Alta, Nahua-Xochimilco, Nahua-Zitlala, Nahua-Ixhuatlancillo, and Nahua-Coyolillo) on the basis of five PCR-based polymorphic DNA loci (LDLR, GYPA, HBGG, D7S8, GC), HLA_DQA1, and the blood groups ABO and Rh (CcDEe). Among the indigenous populations, the highest gene frequencies for O and D were 0.9703 and 1.000 for Zitlala (State of Guerrero) and 0.9955 and 0.9414 for Tzeltales (State of Chiapas), respectively. Maximum likelihood estimates of admixture components yield a trihybrid model with Amerindian (assuming that Nahua-Zitlala is the most representative indigenous population), Spanish, and African ancestry with the admixture proportions: 93.03, 6.03, and 0.94 for Tzeltales, and 28.99, 44.03, and 26.98 for Coyolillo. A contribution of the ancestral populations of Ixhuatlancillo, Actopan, Ixmiquilpan, Milpa-Alta, and Xochimilco were found with the following average of admixture proportions: 75.84, 22.50, and 1.66. The findings herein demonstrate that the genetic admixture of the Mexican indigenous populations who at present speak the same Amer-Indian language can be differentiated and that the majority of them have less ancestral indigenous contribution than those considered as Mestizo populations.

PREVALENCE OF METABOLIC SYNDROME IN YOUNG MEXICANS: A SENSITIVITY ANALYSIS ON ITS COMPONENTS.

PubMed

Murguía-Romero, Miguel; Jiménez-Flores, J Rafael; Sigrist-Flores, Santiago C; Tapia-Pancardo, Diana C; Jiménez-Ramos, Arnulfo; Méndez-Cruz, A René; Villalobos-Molina, Rafael

2015-07-28

obesity is a worldwide epidemic, and the high prevalence of diabetes type II (DM2) and cardiovascular disease (CVD) is in great part a consequence of that epidemic. Metabolic syndrome is a useful tool to estimate the risk of a young population to evolve to DM2 and CVD. to estimate the MetS prevalence in young Mexicans, and to evaluate each parameter as an independent indicator through a sensitivity analysis. the prevalence of MetS was estimated in 6 063 young of the México City metropolitan area. A sensitivity analysis was conducted to estimate the performance of each one of the components of MetS, as an indicator of the presence of MetS itself. Five statistical of the sensitivity analysis were calculated for each MetS component and the other parameters included: sensitivity, specificity, positive predictive value or precision, negative predictive value, and accuracy. the prevalence of MetS in Mexican young population was estimated to be 13.4%. Waist circumference presented the highest sensitivity (96.8% women; 90.0% men), blood pressure presented the highest specificity for women (97.7%) and glucose for men (91.0%). When all the five statistical are considered triglycerides is the component with the highest values, showing a value of 75% or more in four of them. Differences by sex are detected for averages of all components of MetS in young without alterations. Mexican young are highly prone to acquire MetS: 71% have at least one and up to five MetS parameters altered, and 13.4% of them have MetS. From all the five components of MetS, waist circumference presented the highest sensitivity as a predictor of MetS, and triglycerides is the best parameter if a single factor is to be taken as sole predictor of MetS in Mexican young population, triglycerides is also the parameter with the highest accuracy. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Association of Lactase Persistence Genotypes with High Intake of Dairy Saturated Fat and High Prevalence of Lactase Non-Persistence among the Mexican Population.

PubMed

Ojeda-Granados, Claudia; Panduro, Arturo; Rebello Pinho, João Renato; Ramos-Lopez, Omar; Gleyzer, Ketti; Malta, Fernanda de Mello; Gonzalez-Aldaco, Karina; Roman, Sonia

2016-01-01

Lactase (LCT) -13910 C>T and -22018 G>A polymorphisms associated with the lactase non-persistence (LNP)/persistence (LP) phenotypes vary globally. LP has been associated with obesity in Europeans. However, it has not been genetically evaluated in Mexico, a country with admixed population, recent introduction of dairy, and a high prevalence of obesity. Thus, we aimed to determine the distribution of the LCT polymorphisms and their association with the nutritional profile of West Mexico's populations. Genotyping of 1,196 individuals (natives and mestizos) was carried out by a Taqman allelic discrimination assay. Descriptive statistics and interpopulation analyzes were performed by SPSS, Arlequin, and Structure software. Demographic, anthropometric, biochemical and dietary data were analyzed in 212 mestizos. LNP genotypes mainly prevailed (CC 68.7% and GG 68.2%); both predominated in native Huicholes and Nahuas (>97.7%). Among the mestizos, the LP genotypes were associated with a higher intake of saturated fat (9.9 ± 3.9% vs. 8.5 ± 4.0%, p = 0.018; OR = 2.55, 95% CI 1.29-5.03, p = 0.006) and a daily/more frequent consumption of dairy (88.8 vs. 78.0%; p = 0.049) than LNP genotypes. The LNP trait was predominant in Mexicans with a major Amerindian ancestry. A daily consumption of dairy was associated with a higher intake of saturated fat in LP individuals. © 2016 S. Karger AG, Basel.

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

PubMed

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

Genetic variants in COL13A1, ADIPOQ and SAMM50, in addition to the PNPLA3 gene, confer susceptibility to elevated transaminase levels in an admixed Mexican population.

PubMed

Larrieta-Carrasco, Elena; Flores, Yvonne N; Macías-Kauffer, Luis R; Ramírez-Palacios, Paula; Quiterio, Manuel; Ramírez-Salazar, Eric G; León-Mimila, Paola; Rivera-Paredez, Berenice; Cabrera-Álvarez, Guillermo; Canizales-Quinteros, Samuel; Zhang, Zuo-Feng; López-Pérez, Tania V; Salmerón, Jorge; Velázquez-Cruz, Rafael

2018-02-01

Non-alcoholic fatty liver disease (NAFLD) is the accumulation of extra fat in liver cells not caused by alcohol. Elevated transaminase levels are common indicators of liver disease, including NAFLD. Previously, we demonstrated that PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), and GCKR (rs780094) are associated with elevated transaminase levels in overweight/obese Mexican adults. We investigated the association between 288 SNPs identified in genome-wide association studies and risk of elevated transaminase levels in an admixed Mexican-Mestizo sample of 178 cases of NAFLD and 454 healthy controls. The rs2896019, rs12483959, and rs3810622 SNPs in PNPLA3 and rs1227756 in COL13A1 were associated with elevated alanine aminotransferase (ALT, ≥40IU/L). A polygenic risk score (PRS) based on six SNPs in the ADIPOQ, COL13A1, PNPLA3, and SAMM50 genes was also associated with elevated ALT. Individuals carrying 9-12 risk alleles had 65.8% and 48.5% higher ALT and aspartate aminotransferase (AST) levels, respectively, than those with 1-4 risk alleles. The PRS showed the greatest risk of elevated ALT levels, with a higher level of significance than the individual variants. Our findings suggest a significant association between variants in COL13A1, ADIPOQ, SAMM50, and PNPLA3, and risk of NAFLD/elevated transaminase levels in Mexican adults with an admixed ancestry. This is the first study to examine high-density single nucleotide screening for genetic variations in a Mexican-Mestizo population. The extent of the effect of these variations on the development and progression of NAFLD in Latino populations requires further analysis. Copyright © 2018 Elsevier Inc. All rights reserved.

Treatment protocol for "Mestizo nose" with open rhinoplasty.

PubMed

de la Peña-Salcedo, Jose Abel; Soto-Miranda, Miguel Angel; Lopez-Salguero, Jose Fernando

2011-12-01

The aim of this study was to develop an operative sequence to guide plastic surgeons on how to handle the challenges of "Mestizo nose" during rhinoplasty. This type of nose has characteristics quite different from the Caucasian nose. Rhinoplasties on Mestizo nose represent a surgical challenge because of the anatomical characteristics of a weak frame and thick skin. The Hispanic population has grown, and nowadays a large number of patients requesting rhinoplasty within the US belong to this ethnic group. We have developed an operative sequence for the treatment of Mestizo nose. This operative sequence has been tested in 879 rhinoplasties (92.37% females and 7.62% males, aged 15-63 years, mean age = 39 years). All were primary cases. An algorithm on how to approach the different types of Mestizo nose is presented. We had overall good results using our algorithm, with an improvement in the nasal aesthetics of about 54.75%. Complications were postoperative bleeding (1.37%), pain (0.57%), septal hematoma (0.23%), unaesthetic scars (0.34%), and cartilage extrusion (0.11%). Our revision rate was 5%. We present ten complete cases to show our surgical results. This operative sequence has allowed us to get predictable and reliable surgical outcomes when used in Mestizo rhinoplasty operations. We think it can be very useful for every plastic surgeon who performs Mestizo nose rhinoplasty, although not all steps need to be performed in every case.

HPV-16 and HLA-DRB1 alleles are associated with cervical carcinoma in Mexican Mestizo women.

PubMed

Alaez-Verson, Carmen; Berumen-Campos, Jaime; Munguía-Saldaña, Andrea; Flores-Aguilar, Hilario; Guardado-Estrada, Mariano; Rodríguez-Gomez, Araceli; Gorodezky-Lauferman, Clara

2011-07-01

The aim of this report was to investigate the contribution of HLA-DRB1/DQB1 alleles to the expression of cervical cancer (CC) and squamous intraepithelial lesion (SIL) in Mexican patients. A total of 257 women were included in the study: 61with low-grade squamous intraepithelial lesions (LSIL), 30 with high-grade (HSIL), 73 with CC and 93 healthy females. All were Mexican Mestizos. For HLA class II typing, PCR-SSOP methodology was used. HPV-16 viral DNA was detected by PCR with specific primers for E6-E7 region. HPV-16 was found in 52% of the patients with CC as well as in 19% of women with HSIL and in 12.5% of females with LSIL. HLA-DRB1∗04:03 (OR = 5.88) was found increased in patients with HSIL as compared with controls, although significance (p = 0.04) was lost after correction (pc =NS). HLA-DRB1∗04:03 seems to influence the risk for developing HSIL, disregarding the presence of HPV-16. HLA-DRB1∗01:01 (OR = 0.12; p = 0.01) may confer protection to the development of CC. An analysis performed stratifying by the presence of HPV-16 infection showed that the frequency of HLA-DRB1∗04:07 (OR = 2.71) was increased in CC patients infected with HPV-16, confirming that the HLA association is HPV dependent. These results shed light on the influence that this virus may have in the expression of CC in the susceptible host. Genetic background is, therefore, a crucial factor in understanding the etiopathogenesis of CC in HPV-positive patients. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

[Prevalence of asthma in Tepehuano and Mestizo school children from Durango, Mexico].

PubMed

Esquivel, Cosme Alvarado; Pérez, Vicente Cisneros; Arredondo, Domingo Moreno; Iturbide, María Sandoval; Hernández, Albertino de la Rosa; Arellano, Andrés González

2008-01-01

There is a lack of information concerning the prevalence of asthma among ethnic groups of Mexico. Therefore, we sought to determine the prevalence of asthma in school children of two ethnic groups (Tepehuanos and Mestizos) of Durango state, Mexico. To determine the prevalence of asthma in school children from two ethnic groups of Durango, Mexico. Four hundred and eight school children of Mestizo ethnicity and all 327 school children of Tepehuano ethnicity of the whole Tepehuano region of Durango state participated in the study. All children or their parents submitted the ISAAC questionnaire. For Tepehuano population a translator helped in submitting the questionnaires. Confirmation of asthma was performed by clinical examination, skin prick tests, and spirometry. Thirty two (7.8%; 95% CI: 5.5-10.8) Mestizo children and twelve (3.7%; 95% CI 2.0-6.2) Tepehuano children were found as suggestive of suffering from asthma (wheeze ever) by using the ISAAC questionnaire and were further evaluated by clinical examination, skin prick test, and in some cases by spirometry. Asthma was confirmed in 30 (7.4%; 95% CI 5.1-10.2) of the Mestizo children but in none of the Tepehuano children (p < 0.001). Asthma in Mestizo children was associated with a mother or tutor who smokes at home (OR = 3.35; 95% CI: 1.48-7.59; p = 0.002). There was an absence of asthma cases among the Tepehuano school children population of Durango state, Mexico. The prevalence of asthma in our Mestizo children population is low compared to those reported in other Latin American countries. A mother or tutor who smokes at home might be a contributing factor of asthma in our Mestizo children.

Differences in idiopathic inflammatory myopathy phenotypes and genotypes between Mesoamerican Mestizos and North American Caucasians: ethnogeographic influences in the genetics and clinical expression of myositis.

PubMed

Shamim, Ejaz A; Rider, Lisa G; Pandey, Janardan P; O'Hanlon, Terrance P; Jara, Luis J; Samayoa, Eduardo A; Burgos-Vargas, Ruben; Vazquez-Mellado, Janitzia; Alcocer-Varela, Jorge; Salazar-Paramo, Mario; Kutzbach, Abraham Garcia; Malley, James D; Targoff, Ira N; Garcia-De la Torre, Ignacio; Miller, Frederick W

2002-07-01

As part of a larger, worldwide study of the ethnogeography of myositis, we evaluated the clinical, serologic, and immunogenetic features of Mestizo (Mexican and Guatemalan) and North American Caucasian patients with idiopathic inflammatory myopathy (IIM). Clinical manifestations, autoantibodies, HLA-DRB1 and DQA1 alleles, and immunoglobulin Gm/Km allotypes were compared between 138 Mestizos with IIM and 287 Caucasians with IIM, using the same classification criteria and standardized questionnaires. IIM in Mestizo patients was characterized by a higher proportion of dermatomyositis (69% of adult Mestizos versus 35% of adult Caucasians; P < 0.001) and anti-Mi-2 autoantibodies (30% versus 7% of adults, respectively, and 32% versus 4% of children, respectively; P < 0.01). Genetic risk factors also differed in these populations. Whereas Mestizos had no HLA risk factors for IIM, HLA-DRB1*0301, the linked allele DQA1*0501, and DRB1 alleles sharing the first hypervariable region motif (9)EYSTS(13) were major risk factors in Caucasian patients with IIM. Furthermore, different HLA-DRB1 and DQA1 alleles were associated with anti-Mi-2 autoantibodies (DRB1*04 and DQA1*03 in Mestizos and DRB1*07 and DQA1*02 in Caucasians). Immunoglobulin gamma-chain allotypes Gm(1), Gm(17) (odds ratio for both 11.3, P = 0.008), and Gm(21) (odds ratio 7.3, P = 0.005) and kappa-chain allotype Km(3) (odds ratio 7.3, P = 0.005) were risk factors for IIM in Mestizos; however, no Gm or Km allotypes were risk or protective factors in Caucasians. In addition, Gm and Km phenotypes were unique risk factors (Gm 1,3,17 5,13,21 and Gm 1,17 23 21 and Km 3,3) or protective factors (Km 1,1) for the development of myositis and anti-Mi-2 autoantibodies (Gm 1,2,3,17 23 5,13,21) in adult Mestizos. IIM in Mesoamerican Mestizos differs from IIM in North American Caucasians in the frequency of phenotypic features and in the immune-response genes predisposing to and protecting from myositis and anti-Mi-2 autoantibodies

[Obesity, body morphology, and blood pressure in urban and rural population groups of Yucatan].

PubMed

Arroyo, Pedro; Fernández, Victoria; Loría, Alvar; Pardío, Jeannette; Laviada, Hugo; Vargas-Ancona, Lizardo; Ward, Ryk

2007-01-01

To characterize body morphology and blood pressure of adults of the Mexican state of Yucatan. Rural-urban differences in weight, height, waist, and hip circumferences, and blood pressure were analyzed in 313 urban and 271 rural subjects. No rural-urban differences in prevalence of obesity and overweight were found. Hypertension was marginally higher in urban subjects. Rural abnormal waist circumference was higher in young men and young women. Comparison with two national surveys and a survey in the aboriginal population (rural mixtecos) showed similar prevalence of obesity as ENSA-2000 and higher than mixtecos and ENEC-1993. Abnormal waist circumference was intermediate between ENSANUT-2006 and mixtecos and hypertension was intermediate between ENEC and mixtecos. The Maya and mestizo population of Yucatan showed a high prevalence of obesity and abnormal waist circumference not accompanied by a comparable higher hypertension frequency. This finding requires further confirmation.

[Relation of leptin in plasma with oxidative damage in indigenous tepehuán and mestizo populations from Durango].

PubMed

Delgadillo-Guzmán, Dealmy; Quintanar-Escorza, Martha Angélica; Carrera-Gracia, Manuela de la A; Lares-Aseff, Ismael

2015-01-01

Obesity is a multifactorial metabolic disorder that involves lipid peroxidation (LPX), activating the antioxidant systems to counteract cellular damage. Objective: To evaluate the correlation between the antioxidant capacity and LPX levels of /eptin, in indigenous Tepehuan and Mestizo populations of the State of Durango. We conducted a nutritional clinical study and lipid profile to confirm the state of health of a group of 60 indigenous Tepehuan of Mezquital and 68 mestizos subjects of Durango city, aged between 18 to 59 years. We determined the concentrations of leptin, antioxidant capacity and LPX in fasting conditions on plasma of participants, comparing averages, minimum, maximum, and standard deviation through ANOVA and Kruskai-Wal/is. For the correlation of variables, Pearson test was applied, getting the r value. Leptin levels were lower in indigenous Tepehuan than mestizos independent of body mass index. Mestizo subjects and Tepehuan with overweight and obesity (OW/0) or both ethnic groups show a greater degree of LPX (3.39 ± 0.31, 2.72 ± 0.54 MDA J.lmol/1, respectively; p < 0.05); however, OW/0 mestizos show more activation of its (0.37±0. 03 meqltrolox) than Tepehuan normal weight (NW) and OW/0 (0.32 ±0. 01 meq/trolox). The correlation between antioxidant capacity and LPX in mixed OW/0 was positive (r = 0.9; p < 0. 001). There is a correlation between levels of leptin and the antioxidant capacity of Tepehuan subjects both NW and OW/0 (r = 0.40; p < 0.05 and r = -0.66; p < 0.0001, respectively). Tepehuan groups with OW/0 have less oxidative damage, while antioxidant mechanisms have a smaller activation than the top crosses of the same nutritional condition. The results suggest that antioxidant capacity has an implication on the regulation of leptin levels in Tepehuan subjects.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Association between the APOE ε4 Allele and Late-Onset Alzheimer's Disease in an Ecuadorian Mestizo Population

PubMed Central

Calero, Cristian; Vinueza, Rodrigo; Correa, Patricio; Carrera-Gonzalez, Andrea; Villegas, Franklin; Moreta, Germania; Paredes, Rosario

2017-01-01

Alzheimer's disease (AD) is the most common neurodegenerative disease. It has two main pathological hallmarks: amyloid plaques and neurofibrillary tangles. The APOE ε4 allele has been recognized as the strongest genetic risk factor for late-onset Alzheimer's disease (LOAD) in several populations worldwide, yet the risk varies by region and ethnicity. The aims of this study were to describe APOE allele and genotype frequencies and examine the relationship between the APOE ε4 allele and LOAD risk in an Ecuadorian Mestizo population. We carried out a case-control study comprising 56 individuals clinically diagnosed with probable AD (≥65 years of age) and 58 unrelated healthy control subjects (≥65 years of age). Genotyping was performed using the real-time PCR method. Our data showed that allelic and genotypic frequencies follow the trends observed in most worldwide populations. We also found a high-risk association between APOE ε4 allele carriers and LOAD (OR = 7.286; 95% CI = 2.824–18.799; p < 0.001). Therefore, we concluded that APOE ε4 must be considered an important genetic risk factor for LOAD in the Ecuadorian Mestizo population. Additionally, we suggest that in mixed populations the effects of admixture and ethnic identity should be differentiated when evaluating genetic contributions to Alzheimer's disease risk. PMID:29348964

Comparison of statin eligibility according to the Adult Treatment Panel III, ACC/AHA blood cholesterol guideline, and presence of carotid plaque by ultrasound in Mexican mestizo patients with rheumatoid arthritis.

PubMed

Galarza-Delgado, Dionicio A; Azpiri-Lopez, Jose R; Colunga-Pedraza, Iris J; Cardenas-de la Garza, Jesus A; Vera-Pineda, Raymundo; Garcia-Colunga, Judith I; Arvizu-Rivera, Rosa I; Martinez-Moreno, Adrian; Villarreal-Perez, Jesus Z; Elizondo-Riojas, Guillermo; Garza Elizondo, Mario A

2016-11-01

Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death in rheumatoid arthritis (RA) patients. Guidelines of the American College of Cardiology and the American Heart Association (ACC/AHA) 2013 and the Adult Treatment Panel III (ATP-III) differ in their strategies to recommend initiation of statin therapy. The presence of carotid plaque (CP) by carotid ultrasound is an indication to begin statin therapy. We aimed to compare the recommendation to initiate statin therapy according to the ACC/AHA 2013 guidelines, ATP-III guidelines, and CP by carotid ultrasound. We then carried out an observational, cross-sectional study of 62 statin-naive Mexican mestizo RA patients, aged 40 to 75, who fulfilled the 1987 or 2010 ACR/European League Against Rheumatism (EULAR) classification criteria. CP was evaluated with B-mode ultrasound. Cohen's kappa (k) was used to assess agreement between ACC/AHA 2013 guidelines, ATP-III guidelines, and the presence of CP, considering a p < 0.05 as statistically significant. Agreement was classified as slight (0.01-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and an almost perfect agreement (0.81-1.00). Slight agreement (k = 0.096) was found when comparing statin recommendation between CP and ATP-III. Fair agreement (k = 0.242) was revealed between ACC/AHA 2013 and ATP-III. Comparison between ACC/AHA 2013 and CP showed moderate agreement (k = 0.438). ACC/AHA 2013 guidelines could be an adequate and cost-effective tool to evaluate the need of statin therapy in Mexican mestizo RA patients, with moderate agreement with the presence of CP by ultrasound.

Calpain-10 gene polymorphisms and risk of type 2 diabetes mellitus in Mexican mestizos.

PubMed

Picos-Cárdenas, V J; Sáinz-González, E; Miliar-García, A; Romero-Zazueta, A; Quintero-Osuna, R; Leal-Ugarte, E; Peralta-Leal, V; Meza-Espinoza, J P

2015-03-27

The calpain-10 gene is expressed primarily in tissues important in glucose metabolism; thus, some of its polymorphisms have been associated with type 2 diabetes. In this study, we examined the association between the calpain-10 single-nucleotide polymorphism (SNP)-43, SNP-19, and SNP-63 and type 2 diabetes in Mexican mestizos. We included 211 patients and 152 non-diabetic subjects. Polymerase chain reaction was used to identify alleles. We compared allele, genotype, haplotype, and diplotype frequencies between both groups and used the chi-square test to calculate the risk. The allele frequency of SNP-43 allele 1 was 70% in controls and 72% in patients; the GG, GA, and AA genotype frequencies were 48.7, 42.8, and 8.5% in controls and 51.2, 41.7, and 7.1% in patients, respectively. For SNP- 19, the prevalence of allele 1 (2R) was 32% in controls and 39% in patients. In controls, homozygosity (2R/2R) was 10.5%, heterozygosity was 42.8%, and 3R/3R was 46.7%; in cases, these values were 13.3, 50.7, and 36.0%, respectively. For SNP-63, the frequency of allele 1 was 87% in controls and 83% in patients; genotype frequencies in controls were 75.7% (CC), 23% (CT), and 1.3% (TT), and were 69.7, 27.5, and 2.8%, respectively for the cases. Genotype distributions were consistent with Hardy-Weinberg equilibrium. No significant intergroup differences for allele, genotype, haplotype, or diplotype frequencies were observed. We found no association between these polymorphisms and diabetes. However, our sample size was small, so the role of calpain-10 risk alleles should be further examined.

CYP2D6 genotype and phenotype in Amerindians of Tepehuano origin and Mestizos of Durango, Mexico.

PubMed

Sosa-Macías, Martha; Elizondo, Guillermo; Flores-Pérez, Carmen; Flores-Pérez, Janet; Bradley-Alvarez, Francisco; Alanis-Bañuelos, Ruth E; Lares-Asseff, Ismael

2006-05-01

Although the drug-metabolizing enzyme CYP2D6 has been studied extensively in subjects of differing ethnicities, limited CYP2D6 pharmacogenetic data are available for the Amerindian population and Mestizos of Mexico. Dextromethorphan hydroxylation phenotype was studied in Tepehuano Amerindian (n = 58) and Mestizo (n = 88) subjects, and 195 individuals (85 Tepehuano Amerindians and 110 Mestizos) were genotyped by polymerase chain reaction-restriction fragment length polymorphism methods to identify the frequencies of the CYP2D6*3, *4, *6, and *10 alleles. Tepehuano Amerindian subjects lacked the poor metabolizer (PM) phenotype, whereas in Mestizos the PM phenotype frequency was 6.8%. The CYP2D6*3, *6, and *10 alleles were not found in Tepehuano Amerindians. The CYP2D6*4 allele had a low frequency (0.006) in this Amerindian group. In the Mestizo group, the CYP2D6*3, *4, and *10 alleles had frequencies of 0.009, 0.131, and 0.023, respectively. The CYP2D6*6 allele was not found in Mestizos. The genotype-phenotype association was strongly statistically significant (r(2) = .45; P = .005) in Mestizos. The Tepehuano population was found to have a low phenotypic and genotypic CYP2D6 diversity and differed from other Amerindian groups. On the other hand, the frequencies of the CYP2D6 variant alleles in Mestizos were similar to those reported for whites.

Population data of 24 STRs in Mexican-Mestizo population from Monterrey, Nuevo Leon (Northeast, Mexico) based on Powerplex(®) Fusion and GlobalFiler(®) kits.

PubMed

Ramos-González, Benito; Aguilar-Velázquez, José Alonso; Chávez-Briones, María de Lourdes; Delgado-Chavarría, Juan Ramón; Alfaro-Lopez, Elizabeth; Rangel-Villalobos, Héctor

2016-03-01

The STR loci included into new commercial human identification kits compels geneticists estimating forensic parameters for interpretation purposes in forensic casework. Therefore, we studied for the first time in Mexico the GlobalFiler(®) and Powerplex(®) Fusion systems in 326 and 682 unrelated individuals, respectively. These individuals are resident of the Monterrey City of the Nuevo Leon state (Northeast, Mexico). Population data from 23 autosomal STRs and the Y-STR locus DYS391 are reported and compared against available STR data from American ethnic groups and the unique Mexican population studied with Powerplex(®) Fusion. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Estimating the geographical distribution of the prevalence of the metabolic syndrome in young Mexicans.

PubMed

Murguía-Romero, Miguel; Jiménez-Flores, Rafael; Villalobos-Molina, Rafael; Méndez-Cruz, Adolfo René

2012-09-01

The geographical distribution of the metabolic syndrome (MetS) prevalence in young Mexicans (aged 17-24 years) was estimated stepwise starting from its prevalence based on the body mass index (BMI) in a study of 3,176 undergraduate students of this age group from Mexico City. To estimate the number of people with MetS by state, we multiplied its prevalence derived from the BMI range found in the Mexico City sample by the BMI proportions (range and state) obtained from the Mexico 2006 national survey on health and nutrition. Finally, to estimate the total number of young people with MetS in Mexico, its prevalence by state was multiplied by the share of young population in each state according to the National Population and Housing Census 2010. Based on these figures, we estimated the national prevalence of MetS at 15.8%, the average BMI at 24.1 (standard deviation = 4.2), and the prevalence of overweight people (BMI ≥25) of that age group at 39.0%. These results imply that 2,588,414 young Mexicans suffered from MetS in 2010. The Yucatan peninsula in the south and the Sonora state in the north showed the highest rates of MetS prevalence. The calculation of the MetS prevalence by BMI range in a sample of the population, and extrapolating it using the BMI proportions by range of the total population, was found to be a useful approach. We conclude that the BMI is a valuable public health tool to estimate MetS prevalence in the whole country, including its geographical distribution.

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Genetic analysis of Mexican Criollo cattle populations.

PubMed

Ulloa-Arvizu, R; Gayosso-Vázquez, A; Ramos-Kuri, M; Estrada, F J; Montaño, M; Alonso, R A

2008-10-01

The objective of this study was to evaluate the genetic structure of Mexican Criollo cattle populations using microsatellite genetic markers. DNA samples were collected from 168 animals from four Mexican Criollo cattle populations, geographically isolated in remote areas of Sierra Madre Occidental (West Highlands). Also were included samples from two breeds with Iberian origin: the fighting bull (n = 24) and the milking central American Criollo (n = 24) and one Asiatic breed: Guzerat (n = 32). Genetic analysis consisted of the estimation of the genetic diversity in each population by the allele number and the average expected heterozygosity found in nine microsatellite loci. Furthermore, genetic relationships among the populations were defined by their genetic distances. Our data shows that Mexican cattle populations have a relatively high level of genetic diversity based either on the mean number of alleles (10.2-13.6) and on the expected heterozygosity (0.71-0.85). The degree of observed homozygosity within the Criollo populations was remarkable and probably caused by inbreeding (reduced effective population size) possibly due to reproductive structure within populations. Our data shows that considerable genetic differentiation has been occurred among the Criollo cattle populations in different regions of Mexico.

Perceived Discrimination and Mexican-Origin Young Adults' Sleep Duration and Variability: The Moderating Role of Cultural Orientations.

PubMed

Zeiders, Katharine H; Updegraff, Kimberly A; Kuo, Sally I-Chun; Umaña-Taylor, Adriana J; McHale, Susan M

2017-08-01

Perceived ethnic discrimination is central to the experiences of Latino young adults, yet we know little about the ways in which and the conditions under which ethnic discrimination relates to Latino young adults' sleep patterns. Using a sample of 246 Mexican-origin young adults (M age  = 21.11, SD = 1.54; 50 % female), the current study investigated the longitudinal links between perceived ethnic discrimination and both sleep duration and night-to-night variability in duration, while also examining the moderating roles of Anglo and Mexican orientations in the associations. The results revealed that perceived discrimination predicted greater sleep variability, and this link was not moderated by cultural orientations. The relation between perceived discrimination and hours of sleep, however, was moderated by Anglo and Mexican orientations. Individuals with high Anglo and Mexican orientations (bicultural) and those with only high Mexican orientations (enculturated), showed no association between discrimination and hours of sleep. Individuals with low Anglo and Mexican orientations (marginalized) displayed a positive association, whereas those with high Anglo and low Mexican orientations (acculturated) displayed a negative association. The results suggest that discrimination has long term effects on sleep variability of Mexican-origin young adults, regardless of cultural orientations; however, for sleep duration, bicultural and enculturated orientations are protective.

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population

PubMed Central

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aldrete, Maria Elena Aguilar; Oregon-Romero, Edith; Mercado, Monica Vazquez-Del; Navarro-Hernandez, Rosa-Elena

2012-01-01

Purpose Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. Subjects and methods In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. Results sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson’s r = −0.169 to −0.465) were found. Conclusion In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels. PMID:23118546

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population.

PubMed

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aguilar Aldrete, Maria Elena; Oregon-Romero, Edith; Vazquez-Del Mercado, Monica; Navarro-Hernandez, Rosa-Elena

2012-01-01

Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson's r = -0.169 to -0.465) were found. In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels.

Forensic parameters of the X-STR Decaplex system in Mexican populations.

PubMed

Mariscal Ramos, C; Martínez-Cortes, G; Ramos-González, B; Rangel-Villalobos, H

2018-03-01

We studied the X-STR decaplex system in 529 DNA female samples of Mexican populations from five geographic regions. Allele frequencies and forensic parameters were estimated in each region and in the pooled Mexican population. Genotype distribution by locus was in agreement with Hardy-Weinberg expectations in each Mexican population sample. Similarly, linkage equilibrium was demonstrated between pair of loci. Pairwise comparisons and genetic distances between Mexican, Iberoamerican and one African populations were estimated and graphically represented. Interestingly, a non-significant interpopulation differentiation was detected (Fst = 0.0021; p = .74389), which allows using a global Mexican database for forensic interpretation of X-STR genotypes. Copyright © 2017 Elsevier B.V. All rights reserved.

The Genetics of Mexico Recapitulates Native American Substructure and Affects Biomedical Traits

PubMed Central

Moreno-Estrada, Andrés; Gignoux, Christopher R.; Fernández-López, Juan Carlos; Zakharia, Fouad; Sikora, Martin; Contreras, Alejandra V.; Acuña-Alonzo, Victor; Sandoval, Karla; Eng, Celeste; Romero-Hidalgo, Sandra; Ortiz-Tello, Patricia; Robles, Victoria; Kenny, Eimear E.; Nuño-Arana, Ismael; Barquera-Lozano, Rodrigo; Macín-Pérez, Gastón; Granados-Arriola, Julio; Huntsman, Scott; Galanter, Joshua M.; Via, Marc; Ford, Jean G.; Chapela, Rocío; Rodriguez-Cintron, William; Rodríguez-Santana, Jose R.; Romieu, Isabelle; Sienra-Monge, Juan José; Navarro, Blanca del Rio; London, Stephanie J.; Ruiz-Linares, Andrés; Garcia-Herrera, Rodrigo; Estrada, Karol; Hidalgo-Miranda, Alfredo; Jimenez-Sanchez, Gerardo; Carnevale, Alessandra; Soberón, Xavier; Canizales-Quinteros, Samuel; Rangel-Villalobos, Héctor; Silva-Zolezzi, Irma; Burchard, Esteban Gonzalez; Bustamante, Carlos D.

2014-01-01

Mexico harbors great cultural and ethnic diversity, yet fine-scale patterns of human genome-wide variation from this region remain largely uncharacterized. We studied genomic variation within Mexico from over 1,000 individuals representing 20 indigenous and 11 mestizo populations. We found striking genetic stratification among indigenous populations within Mexico at varying degrees of geographic isolation. Some groups were as differentiated as Europeans are from East Asians. Pre-Columbian genetic substructure is recapitulated in the indigenous ancestry of admixed mestizo individuals across the country. Furthermore, two independently phenotyped cohorts of Mexicans and Mexican Americans showed a significant association between sub-continental ancestry and lung function. Thus, accounting for fine-scale ancestry patterns is critical for medical and population genetic studies within Mexico, in Mexican-descent populations, and likely in many other populations worldwide. PMID:24926019

A history of binge drinking during adolescence is associated with poorer sleep quality in young adult Mexican Americans and American Indians.

PubMed

Ehlers, Cindy L; Wills, Derek; Gilder, David A

2018-06-01

Binge drinking during adolescence is common, and adolescents and young adults with alcohol problems may also have sleep difficulties. However, few studies have documented the effects of a history of adolescent binge drinking on sleep in young adulthood in high-risk minority populations. To quantify sleep disturbance, as indexed by the Pittsburgh Sleep Quality Index (PSQI), in a sample of young adult Mexican American and American Indian men and women (18-30 years, n = 800) with and without a history of alcohol binge drinking during adolescence, controlling for age, gender, and race. Gender was found to affect PSQI responses with females reporting waking up at night, having more bad dreams, and later habitual bedtimes than males, and males reporting more problems with breathing and snoring. Increasing age was associated with snoring or coughing, less hours spent in bed, and later evening bedtimes. Race also influenced the PSQI with American Indians reporting longer sleep latencies and sleep durations, more hours spent in bed, and more trouble with coughing and snoring than Mexican Americans, and Mexican Americans reporting later bedtimes. A history of adolescent regular binge drinking was associated with longer sleep latencies, more problems with breathing, bad dreams, and an overall higher PSQI total score, when controlling for age, race, and gender. This report suggests, like what has been found in young adults in general population samples, that binge drinking during adolescence is associated with deleterious consequences on sleep quality in young adulthood in these high-risk and understudied ethnic groups.

IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

PubMed

Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

2016-01-01

In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

Leptin Levels and Nutritional Status of Indigenous Tepehuán and Mestizo Subjects in Durango, Mexico

PubMed Central

Delgadillo Guzmán, Dealmy; Marchat Marchau, Laurence Annie; Reyes, José L.; Loera Castañeda, Verónica; Sosa Macías, Martha; García Vivas, Jessica; Asseff, Ismael Lares

2014-01-01

The aim of this study was to assess differences in nutritional status and their association with circulating leptin levels in the indigenous Tepehuán people of Mezquital Durango and Mestizo populations of Durango City, Mexico. A group of 128 volunteers aged 18 through 59 years were recruited for the study: 60 indigenous Tepehuán from Mezquital and 68 Mestizo individuals from Durango City. The classification of nutritional status was through body mass index (BMI). Clinical evaluations, including anthropometry and lipid profiles, were performed to ascertain the health of the participants. Circulating leptin levels were determined in blood samples after at 08 hours of fasting. The healthy subjects were classified according to BMI: 32 Tepehuán and 30 Mestizo subjects were of normal weight (NW), and 28 Tepehuán and 38 Mestizo subjects were overweight or obese (OW/O). Both NW and OW/O Tepehuán subjects showed lower leptin concentrations than the comparable Mestizo subjects. Statistical analysis showed a negative Pearson's correlation (r = −0.5; P < 0.05) between BMI and leptin levels in NW Tepehuán subjects, but no significant correlation was found in other groups. The differences found in Tepehuán compared with Mestizo subjects might be explained by poor nutritional status, which leads to scarce adipose tissue and low levels of leptin synthesis. Leptin concentration and its relationship to BMI are associated with ethnicity. PMID:24825928

Leptin levels and nutritional status of indigenous Tepehuán and Mestizo subjects in Durango, Mexico.

PubMed

Guzmán, Dealmy Delgadillo; Marchau, Laurence Annie Marchat; Reyes, José L; Castañeda, Verónica Loera; Macías, Martha Sosa; Vivas, Jessica García; Asseff, Ismael Lares

2014-01-01

The aim of this study was to assess differences in nutritional status and their association with circulating leptin levels in the indigenous Tepehuán people of Mezquital Durango and Mestizo populations of Durango City, Mexico. A group of 128 volunteers aged 18 through 59 years were recruited for the study: 60 indigenous Tepehuán from Mezquital and 68 Mestizo individuals from Durango City. The classification of nutritional status was through body mass index (BMI). Clinical evaluations, including anthropometry and lipid profiles, were performed to ascertain the health of the participants. Circulating leptin levels were determined in blood samples after at 08 hours of fasting. The healthy subjects were classified according to BMI: 32 Tepehuán and 30 Mestizo subjects were of normal weight (NW), and 28 Tepehuán and 38 Mestizo subjects were overweight or obese (OW/O). Both NW and OW/O Tepehuán subjects showed lower leptin concentrations than the comparable Mestizo subjects. Statistical analysis showed a negative Pearson's correlation (r = -0.5; P < 0.05) between BMI and leptin levels in NW Tepehuán subjects, but no significant correlation was found in other groups. The differences found in Tepehuán compared with Mestizo subjects might be explained by poor nutritional status, which leads to scarce adipose tissue and low levels of leptin synthesis. Leptin concentration and its relationship to BMI are associated with ethnicity.

Amazonian plants from Peru used by Quechua and Mestizo to treat malaria with evaluation of their activity.

PubMed

Roumy, V; Garcia-Pizango, G; Gutierrez-Choquevilca, A-L; Ruiz, L; Jullian, V; Winterton, P; Fabre, N; Moulis, C; Valentin, A

2007-07-25

Indigenous Quechua and Mestizo populations from distinct areas in Loreto, Peru, were interviewed about traditional medication for the treatment of malaria. An ethnographic survey concerning the native theory of illness aetiology in the specific case of malaria permitted the elaboration of an efficient ethnopharmacological enquiry. The survey took place on three main zones corresponding to villages on the Napo and the Pastaza rivers (for the Quechua), and in the surroundings of Iquitos (for the Mestizos) and led to the collection of 14 plants. Serial extractions in hexane, dichloromethane, and methanol were performed on the different parts of the plants collected. The extracts were then tested for antiplasmodial activity in vitro. Seven plants displayed antiplasmodial activity (IC(50) from 2 to 25 microg/mL) and usually low cytotoxicity, indicating their antiplasmodial specificity. The results give scientific validation to the traditional medical knowledge of Quechua and Mestizo populations from Loreto and confirm a source of potentially active plants.

Genetic polymorphisms of matrix metalloproteinases and protein levels in chronic obstructive pulmonary disease in a Mexican population.

PubMed

Hernández-Montoya, Jazmín; Pérez-Ramos, Julia; Montaño, Martha; Ramírez-Venegas, Alejandra; Sansores, Raúl H; Pérez-Rubio, Gloria; Velázquez-Uncal, Mónica; Camarena, Angel; Ramos, Carlos; Falfán-Valencia, Ramcés

2015-01-01

To evaluate association of single nucleotide polymorphisms (SNPs) in the MMP1, MMP2, MMP9 and MMP12 genes and serum MMP-2 and MMP-9 levels in smoking chronic obstructive pulmonary disease (COPD) patients. Genotyping using real-time PCR in 330 smokers with COPD (COPD), 658 smokers without COPD (SNC) and 150 nonsmokers (NCNS), the analysis of samples used was χ(2) test. Using ELISA, the proteins were evaluated. Multiple comparisons were made by ANOVA. rs243864 (OR: 7.44; 95% CI: 3.62-15.26) and rs11646643 (OR: 1.58; 95% CI: 1.07-2.34) of the MMP-2 gene and rs3918253 (OR: 1.72; 95% CI: 1.08-2.71) of the MMP-9 gene, were associated with the risk of COPD. Serum MMP-2 level in the COPD group was lower compared with SNC (p < 0.05). Serum MMP-9 level was elevated in the COPD group compared with SNC (p < 0.05). Polymorphisms in MMP2 and MMP9 but not in MMP1 and MMP12 are associated with the risk of COPD in the Mexican mestizo population.

Lifetime history of traumatic events in a young adult Mexican American sample: relation to substance dependence, affective disorder, acculturation stress, and PTSD

PubMed Central

Ehlers, Cindy L.; Kim, Corinne; Gilder, David A.; Stouffer, Gina M.; Caetano, Raul; Yehuda, Rachel

2016-01-01

Mexican Americans comprise one of the most rapidly growing populations in the United States, and within this population, trauma and post-traumatic stress disorder (PTSD) are associated with physical and mental health problems. Therefore, efforts to delineate factors that may uniquely contribute to increased likelihood of trauma, PTSD, and substance use disorders over the lifetime in Mexican Americans are important to address health disparities and to develop treatment and prevention programs. Six hundred fourteen young adults (age 18–30 yrs) of Mexican American heritage, largely second generation, were recruited from the community and assessed with the Semi-Structured Assessment for the Genetics of Alcoholism and an acculturation stress scale. More males (51.2%) reported experiencing traumas than females (41.1%), however, a larger proportion of females received a PTSD diagnosis (15%) than males (8%). Alcohol dependence and affective disorders, but not anxiety disorders, antisocial disorders, nicotine, marijuana, or stimulant dependence, were significantly comorbid with PTSD. Endorsing higher levels of acculturation stress was also significantly associated with both trauma exposure and a diagnosis of PTSD. Logistic regression revealed that female gender, having an affective disorder, alcohol dependence, higher levels of acculturation stress, and lower levels of education were all predictors of PTSD status. Additionally, alcohol dependence generally occurred after the PTSD diagnosis in early adulthood in this high-risk population. These studies suggest that treatment and prevention efforts should particularly focus on young adult second generation Mexican American women with higher levels of acculturation stress, who may be at higher risk for PTSD, affective disorder, and alcohol dependence following trauma exposure. PMID:27569652

The Precarious Health of Young Mexican American Men in South Texas, Cameron County Hispanic Cohort, 2004-2015.

PubMed

Watt, Gordon P; Vatcheva, Kristina P; Griffith, Derek M; Reininger, Belinda M; Beretta, Laura; Fallon, Michael B; McCormick, Joseph B; Fisher-Hoch, Susan P

2016-08-25

Hispanic men have higher rates of illness and death from various chronic conditions than do non-Hispanic men. We aimed to characterize the health of Mexican American men living on the US-Mexico border in South Texas and elucidate indications of chronic disease in young men. We sampled all male participants from the Cameron County Hispanic Cohort, an ongoing population-based cohort of Mexican Americans in Brownsville, Texas. We calculated descriptive statistics and stratified the sample into 3 age groups to estimate the prevalence of sociodemographic, behavioral, and clinical factors by age group and evaluated differences between age groups. Obesity prevalence was approximately 50% across all age groups (P = .83). Diabetes prevalence was high overall (26.8%), and 16.9% (95% confidence interval [CI], 10.1%-23.8%) of men younger than 35 had diabetes. More than 70% of these young men had elevated liver enzymes, and mean values of aspartate aminotransferase were significantly higher in younger men (45.0 u/L; 95% CI, 39.5-50.6 u/L) than in both older age groups. Less than 20% of young men had any form of health insurance. Current smoking was higher in young men than in men in the other groups, and the rate was higher than the national prevalence of current smoking among Hispanic men. We suggest a need for obesity and diabetes prevention programs and smoking cessation programs for men in this region. Opportunities exist to expand current intervention programs and tailor them to better reach this vulnerable population of young Hispanic men. Elevated liver enzymes in men younger than 35 suggest a substantial burden of liver abnormalities, a finding that warrants further study.

Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

PubMed

Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

2017-08-01

Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

Serum Lipid Concentrations and FADS Genetic Variants in Young Mexican College Students: The UP-AMIGOS Cohort Study.

PubMed

Vazquez-Vidal, Itzel; Voruganti, V Saroja; Hannon, Bridget A; Andrade, Flavia Cristina Drumond; Aradillas-García, Celia; Nakamura, Manabu T; Terán-García, Margarita

2018-05-30

Recent genome-wide association studies in the Mexican population have identified several genetic loci associated with blood lipid levels in adults. However, studies focusing on the fatty acid desaturase (FADS) gene cluster have been understudied in this population, even though it seems associated with lipid profiles in other ethnicities. The aim of this study was to test associations between single nucleotide polymorphisms (SNPs) in the FADS cluster (rs174546, rs1535, rs174548, rs174550, rs174450, and rs174618) and serum lipid profiles in young Mexicans. Anthropometrics, serum lipid profiles, and FADS SNPs were measured in 998 subjects in the UP-AMIGOS cohort study. Genotype-phenotype (total cholesterol [TC], triglyceride [TG], high-density lipoprotein cholesterol [HDL-C], low-density lipoprotein cholesterol [LDL-C], and very-low-density lipoprotein [VLDL]) associations were assessed using PLINK adjusted for sex, age, and body mass index (BMI). Among 6 FADS SNPs, we found that carriers of the C-allele of the FADS1-rs174546 showed a significant association with lower TG concentrations (β = -12.6 mg/dL, p = 0.009) and lower VLDL concentrations (β = -2.52 mg/dL, p = 0.005). We found that rs174546, rs1535, and rs174550 were in high linkage disequilibrium (r2 > 0.80). There were no significant associations between rs174550, rs174548, and rs174618 and lipid profiles. A genetic variant in the FADS1 (rs174546) gene is a major contributor of plasma TG and VLDL concentrations in healthy young Mexicans. © 2018 S. Karger AG, Basel.

Exploring the Distribution of Genetic Markers of Pharmacogenomics Relevance in Brazilian and Mexican Populations

PubMed Central

Bonifaz-Peña, Vania; Contreras, Alejandra V.; Struchiner, Claudio Jose; Roela, Rosimeire A.; Furuya-Mazzotti, Tatiane K.; Chammas, Roger; Rangel-Escareño, Claudia; Uribe-Figueroa, Laura; Gómez-Vázquez, María José; McLeod, Howard L.; Hidalgo-Miranda, Alfredo

2014-01-01

Studies of pharmacogenomics-related traits are increasingly being performed to identify loci that affect either drug response or susceptibility to adverse drug reactions. However, the effect of the polymorphisms can differ in magnitude or be absent depending on the population being assessed. We used the Affymetrix Drug Metabolizing Enzymes and Transporters (DMET) Plus array to characterize the distribution of polymorphisms of pharmacogenetics and pharmacogenomics (PGx) relevance in two samples from the most populous Latin American countries, Brazil and Mexico. The sample from Brazil included 268 individuals from the southeastern state of Rio de Janeiro, and was stratified into census categories. The sample from Mexico comprised 45 Native American Zapotecas and 224 self-identified Mestizo individuals from 5 states located in geographically distant regions in Mexico. We evaluated the admixture proportions in the Brazilian and Mexican samples using a panel of Ancestry Informative Markers extracted from the DMET array, which was validated with genome-wide data. A substantial variation in ancestral proportions across census categories in Brazil, and geographic regions in Mexico was identified. We evaluated the extent of genetic differentiation (measured as FST values) of the genetic markers of the DMET Plus array between the relevant parental populations. Although the average levels of genetic differentiation are low, there is a long tail of markers showing large frequency differences, including markers located in genes belonging to the Cytochrome P450, Solute Carrier (SLC) and UDP-glucuronyltransferase (UGT) families as well as other genes of PGx relevance such as ABCC8, ADH1A, CHST3, PON1, PPARD, PPARG, and VKORC1. We show how differences in admixture history may have an important impact in the distribution of allele and genotype frequencies at the population level. PMID:25419701

[Evolution of type 2 diabetes and carbohydrate intolerance following bariatric surgery in a Mexican mestizo population].

PubMed

Ramírez-Avilés, Eva; Espinosa-González, Omar; Amado-Galván, Mónica; Maydón-González, Hernán; Sepúlveda-Guerrero, Elisa; Zerrweck-López, Carlos

Bariatric surgery continues to be the best treatment for weight loss and control of obesity related comorbidities. Gastric bypass and sleeve gastrectomy have demonstrated to be the most effective surgeries, but this has not been established in a Mexican (non-American) population. To analyse the improvement in type 2 diabetes mellitus and carbohydrate intolerance in obese patients after bariatric surgery. A retrospective analysis was performed on the data collected prospectively between 2013 and 2015 on every obese patient with diabetes and carbohydrate intolerance submitted for bariatric surgery. Analysis was performed at baseline, and at 1, 3, 6, 9 and 12 months, and included metabolic, clinical, lipid, and anthropometrical parameters. A peri-operative and morbidity and mortality analysis was also performed. Remission rates for patients with diabetes were also established. The analysis included 73 patients, 46 with diabetes and 27 with carbohydrate intolerance. Sixty-two patients were female with a mean age of 42 years. Baseline glucose and glycosylated haemoglobin were 123±34mg/dl and 6.8±1.6%, and at 12 months they were 90.1±8mg/dl and 5.4±0.3%, respectively. Diabetes remission was observed in 68.7% of patients, including 9.3% with partial remission and 21.8% with an improvement. There was also a significant improvement in all metabolic and non-metabolic parameters. Bariatric surgery safely improves the metabolic status of patients with diabetes mellitus or carbohydrate intolerance during the first year, inducing high rates of complete remission. It has also shown a significant improvement on blood pressure, lipid, and anthropometric parameters during the first year of follow-up. Copyright © 2017 Academia Mexicana de Cirugía A.C. Publicado por Masson Doyma México S.A. All rights reserved.

Parents’ Traditional Cultural Values and Mexican-Origin Young Adults’ Routine Health and Dental Care

PubMed Central

Updegraff, Kimberly A.; Kuo, Sally I-Chun; McHale, Susan M.; Umaña-Taylor, Adriana J.; Wheeler, Lorey A.

2017-01-01

Purpose To investigate the prospective associations between Mexican-origin mothers’ and fathers’ traditional cultural values and young adults’ health and dental care utilization and to test the moderating role of youth gender. Methods Mexican-origin parents and youth (N = 246 families) participated in home interviews and provided self-reports of parents’ cultural values (time 1) and young adults’ health status and routine health and dental care (time 2; 5 years later). Logistic regressions tested parents’ traditional cultural values as predictors of routine health and dental care, accounting for parent nativity, parent acculturation, family socioeconomic status, youth gender, youth age, and youth physical health status. We also tested whether youth gender moderated the associations between parents’ cultural values and young adults’ routine care. Results Young adults whose mothers endorsed strong familism values when they were in mid-to-late adolescence were more likely to report at least one routine physician visit in the past year as young adults (odds ratio [OR] = 3.47, 95% confidence interval [CI]: 1.23–9.83, p = .019). Furthermore, for females only, mothers’ more traditional gender role attitudes predicted reduced odds of receiving routine health (OR = .22; 95% CI: .08–.64, p = .005) and dental care (OR = .26; 95% CI: .09–.75, p = .012) in young adulthood. Conclusions Our findings highlight the importance of examining intragroup variability in culturally specific mechanisms to identify targets for addressing ethnic/racial disparities in health care utilization among Mexican-origin young adults, during a period of increased risk for health-compromising behaviors and reduced access to care. PMID:27988108

Lifetime history of traumatic events in a young adult Mexican American sample: Relation to substance dependence, affective disorder, acculturation stress, and PTSD.

PubMed

Ehlers, Cindy L; Kim, Corinne; Gilder, David A; Stouffer, Gina M; Caetano, Raul; Yehuda, Rachel

2016-12-01

Mexican Americans comprise one of the most rapidly growing populations in the United States, and within this population, trauma and post-traumatic stress disorder (PTSD) are associated with physical and mental health problems. Therefore, efforts to delineate factors that may uniquely contribute to increased likelihood of trauma, PTSD, and substance use disorders over the lifetime in Mexican Americans are important to address health disparities and to develop treatment and prevention programs. Six hundred fourteen young adults (age 18-30 yrs) of Mexican American heritage, largely second generation, were recruited from the community and assessed with the Semi-Structured Assessment for the Genetics of Alcoholism and an acculturation stress scale. More males (51.2%) reported experiencing traumas than females (41.1%), however, a larger proportion of females received a PTSD diagnosis (15%) than males (8%). Alcohol dependence and affective disorders, but not anxiety disorders, antisocial disorders, nicotine, marijuana, or stimulant dependence, were significantly comorbid with PTSD. Endorsing higher levels of acculturation stress was also significantly associated with both trauma exposure and a diagnosis of PTSD. Logistic regression revealed that female gender, having an affective disorder, alcohol dependence, higher levels of acculturation stress, and lower levels of education were all predictors of PTSD status. Additionally, alcohol dependence generally occurred after the PTSD diagnosis in early adulthood in this high-risk population. These studies suggest that treatment and prevention efforts should particularly focus on young adult second generation Mexican American women with higher levels of acculturation stress, who may be at higher risk for PTSD, affective disorder, and alcohol dependence following trauma exposure. Copyright © 2016 Elsevier Ltd. All rights reserved.

Association of EEG alpha variants and alpha power with alcohol dependence in Mexican American young adults.

PubMed

Ehlers, Cindy L; Phillips, Evelyn

2007-02-01

Several studies support an association between electroencephalogram (EEG) voltage and alcohol dependence. However, the distribution of EEG variants also appears to differ depending on an individual's ethnic heritage, suggesting significant genetic stratification of this EEG phenotype. The present study's aims were to investigate the incidence of EEG alpha variants and spectral power in the alpha frequency range in Mexican American young adults based on gender, and personal and family history of alcohol dependence. Clinical ratings (high-, medium-, and low alpha voltage variants) and spectral characteristics of the EEG in the alpha frequency range (7.5-12 Hz) were investigated in young adult (age 18-25 years) Mexican American men (n=98) and women (n=138) who were recruited from the community. Nineteen percent (n=45) of the participants had a low-voltage alpha EEG variant, 18% had a high-voltage variant, and 63% had a medium-voltage variant. There were no significant differences in the distribution of the EEG variants based on family history of alcohol dependence. There was a significant relationship between gender and the three alpha variants (chi2=9.7; df=2; P<.008), and there were no male participants with alcohol dependence with high alpha variants (chi2=5.8; df=2; P<.056). Alcohol dependence, but not a family history of alcohol dependence, was associated with lower spectral power in the alpha frequency range in the right (F=4.4; df=1,96; P<.04) and left (F=5.3; df=1.96; P<.02) occipital areas in the men but not in the women. In conclusion, in this select population of Mexican American young adults, male gender and alcohol dependence are associated with an absence of high-voltage alpha variants and lower alpha power in the EEG. These data suggest that EEG low voltage, a highly heritable trait, may represent an important endophenotype in male Mexican Americans that may aid in linking brain function with genetic factors underlying alcohol dependence in this ethnic

CFH haplotypes and ARMS2, C2, C3, and CFB alleles show association with susceptibility to age-related macular degeneration in Mexicans

PubMed Central

Zenteno, Juan Carlos; Fernández-López, Juan Carlos; Rodríguez-Corona, Ulises; Falfán-Valencia, Ramcés; Sebastian, Leticia; Morales, Fabiola; Ochoa-Contreras, Daniel; Carnevale, Alessandra; Silva-Zolezzi, Irma

2014-01-01

Purpose To evaluate the contribution of genetic variants of complement factor H (CFH), complement component 2 and 3 (C2 and C3), complement factor B (CFB), and age-related maculopathy susceptibility 2 (ARMS2) to age-related macular degeneration (AMD) risk in the Mexican Mestizo population. Methods Analysis included 282 unrelated Mexican patients with advanced AMD, 205 healthy controls, and 280 population controls. Stereoscopic fundus images were graded on the Clinical Age-Related Maculopathy System (CARMS). We designed a resequencing strategy using primers with M13 adaptor for the 23 exons of the CFH gene in a subgroup of 96 individuals clinically evaluated: 48 AMD cases and 48 age- and sex-matched healthy controls. Single nucleotide polymorphisms (SNPs) in C3 (Arg80Gly and Pro292Leu), C2 (rs547154), CFB (Leu9His), and ARMS2 (Ala69Ser) were genotyped in all patients, healthy and population controls using TaqMan assay. Results All evaluated individuals were Mexican Mestizos, and their genetic ancestry was validated using 224 ancestry informative markers and calculating Fst values. The CFH resequencing revealed 19 SNPs and a common variant in the intron 2 splice acceptor site; three CFH haplotypes inferred from individual genotypes, showed significant differences between cases and controls. The risk alleles in C3 (rs1047286, odds ratio [OR]=2.48, 95% confidence interval [CI]=1.64–3.75, p=1.59E-05; rs2230199, OR=2.15, 95% CI=1.48–3.13, p=6.28E-05) and in ARMS2 (rs10490924, OR=3.09, 95% CI=2.48–3.86, p=5.42E-23) were strongly associated with risk of AMD. The protective effect of alleles in C2 (rs547154) and CFB (rs4151667) showed a trend but was not significantly associated after correction for multiple testing. Conclusions Our results show that ARMS2 and C3 are major contributors to advanced AMD in Mexican patients, while the contributions of CFH, C2, and CFB are minor to those of other populations, reveling significant ethnic differences in minor allele

[High frequency of ancestral allele of the TJP1 polymorphism rs2291166 in Mexican population, conformational effect and applications in surgery and medicine].

PubMed

Ramirez-Garcia, Sergio Alberto; Flores-Alvarado, Luis Javier; Topete-González, Luz Rosalba; Charles-Niño, Claudia; Mazariegos-Rubi, Manuel; Dávalos-Rodríguez, Nory Omayra

2016-01-01

TJP1 gene encodes a ZO-1 protein that is required for the recruitment of occludins and claudins in tight junction, and is involved in cell polarisation. It has different variations, the frequency of which has been studied in different populations. In Mexico there are no studies of this gene. These are required because their polymorphisms can be used in studies associated with medicine and surgery. Therefore, the aim of this study was to estimate the frequency of alleles and genotypes of rs2291166 gene polymorphism TJP1 in Mexico Mestizos population, and to estimate the conformational effect of an amino acid change. A total of 473 individuals were included. The rs2291166 polymorphism was identified PASA PCR-7% PAGE, and stained with silver nitrate. The conformational effect of amino acid change was performed in silico, and was carried out with servers ProtPraram Tool and Search Database with Fasta. The most frequent allele in the two populations is the ancestral allele (T). A genotype distribution similar to other populations was found. The polymorphism is in Hardy-Weinberg, p>0.05. Changing aspartate to alanine produced a conformational change. The study reveals a high frequency of the ancestral allele at rs2291166 polymorphism in the Mexican population. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

-383 A/C tumor necrosis factor receptor 1 polymorphism and ankylosing spondylitis in Mexicans: a preliminary study.

PubMed

Corona-Sanchez, Esther Guadalupe; Muñoz-Valle, José Francisco; Gonzalez-Lopez, Laura; Sanchez-Hernandez, Julia Dolores; Vazquez-Del Mercado, Monica; Ontiveros-Mercado, Heriberto; Huerta, Miguel; Trujillo, Xochitl; Rocha-Muñoz, Alberto Daniel; Celis, Alfredo; Ortega-Flores, Ricardo; Gamez-Nava, Jorge Ivan

2012-08-01

The objective of this study was to evaluate the differences in allele and genotype frequencies of -383 tumor necrosis factor receptor 1 (TNFR1) polymorphism between ankylosing spondylitis (AS) and controls. Mexican Mestizos with AS were matched by gender, age, and ethnicity with healthy controls and compared in allele and genotype frequencies of the -383 TNFR1 polymorphism. Polymorphisms were genotyped using PCR-RFLP. The AA genotype occurred at a higher frequency in the AS group (92%) compared with controls (79%, P = 0.03). A allele was increased in AS (96% vs. 88%, P = 0.015) and was associated with genetic susceptibility for AS (odds ratio = 3.48, 95% CI = 1.23-10.61). This preliminary study is the first assessing the association of the -383 A/C TNFR1 polymorphism with AS, although it has the limitation of a small sample size. These data are of interest for the genetic epidemiology of AS in the Mexican population, requiring further investigation in other countries.

Abdominal obesity is strongly associated to blood pressure in young Mexicans.

PubMed

Urquidez Romero, Rene; Murguía Romero, Miguel; Esparza Romero, Julián; Díaz Torres, Beatriz Araceli; Rodríguez Tadeo, Alejandra; Medrano Donlucas, Gabriel; Ramos Jiménez, Arnulfo; Wall Medrano, Abraham; Gallardo Ortíz, Itzell A; Tapia Pancardo, Diana C Tapia-Pancardo C; Méndez Cruz, A René; Jiménez Flores, J Rafael; Villalobos Molina, Rafael

2017-03-30

The objective of this study was to determine associations between abdominal obesity (AOb) and the other components of metabolic syndrome (MetS) in young Mexicans in a cross-sectional survey completed during a 4 year period. This cross-sectional study reports on components and prevalence of MetS by using Alberti et al. (16) criteria, as well as association between AOb and elevated blood pressure (BP) of 2,993 Mexican university students, ages 17 to 25 years (66% women) from central and northern Mexico, over a 4-year survey (2010-2013). The most prevalent MetS components in the total sample were low HDL-C concentration (43.6%) and AOb (41.1%). MetS prevalence was 11.8%, more men than women were classified with MetS (14.3% vs. 10.5%, p < 0.01). BP was the MetS component with the lowest prevalence (8.6%). A strong association between AOb and altered BP with in both men and women was found (OR 4.3, IC95% 2.5-7.4). Even BP was the component with the lowest prevalence, AOb was more strongly associated with it. This fact, could explain the prevalence of hypertension among young Mexican adults.

Parents' Traditional Cultural Values and Mexican-Origin Young Adults' Routine Health and Dental Care.

PubMed

Updegraff, Kimberly A; Kuo, Sally I-Chun; McHale, Susan M; Umaña-Taylor, Adriana J; Wheeler, Lorey A

2017-05-01

To investigate the prospective associations between Mexican-origin mothers' and fathers' traditional cultural values and young adults' health and dental care utilization and to test the moderating role of youth gender. Mexican-origin parents and youth (N = 246 families) participated in home interviews and provided self-reports of parents' cultural values (time 1) and young adults' health status and routine health and dental care (time 2; 5 years later). Logistic regressions tested parents' traditional cultural values as predictors of routine health and dental care, accounting for parent nativity, parent acculturation, family socioeconomic status, youth gender, youth age, and youth physical health status. We also tested whether youth gender moderated the associations between parents' cultural values and young adults' routine care. Young adults whose mothers endorsed strong familism values when they were in mid-to-late adolescence were more likely to report at least one routine physician visit in the past year as young adults (odds ratio [OR] = 3.47, 95% confidence interval [CI]: 1.23-9.83, p = .019). Furthermore, for females only, mothers' more traditional gender role attitudes predicted reduced odds of receiving routine health (OR = .22; 95% CI: .08-.64, p = .005) and dental care (OR = .26; 95% CI: .09-.75, p < .012) in young adulthood. Our findings highlight the importance of examining intragroup variability in culturally specific mechanisms to identify targets for addressing ethnic/racial disparities in health care utilization among Mexican-origin young adults, during a period of increased risk for health-compromising behaviors and reduced access to care. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

[Bioimpedance vector analysis for body composition in Mexican population].

PubMed

Espinosa-Cuevas, Maria de los Angeles; Rivas-Rodríguez, Lucía; González-Medina, Enna Cristal; Atilano-Carsi, Ximena; Miranda-Alatriste, Paola; Correa-Rotter, Ricardo

2007-01-01

To construct bivariate tolerance ellipses from impedance values normalized for height, which can be used in Mexican population for the assessment of body composition and compare them with others made in different populations. Body composition was assessed by bioelectrical impedance analysis (BIA) in 439 subjects (204 men and 235 women), 18 to 82 years old, with a BMI between 18-31, using an impedanciometer Quadscan 4000. Resistance, reactance and phase angle were used to calculate bioelectrical impedance vectors and construct bivariate tolerance ellipses. Mean age in men was 47.1 +/- 16 years and 42.4 +/- 13 for women, mean weight (73.4 + 9 vs. 60.1 + 8 kg) and height (1.68 vs. 1.55 m) were significant greater in men than in women (p < 0.002). Women in comparison with men, had greater values of impedance (622.96 +/- 66.16 S2 vs. 523.59 +/- 56.56 D) and resistance (618.96 +/- 66.10 Q 61.97 vs. 521.73 +/- 61.97 2), as well as of resistance and reactance standardized by height (398.24 +/-46.30 S2/m vs. 308.66 +/- 38.44) (44.32 +/- 7.14 i/m vs. 39.75 +/-6.29) respectively, with a significant difference in all of them (p < 0.0001). Similarly, the reactance was greater in females, nevertheless this difference did not reach statistical significance (68.96 +/- 11.17 vs. 67.18 +/- 10.3; p = 0.0861). The phase angle was greater in men than in women, with a statistically significant difference (7.330 +/- 0.88 vs. 6.360 +/- 0.97; p < 0.0001). Bivariate tolerance ellipses (50%, 75% and 95%) derived from Mexican subjects showed a significant upward deviation (p < 0.05) from previously published references from Mexican American and Italian populations. New ellipses of tolerance were therefore constructed for the Mexican population. Bioimpedance vectors in Mexican subjects are significantly different from the existing ones, supporting the need of population specific bivariate tolerance ellipses for the evaluation of body composition.

Links between Childhood and Adult Social Circumstances and Obesity and Hypertension in the Mexican Population

PubMed Central

Beltrán-Sánchez, Hiram; Crimmins, Eileen M.; Teruel, Graciela M.; Thomas, Duncan

2011-01-01

Objectives This study examines links between early life circumstances and adult socioeconomic status and obesity and hypertension in the adult Mexican population. Methods We use data from the Mexican Family Life Survey (MxFLS) collected in 2002 for people aged 20 or older (N=14, 280). Results We found that men with low education and women with more education have significantly lower obesity. Women with higher education also have significantly less hypertension. Obesity triples the likelihood of hypertension among both men and women. Better childhood experiences are associated with less hypertension among women, but more hypertension among men in rural areas. Discussion Recent changes in income, nutrition, and infection in Mexico may be responsible for the observed high prevalence of overweight and obesity and the extremely high odds of hypertension among obese young adults. PMID:21948773

Usual Vitamin Intakes by Mexican Populations.

PubMed

Pedroza-Tobías, Andrea; Hernández-Barrera, Lucía; López-Olmedo, Nancy; García-Guerra, Armando; Rodríguez-Ramírez, Sonia; Ramírez-Silva, Ivonne; Villalpando, Salvador; Carriquiry, Alicia; Rivera, Juan A

2016-09-01

In the past several years, the consumption of high-energy, nutrient-poor foods has increased globally. Dietary intake data collected by the National Health and Nutrition Survey (ENSANUT) 2012 provide information to assess the quality of the Mexican diet and to guide food and nutrition policy. The aim was to describe the usual intake and the prevalence of inadequate intakes of vitamins for the overall Mexican population and by subgroups defined by sex, age, region, urban or rural areas, and socioeconomic status (SES). ENSANUT 2012 is a cross-sectional probabilistic survey representative of the Mexican population. Dietary information was collected by using the 24-h recall automated multiple-pass method (n = 10,096) with a repeated measurement on a subsample (n = 889) to permit adjustment for intraindividual variability with the use of the Iowa State University method. Mean usual intakes and the prevalence of inadequate intakes of thiamin, riboflavin, niacin, folate, and vitamins A, D, E, C, B-6, and B-12 were calculated for children aged 1-4 y (CH1-4y), children aged 5-11 y (CH5-11y), adolescents aged 12-19 y, and adults aged ≥20 y. In all of the age groups, prevalences of inadequate intakes of vitamins D and E were the highest (77-99% of adults and adolescents and 53-95% of CH5-11y and CH1-4y) and those of folate and vitamin A were intermediate (47-70% of adults and adolescents, 15-23% of CH5-11y and 8-13% of CH1-4y), whereas those of thiamin, riboflavin, niacin, and vitamins B-6, B-12, and C were the lowest (0-37% of adults, 1-27% of adolescents, and 0-2.4% of CH5-11y and CH1-4y). With few exceptions, the highest prevalences of inadequate intakes for vitamins were observed in the poorest populations (rural South region and the lowest tertile of SES). The intake of vitamins among Mexicans is inadequate overall. Information collected by ENSANUT can help target food assistance programs and develop strategies to prevent vitamin deficiencies. © 2016 American Society

Polymorphisms of alcohol metabolizing enzymes in indigenous Mexican population: unusual high frequency of CYP2E1*c2 allele.

PubMed

Gordillo-Bastidas, Elizabeth; Panduro, Arturo; Gordillo-Bastidas, Daniela; Zepeda-Carrillo, Eloy A; García-Bañuelos, Jesús J; Muñoz-Valle, José F; Bastidas-Ramírez, Blanca E

2010-01-01

Alcohol abuse represents the major identified etiological factor of cirrhosis in México. ADH1B, ALDH2, and CYP2E1 have been considered candidate genes in alcohol-related diseases. Controversial results probably due to ethnic differences, among other factors, have been reported. Mexican Mestizos (MES) derive from the combination of indigenous, Spaniard, and African genes. Huichols (HUI) constitute an indigenous group from western Mexico with no racial admixture. We determined ADH1B*2, ALDH2*2, and CYP2E1*c2 allele frequencies in healthy HUI and MES from western Mexico. Lipid and hepatic profile were also carried out. One hundred and one HUI and 331 MES subjects were studied. Genotype and allele frequency were assessed through polymerase chain reaction-restriction fragment length polymorphism after DNA isolation from peripheral leukocytes. Commercial kits for lipid and hepatic determinations were used. Polymorphic allele distribution in HUI was: 0%ADH1B*2, 0.5%ALDH2*2, 51.5%CYP2E1*c2; in MES: 3.4%ADH1B*2, 0%ALDH2*2, 16.1%CYP2E1*c2. Frequency of ADH1B*2 was statistically (p < 0.001) lower in HUI than MES. CYP2E1*c2 polymorphic allele was significantly higher (p < 0.0001) in HUI than MES. Hepatic profile was normal in both groups. HUI showed a better lipid profile than MES independently of genotype. Huichols exhibited the highest CYP2E1*c2 allele frequency of the world documented up to this date; meanwhile, ADH1B*2 and ALDH2*2 were practically absent. This feature could be useful in the understanding of Mexican population gene composition, alcohol metabolism, and alcoholic liver disease development. However, further association studies are necessary. The heterogeneity of Mexican population was evidenced by the significantly different distribution of CYP2E1*c2 allele observed among different regions of the country. Lipid and hepatic values were not associated to genotype. This report constitutes the first study dealing with gene polymorphisms of alcohol metabolizing

CCL2 Serum Levels and Adiposity Are Associated with the Polymorphic Phenotypes -2518A on CCL2 and 64ILE on CCR2 in a Mexican Population with Insulin Resistance.

PubMed

Guzmán-Ornelas, Milton-Omar; Petri, Marcelo Heron; Vázquez-Del Mercado, Mónica; Chavarría-Ávila, Efraín; Corona-Meraz, Fernanda-Isadora; Ruíz-Quezada, Sandra-Luz; Madrigal-Ruíz, Perla-Monserrat; Castro-Albarrán, Jorge; Sandoval-García, Flavio; Navarro-Hernández, Rosa-Elena

2016-01-01

Genetic susceptibility has been described in insulin resistance (IR). Chemokine (C-C motif) ligand-2 (CCL2) is overexpressed in white adipose tissue and is the ligand of C-C motif receptor-2 (CCR2). The CCL2 G-2518A polymorphism is known to regulate gene expression, whereas the physiological effects of the CCR2Val64Ile polymorphism are unknown. The aim of the study is to investigate the relationship between these polymorphisms with soluble CCL2 levels (sCCL2), metabolic markers, and adiposity. In a cross-sectional study we included 380 Mexican-Mestizo individuals, classified with IR according to Stern criteria. Polymorphism was identified using PCR-RFLP/sequence-specific primers. Anthropometrics and metabolic markers were measured by routine methods and adipokines and sCCL2 by ELISA. The CCL2 polymorphism was associated with IR (polymorphic A+ phenotype frequencies were 70.9%, 82.6%, in individuals with and without IR, resp.). Phenotype carriers CCL2 (A+) displayed lower body mass and fat indexes, insulin and HOMA-IR, and higher adiponectin levels. Individuals with IR presented higher sCCL2 compared to individuals without IR and was associated with CCR2 (Ile+) phenotype. The double-polymorphic phenotype carriers (A+/Ile+) exhibited higher sCCL2 than double-wild-type phenotype carriers (A-/Ile-). The present findings suggest that sCCL2 production possibly will be associated with the adiposity and polymorphic phenotypes of CCL2 and CCR2, in Mexican-Mestizos with IR.

The shape of things to come? Obesity prevalence among foreign-born vs. US-born Mexican youth in California

PubMed Central

Buttenheim, Alison M.; Pebley, Anne R.; Hsih, Katie; Chung, Chang Y.; Goldman, Noreen

2013-01-01

Obesity among the Mexican-origin adult population in the US has been associated with longer stays in the US and with being US- vs. Mexican-born, two proxies for acculturation. This pattern is less clear for Mexican-origin children and young adults: recent evidence suggests that it may be reversed, with foreign-born Mexican youth in the US at higher risk of obesity than their US-born Mexican–American counterparts. The objective of this study is to evaluate the hypothesis that the immigrant advantage in obesity prevalence for Mexican-origin populations in the US does not hold for children and young adults. We use data from the Los Angeles Family and Neighborhood Survey (N = 1143) and the California Health Interview Survey (N = 25,487) for respondents ages 4–24 to calculate the odds of overweight/obesity by ethnicity and nativity. We find support for the hypothesis that overweight/obesity prevalence is not significantly lower for first-generation compared to second- and third-generation Mexican-origin youth. Significantly higher obesity prevalence among the first generation was observed for young adult males (ages 18–24) and adolescent females (ages 12–17). The previously-observed protective effect against obesity risk among recent adult immigrants does not hold for Mexican-origin youth. PMID:23273875

Genetic and environmental determinants of the susceptibility of Amerindian derived populations for having hypertriglyceridemia

PubMed Central

Aguilar-Salinas, Carlos A.; Tusie-Luna, Teresa; Pajukanta, Päivi

2014-01-01

Here, we discuss potential explanations for the higher prevalence of hypertriglyceridemia in populations with an Amerindian background. Although environmental factors are the triggers, the search for the ethnic related factors that explains the increased susceptibility of the Amerindians is a promising area for research. The study of the genetics of hypertriglyceridemia in Hispanic populations faces several challenges. Ethnicity could be a major confounding variable to prove genetic associations. Despite that, the study of hypertriglyceridemia in Hispanics has resulted in significant contributions. Two GWAS reports have exclusively included Mexican mestizos. Fifty percent of the associations reported in Caucasians could be generalized to the Mexicans, but in many cases the Mexican lead SNP was different than that reported in Europeans. Both reports included new associations with apo B or triglycerides concentrations. The frequency of susceptibility alleles in Mexicans is higher than that found in Europeans for several of the genes with the greatest effect on triglycerides levels. An example is the SNP rs964184 in APOA5. The same trend was observed for ANGPTL3 and TIMD4 variants. In summary, we postulate that the study of the genetic determinants of hypertriglyceridemia in Amerindian populations which have major changes in their lifestyle, may prove to be a great resource to identify new genes and pathways associated with hypertriglyceridemia. PMID:24768220

Association of vWA and TPOX Polymorphisms with Venous Thrombosis in Mexican Mestizos

PubMed Central

Meraz-Ríos, Marco Antonio; Majluf-Cruz, Abraham; Santana, Carla; Noris, Gino; Camacho-Mejorado, Rafael; Acosta-Saavedra, Leonor C.; Calderón-Aranda, Emma S.; Hernández-Juárez, Jesús; Magaña, Jonathan J.; Gómez, Rocío

2014-01-01

Objective. Venous thromboembolism (VTE) is a multifactorial disorder and, worldwide, the most important cause of morbidity and mortality. Genetic factors play a critical role in its aetiology. Microsatellites are the most important source of human genetic variation having more phenotypic effect than many single nucleotide polymorphisms. Hence, we evaluate a possible relationship between VTE and the genetic variants in von Willebrand factor, human alpha fibrinogen, and human thyroid peroxidase microsatellites to identify possible diagnostic markers. Methods. Genotypes were obtained from 177 patients with VTE and 531 nonrelated individuals using validated genotyping methods. The allelic frequencies were compared; Bayesian methods were used to correct population stratification to avoid spurious associations. Results. The vWA-18, TPOX-9, and TPOX-12 alleles were significantly associated with VTE. Moreover, subjects bearing the combination vWA-18/TPOX-12 loci exhibited doubled risk for VTE (95% CI = 1.02–3.64), whereas the combination vWA-18/TPOX-9 showed an OR = 10 (95% CI = 4.93–21.49). Conclusions. The vWA and TPOX microsatellites are good candidate biomarkers in venous thromboembolism diseases and could help to elucidate their origins. Additionally, these polymorphisms could become useful markers for genetic studies of VTE in the Mexican population; however, further studies should be done owing that this data only show preliminary evidence. PMID:25250329

Genetic structure of seven Mexican indigenous populations based on five polymarker loci.

PubMed

Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Loeza, Francisco; Salamanca-Gomez, Fabio; Cerda-Flores, Ricardo M

2003-01-01

This descriptive study investigates the genetic structure of seven Mexican indigenous populations (Mixteca Alta, Mixteca Baja, Otomies, Purepecha, Nahuas-Guerrero, Nahuas-Xochimilco, and Tzeltales) on the basis of five PCR-based polymorphic DNA loci: LDLR, GYPA, HBGG, D7S8, and GC. Genetic distance and diversity analyses indicate that these Mexican indigenous are similar and that more than 96% of the total gene diversity (H(T)) can be attributed to individual variation within populations. Mixteca-Alta, Mixteca-Baja, and Nahuas-Xochimilco show indications of higher admixture with European-derived persons. The demonstration of a relative genetic homogeneity of Mexican Indians for the markers studied suggests that this population is suitable for studying disease-marker associations in the search for candidate genes of complex diseases. Copyright 2002 Wiley-Liss, Inc.

Metabolic syndrome prevalence among Northern Mexican adult population.

PubMed

Salas, Rogelio; Bibiloni, Maria del Mar; Ramos, Esteban; Villarreal, Jesús Z; Pons, Antoni; Tur, Josep A; Sureda, Antoni

2014-01-01

Dietary habits in the Mexican population have changed dramatically over the last few years, which are reflected in increased overweight and obesity prevalence. The aim was to examine the prevalence of metabolic syndrome (MetS) and associated risk factors in Northern Mexican adults aged ≥ 16 years. The study was a population-based cross-sectional nutritional survey carried out in the State of Nuevo León, Mexico. The study included a sub-sample of 1,200 subjects aged 16 and over who took part in the State Survey of Nutrition and Health-Nuevo León 2011/2012. Anthropometric measurements, physical activity, blood pressure and fasting blood tests for biochemical analysis were obtained from all subjects. The prevalence of MetS in Mexican adults aged ≥ 16 years was 54.8%, reaching 73.8% in obese subjects. This prevalence was higher in women (60.4%) than in men (48.9%) and increased with age in both genders. Multivariate analyses showed no evident relation between MetS components and the level of physical activity. Obese adults, mainly women, are particularly at risk of developing MetS, with the associated implications for their health. The increasing prevalence of MetS highlights the need for developing strategies for its early detection and prevention.

Hypocholesterolemia is an independent risk factor for depression disorder and suicide attempt in Northern Mexican population.

PubMed

Segoviano-Mendoza, Marcela; Cárdenas-de la Cruz, Manuel; Salas-Pacheco, José; Vázquez-Alaniz, Fernando; La Llave-León, Osmel; Castellanos-Juárez, Francisco; Méndez-Hernández, Jazmín; Barraza-Salas, Marcelo; Miranda-Morales, Ernesto; Arias-Carrión, Oscar; Méndez-Hernández, Edna

2018-01-15

Cholesterol has been associated as a risk factor for cardiovascular disease. Recently, however, there is growing evidence about crucial requirement of neuron membrane cholesterol in the organization and function of the 5-HT 1A serotonin receptor. For this, low cholesterol level has been reported to be associated with depression and suicidality. However there have been inconsistent reports about this finding and the exact relationship between these factors remains controversial. Therefore, we investigated the link between serum cholesterol and its fractions with depression disorder and suicide attempt in 467 adult subjects in Mexican mestizo population. Plasma levels of total cholesterol, triglycerides, and high-density lipoprotein cholesterol (HDL-c) and low density lipoprotein cholesterol (LDL-c) were determined in 261 MDD patients meeting the DSM-5 criteria for major depressive disorder (MDD), 59 of whom had undergone an episode of suicide attempt, and 206 healthy controls. A significant decrease in total cholesterol, LDL-cholesterol, VLDL-cholesterol and triglyceride serum levels was observed in the groups of MDD patients and suicide attempt compared to those without suicidal behavior (p < 0.05). After adjusting for covariates, lower cholesterol levels were significantly associated with MDD (OR 4.229 CI 95% 2.555 - 7.000, p<.001) and suicide attempt (OR 5.540 CI 95% 2.825 - 10.866, p<.001) CONCLUSIONS: These results support the hypothesis that lower levels of cholesterol are associated with mood disorders like MDD and suicidal behavior. More mechanistic studies are needed to further explain this association.

A statistical assessment of population trends for data deficient Mexican amphibians

PubMed Central

Thessen, Anne E.; Arias-Caballero, Paulina; Ayala-Orozco, Bárbara

2014-01-01

Background. Mexico has the world’s fifth largest population of amphibians and the second country with the highest quantity of threatened amphibian species. About 10% of Mexican amphibians lack enough data to be assigned to a risk category by the IUCN, so in this paper we want to test a statistical tool that, in the absence of specific demographic data, can assess a species’ risk of extinction, population trend, and to better understand which variables increase their vulnerability. Recent studies have demonstrated that the risk of species decline depends on extrinsic and intrinsic traits, thus including both of them for assessing extinction might render more accurate assessment of threats. Methods. We harvested data from the Encyclopedia of Life (EOL) and the published literature for Mexican amphibians, and used these data to assess the population trend of some of the Mexican species that have been assigned to the Data Deficient category of the IUCN using Random Forests, a Machine Learning method that gives a prediction of complex processes and identifies the most important variables that account for the predictions. Results. Our results show that most of the data deficient Mexican amphibians that we used have decreasing population trends. We found that Random Forests is a solid way to identify species with decreasing population trends when no demographic data is available. Moreover, we point to the most important variables that make species more vulnerable for extinction. This exercise is a very valuable first step in assigning conservation priorities for poorly known species. PMID:25548736

A statistical assessment of population trends for data deficient Mexican amphibians.

PubMed

Quintero, Esther; Thessen, Anne E; Arias-Caballero, Paulina; Ayala-Orozco, Bárbara

2014-01-01

Background. Mexico has the world's fifth largest population of amphibians and the second country with the highest quantity of threatened amphibian species. About 10% of Mexican amphibians lack enough data to be assigned to a risk category by the IUCN, so in this paper we want to test a statistical tool that, in the absence of specific demographic data, can assess a species' risk of extinction, population trend, and to better understand which variables increase their vulnerability. Recent studies have demonstrated that the risk of species decline depends on extrinsic and intrinsic traits, thus including both of them for assessing extinction might render more accurate assessment of threats. Methods. We harvested data from the Encyclopedia of Life (EOL) and the published literature for Mexican amphibians, and used these data to assess the population trend of some of the Mexican species that have been assigned to the Data Deficient category of the IUCN using Random Forests, a Machine Learning method that gives a prediction of complex processes and identifies the most important variables that account for the predictions. Results. Our results show that most of the data deficient Mexican amphibians that we used have decreasing population trends. We found that Random Forests is a solid way to identify species with decreasing population trends when no demographic data is available. Moreover, we point to the most important variables that make species more vulnerable for extinction. This exercise is a very valuable first step in assigning conservation priorities for poorly known species.

Genetic structure of the populations migrating from San Luis Potosi and Zacatecas to Nuevo León in Mexico.

PubMed

Cerda-Flores, R M; Kshatriya, G K; Barton, S A; Leal-Garza, C H; Garza-Chapa, R; Schull, W J; Chakraborty, R

1991-06-01

The Mexicans residing in the Monterrey metropolitan area in Nuevo León, Mexico, were grouped by generation and birthplace [Monterrey Metropolitan Area (MMA), San Luis Potosi (SLP), and Zacatecas (ZAC)] of the four grandparents to determine the extent of genetic variation within this population and the genetic differences, if any, between the natives living in the MMA and the immigrant populations from SLP and ZAC. Nine genetic marker systems were analyzed. The genetic distance analysis indicates that SLP and ZAC are similar to the MMA, irrespective of birthplace and generation. Gene diversity analysis (GST) suggests that more than 96% of the total gene diversity (HT) can be attributed to individual variation within the population. The genetic admixture analysis suggests that the Mexicans of the MMA, SLP, and ZAC, stratified by birthplace and generation, have received a predominantly Spanish contribution (78.5%), followed by a Mexican Indian contribution (21.5%). Similarly, admixture analysis, conducted on the population of Nuevo León and stratified by generation, indicates a substantial contribution from the MMA (64.6%), followed by ZAC (22.1%) and SLP (13.3%). Finally, we demonstrate that there is no nonrandom association of alleles among the genetic marker systems (i.e., no evidence of gametic disequilibrium) despite the Mestizo origin of this population.

Socioeconomic Gradients in Health for White and Mexican-Origin Populations

PubMed Central

Goldman, Noreen; Kimbro, Rachel T.; Turra, Cassio M.; Pebley, Anne R.

2006-01-01

Objectives. We assessed whether the few findings to date suggesting weak relationships between education and health-related variables among Hispanics are indicative of a more widespread pattern. Methods. We used logistic regression models to examine education differentials (i.e., education gradients) in health behaviors and outcomes among White and Mexican-origin adults, adolescents, and infants. We gathered information from 3 data sets: the Los Angeles Family and Neighborhood Survey, the Fragile Families and Child Wellbeing Study, and the National Health Interview Survey. Results. In contrast with patterns for Whites, education was weakly associated or not associated with numerous health-related variables among the US Mexican-origin population. Among adults, Mexican immigrants were especially likely to have weaker education gradients than Whites. Conclusions. The weak relationships between education and health observed among individuals of Mexican origin may have been the result of several complex mechanisms: social gradients in health in Mexico that differ from those in the United States, selective immigration according to health and socioeconomic status, and particular patterns of integration of Mexican immigrants into US society. PMID:17077396

Metabolic Syndrome Prevalence among Northern Mexican Adult Population

PubMed Central

Salas, Rogelio; Bibiloni, Maria del Mar; Ramos, Esteban; Villarreal, Jesús Z.; Pons, Antoni; Tur, Josep A.; Sureda, Antoni

2014-01-01

Background and Aims Dietary habits in the Mexican population have changed dramatically over the last few years, which are reflected in increased overweight and obesity prevalence. The aim was to examine the prevalence of metabolic syndrome (MetS) and associated risk factors in Northern Mexican adults aged ≥16 years. Methods and Results The study was a population-based cross-sectional nutritional survey carried out in the State of Nuevo León, Mexico. The study included a sub-sample of 1,200 subjects aged 16 and over who took part in the State Survey of Nutrition and Health–Nuevo León 2011/2012. Anthropometric measurements, physical activity, blood pressure and fasting blood tests for biochemical analysis were obtained from all subjects. The prevalence of MetS in Mexican adults aged ≥16 years was 54.8%, reaching 73.8% in obese subjects. This prevalence was higher in women (60.4%) than in men (48.9%) and increased with age in both genders. Multivariate analyses showed no evident relation between MetS components and the level of physical activity. Conclusions Obese adults, mainly women, are particularly at risk of developing MetS, with the associated implications for their health. The increasing prevalence of MetS highlights the need for developing strategies for its early detection and prevention. PMID:25141255

Psychometric tests of Expectations of Filial Piety Scale in a Mexican-American population.

PubMed

Kao, Hsueh-Fen S; McHugh, Mary L; Travis, Shirley S

2007-08-01

This paper reports the development of the Expectations of Filial Piety Scale for use with Mexican-American parents regarding expectations they have of their adult children for care and support. Earlier work by the authors demonstrated that filial piety is a cross-cultural construct that can be used with Hispanic/Latino populations. More refined development of the construct required testing with more homogeneous subsets (i.e. Mexican-Americans) within the broad designation of Hispanic/Latino adults. Non-experimental methodological design for field testing of the instrument's psychometric properties. A convenient sample of 80 Mexican-American adults in California and Texas completed a brief biographical survey and field tested the Expectations of Filial Piety Scale. Common factor analysis with orthogonal rotation was used to extract three factors, which accounted for 58% of the variance in scale scores. These factors included: I: respect for parents (24.05%); II: honouring parents (12.5%); and III: family unity (16.56%). Overall scale reliability was 0.87 with individual factor reliability coefficients ranging from 0.74 to 0.87 and test-retest correlation was 0.73. The results show that the Expectations of Filial Piety Scale is an internally consistent and reliable tool for use in studies of the Mexican-American population. Mexican elders historically underuse formal services; a large portion of this population will most likely depend on support from their family members when they reach advanced ages. There is a lack of culturally sensitive instruments to measure family values in caring for older adults in Mexican-Americans. This scale can enable case workers and nurses in long-term care settings to assess the elder's expectations for family support accurately and compare these expectations with available family support, children's intentions to care for a dependent parent or other family member and the need for supplemental care in Mexican-American families.

Family Factors Related to Competence in Young, Disadvantaged Mexican-American Children. Part of the Final Report on Head Start Evaluation and Research: 1968-69 to the Office of Economic Opportunity.

ERIC Educational Resources Information Center

Stedman, James M.; McKenzie, Richard E.

As part of the continuing search for the environmental antecedents of competence in young children, this study investigated several parameters of a population of disadvantaged Mexican-American children. The factors of child competence on which this study focused were behavioral adjustment and linguistic ability. The antecedents of competence were…

Parental perceptions of childhood overweight in the Mexican American population: an integrative review.

PubMed

Ward, Carroll L

2008-12-01

The prevalence of overweight in Mexican American children has been increasing at a steady rate over the past few years. People of Mexican origin make up the largest proportion of the Hispanic population, which has been reported by the U.S. Census Bureau to be the fastest growing ethnic group in the United States. The purpose of this integrative review was to examine and summarize the current research on parental perceptions of childhood overweight in the Mexican American population. Four main themes evolved as a result of the data analysis: parental perception of overweight, parental practices, household food security status, and acculturation. School nurses are in a position to influence children in improving their nutritional status and increasing their physical activity. Understanding cultural values and beliefs regarding health status and overweight of Mexican American families should be a priority for school nurses. Identifying food-related parenting styles and the concept of acculturation should also be considered prior to incorporating relevant interventions in the school setting.

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico

PubMed Central

2014-01-01

research improves our understanding of the socio-economic activities associated with the intracultural distribution of ethnobotanical knowledge among mestizo Mexican communities. It also provides information on plant resources and habitats and how local peasants value them. This information could help in the development of proposals to improve biocultural conservation and strengthen traditional knowledge systems for effective forest management. PMID:24467777

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico.

PubMed

Beltrán-Rodríguez, Leonardo; Ortiz-Sánchez, Amanda; Mariano, Nestor A; Maldonado-Almanza, Belinda; Reyes-García, Victoria

2014-01-27

-economic activities associated with the intracultural distribution of ethnobotanical knowledge among mestizo Mexican communities. It also provides information on plant resources and habitats and how local peasants value them. This information could help in the development of proposals to improve biocultural conservation and strengthen traditional knowledge systems for effective forest management.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases.

PubMed

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-10-01

Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi resistant bacteria or yeast. The study aimed

Family Relations and the Adjustment of Young Children of Mexican Descent: Do Family Cultural Values Moderate These Associations?

ERIC Educational Resources Information Center

Gamble, Wendy C.; Modry-Mandell, Kerri

2008-01-01

This study examined the role of family cultural values as moderators of the association between family relations and the adjustment of young children. Fifty-five families of Mexican descent with young children enrolled in Head Start programs in the Southwest participated. Mothers provided information about closeness of the mother-child…

Urban occupational health in the Mexican and Latino/Latina immigrant population: A literature review

PubMed Central

Gany, Francesca; Novo, Patricia; Dobslaw, Rebecca; Leng, Jennifer

2017-01-01

Mexican and Latino/Latina immigrants represent a rapidly growing population within the United States. The majority settle in urban areas. As a group, Mexican immigrants typically have low educational attainment and socioeconomic status, and limited English proficiency. These immigrants often find work in hazardous jobs, with high injury and fatality rates. They often have inadequate or no safety training, no personal protective equipment, limited understanding of workers’ rights, job insecurity, fear of report of undocumented status and lack health care benefits. This review includes what has been published on the urban occupational health of this population. The findings suggest that Mexican and Latino/Latina immigrants experience higher rates of workrelated fatalities and injuries compared to other populations, and may be less likely to report such incidents to employers or to apply for workers’ compensation. There is a strong need to develop effective programs to address the health and safety of this vulnerable population. PMID:23468371

Mexican American Adolescents’ Sleep Patterns: Contextual Correlates and Implications for Health and Adjustment in Young Adulthood

PubMed Central

Kuo, Sally I-Chun; Updegraff, Kimberly A.; Zeiders, Katharine H.; McHale, Susan M.; Umaña-Taylor, Adriana J.; De Jesús, Sue A. Rodríguez

2014-01-01

Late adolescence is a period of substantial risk for unhealthy sleep patterns. This study investigated the contextual correlates and health and adjustment implications of sleep patterns among Mexican American youth (N = 246; 51% female). We focused on Mexican American youth because they represent a large and rapidly increasing subgroup of the U.S. population that is at higher risk for health and adjustment problems; this higher risk may be explained, in part, by sleep patterns. Using data from 7 phone diary interviews conducted when youth averaged 18 years of age, we assessed average nighttime sleep duration and night-to-night variability in sleep duration. Guided by socio-ecological models, we first examined how experiences in the family context (time spent and quality of relationships with parents, parents’ familism values) and in extra-familial contexts (school, work, peers) were related to sleep duration and variability. The findings revealed that time spent in school, work, and with peers linked to less sleep. Further, conflict with mothers was related to greater sleep variability. Next, we tested the implications of sleep in late adolescence for health (perceived physical health, body mass index) and adjustment (depressive symptoms, risky behaviors) in young adulthood. These findings indicated that more sleep variability predicted relative decreases in health and increases in risky behaviors, and shorter sleep duration predicted relative decreases in poorer perceived health for males. The discussion highlights the significance of the transition to young adulthood as a target for sleep research and the importance of studying sleep within its socio-cultural context. PMID:25047598

Parental Perceptions of Childhood Overweight in the Mexican American Population: An Integrative Review

ERIC Educational Resources Information Center

Ward, Carroll L.

2008-01-01

The prevalence of overweight in Mexican American children has been increasing at a steady rate over the past few years. People of Mexican origin make up the largest proportion of the Hispanic population, which has been reported by the U.S. Census Bureau to be the fastest growing ethnic group in the United States. The purpose of this integrative…

The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

PubMed Central

Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

2013-01-01

Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

[Renal length measured by ultrasound in adult mexican population].

PubMed

Oyuela-Carrasco, J; Rodríguez-Castellanos, F; Kimura, E; Delgado-Hernández, R; Herrera-Félix, J P

2009-01-01

Renal length estimation by ultrasound is an important parameter in clinical evaluation of kidney disease and healthy donors. Changes in renal volume may be a sign of kidney disease. Correct interpretation of renal length requires the knowledge of normal limits, these have not been described for Latin American population. To describe normal renal length (RL) by ultrasonography in a group of Mexican adults. Ultrasound measure of RL in 153 healthy Mexican adults stratified by age. Describe the association of RL to several anthropometric variables. A total of 77 males and 76 females were scanner. The average age for the group was 44.12 +/- 15.44 years. The mean weight, body mass index (BMI) and height were 68.87 +/- 11.69 Kg, 26.77 +/- 3.82 kg/m2 and 160 +/- 8.62 cm respectively. Dividing the population by gender, showed a height of 166 +/- 6.15 cm for males and 154.7 +/- 5.97 cm for females (p =0.000). Left renal length (LRL) in the whole group was 105.8 +/- 7.56 mm and right renal length (RRL) was 104.3 +/- 6.45 mm (p = 0.000.) The LRL for males was 107.16 +/- 6.97 mm and for females was 104.6 +/- 7.96 mm. The average RRL for males was 105.74 +/- 5.74 mm and for females 102.99 +/- 6.85 mm (p = 0.008.) We noted that RL decreased with age and the rate of decline accelerates alter 60 years of age. Both lengths correlated significantly and positively with weight, BMI and height. The RL was significantly larger in males than in females in both kidneys (p = 0.036) in this Mexican population. Renal length declines after 60 years of age and specially after 70 years.

From Folklore to Molecular Pharmacophores: Cultivating STEM Students among Young, First-Generation Female Mexican-Americans

ERIC Educational Resources Information Center

Gardea, Jessica; Rios, Laura; Pal, Rituraj; Gardea-Torresdey, Jorge L.; Narayan, Mahesh

2011-01-01

The Research and Engineering Apprenticeship Program of the Academy of Applied Science has funded several high school student summer internships to work within the Department of Chemistry at the University of Texas at El Paso. Over the last nine years, young Mexican-American scholars have been recruited into STEM-specific (science, technology,…

Disparities in stroke type and vascular risk factors between 2 Hispanic populations in Miami and Mexico city.

PubMed

Romano, Jose G; Arauz, Antonio; Koch, Sebastian; Dong, Chuanhui; Marquez, Juan M; Artigas, Carol; Merlos, Marlon; Hernandez, Bernardo; Roa, Luis F; Rundek, Tatjana; Sacco, Ralph L

2013-08-01

The heterogeneous nature and determinants of stroke among different Hispanic groups was examined by comparing hospitalized Hispanic stroke patients in Miami, where the Hispanic population is largely of Caribbean origin, to a Mestizo population in Mexico City. Consecutive Hispanic patients who were admitted with stroke or transient ischemic attack (TIA) and included in the prospective stroke registries of 2 tertiary care teaching hospitals were studied. Demographic factors, stroke subtypes, vascular risk factors, stroke severity, and outcomes were compared. Vascular risk factor definitions were standardized. A total of 928 patients (520 Mexicans and 408 Miami Hispanics) were analyzed. Mexicans were younger, with a greater proportion of women. More cerebral venous thromboses (CVTs) were admitted in Mexico, while TIA and stroke mimics were more commonly admitted in Miami; cardioembolic strokes were more commonly ascertained in Miami, and more cryptogenic strokes in Mexico. Stroke severity was similar for intracerebral hemorrhages, but more severe ischemic strokes and CVTs were included in the Mexican registry. Outcome at 1 and 3 months was similar in both registries after adjusting for age and baseline stroke severity. After adjusting for age and sex, hypertension, dyslipidemia, and atrial fibrillation were more frequent, and diabetes mellitus was less frequent, among Miami Hispanics compared to Mexicans. We found significant differences in the frequency of hypertension, diabetes, dyslipidemia, and atrial fibrillation in Miami Hispanics and Mexican stroke patients, highlighting the heterogeneity of the Hispanic ethnic group. Future studies are needed to clarify the relative contribution of genetic and environmental disparities amongst Mexican and Caribbean Hispanic stroke patients. Copyright © 2013 National Stroke Association. Published by Elsevier Inc. All rights reserved.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases

PubMed Central

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-01-01

Context: Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). Material and Method: The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Results: Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. Conclusion: This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. SUMMARY This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36

Factors Affecting Career Decision Making of Mexican and Mexican-American Students.

ERIC Educational Resources Information Center

Newlon, Betty J.; Borboa, Roman

The purpose of this research was to identify the self-reported factors affecting the career decision making of Mexican and Mexican-American students. It was hypothesized that the factor clusters would differ between the two sample populations, Mexican and Mexican-American. It was also hypothesized that these clusters would differ from six clusters…

Shades of Decay: The Meanings of Tooth Discoloration and Deterioration to Mexican Immigrant Caregivers of Young Children

PubMed Central

Masterson, Erin E.; Barker, Judith C.; Hoeft, Kristin S.; Hyde, Susan

2014-01-01

The objective of this article is to investigate parental understanding of tooth discoloration and decay and their related care seeking for young, Mexican-American children. The research design entailed semi-structured, face-to-face interviews conducted in Spanish with a convenience sample of 37 Mexican immigrant mothers of young children in a low-income urban neighborhood. Five major color terms – white, off-white, yellow, brown, and black – were used to describe tooth discoloration, the causes of which were mainly unrecognized or attributed to poor oral hygiene and exposure to sweet substances. Mothers also described three major levels of deterioration of the structural integrity of teeth due to caries, from stains to decayed portions to entirely rotten. A trend was observed between use of darker discoloration terms and extensive carious lesions. Teeth described as both dark in color and structurally damaged resulted in seeking of professional care. The paper concludes with the finding that Spanish terms used to describe tooth discoloration and carious lesions are broad and complex. Mexican immigrant mothers’ interpretations of tooth discoloration and decay may differ from dental professionals’ and result in late care seeking. Increased understanding between dental practitioners and caregivers is needed to create educational messages about the early signs of tooth decay. PMID:26279585

Nativity and nutritional behaviors in the Mexican origin population living in the US-Mexico border region.

PubMed

Montoya, Jared A; Salinas, Jennifer J; Barroso, Cristina S; Mitchell-Bennett, Lisa; Reininger, Belinda

2011-02-01

The purpose of this study is to determine the relationship between nativity and nutritional behaviors and beliefs in the Mexican American population living in the South Texas border region. Mexican Americans living the border region of South Texas were sampled to assess their nutrition behaviors and beliefs. Nativity was measured as whether subjects were born in the United States or Mexico. Nutritional behaviors were measured using the SPAN and indexes were used to measure barriers to good nutrition, dietary self-efficacy, and dietary importance. OLS regression analysis was used and adjustments were made for sociodemographic factors. Differences between US-born Mexican Americans and Mexico-born Mexican Americans existed in nutritional beliefs, but not in behaviors. Mexico-born Mexican Americans reported their dietary choices as more important and reported greater food self-efficacy than their US-born Mexican American counterparts. Socioeconomic status influenced US-born Mexican Americans nutritional beliefs only and the same effect was not observed for Mexico-born Mexican Americans. Despite low levels of overall acculturation in the border region dietary beliefs still exist between immigrants and US-born Mexican Americans in dietary beliefs, but, not behaviors in US-born Mexican Americans.

Mexican-American mothers’ initiation and understanding of home oral hygiene for young children

PubMed Central

HOEFT, Kristin S.; BARKER, Judith C.; MASTERSON, Erin E.

2012-01-01

Purpose To investigate caregiver beliefs and behaviors as key issues in the initiation of home oral hygiene routines. Oral hygiene helps reduce the prevalence of early childhood caries, which is disproportionately high among Mexican-American children. Methods Interviews were conducted with a convenience sample of 48 Mexican-American mothers of young children in a low income, urban neighborhood. Interviews were digitally recorded, translated, transcribed, coded and analyzed using standard qualitative procedures. Results The average age of tooth brushing initiation was 1.8±0.8 years; only a small proportion of parents (13%) initiated oral hygiene in accord with American Dental Association (ADA) recommendations. Mothers initiated 2 forms of oral hygiene: infant oral hygiene and regular tooth brushing. For the 48% of children who participated in infant oral hygiene, mothers were prompted by pediatrician and social service (WIC) professionals. For regular tooth brushing initiation, a set of maternal beliefs exist about when this oral hygiene practice becomes necessary for children. Beliefs are mainly based on a child’s dental maturity, interest, capacity and age/size. Conclusions Most (87%) of the urban Mexican-American mothers in the study do not initiate oral hygiene practices in compliance with ADA recommendations. These findings have implications for educational messages. PMID:19947134

Measuring Cultural Socialization Attitudes and Behaviors of Mexican-Origin Mothers With Young Children: A Longitudinal Investigation

PubMed Central

Derlan, Chelsea L.; Umaña-Taylor, Adriana J.; Toomey, Russell B.; Jahromi, Laudan B.; Updegraff, Kimberly A.

2016-01-01

We describe the development and psychometric testing of the Cultural Socialization Behaviors Measure (CSBM) and the Cultural Socialization Attitudes Measure (CSAM). The CSBM assesses cultural socialization behaviors that parents use with young children, and the CSAM assesses the attitudes that parents have regarding the importance of socializing their young children about their culture. Both measures demonstrated strong reliability, validity, and cross-language equivalence (i.e., Spanish and English) among a sample of 204 Mexican-origin young mothers (Mage = 20.94 years, SD = 1.01) with 4-year-old children. In addition, the measures demonstrated longitudinal equivalence when children were 4 and 5 years of age. PMID:27990040

Measuring Cultural Socialization Attitudes and Behaviors of Mexican-Origin Mothers With Young Children: A Longitudinal Investigation.

PubMed

Derlan, Chelsea L; Umaña-Taylor, Adriana J; Toomey, Russell B; Jahromi, Laudan B; Updegraff, Kimberly A

2016-07-01

We describe the development and psychometric testing of the Cultural Socialization Behaviors Measure (CSBM) and the Cultural Socialization Attitudes Measure (CSAM). The CSBM assesses cultural socialization behaviors that parents use with young children, and the CSAM assesses the attitudes that parents have regarding the importance of socializing their young children about their culture. Both measures demonstrated strong reliability, validity, and cross-language equivalence (i.e., Spanish and English) among a sample of 204 Mexican-origin young mothers ( M age = 20.94 years, SD = 1.01) with 4-year-old children. In addition, the measures demonstrated longitudinal equivalence when children were 4 and 5 years of age.

Evaluation of the contribution of D9S1120 to anthropological studies in Native American populations.

PubMed

Aguilar-Velázquez, J A; Martínez-Sevilla, V Manuel; Sosa-Macías, M; González-Martin, A; Muñoz-Valle, J F; Rangel-Villalobos, H

2017-12-01

The D9S1120 locus exhibits a population-specific allele of 9 repeats (9RA) in all Native American and two Siberian populations currently studied, but it is absent in other worldwide populations. Although this feature has been used in anthropological genetic studies, its impact on the evaluation of the structure and genetic relations among Native American populations has been scarcely assessed. Consequently, the aim of this study was to evaluate the anthropological impact of D9S1120 when it was added to STR population datasets in Mexican Native American groups. We analyzed D9S1120 by PCR and capillary electrophoresis (CE) in 1117 unrelated individuals from 13 native groups from the north and west of Mexico. Additional worldwide populations previously studied with D9S1120 and/or 15 autosomal STRs (Identifier kit) were included for interpopulation analyses. We report statistical results of forensic importance for D9S1120. On average, the modal alleles were the Native American-specific allele 9RA (0.3254) and 16 (0.3362). Genetic distances between Native American and worldwide populations were estimated. When D9S1120 was included in the 15 STR population dataset, we observed improvements for admixture estimation in Mestizo populations and for representing congruent genetic relationships in dendrograms. Analysis of molecular variance (AMOVA) based on D9S1120 confirms that most of the genetic variability in the Mexican population is attributable to their Native American backgrounds, and allows the detection of significant intercontinental differentiation attributed to the exclusive presence of 9RA in America. Our findings demonstrate the contribution of D9S1120 to a better understanding of the genetic relationships and structure among Mexican Native groups. Copyright © 2017 Elsevier GmbH. All rights reserved.

Adherence to Dietary Recommendations for Food Group Intakes Is Low in the Mexican Population.

PubMed

Batis, Carolina; Aburto, Tania C; Sánchez-Pimienta, Tania G; Pedraza, Lilia S; Rivera, Juan A

2016-09-01

Given the high prevalence of obesity and noncommunicable diseases in Mexico and the key role of dietary quality in these conditions, it is important to determine Mexicans' adherence to dietary recommendations. Our aim was to estimate the percentage of the Mexican population who adhere to dietary recommendations for key food groups. We analyzed 7983 participants aged ≥5 y from the nationally representative Mexican National Health and Nutrition Survey 2012. Dietary intake data were collected by using one 24-h recall and a repeated 24-h recall in 9% of the sample. We used the National Cancer Institute method for episodically consumed foods, which uses a 2-part (probability and amount) mixed regression model to estimate the usual intake distribution and its association with sociodemographic variables. For the food groups that are encouraged, only 1-4% of the population (range across sex and age groups) reached the recommended intake of legumes, 4-8% for seafood, 7-16% for fruit and vegetables, and 9-23% for dairy. For food groups that are discouraged, only 10-22% did not exceed the recommended upper limit for sugar-sweetened beverages, 14-42% for high saturated fat and/or added sugar (HSFAS) products, and 9-50% for processed meats, whereas the majority (77-93%) did not exceed the limit for red meat. A lower proportion of adolescents than children and adults adhered to recommendations for several food groups. Participants with higher socioeconomic status (SES) and living in urban areas consumed more (probability of consuming and/or amount consumed) fruit and vegetables, dairy, and HSFAS products, but they consumed fewer legumes than those of lower SES and living in rural areas. These results reveal the poor dietary quality of the Mexican population and the urgent need to shift these habits. If current intakes continue, the burden of disease due to obesity and noncommunicable chronic diseases will likely remain elevated in the Mexican population. © 2016 American

Recalibration of the Klales et al. (2012) method of sexing the human innominate for Mexican populations.

PubMed

Gómez-Valdés, Jorge A; Menéndez Garmendia, Antinea; García-Barzola, Lizbeth; Sánchez-Mejorada, Gabriela; Karam, Carlos; Baraybar, José Pablo; Klales, Alexandra

2017-03-01

The aim of this study was to test the accuracy of the Klales et al. (2012) equation for sex estimation in contemporary Mexican population. Our investigation was carried out on a sample of 203 left innominates of identified adult skeletons from the UNAM-Collection and the Santa María Xigui Cemetery, in Central Mexico. The Klales' original equation produces a sex bias in sex estimation against males (86-92% accuracy versus 100% accuracy in females). Based on these results, the Klales et al. (2012) method was recalibrated for a new cutt-of-point for sex estimation in contemporary Mexican populations. The results show cross-validated classification accuracy rates as high as 100% after recalibrating the original logistic regression equation. Recalibration improved classification accuracy and eliminated sex bias. This new formula will improve sex estimation for Mexican contemporary populations. © 2017 Wiley Periodicals, Inc.

Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study

PubMed Central

2013-01-01

Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of

Familism Values, Family Time, and Mexican-Origin Young Adults’ Depressive Symptoms

PubMed Central

Zeiders, Katharine H.; Updegraff, Kimberly A.; Umaña-Taylor, Adriana J.; McHale, Susan M.; Padilla, Jenny

2015-01-01

Using longitudinal data across eight years, this study examined how parents’ familism values in early adolescence predicted youths’ depressive symptoms in young adulthood via youths’ familism values and family time. We examined these processes among 246 Mexican-origin families using interview and phone-diary data. Findings revealed that fathers’ familism values predicted male and female youths’ familism values in middle adolescence. For female youth only, fathers’ familism values also predicted youths’ family time in late adolescence. The link between family time and young adults’ depressive symptoms depended on parental acceptance and adolescent gender: Among female and male youth, family time predicted fewer depressive symptoms, but only when paternal acceptance was high. For female adolescents only, family time predicted fewer depressive symptoms when maternal acceptance was high but more depressive symptoms when maternal acceptance was low. Findings highlight family dynamics as the mechanisms through which familism values have implications for youths’ adjustment. PMID:26778855

MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

PubMed

Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Muñoz-Valle, J F

2018-07-15

Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

Association between obesity and depressive symptoms in Mexican population.

PubMed

Zavala, Gerardo A; Kolovos, Spyros; Chiarotto, Alessandro; Bosmans, Judith E; Campos-Ponce, Maiza; Rosado, Jorge L; Garcia, Olga P

2018-06-01

Obesity and depression are among the leading causes of disability in Mexico, but their association has not been explored yet. The aim of the current study was to investigate the association between obesity and depression in Mexican population. We used data from the health and nutrition survey (ENSANUT 2012), which is representative of the Mexican population. Obesity was determined using the body mass index (BMI) and abdominal obesity by measuring waist circumference. Depressive symptoms were reported using the Center for Epidemiological Studies Depression Scale Short-Form (CES-D-SF, scale 0-21). Regression analyses were performed between obesity and depression, adjusting for gender, age, living with a partner, education, and diabetes history. Obese women had 1.28 (95% CI 1.07-1.53) times the odds of having depression in comparison with normal-weight women, whereas no association was found for men (OR 0.94; 95% CI 0.74-1.19). A significant association between BMI and depressive symptoms score (β = 0.05, 95% CI 0.02-0.07) was present in women, but no association was found for men (β = - 0.02, 95% CI - 0.05 to 0.00). There was a statistically significant association between waist circumference and depression scores again for women (β = 0.03, 95% CI 0.01-0.04) but not for men (β = 0.00, 95% CI - 0.01 to 0.01). No associations were found between abdominal obesity and depression for both genders. No association was found between different obesity severity levels and depression for both genders. Obesity was associated with depression in Mexican women, whereas no association was found between obesity and depression in men.

[Food groups consumption and sociodemographic characteristics in Mexican population].

PubMed

Gaona-Pineda, Elsa B; Martínez-Tapia, Brenda; Arango-Angarita, Andrea; Valenzuela-Bravo, Danae; Gómez-Acosta, Luz M; Shamah-Levy, Teresa; Rodríguez-Ramírez, Sonia

2018-01-01

To estimate the recommendable and non-recommendable food groups for usual consumption by sociodemographic characteristics in Mexican population. Through a 7-day, semi-quan¬titative food frequency questionnaire used in 2016 National Health and Nutrition Survey, we estimated the proportions of population (preschool and school children, adolescents and adults) who consumed food groups that are relevant for public health by area, region and socioeconomic status (SES). Less than 50% of population consumed vegetables daily; almost 80% of the population consumed plain water daily and sweetened beverages (3 d/week). Center and Mexico City regions had the highest percentage of fruits and vegetables consumers (p<0.012). High SES had the highest consumer´s percentage of recommendable and non-recommendable food groups. A high percentage of the population do not consume fruits, vegetables and plain water daily.

Ancestral effect on HOMA-IR levels quantitated in an American population of Mexican origin.

PubMed

Qu, Hui-Qi; Li, Quan; Lu, Yang; Hanis, Craig L; Fisher-Hoch, Susan P; McCormick, Joseph B

2012-12-01

An elevated insulin resistance index (homeostasis model assessment of insulin resistance [HOMA-IR]) is more commonly seen in the Mexican American population than in European populations. We report quantitative ancestral effects within a Mexican American population, and we correlate ancestral components with HOMA-IR. We performed ancestral analysis in 1,551 participants of the Cameron County Hispanic Cohort by genotyping 103 ancestry-informative markers (AIMs). These AIMs allow determination of the percentage (0-100%) ancestry from three major continental populations, i.e., European, African, and Amerindian. We observed that predominantly Amerindian ancestral components were associated with increased HOMA-IR (β = 0.124, P = 1.64 × 10(-7)). The correlation was more significant in males (Amerindian β = 0.165, P = 5.08 × 10(-7)) than in females (Amerindian β = 0.079, P = 0.019). This unique study design demonstrates how genomic markers for quantitative ancestral information can be used in admixed populations to predict phenotypic traits such as insulin resistance.

[C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

PubMed

Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

2017-01-01

Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

Biological Risk in the Mexican Population at the Turn of the 21st Century

PubMed Central

Beltrán-Sánchez, Hiram; Crimmins, Eileen M.

2013-01-01

Mexico has experienced changes in its demographic and epidemiologic profile accompanied by recent changes in nutrition and income. Thus, the old and the young have experienced very different environments. Using data from the Mexican National Health Nutrition Survey 2006, we examine age and sex differences in physiological status and dysregulation and assess how socioeconomic factors associate with variability in biological indicators of health. Results indicate that young people have experienced better physical development as evidenced by their being taller and having less stunting. There is currently little under-nutrition in Mexico, but there is evidence of over-nutrition as indicated by high prevalence of overweight across the age range. Physiological dysregulation across multiple systems is higher in Mexicans than Americans across all ages. Mexicans have: higher levels of blood pressure, plasma glucose, and especially for women, dysregulated cholesterol and higher body weight. Low education is associated with both being stunted and overweight, and with adverse levels of HDL cholesterol and more physiological risk factors. Rural dwelling males are less likely to be overweight as are females living in poor states. Living in a poor state among females and having rural residence among males is associated with a higher number of high-risk factors. Overweight is a strong predictor of hypertension. Age differences in indicators of physiological development suggest that the epidemiological and demographic transitions in Mexico were accompanied by improved physical development; however, increases in nutrition may have reached a point of diminishing returns as Mexico switched from a state of under-nutrition to over-nutrition. PMID:23812952

Interpersonal and personal factors influencing sexual debut among Mexican-American young women in the United States.

PubMed

Gilliam, Melissa L; Berlin, Amy; Kozloski, Mike; Hernandez, Maida; Grundy, Maureen

2007-11-01

The purpose of this study is to better understand factors influencing the age of sexual initiation among Latina youth. Prior qualitative research with young women from the target population and the existing literature determined the theoretical framework for this study. A quantitative instrument was then developed and pre-tested. We enrolled a convenience sample of predominantly Mexican-American adolescent and young adult women from the west side of Chicago. A total of 271 participants were included in the analysis. Bi-variate and multivariable analyses were conducted to determine factors associated with age of first sexual intercourse. We found that personal, family, and peer/partner related factors influence the sexual decision making of these young women. Strong family expectations regarding educational attainment, negative parental messages about premarital sex and pregnancy, resistance to the influence of peers and partners, greater sense of personal control over sexual behaviors, preference for speaking Spanish, and small age difference between the young woman and her first sexual partner were all positively associated with age of sexual initiation. Among these, greater sense of personal control over behaviors was the strongest factor influencing age of sexual initiation. This study provides a model that can be used to better understand Latina sexual decision making. Our findings might also inform future programs for Latinas, as they suggest that increasing girls' feelings of personal control over decisions regarding sexual debut and helping Latino parents to communicate strong messages about educational achievement, pregnancy, and sexuality may lead to positive health behaviors.

Mexican-Origin Parents’ Differential Treatment and Siblings’ Adjustment from Adolescence to Young Adulthood

PubMed Central

McHale, Susan M.; Updegraff, Kimberly A.; Umaña-Taylor, Adriana J.

2016-01-01

Parents’ differential treatment is a common family dynamic that has been linked to youth’s well-being in childhood and adolescence in European American families. Much less is known, however, about this family process in other ethnic groups. We examined the longitudinal associations between parents’ differential treatment (PDT) and both depressive symptoms and risky behaviors of Mexican-origin sibling pairs from early adolescence through young adulthood. We also tested the moderating roles of cultural orientations as well as youth age, gender and sibling dyad gender constellation in these associations. Participants were mothers, fathers, and two siblings from 246 Mexican-origin families who participated in individual home interviews on 3 occasions over 8 years. Multilevel models revealed that, controlling for dyadic parent-child relationship qualities (i.e., absolute levels of warmth and conflict), adolescents who had less favorable treatment by mothers relative to their sibling reported more depressive symptoms and risky behavior, on average. Findings for fathers’ PDT emerged at the within-person level indicating that, on occasions when adolescents experienced less favorable treatment by fathers than usual, they reported more depressive symptoms and risky behavior. However, some of these effects were moderated by youth age and cultural socialization. For example, adolescents who experienced relatively less paternal warmth than their siblings also reported poorer adjustment, but this effect did not emerge for young adults; such an effect also was significant for unfavored youth with stronger but not weaker cultural orientations. PMID:27504752

Recent Trends in Coverage of the Mexican-Born Population of the United States: Results From Applying Multiple Methods Across Time

PubMed Central

Van Hook, Jennifer; Bean, Frank D.; Bachmeier, James D.; Tucker, Catherine

2014-01-01

The accuracy of counts of U.S. racial/ethnic and immigrant groups depends on coverage of the foreign-born in official data. Because Mexicans constitute by far the largest single national-origin group among the foreign-born in the United States, we compile new evidence about the coverage of the Mexican-born population in the 2000 census and 2001–2010 American Community Survey (ACS) using three techniques: a death registration, a birth registration, and a net migration method. For the late 1990s and first half of the 2000–2010 decade, results indicate that coverage error was somewhat higher than currently assumed but substantially declined by the latter half of the 2000–2010 decade. Additionally, we find evidence that U.S. census and ACS data miss substantial numbers of children of Mexican immigrants, as well as people who are most likely to be unauthorized: namely, working-aged Mexican immigrants (ages 15–64), especially males. The findings highlight the heterogeneity of the Mexican foreign-born population and the ways in which migration dynamics may affect population coverage. PMID:24570373

A Population-Based Study of Job Stress in Mexican Americans, Non-Hispanic Blacks, and Non-Hispanic Whites

ERIC Educational Resources Information Center

Perez, Norma; Franzini, Luisa; Freeman, Daniel H.; Ju, Hyunsu; Peek, Kristen

2011-01-01

There is little known about the association between socioeconomic status and job stress in Mexican Americans. To address this issue, data were originated on a community level using personal interviews from working Mexican Americans using a multistage probability sample. In this study we described the population's sociodemographic characteristics,…

Characterization of mtDNA haplogroups in 14 Mexican indigenous populations.

PubMed

Peñaloza-Espinosa, Rosenda I; Arenas-Aranda, Diego; Cerda-Flores, Ricardo M; Buentello-Malo, Leonor; González-Valencia, Gerardo; Torres, Javier; Alvarez, Berenice; Mendoza, Irma; Flores, Mario; Sandoval, Lucila; Loeza, Francisco; Ramos, Irma; Muñoz, Leopoldo; Salamanca, Fabio

2007-06-01

In this descriptive study we investigated the genetic structure of 513 Mexican indigenous subjects grouped in 14 populations (Mixteca-Alta, Mixteca-Baja, Otomi, Purépecha, Tzeltal, Tarahumara, Huichol, Nahua-Atocpan, Nahua-Xochimilco, Nahua-Zitlala, Nahua-Chilacachapa, Nahua-Ixhuatlancillo, Nahua-Necoxtla, and Nahua-Coyolillo) based on mtDNA haplogroups. These communities are geographically and culturally isolated; parents and grandparents were born in the community. Our data show that 98.6% of the mtDNA was distributed in haplogroups A1, A2, B1, B2, C1, C2, D1, and D2. Haplotype X6 was present in the Tarahumara (1/53) and Huichol (3/15), and haplotype L was present in the Nahua-Coyolillo (3/38). The first two principal components accounted for 95.9% of the total variation in the sample. The mtDNA haplogroup frequencies in the Purépecha and Zitlala were intermediate to cluster 1 (Otomi, Nahua-Ixhuatlancillo, Nahua-Xochimilco, Mixteca-Baja, and Tzeltal) and cluster 2 (Nahua-Necoxtla, Nahua-Atocpan, and Nahua-Chilacachapa). The Huichol, Tarahumara, Mixteca-Alta, and Nahua-Coyolillo were separated from the rest of the populations. According to these findings, the distribution of mtDNA haplogroups found in Mexican indigenous groups is similar to other Amerindian haplogroups, except for the African haplogroup found in one population.

The 3'UTR 1188A/C polymorphism of IL-12p40 is not associated with susceptibility for developing plaque psoriasis in Mestizo population from western Mexico.

PubMed

Sandoval-Talamantes, Ana Karen; Brito-Luna, Myrian Johanna; Fafutis-Morris, Mary; Villanueva-Quintero, Delfina Guadalupe; Graciano-Machuca, Omar; Ramírez-Dueñas, María Guadalupe; Alvarado-Navarro, Anabell

2015-02-01

Psoriasis is a chronic autoimmune inflammatory disease that affects the skin and the joints. Psoriasis is characterized by the keratinocyte proliferation, which is induced by cytokines Th1 and Th17. Patients with plaque psoriasis present a chronic inflammatory response with high levels of interleukin (IL)-12 and IL-23. Various single-nucleotide polymorphisms (SNP) have been identified in the IL12B gene, such as SNP 3' UTR 1188 A/C (SNP rs3212227), which has been associated with susceptibility to developing plaque psoriasis and with the production of IL-12 and IL-23 in individuals of different ethnic groups. In this study, we determined whether there is an association of SNP rs3212227 with the susceptibility of developing plaque psoriasis and with serum levels of IL-12 and IL-23 in Mestizo population in western Mexico. We included 112 patients with psoriasis and 112 clinical healthy individuals in the study. The frequencies of genotypes A/A, A/C, and C/C in patients with plaque psoriasis were 41, 53, and 6%, respectively, while in the control group, these were 37, 53, and 10%, respectively, without finding statistically significant differences between both groups (p>0.05). Although IL-12 and IL-23 serum levels were higher in patients than in controls, we found no significant differences. The group of patients with genotype CC presented the highest levels of IL-23 (p<0.05). These data suggest that the SNP rs3212227 phenotype is not associated with the risk of developing plaque psoriasis or with IL-12 and IL-23 levels in Mestizo population in western Mexico. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

Lack of Association of the Polymorphisms IL-17A (−197G/A) and IL-17F (+7488A/G) with Multibacillary Leprosy in Mexican Patients

PubMed Central

Escamilla-Tilch, Mónica; Estrada-García, Iris; Granados, Julio; Arenas-Guzmán, Roberto; Ramos-Payan, Rosalio; Pérez-Suárez, Thalía Gabriela; Salazar, Ma. Isabel; Pérez-Lucas, Riky Luis; Estrada-Parra, Sergio; Torres-Carrillo, Nora Magdalena

2014-01-01

Background. Leprosy is a chronic infectious disease caused by the intracellular acid-fast bacilli Mycobacterium leprae; it has been determined that genetic factors of the host play an important role in the disease susceptibility. Thus, in this case-control study, we evaluated the possible association between the IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs and susceptibility to leprosy disease in Mexican population. Methods. Seventy-five leprosy patients and sixty-nine control subjects were included. Both SNPs were genotyped with the polymerase chain reaction-restriction fragment length polymorphism technique. Results. We found nonsignificant differences in genotype and allele frequencies related to IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs in MB as well as subclinical forms of leprosy disease versus healthy individuals. Conclusions. Since the sample size is not large enough, it is difficult to sustain an association of susceptibility to leprosy with genotypes or allele frequencies of IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780), suggesting that IL-17 polymorphisms have no significant role in the genetic susceptibility to development of this disease in the Mexican Mestizo population. PMID:25431761

[Compensated sex: a practice at the heart of young Mexican women's vulnerabilities (STI/HIV/AIDS)].

PubMed

Théodore, Florence Lise; Gutiérrez, Juan Pablo; Torres, Pilar; Luna, Gabriela

2004-01-01

To discuss the risks for Mexican young women who engage in sexual relations in exchange for social or economic benefits, also known as compensated sex (CS), with the objective of exploring its possible public health implications. This is a qualitative study conducted in youths 15 to 25 years of age in Cuernavaca, Morelos, Mexico, between September 2001 and December 2002. The theoretical framework included sociology of knowledge, post-structuralism, and gender studies. Research methods consisted of six focal groups and eight interviews with young subjects identified or self-declared as having practiced CS. To conceal their CS practices as a way to obtain social or economic benefits, young girls disguise it as "courtship" and subject themselves to rules and behaviors that restrain them in terms of condom use and expose them to sexually transmitted infections (STI). Although CS itself may not necessarily constitute a risky practice, the courtship context in which young women tend to develop these practices exposes them to a greater risk of STIs.

A Comparison of PBDE Serum Concentrations in Mexican and Mexican-American Children Living in California

PubMed Central

Fenster, Laura; Castorina, Rosemary; Marks, Amy R.; Sjödin, Andreas; Rosas, Lisa Goldman; Holland, Nina; Guerra, Armando Garcia; Lopez-Carillo, Lizbeth; Bradman, Asa

2011-01-01

Background: Polybrominated diphenyl ethers (PBDE), which are used as flame retardants, have been found to be higher in residents of California than of other parts of the United States. Objectives: We aimed to investigate the role of immigration to California on PBDE levels in Latino children. Methods: We compared serum PBDE concentrations in a population of first-generation Mexican-American 7-year-old children (n = 264), who were born and raised in California [Center for Health Analysis of Mothers and Children of Salinas (CHAMACOS) study], with 5-year-old Mexican children (n = 283), who were raised in the states in Mexico where most CHAMACOS mothers had originated (Proyecto Mariposa). Results: On average, PBDE serum concentrations in the California Mexican-American children were three times higher than their mothers’ levels during pregnancy and seven times higher than concentrations in the children living in Mexico. The PBDE serum concentrations were higher in the Mexican-American children regardless of length of time their mother had resided in California or the duration of the child’s breast-feeding. These data suggest that PBDE serum concentrations in these children resulted primarily from postnatal exposure. Conclusions: Latino children living in California have much higher PBDE serum levels than their Mexican counterparts. Given the growing evidence documenting potential health effects of PBDE exposure, the levels in young children noted in this study potentially present a major public health challenge, especially in California. In addition, as PBDEs are being phased out and replaced by other flame retardants, the health consequences of these chemical replacements should be investigated and weighed against their purported fire safety benefits. PMID:21498147

Breast Cancer Risk Associated with Genotype Polymorphisms of the Aurora Kinase a Gene (AURKA): a Case-Control Study in a High Altitude Ecuadorian Mestizo Population.

PubMed

López-Cortés, Andrés; Cabrera-Andrade, Alejandro; Oña-Cisneros, Fabián; Rosales, Felipe; Ortiz, Malena; Tejera, Eduardo; Paz-Y-Miño, César

2018-07-01

Breast cancer (BC) is the leading cause of cancer related death among women in 2014. The AURKA gene that encodes the protein called Aurora kinase A plays an important role in the progression of the cell cycle, by controlling and promoting the entry into the phase of mitosis. The single nucleotide polymorphism AURKA T91A (rs2273535) (Phe21Ile) has been identified as functional alternator of this kinase, the Ile allele is associated with the occurrence of chromosome segregation errors and tumor progression. Therefore, it is essential to know how BC risk is associated with histopathological characteristics, immunohistochemical characteristics, and genotype polymorphism in a high altitude Ecuadorian mestizo population. In this retrospective case-control study 200 individuals were analyzed. DNA was extracted from 100 healthy and 100 affected women. Genotypes were determined by genomic sequencing. We found significant association between the AURKA T91A (rs2273535) (Phe21Ile) genotype and an increased risk of BC development: Phe/Ile (odds ratio [OR] = 2.6; 95% confidence interval [CI] = 1.4-4.9; P = 0.004), Ile/Ile (OR = 3.8; 95% CI = 1.6-9.0; P = 0.002), and Phe/Ile + Ile/Ile (OR = 2.9; 95% CI = 1.6-5.2; P = 0.001). Additionally, the rs2273535 variant was associated with the tumor grade SBR III (OR = 9.6; 95% CI = 1.0-91.9; P = 0.048) and the Ki-67 ≥ 20 (OR = 16.5; 95% CI = 2.7-101.3; P = 0.002). In brief, this study provides the first evidence where the Ile allele of the AURKA gene could act as potentially predictive biomarker of BC in the high altitude Ecuadorian mestizo population that lives at 2800 m above sea level (masl).

Autoimmune vitiligo in rheumatic disease in the mestizo Mexican population.

PubMed

Avalos-Díaz, Esperanza; Pérez-Pérez, Elena; Rodríguez-Rodríguez, Mayra; Pacheco-Tovar, María-Guadalupe; Herrera-Esparza, Rafael

2016-08-01

Vitiligo is a chronic disease characterized by the dysfunction or destruction of melanocytes with secondary depigmentation. The aim of the present study was to determine the prevalence of vitiligo associated with autoimmune rheumatic diseases. The clinical records from a 10-year database of patients with rheumatic diseases and associated vitiligo was analysed, with one group of patients having autoimmune rheumatic disease and another non-autoimmune rheumatic disease. Available serum samples were used to assess the anti-melanocyte antibodies. A total of 5,251 individual clinical files were archived in the last 10 years, and these patients underwent multiple rheumatology consultations, with 0.3% of the group presenting with vitiligo. The prevalence of vitiligo in the autoimmune rheumatic disease group was 0.672%, which was mainly associated with lupus and arthritis. However, patients with more than one autoimmune disease had an increased relative risk to develop vitiligo, and anti-melanocyte antibodies were positive in 92% of these patients. By contrast, the prevalence was 0.082% in the group that lacked autoimmune rheumatic disease and had negative autoantibodies. In conclusion, the association between vitiligo and autoimmune rheumatic diseases was relatively low. However, the relative risk increased when there were other autoimmune comorbidities, such as thyroiditis or celiac disease. Therefore, the presence of multiple autoimmune syndromes should be suspected.

Overview of the Dietary Intakes of the Mexican Population: Results from the National Health and Nutrition Survey 2012.

PubMed

Rivera, Juan A; Pedraza, Lilia S; Aburto, Tania C; Batis, Carolina; Sánchez-Pimienta, Tania G; González de Cosío, Teresita; López-Olmedo, Nancy; Pedroza-Tobías, Andrea

2016-09-01

Mexico is facing the double burden of malnutrition: stunting and micronutrient deficiencies in young children, iron deficiency in pregnant women, and widespread obesity across age groups. The aim was to summarize and discuss findings published in this supplement on dietary intakes and the eating habits of the Mexican population. A 24-h recall questionnaire that used the multiple-pass method with a repeated measure in a fraction of the sample was applied in a nationally representative sample. We estimated mean intakes and percentages of inadequacy for macronutrients and micronutrients; mean intakes and percentages of the population who adhere to dietary recommendations for food groups; sources of added sugars; intakes of discretionary foods by mealtime, place, and activity; and mean dietary intakes in children <2 y old. Infant formula was consumed by almost half of infants aged <6 mo and sugar-sweetened beverages were consumed by two-thirds of children aged 12-23 mo. In the different age groups, a high proportion of the population had excessive intakes of added sugars (58-85%) and saturated fats (54-92%), whereas a high prevalence of insufficient intakes was found for fiber (65-87%), vitamin A (8-70%), folates (13-69%), calcium (26-88%), and iron (46-89%). Discretionary foods (nonbasic foods high in saturated fats and/or added sugars) contributed 26% of the population's total energy intake, whereas only 1-23% met recommendations for legumes, seafood, fruit, vegetables, and dairy foods. High proportions of Mexicans consume diets that do not meet recommendations. Breastfeeding and complementary feeding diverged from recommendations, intakes of discretionary foods were high, and the prevalence of nutrient inadequacies and age groups not meeting intake recommendations of basic food groups were also high. The results are consistent with the high prevalence of the double burden of malnutrition and are useful to design food and nutrition policies. © 2016 American Society

Population density of the western burrowing owl (Athene cunicularia hypugaea) in Mexican prairie dog (Cynomys mexicanus) colonies in northeastern Mexico.

PubMed

Ruiz Ayma, Gabriel; Olalla Kerstupp, Alina; Macías Duarte, Alberto; Guzmán Velasco, Antonio; González Rojas, José I

2016-08-26

The western burrowing owl (Athene cunicularia hypugaea) occurs throughout western North America in various habitats such as desert, short-grass prairie and shrub-steppe, among others, where the main threat for this species is habitat loss. Range-wide declines have prompted a need for reliable estimates of its populations in Mexico, where the size of resident and migratory populations remain unknown. Our objective was to estimate the abundance and density of breeding western burrowing owl populations in Mexican prairie dog (Cynomys mexicanus) colonies in two sites located within the Chihuahuan Desert ecoregion in the states of Nuevo Leon and San Luis Potosi, Mexico. Line transect surveys were conducted from February to April of 2010 and 2011. Fifty 60 ha transects were analyzed using distance sampling to estimate owl and Mexican prairie dog populations. We estimated a population of 2026 owls (95 % CI 1756-2336) in 2010 and 2015 owls (95 % CI 1573-2317) in 2011 across 50 Mexican prairie dog colonies (20,529 ha). The results represent the first systematic attempt to provide reliable evidence related to the size of the adult owl populations, within the largest and best preserved Mexican prairie dog colonies in Mexico.

Mexican-origin parents' differential treatment and siblings' adjustment from adolescence to young adulthood.

PubMed

Padilla, Jenny; McHale, Susan M; Updegraff, Kimberly A; Umaña-Taylor, Adriana J

2016-12-01

Parents' differential treatment is a common family dynamic that has been linked to youth's well-being in childhood and adolescence in European American families. Much less is known, however, about this family process in other ethnic groups. The authors examined the longitudinal associations between parents' differential treatment (PDT) and both depressive symptoms and risky behaviors of Mexican-origin sibling pairs from early adolescence through young adulthood. They also tested the moderating roles of cultural orientations as well as youth age, gender and sibling dyad gender constellation in these associations. Participants were mothers, fathers, and 2 siblings from 246 Mexican-origin families who participated in individual home interviews on 3 occasions over 8 years. Multilevel models revealed that, controlling for dyadic parent-child relationship qualities (i.e., absolute levels of warmth and conflict), adolescents who had less favorable treatment by mothers relative to their sibling reported more depressive symptoms and risky behavior, on average. Findings for fathers' PDT emerged at the within-person level indicating that, on occasions when adolescents experienced less favorable treatment by fathers than usual, they reported more depressive symptoms and risky behavior. However, some of these effects were moderated by youth age and cultural socialization. For example, adolescents who experienced relatively less paternal warmth than their siblings also reported poorer adjustment, but this effect did not emerge for young adults; such an effect also was significant for unfavored youth with stronger but not weaker cultural orientations. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Higher prepregnancy body mass index is a risk factor for developing preeclampsia in Maya-Mestizo women: a cohort study.

PubMed

Canto-Cetina, Thelma; Coral-Vázquez, Ramón Mauricio; Rojano-Mejía, David; Pérez Godoy, Sergio; Coronel, Agustín; Canto, Patricia

2018-08-01

Preeclampsia and obesity are two closely related syndromes. The high maternal prepregnancy body mass index (BMI) is a risk factor for present preeclampsia, independently of the ethnic background of the studied population. The aim of this study was to analyse in a prospective cohort study the relation between prepregnancy BMI and development of preeclampsia in Maya-Mestizo women. This is a prospective cohort study of 642 pregnant women that were included in the first trimester of the pregnancy (gestational age ≤12 weeks at the first antenatal visit) and all of them were of Maya-Mestizo ethnic origin from the state of Yucatán, México. We assessed the potential risk factors for preeclampsia and documented the prepregnancy BMI (kg/m 2 ) that was based on measured height and maternal self-report of prepregnancy weight at the initial visit. Besides, in the antenatal visit we documented if the pregnant women developed preeclampsia. Of the 642 pregnant Maya-Mestizo women, 49 developed preeclampsia, with an incidence of 7.6% (44.9% had severe and 55% mild). The prepregnancy BMI was higher in women with developed preeclampsia than in those with normal pregnancies. Women with overweight or obesity in comparison with normal weight presented a RR = 2.82 (95% CI: 1.32-6.03; P = 0.008) and RR= 4.22 (95% CI: 2.07-8.61; P = 0.001), respectively. Our findings expand the previous studies to show that the higher prepregnancy BMI is a strong, independent risk factor for preeclampsia.

Fatty acids intake in the Mexican population. Results of the National Nutrition Survey 2006

PubMed Central

2011-01-01

Background There is growing evidence that quality, rather that quantity of fat is the determinant of cardiovascular risk. The objective of the study is to describe quantitatively the intake and adequacy of fatty acid classes among the Mexican population aged 5-90 years from a probabilistic survey. Methods Dietary intake of individual and classes of fatty acids was computed from the dataset of the 2006 Mexican National Health and Nutrition Survey (ENSANUT2006), collected by a food frequency questionnaire. Adequacy was calculated in reference to authoritative recommendations. Results The mean intake of total fatty acids (TFA ≈ 25%E) fell within WHO recommendations; the intakes of saturated fatty acids (SFA) among all age-groups (45-60%) and of trans fatty acids (TrFA) in 30% of school-age children and adolescents and 20% of adults exceeded international recommendations. The mean intake of polyunsaturated fatty acids (PUFA) and particularly of n6 and n3 PUFAS, was inadequately insufficient in 50% of the sample. Conclusions The main public health concerns are the high intake of SFA and the suboptimal intake of PUFA in Mexican population. The TrFA intake represents a low public health risk. PMID:21651771

Biocultural aspects of obesity in young Mexican schoolchildren.

PubMed

Brewis, Alexandra

2003-01-01

Obesity related to over-nutrition is investigated in a sample of 219 Mexican children from affluent families, ages 6-12 years. Defined as weight-for-age at or above the 95(th) percentile, obesity rates in middle childhood are very high in this population, being 24.2% of children (29.4% of boys and 19.1% of girls). Binary logistic regression shows that children are more likely to be obese if they are boys, from small households with few or no other children, and have more permissive, less authoritarian parents. Diet at school and activity patterns, including television viewing, are not different for boys and girls and so do not explain this gender variation. The value placed on children, especially sons, in smaller middle-class families, can result in indulgent feeding because food treats are a cultural index of parental caring. Parents also value child fatness as a sign of health. These obese Mexican children have no greater social problems (peer rejection or stigma) or psychological problems (anxiety, depression, or low self esteem) than their non-obese peers. More study specifically focused on feeding practices in the home environment is required to explain very high rates of child obesity. The differences in obesity risk related to specific aspects of children's developmental microniche emphasize the importance of including a focus on gender as a socio-ecological construct in human biological studies of child growth, development, and nutrition. Copyright 2003 Wiley-Liss, Inc.

Distribution of the IL-1RN, IL-6, IL-10, INF-γ, and TNF-α Gene Polymorphisms in the Mexican Population

PubMed Central

Vargas-Alarcon, Gilberto; Ramírez-Bello, Julián; Juárez-Cedillo, Teresa; Ramírez-Fuentes, Silvestre; Carrillo-Sánchez, Silvia

2012-01-01

Background: Cytokines are a group of polypeptides with an important role in the inflammatory response. It has been suggested that certain polymorphisms located in several cytokine genes are associated with different diseases. The aim of the present study was to establish the gene frequency of 13 polymorphisms of the IL-1RN, IL-6, IL-10, INF-γ, and TNF-α genes in a Mexican population. These polymorphisms have been reported in several populations, with important variation in frequency according to the studied population. Methods: Thirteen polymorphisms (rs419598, rs315951, rs2234663, rs3811058, rs1800796, rs2069827, rs1800896, rs1800871, rs1800872, rs1800629, rs2069709, rs2069710, and rs361525) were analyzed by 5′ exonuclease TaqMan genotyping assays in a group of 248 healthy unrelated Mexican individuals. Results: The results obtained showed that the studied Mexican population presents significant differences (p<0.05) in the distribution of the IL1RN (rs419598, rs315951, and and rs2234663), IL1F10 (rs3811058), IL6 (rs1800796, rs2069827), IL10 (rs1800896, rs1800871, and rs1800872), and TNF-α (rs1800629) polymorphisms when compared to Caucasian, Asian, and African populations. Conclusions: In summary, the distribution of the IL-1RN, IL-6, IL-10, and TNF-α cytokine gene polymorphisms distinguishes the studied Mexican population from other groups. Since the alleles of these cytokines are associated with the development of several inflammatory diseases, knowledge of the distribution of these alleles in the studied Mexican population could be helpful to understand their true role as a genetic susceptibility marker in this population. PMID:22971140

Distribution of the IL-1RN, IL-6, IL-10, INF-γ, and TNF-α Gene Polymorphisms in the Mexican Population.

PubMed

Vargas-Alarcon, Gilberto; Ramírez-Bello, Julián; Juárez-Cedillo, Teresa; Ramírez-Fuentes, Silvestre; Carrillo-Sánchez, Silvia; Fragoso, José Manuel

2012-10-01

Cytokines are a group of polypeptides with an important role in the inflammatory response. It has been suggested that certain polymorphisms located in several cytokine genes are associated with different diseases. The aim of the present study was to establish the gene frequency of 13 polymorphisms of the IL-1RN, IL-6, IL-10, INF-γ, and TNF-α genes in a Mexican population. These polymorphisms have been reported in several populations, with important variation in frequency according to the studied population. Thirteen polymorphisms (rs419598, rs315951, rs2234663, rs3811058, rs1800796, rs2069827, rs1800896, rs1800871, rs1800872, rs1800629, rs2069709, rs2069710, and rs361525) were analyzed by 5' exonuclease TaqMan genotyping assays in a group of 248 healthy unrelated Mexican individuals. The results obtained showed that the studied Mexican population presents significant differences (p<0.05) in the distribution of the IL1RN (rs419598, rs315951, and and rs2234663), IL1F10 (rs3811058), IL6 (rs1800796, rs2069827), IL10 (rs1800896, rs1800871, and rs1800872), and TNF-α (rs1800629) polymorphisms when compared to Caucasian, Asian, and African populations. In summary, the distribution of the IL-1RN, IL-6, IL-10, and TNF-α cytokine gene polymorphisms distinguishes the studied Mexican population from other groups. Since the alleles of these cytokines are associated with the development of several inflammatory diseases, knowledge of the distribution of these alleles in the studied Mexican population could be helpful to understand their true role as a genetic susceptibility marker in this population.

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components

PubMed Central

Martínez-Hernández, Angélica; Córdova, Emilio J.; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals. PMID:25933176

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components.

PubMed

Martínez-Hernández, Angélica; Córdova, Emilio J; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals.

Another Mexican birthweight paradox? The role of residential enclaves and neighborhood poverty in the birthweight of Mexican-origin infants.

PubMed

Osypuk, Theresa L; Bates, Lisa M; Acevedo-Garcia, Dolores

2010-02-01

Examining whether contextual factors influence the birth outcomes of Mexican-origin infants in the US may contribute to assessing rival explanations for the so-called Mexican health paradox. We examined whether birthweight among infants born to Mexican-origin women in the US was associated with Mexican residential enclaves and exposure to neighborhood poverty, and whether these associations were modified by nativity (i.e. mother's place of birth). We calculated metropolitan indices of neighborhood exposure to Mexican-origin population and poverty for the Mexican-origin population, and merged with individual-level, year 2000 natality data (n=490,332). We distinguished between neighborhood exposure to US-born Mexican-origin population (i.e. ethnic enclaves) and neighborhood exposure to foreign-born (i.e. Mexico-born) Mexican-origin population (i.e. immigrant enclaves). We used 2-level hierarchical linear regression models adjusting for individual, metropolitan, and regional covariates and stratified by nativity. We found that living in metropolitan areas with high residential segregation of US-born Mexican-origin residents (i.e. high prevalence of ethnic enclaves) was associated with lower birthweight for infants of US-born Mexican-origin mothers before and after covariate adjustment. When simultaneously adjusting for exposure to ethnic and immigrant enclaves, the latter became positively associated with birthweight and the negative effect of the former increased, among US-born mothers. We found no contextual birthweight associations for mothers born in Mexico in adjusted models. Our findings highlight a differential effect of context by nativity, and the potential health effects of ethnic enclaves, which are possibly a marker of downward assimilation, among US-born Mexican-origin women. Copyright 2009 Elsevier Ltd. All rights reserved.

Two Scales for the Measurement of Mexican-American Identity.

ERIC Educational Resources Information Center

Teske, Raymond, Jr.; Nelson, Bardin H.

The development of scales to measure Mexican American identification with their population is discussed in this paper. The scales measure (1) identification with the Mexican American population using attitudinal items (Identity Scale) and (2) interaction behavior with the Mexican American population (Interaction Scale). The sample consisted of all…

Impact of genetic variants of IL-6, IL6R, LRP5, ESR1 and SP7 genes on bone mineral density in postmenopausal Mexican-Mestizo women with obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia

2013-10-10

Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.

Whole Genome Sequence and Phylogenetic Analysis Show Helicobacter pylori Strains from Latin America Have Followed a Unique Evolution Pathway

PubMed Central

Muñoz-Ramírez, Zilia Y.; Mendez-Tenorio, Alfonso; Kato, Ikuko; Bravo, Maria M.; Rizzato, Cosmeri; Thorell, Kaisa; Torres, Roberto; Aviles-Jimenez, Francisco; Camorlinga, Margarita; Canzian, Federico; Torres, Javier

2017-01-01

Helicobacter pylori (HP) genetics may determine its clinical outcomes. Despite high prevalence of HP infection in Latin America (LA), there have been no phylogenetic studies in the region. We aimed to understand the structure of HP populations in LA mestizo individuals, where gastric cancer incidence remains high. The genome of 107 HP strains from Mexico, Nicaragua and Colombia were analyzed with 59 publicly available worldwide genomes. To study bacterial relationship on whole genome level we propose a virtual hybridization technique using thousands of high-entropy 13 bp DNA probes to generate fingerprints. Phylogenetic virtual genome fingerprint (VGF) was compared with Multi Locus Sequence Analysis (MLST) and with phylogenetic analyses of cagPAI virulence island sequences. With MLST some Nicaraguan and Mexican strains clustered close to Africa isolates, whereas European isolates were spread without clustering and intermingled with LA isolates. VGF analysis resulted in increased resolution of populations, separating European from LA strains. Furthermore, clusters with exclusively Colombian, Mexican, or Nicaraguan strains were observed, where the Colombian cluster separated from Europe, Asia, and Africa, while Nicaraguan and Mexican clades grouped close to Africa. In addition, a mixed large LA cluster including Mexican, Colombian, Nicaraguan, Peruvian, and Salvadorian strains was observed; all LA clusters separated from the Amerind clade. With cagPAI sequence analyses LA clades clearly separated from Europe, Asia and Amerind, and Colombian strains formed a single cluster. A NeighborNet analyses suggested frequent and recent recombination events particularly among LA strains. Results suggests that in the new world, H. pylori has evolved to fit mestizo LA populations, already 500 years after the Spanish colonization. This co-adaption may account for regional variability in gastric cancer risk. PMID:28293542

Differences in lipid profiles in two Hispanic ischemic stroke populations.

PubMed

Arauz, A; Romano, J G; Ruiz-Franco, A; Shang, T; Dong, C; Rundek, T; Koch, S; Hernández-Curiel, B; Pacheco, J; Rojas, P; Ruiz-Navarro, F; Katsnelson, M; Sacco, R L

2014-06-01

The study aims to compare lipid profiles among ischemic stroke patients in a predominantly Caribbean-Hispanic population in Miami and a Mestizo Hispanic population in Mexico City. We analyzed ischemic stroke Hispanic patients with complete baseline fasting lipid profile enrolled contemporaneously in the prospective registries of two tertiary care teaching hospitals in Mexico City and Miami. Demographic characteristics, risk factors, medications, ischemic stroke subtype, and first fasting lipid profile were compared. Vascular risk factor definitions were standardized. Multiple linear regression analysis was performed to compare lipid fractions. A total of 324 patients from Mexico and 236 from Miami were analyzed. Mexicans were significantly younger (58 · 1 vs. 67 · 4 years), had a lower frequency of hypertension (53 · 4% vs. 79 · 7%), and lower body mass index (27 vs. 28 · 5). There was a trend toward greater prevalence of diabetes in Mexicans (31 · 5 vs. 24 · 6%, P = 0 · 07). Statin use at the time of ischemic stroke was more common in Miami Hispanics (18 · 6 vs. 9 · 4%). Mexicans had lower total cholesterol levels (169 · 9 ± 46 · 1 vs. 179 · 9 ± 48 · 4 mg/dl), lower low-density lipoprotein (92 · 3 ± 37 · 1 vs. 108 · 2 ± 40 · 8 mg/dl), and higher triglyceride levels (166 · 9 ± 123 · 9 vs. 149 · 2 ± 115 · 2 mg/dl). These differences remained significant after adjusting for age, gender, hypertension, diabetes, body mass index, smoking, ischemic stroke subtype, and statin use. We found significant differences in lipid fractions in Hispanic ischemic stroke patients, with lower total cholesterol and low-density lipoprotein, and higher triglyceride levels in Mexicans. These findings highlight the heterogeneity of dyslipidemia among the Hispanic race-ethnic group and may lead to different secondary prevention strategies. © 2013 The Authors. International Journal of Stroke © 2013 World Stroke Organization.

Plasma triglyceride/HDL-cholesterol ratio, insulin resistance, and cardiometabolic risk in young adults

PubMed Central

Murguía-Romero, Miguel; Jiménez-Flores, J. Rafael; Sigrist-Flores, Santiago C.; Espinoza-Camacho, Miguel A.; Jiménez-Morales, Mayra; Piña, Enrique; Méndez-Cruz, A. René; Villalobos-Molina, Rafael; Reaven, Gerald M.

2013-01-01

Studies in mature adults suggest that the plasma concentration ratio of triglyceride (TG)/HDL-cholesterol (HDL-C) provides a simple way to identify apparently healthy individuals who are insulin resistant (IR) and at increased cardiometabolic risk. This study extends these observations by examining the clinical utility of the TG/HDL-C ratio and the metabolic syndrome (MetS) in 2,244 healthy college students (17–24 years old) of Mexican Mestizo ancestry. The TG/HDL-C ratio separating the 25% with the highest value was used to identify IR and increased cardiometabolic risk. Cardiometabolic risk factors were more adverse in men and women whose TG/HDL-C ratios exceeded 3.5 and 2.5, respectively, and approximately one third were identified as being IR. The MetS identified fewer individuals as being IR, but their risk profile was accentuated. In conclusion, both a higher TG/HDL-C ratio and a diagnosis of the MetS identify young IR individuals with an increased cardiometabolic risk profile. The TG/HDL-C ratio identified a somewhat greater number of “high risk” subjects, whereas the MetS found a group whose risk profile was somewhat magnified. These findings suggest that the TG/HDL-C ratio may serve as a simple and clinically useful approach to identify apparently healthy, young individuals who are IR and at increased cardiometabolic risk. PMID:23863983

What Can We Learn from the Study of Mexican-Origin Families in the U.S.?

PubMed Central

Updegraff, Kimberly A.; Umaña-Taylor, Adriana J.

2015-01-01

Mexican-origin families are a large and rapidly increasing subgroup of the U.S. population, but they remain underrepresented in family scholarship. This paper introduces a special section of four papers on Mexican-origin families designed to contribute to the advancement of research on how cultural, family, and gender socialization processes unfold across key developmental periods and life transitions in this cultural context. Two longitudinal studies of Mexican-origin families provided the data for these four papers: (a) The Juntos Project, an eight-year longitudinal study of mothers, fathers, and adolescent sibling pairs in 246 Mexican-origin families; and (b) The Supporting MAMI Project, a study following 204 adolescent mothers and their mother figures from the third trimester of pregnancy through their young children's 5th birthdays. In this introductory paper we highlight four themes, including (a) differential acculturation and reciprocal socialization, (b) interdependence in families, (c) the intersection of culture and gender, and (d) methodological issues, then offer suggestions for future research. PMID:25675994

Forensic parameters of the Investigator DIPplex kit (Qiagen) in six Mexican populations.

PubMed

Martínez-Cortés, G; García-Aceves, M; Favela-Mendoza, A F; Muñoz-Valle, J F; Velarde-Felix, J S; Rangel-Villalobos, H

2016-05-01

Allele frequencies and statistical parameters of forensic efficiency for 30 deletion-insertion polymorphisms (DIPs) were estimated in six Mexican populations. For this purpose, 421 unrelated individuals were analyzed with the Investigator DIPplex kit. The Hardy-Weinberg and linkage equilibrium was demonstrated for this 30-plex system in all six populations. We estimated the combined power of discrimination (PD ≥ 99.999999%) and combined power of exclusion (PE ≥ 98.632705%) for this genetic system. A low but significant genetic structure was demonstrated among these six populations by pairwise comparisons and AMOVA (F ST ≥ 0.7054; p ≤ 0.0007), which allows clustering populations in agreement with geographical criteria: Northwest, Center, and Southeast.

Risk Behaviors Among Young Mexican American Gang-Associated Females: Sexual Relations, Partying, Substance Use, and Crime

PubMed Central

Cepeda, Alice; Valdez, Avelardo

2010-01-01

This research focuses on young Mexican American girls who are not formal gang members yet participate in street-based activities of male gangs and engage in risk behaviors. These females comprise a larger proportion associated with male gangs in inner-city neighborhoods than actual female gang members. Using a qualitative design, the article presents a typology of Mexican American females that reveals a hierarchy based on exposure to four risk-related activities: sexual relations, partying, substance use, and crime. Findings illustrate how outcomes associated with these activities vary according to the girl’s relationship to the male gang and status within the community. Also, regardless of their relationship to the gang, participation in these activities resulted in different degrees of negative outcomes. The study concludes that problems associated with these females must go beyond being viewed as individual problems but rather seen within the social, cultural, and economic conditions of their environment. PMID:21218177

The socio-political context of migration and reproductive health disparities: The case of early sexual initiation among Mexican-origin immigrant young women

PubMed Central

Coleman-Minahan, Kate

2017-01-01

Prior research often explains the lower risk of early sexual initiation among foreign-born Mexican-origin young women by a patriarchal and sexually conservative “traditional Latino culture.” This definition overlooks structural factors such as exploitation of migrant workers, and conflates gender inequality and sexual expectations. I use an intersectional framework and the theory of gender and power to explore how gender inequality and sexual expectations are both influenced by structural factors and affect reproductive health outcomes. I integrate data from qualitative interviews with 21 first and second generation Mexican-origin women in 2013–2014 with data from discrete time hazard models with 798 Mexican-origin young women in the National Longitudinal Study of Adolescent to Adult Health. Qualitative results demonstrate that gender inequality and sexual expectations in Mexican-origin immigrant households are associated with structural factors. Gender inequality occurs more often in households with family instability, greater poverty, and among parents who migrated independently. Qualitative data also demonstrate that parental gendered expectations are sometimes at odds to what parents are actually doing in the household. Finally, contrary to assumptions that a patriarchal “traditional Latino culture” protects against early sexual initiation, qualitative and multivariate quantitative data suggest that household gender inequality increases risk of early sexual initiation. These findings challenge the utility of a culturalist approach that views culture as determining behavior to explain health disparities among immigrants and demonstrate the need to incorporate an intersectional framework that includes structural factors. This approach may reduce stereotypes and identify meaningful interventions to reduce reproductive health disparities. PMID:28324794

AIP mutations in young patients with acromegaly and the Tampico Giant: the Mexican experience.

PubMed

Ramírez-Rentería, Claudia; Hernández-Ramírez, Laura C; Portocarrero-Ortiz, Lesly; Vargas, Guadalupe; Melgar, Virgilio; Espinosa, Etual; Espinosa-de-Los-Monteros, Ana Laura; Sosa, Ernesto; González, Baldomero; Zúñiga, Sergio; Unterländer, Martina; Burger, Joachim; Stals, Karen; Bussell, Anne-Marie; Ellard, Sian; Dang, Mary; Iacovazzo, Donato; Kapur, Sonal; Gabrovska, Plamena; Radian, Serban; Roncaroli, Federico; Korbonits, Márta; Mercado, Moisés

2016-08-01

Although aryl hydrocarbon receptor-interacting protein (AIP) mutations are rare in sporadic acromegaly, their prevalence among young patients is nonnegligible. The objectives of this study were to evaluate the frequency of AIP mutations in a cohort of Mexican patients with acromegaly with disease onset before the age of 30 and to search for molecular abnormalities in the AIP gene in teeth obtained from the "Tampico Giant". Peripheral blood DNA from 71 patients with acromegaly (51 females) with disease onset <30 years was analysed (median age of disease onset of 23 years) and correlated with clinical, biochemical and imaging characteristics. Sequencing was also carried out in DNA extracted from teeth of the Tampico Giant. Five patients (7 %) harboured heterozygous, germline mutations of the AIP gene. In two of them (a 9-year-old girl with gigantism and a young man with symptoms of GH excess since age 14) the c.910C>T (p.Arg304Ter), well-known truncating mutation was identified; in one of these two cases and her identical twin sister, the mutation proved to be a de novo event, since neither of their parents were found to be carriers. In the remaining three patients, new mutations were identified: a frameshift mutation (c.976_977insC, p.Gly326AfsTer), an in-frame deletion (c.872_877del, p.Val291_Leu292del) and a nonsense mutation (c.868A > T, p.Lys290Ter), which are predicted to be pathogenic based on in silico analysis. Patients with AIP mutations tended to have an earlier onset of acromegaly and harboured larger and more invasive tumours. A previously described genetic variant of unknown significance (c.869C > T, p.Ala299Val) was identified in DNA from the Tampico Giant. The prevalence of AIP mutations in young Mexican patients with acromegaly is similar to that of European cohorts. Our results support the need for genetic evaluation of patients with early onset acromegaly.

Hepatitis B virus infection in Latin America: A genomic medicine approach

PubMed Central

Roman, Sonia; Jose-Abrego, Alexis; Fierro, Nora Alma; Escobedo-Melendez, Griselda; Ojeda-Granados, Claudia; Martinez-Lopez, Erika; Panduro, Arturo

2014-01-01

Hepatitis B virus (HBV) infection is the leading cause of severe chronic liver disease. This article provides a critical view of the importance of genomic medicine for the study of HBV infection and its clinical outcomes in Latin America. Three levels of evolutionary adaptation may correlate with the clinical outcomes of HBV infection. Infections in Latin America are predominantly of genotype H in Mexico and genotype F in Central and South America; these strains have historically circulated among the indigenous population. Both genotypes appear to be linked to a benign course of disease among the native and mestizo Mexicans and native South Americans. In contrast, genotypes F, A and D are common in acute and chronic infections among mestizos with Caucasian ancestry. Hepatocellular carcinoma is rare in Mexicans, but it has been associated with genotype F1b among Argentineans. This observation illustrates the significance of ascertaining the genetic and environmental factors involved in the development of HBV-related liver disease in Latin America, which contrast with those reported in other regions of the world. PMID:24966588

Recruitment Strategies and Costs Associated with Community-Based Research in a Mexican-Origin Population

ERIC Educational Resources Information Center

Mendez-Luck, Carolyn A.; Trejo, Laura; Miranda, Jeanne; Jimenez, Elizabeth; Quiter, Elaine S.; Mangione, Carol M.

2011-01-01

Purpose: We describe the recruitment strategies and personnel and materials costs associated with two community-based research studies in a Mexican-origin population. We also highlight the role that academic-community partnerships played in the outreach and recruitment process for our studies. We reviewed study documents using case study…

Arsenic exposure and risk of preeclampsia in a Mexican mestizo population.

PubMed

Sandoval-Carrillo, Ada; Méndez-Hernández, Edna M; Antuna-Salcido, Elizabeth I; Salas-Pacheco, Sergio M; Vázquez-Alaniz, Fernando; Téllez-Valencia, Alfredo; Aguilar-Durán, Marisela; Barraza-Salas, Marcelo; Castellanos-Juárez, Francisco X; La Llave-León, Osmel; Salas-Pacheco, José M

2016-07-11

Exposure to arsenic in drinking water has been associated with various complications of pregnancy including fetal loss, low birth weight, anemia, gestational diabetes and spontaneous abortion. However, to date, there are no studies evaluating its possible association with preeclampsia. This case-control study involved 104 preeclamptic and 202 healthy pregnant women. The concentrations of arsenic in drinking water and urine were measured using a Microwave Plasma-Atomic Emission Spectrometer. We found relatively low levels of arsenic in household tap water (range of 2.48-76.02 μg/L) and in the urine of the participants (7.1 μg/L vs 6.78 μg/L in cases and controls, respectively). The analysis between groups showed for the first time that at these lower levels of exposure there is no association with preeclampsia.

Notable Mexican American Women.

ERIC Educational Resources Information Center

Ford, Judith

This paper describes the careers of four notable Mexican American women, including their educational and family backgrounds, achievements, and importance as role models for young Hispanic women. Marie Acosta-Colon's political activism began as a college student volunteering for presidential candidate Eugene McCarthy in 1968. Active in political…

The unauthorized Mexican immigrant population and welfare in Los Angeles County: a comparative statistical analysis.

PubMed

Marcelli, E A; Heer, D M

1998-01-01

"Using a unique 1994 Los Angeles County Household Survey of foreign-born Mexicans and the March 1994 and 1995 Current Population Surveys, we estimate the number of unauthorized Mexican immigrants (UMIs) residing in Los Angeles County, and compare their use of seven welfare programs with that of other non-U.S. citizens and U.S. citizens. Non-U.S. citizens were found to be no more likely than U.S. citizens to have used welfare, and UMIs were 11% (14%) less likely than other non-citizens (U.S.-born citizens).... We demonstrate how results differ depending on the unit of analysis employed, and on which programs constitute ¿welfare'." excerpt

Many Infants and Young Children Are Not Compliant with Mexican and International Complementary Feeding Recommendations for Milk and Other Beverages

PubMed Central

Afeiche, Myriam C.; Villalpando-Carrión, Salvador; Reidy, Kathleen C.; Eldridge, Alison L.

2018-01-01

Mexican and international authorities provide guidelines for milk and beverage consumption for young children. This study classifies beverages as appropriate or inappropriate by age (0–5.9, 6–11.9, and 12–23.9 months) and details consumption patterns, amounts consumed, and the associated socio-demographic characteristics. Analysis of the Mexican National Nutrition and Health Survey (ENSANUT 2012) was conducted (n = 949). Among 0–5.9 month olds, 66.7% consumed either breast milk, infant formula, or a combination with no other beverages, whereas 29.3% consumed breast milk and/or infant formula with water (mean = 58 g/day) and/or other beverages (mean = 115 g/day), such as 100% fruit juice, milk, and sugar-sweetened beverages (SSBs). For infants 6–11.9 months, appropriate beverages include breast milk, infant formula, and water; only 40.2% met these recommendations. Many 6–11.9 month olds consumed age-inappropriate beverages, including milk (31%) and SSBs (35%). After 12 months of age, appropriate beverages include water, milk, and a limited amount of 100% fruit juice and SSBs; 32.4% complied fully, 18.3% consumed appropriate and inappropriate beverages, and 49.3% consumed only inappropriate beverages. Among 12–23.9 month olds, 58% consumed milk, 18% juice, and 42% water while 63% consumed SSBs. Many infants and young children are not compliant with Mexican and international breastfeeding and complementary feeding guidelines for beverages. Communication and guidance about age-appropriate beverages should be improved. PMID:29642599

Abdominal Obesity, Race and Chronic Kidney Disease in Young Adults: Results from NHANES 1999-2010

PubMed Central

Sarathy, Harini; Henriquez, Gabriela; Abramowitz, Matthew K.; Kramer, Holly; Rosas, Sylvia E.; Johns, Tanya; Kumar, Juhi; Skversky, Amy; Kaskel, Frederick; Melamed, Michal L.

2016-01-01

Objective Kidney dysfunction in obesity may be independent of and may precede the development of hypertension and/or diabetes mellitus. We aimed to examine if abdominal obesity is associated with early markers of CKD in a young healthy population and whether these associations differ by race and/or ethnicity. Methods We analyzed data from the NHANES 1999–2010 for 6918 young adults ages 20–40 years. Abdominal obesity was defined by gender criteria of waist circumference. CKD markers included estimated glomerular filtration rate and albuminuria ≥30 mg/g. Race stratified analyses were done overall and in subgroups with normal blood pressures, normoglycemia and normal insulin sensitivity. Awareness of CKD was assessed in participants with albuminuria. Results Abdominal obesity was present in over one-third of all young adults and was more prevalent among non-Hispanic blacks (45.4%) versus Mexican-Americans (40.6%) or non-Hispanic whites (37.4%) (P-value = 0.004). Mexican-American young adults with abdominal obesity had a higher odds of albuminuria even among those with normal blood pressure, normal glucose, and normal insulin sensitivity [adjusted odds ratio 4.5; 95% confidence interval (1.6–12.2), p = 0.004]. Less than 5% of young adults with albuminuria of all races and ethnicities had been told they had kidney disease. Conclusion Abdominal obesity in young adults, especially in Mexican-Americans, is independently associated with albuminuria even with normal blood pressures, normoglycemia and normal insulin levels. Greater awareness of CKD is needed to protect this young population from long-standing exposure to abdominal obesity and early progressive renal disease. PMID:27224643

What can we learn from the study of Mexican-origin families in the United States?

PubMed

Updegraff, Kimberly A; Umaña-Taylor, Adriana J

2015-06-01

Mexican-origin families are a large and rapidly increasing subgroup of the U.S. population, but they remain underrepresented in family scholarship. This paper introduces a special section of four papers on Mexican-origin families designed to contribute to the advancement of research on how cultural, family, and gender socialization processes unfold across key developmental periods and life transitions in this cultural context. Two longitudinal studies of Mexican-origin families provided the data for these four papers: (a) The Juntos Project, an 8-year longitudinal study of mothers, fathers, and adolescent sibling pairs in 246 Mexican-origin families; and (b) The Supporting MAMI Project, a study following 204 adolescent mothers and their mother figures from the third trimester of pregnancy through their young children's 5th birthdays. In this introductory paper, we highlight four themes, including (a) differential acculturation and reciprocal socialization, (b) interdependence in families, (c) the intersection of culture and gender, and (d) methodological issues. We end with suggestions for future research. © 2015 Family Process Institute.

Romantic Relationship Experiences from Late Adolescence to Young Adulthood: The Role of Older Siblings in Mexican-Origin Families

PubMed Central

Wheeler, Lorey A.; Killoren, Sarah E.; Whiteman, Shawn D.; Updegraff, Kimberly A.; McHale, Susan M.; Umaña-Taylor, Adriana J.

2016-01-01

Youth's experiences with romantic relationships during adolescence and young adulthood have far reaching implications for future relationships, health, and well-being; yet, although scholars have examined potential peer and parent influences, we know little about the role of siblings in youth's romantic relationships. Accordingly, this study examined the prospective longitudinal links between Mexican-origin older and younger siblings' romantic relationship experiences and variation by sibling structural and relationship characteristics (i.e., sibling age and gender similarity, younger siblings' modeling) and cultural values (i.e., younger siblings' familism values). Data from 246 Mexican-origin families with older (M = 20.65 years; SD = 1.57; 50% female) and younger (M = 17.72 years; SD = .57; 51% female) siblings were used to examine the likelihood of younger siblings' involvement in dating relationships, sexual relations, cohabitation, and engagement/marriage with probit path analyses. Findings revealed older siblings' reports of involvement in a dating relationship, cohabitation, and engagement/marriage predicted younger siblings' relationship experiences over a two-year period. These links were moderated by sibling age spacing, younger siblings' reports of modeling and familism values. Our findings suggest the significance of social learning dynamics as well as relational and cultural contexts in understanding the links between older and younger siblings' romantic relationship experiences among Mexican-origin youth. PMID:26590830

Prevalence of peripheral arterial disease and related risk factors in an urban Mexican population.

PubMed

Buitrón-Granados, Luisa Virginia; Martínez-López, Carlos; Escobedo-de la Peña, Jorge

2004-01-01

Peripheral arterial disease (PAD) is a growing and often underdiagnosed health problem that predicts cardiovascular events and mortality. Estimating its prevalence in the general population is a major issue for assessing health needs and planning health services. The aim of this study was to determine the prevalence of PAD and its risk factors in an urban Mexican population. A random sample of 400 adult subjects was selected from a Family Medical Unit of the Mexican Institute of the Social Security. Clinical examination was performed and a questionnaire was applied to all subjects. After an overnight fast, serum glucose, triglyceride, and cholesterol concentrations were measured. Blood pressure was taken and the ankle-brachial index (ABI) was calculated by Doppler examination in both sides. PAD was diagnosed if one of the ABIs was less than 0.90. Prevalence was estimated with 95% confidence intervals (CI95%), and odds ratios (OR) with CI95% were obtained to assess association with some atherogenic risk factors in a multiple logistic regression analysis. The prevalence of PAD was 10.0% (CI95%, 7.24%-13.37%), and it was higher in men. Most subjects with PAD had no signs or symptoms, although the presence of either signs or symptoms was more frequent in subjects with PAD. The main risk factors related to PAD were serum triglycerides > or = 150 mg/dL (OR 2.25; CI95% 1.0-5.1), heavy smoking (OR 2.5; CI95% 0.9-6.7) and a history of diabetes mellitus for longer than 7 years (OR 1.9; CI95% 0.6-5.8). The prevalence of PAD is high in this Mexican urban population. Asymptomatic PAD may be highly frequent, and low-cost, noninvasive Doppler ultrasonography should be considered as an adequate screening procedure in primary care to detect individuals at high risk for major cardiovascular events.

Optimizing conservation strategies for Mexican freetailed bats: a population viability and ecosystem services approach

USGS Publications Warehouse

Wiederholt, Ruscena; Lopez-Hoffman, Laura; Svancara, Colleen; McCracken, Gary; Thogmartin, Wayne E.; Diffendorfer, James E.; Mattson, Brady; Bagstad, Kenneth J.; Cryan, Paul; Russell, Amy; Semmens, Darius J.; Rodrigo A. Medellín,

2015-01-01

Conservation planning can be challenging due to the need to balance biological concerns about population viability with social concerns about the benefits biodiversity provide to society, often while operating under a limited budget. Methods and tools that help prioritize conservation actions are critical for the management of at-risk species. Here, we use a multi-attribute utility function to assess the optimal maternity roosts to conserve for maintaining the population viability and the ecosystem services of a single species, the Mexican free-tailed bat (Tadarida brasiliensis mexicana). Mexican free-tailed bats provide ecosystem services such as insect pest-suppression in agricultural areas and recreational viewing opportunities, and may be threatened by climate change and development of wind energy. We evaluated each roost based on five attributes: the maternity roost’s contribution to population viability, the pest suppression ecosystem services to the surrounding area provided by the bats residing in the roost, the ecotourism value of the roost, the risks posed to each roost structure, and the risks posed to the population of bats residing in each roost. We compared several scenarios that prioritized these attributes differently, hypothesizing that the set of roosts with the highest rankings would vary according to the conservation scenario. Our results indicate that placing higher values on different roost attributes (e.g. population importance over ecosystem service value) altered the roost rankings. We determined that the values placed on various conservation objectives are an important determinant of habitat planning.

Bilingual "Educación" in the Home: Everyday Mexican Immigrant Family Educational Practices

ERIC Educational Resources Information Center

Valdez, Verónica

2015-01-01

As we embrace the increasing numbers of young Mexican immigrant children and their families present in our schools, it is important for educators to better understand the many family educational practices present in these households. This article examines the strategies and resources utilized by two Mexican-born and two U.S.-born Mexican immigrant…

Loneliness among very old Mexican Americans: findings from the Hispanic Established Populations Epidemiologic Studies of the Elderly.

PubMed

Gerst-Emerson, Kerstin; Shovali, Tamar E; Markides, Kyriakos S

2014-01-01

Increasing numbers of researchers are finding that loneliness is a significant risk factor for morbidity and mortality, and several variables have been found to be closely related to the experience of loneliness among elders. However, much of the research has focused on the general older population, with no research to date focusing on minority populations. The objective of this study was to determine the prevalence and the correlates of loneliness among a community-dwelling older Mexican American population. This study used a three-item loneliness scale to determine the prevalence of loneliness. Pearson's correlation and linear regression analyses were used to determine the cross-sectional association between sociodemographic, interpersonal relationship and health variables with the scale. Data used came from the most recent wave (2011) of the Hispanic Established Populations for the Epidemiological Study of the Elderly (H-EPESE). A total of 873 Mexican Americans completed the loneliness scale. The age range was from 80 to 102, with a majority (65%) female. The mean score on the scale was 4.05 (range 3-9), indicating relatively low levels of loneliness. Regression results indicate that depressive symptoms, cognitive status, and living alone were significantly associated with higher loneliness scores. Being married and having a confidante were significantly associated with lower loneliness. Age, number of close relatives and frequency of contact were not associated with loneliness. Findings suggest that among community-dwelling Mexican American older adults, loneliness has multiple determinants. Loneliness is a significant public health topic and clinicians should be aware of the various factors that can affect loneliness. Published by Elsevier Ireland Ltd.

Loneliness among very old Mexican Americans: Findings from the Hispanic established populations epidemiologic studies of the elderly

PubMed Central

Gerst-Emerson, Kerstin; Shovali, Tamar E.; Markides, Kyriakos S.

2015-01-01

Increasing numbers of researchers are finding that loneliness is a significant risk factor for morbidity and mortality, and several of variables have been found to be closely related to the experience of loneliness among elders. However, much of the research has focused on the general older population, with no research to date focusing on minority populations. The objective of this study was to determine the prevalence and the correlates of loneliness among a community-dwelling older Mexican American population. This study used a three-item loneliness scale to determine prevalence of loneliness. Pearson’s correlation and linear regression analyses were used to determine the cross-sectional association between sociodemographic, interpersonal relationship and health variables with the scale. Data used came from the most recent wave (2011) of the Hispanic Established Populations for the Epidemiologic Studies of the Elderly (H-EPESE). A total of 873 Mexican Americans completed the loneliness scale. The age range was from 80 to 102, with a majority (65%) female. The mean score on the scale was 4.05 (range 3–9), indicating relatively low levels of loneliness. Regression results indicate that depressive symptoms, cognitive status, and living alone were significantly associated with higher loneliness scores. Being married and having a confidante were significantly associated with lower loneliness. Age, number of close relatives and frequency of contact were not associated with loneliness. Findings suggest that among community-dwelling Mexican American older adults, loneliness has multiple determinants. Loneliness is a significant public health topic and clinicians should be aware of the various factors that can affect loneliness. PMID:24582944

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary

PubMed Central

Pons-Estel, Guillermo J.; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K.; Pons-Estel, Bernardo A.; Alarcón-Riquelme, Marta; Alarcón, Graciela S.

2016-01-01

Objective. To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Methods. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student’s t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. Results. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. Conclusion. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. PMID:26412809

Exploring Differences in Adiposity in Two US Hispanic Populations of Mexican Origin Using Social, Behavioral, Physiologic and Genetic Markers: The IRAS Family Study

PubMed Central

Young, Kendra A.; Fingerlin, Tasha E.; Langefeld, Carl D.; Lorenzo, Carlos; Haffner, Steven M.; Wagenknecht, Lynne E.; Norris, Jill M.

2014-01-01

Objective The census classification of Hispanic origin is used in epidemiological studies to group individuals, even though there is geographical, cultural, and genetic diversity within Hispanic Americans of purportedly similar backgrounds. We observed differences in our measures of adiposity between our two Mexican American populations, and examined whether these differences were attributed to social, behavioral, physiologic or genetic differences between the two populations. Research Design and Methods In the IRAS Family Study, we examined 478 Hispanics from San Antonio, Texas and 447 Hispanics from the San Luis Valley, Colorado. Associations with body mass index (BMI), visceral adipose tissue area (VAT), and subcutaneous adipose tissue area (SAT) using social, behavioral, physiologic and genetic variables were examined. Results Hispanics of Mexican origin in our clinic population in San Antonio had significantly higher mean BMI (31.09 vs 28.35 kg/m2), VAT (126.3 vs 105.5 cm2), and SAT (391.6 vs 336.9 cm2), than Hispanics of Mexican origin in the San Luis Valley. The amount of variation in adiposity explained by clinic population was 4.5% for BMI, 2.8% for VAT, and 2.7% for SAT. After adjustment, clinic population was no longer associated with VAT and SAT, but remained associated with BMI, although the amount of variation explained by population was substantially less (1.0% for BMI). Conclusion Adiposity differences within this population of Mexican origin can be largely explained by social, behavioral, physiologic and genetic differences. (Ethn Dis. 2012;22(1):65–71) PMID:22774311

Exploring differences in adiposity in two U.S. Hispanic populations of Mexican origin using social, behavioral, physiologic and genetic markers: the IRAS Family Study.

PubMed

Young, Kendra A; Fingerlin, Tasha E; Langefeld, Carl D; Lorenzo, Carlos; Haffner, Steven M; Wagenknecht, Lynne E; Norris, Jill M

2012-01-01

The census classification of Hispanic origin is used in epidemiological studies to group individuals, even though there is geographical, cultural, and genetic diversity within Hispanic Americans of purportedly similar backgrounds. We observed differences in our measures of adiposity between our two Mexican American populations, and examined whether these differences were attributed to social, behavioral, physiologic or genetic differences between the two populations. In the IRAS Family Study, we examined 478 Hispanics from San Antonio, Texas and 447 Hispanics from the San Luis Valley, Colorado. Associations with body mass index (BMI), visceral adipose tissue area (VAT), and subcutaneous adipose tissue area (SAT) using social, behavioral, physiologic and genetic variables were examined. Hispanics of Mexican origin in our clinic population in San Antonio had significantly higher mean BMI (31.09 vs. 28.35 kg/m2), VAT (126.3 vs. 105.5 cm2), and SAT (391.6 vs. 336.9 cm2), than Hispanics of Mexican origin in the San Luis Valley. The amount of variation in adiposity explained by clinic population was 4.5% for BMI, 2.8% for VAT, and 2.7% for SAT. After adjustment, clinic population was no longer associated with VAT and SAT, but remained associated with BMI, although the amount of variation explained by population was substantially less (1.0% for BMI). Adiposity differences within this population of Mexican origin can be largely explained by social, behavioral, physiologic and genetic differences.

Health care utilization in the elderly Mexican population: expenditures and determinants.

PubMed

González-González, César; Sánchez-García, Sergio; Juárez-Cedillo, Teresa; Rosas-Carrasco, Oscar; Gutiérrez-Robledo, Luis M; García-Peña, Carmen

2011-03-29

Worldwide population aging has been considered one of the most important demographic phenomena, and is frequently referred as a determinant of health costs and expenditures. These costs are an effect either of the aging process itself (social) or because of the increase that comes with older age (individual). To analyze health expenditures and its determinants in a sample of Mexican population, for three dimensions acute morbidity, ambulatory care and hospitalization focusing on different age groups, particularly the elderly. A secondary analysis of the Mexican National Health and Nutrition Survey (ENSANUT), 2006 was conducted. A descriptive analysis was performed to establish a health profile by socio-demographic characteristics. Logistic regression models were estimated to determine the relation between acute morbidity, ambulatory care, hospitalization and age group; to establish the determinants of hospitalization among the population 60 years and older; and to determine hospitalization expenditures by age. Higher proportion of elderly reporting health problems was found. Average expenditures of hospitalization in households were $240.6 am dlls, whereas in households exclusively with elderly the expenditure was $308.9 am dlls, the highest among the considered age groups. The multivariate analysis showed higher probability of being hospitalized among the elderly, but not for risks for acute morbidity and ambulatory care. Among the elderly, older age, being male or living in a city or in a metro area implied a higher probability of hospitalization during the last year, with chronic diseases playing a key role in hospitalization. The conditions associated with age, such as chronic diseases, have higher weight than age itself; therefore, they are responsible for the higher expenditures reported. Conclusions point towards a differentiated use and intensity of health services depending on age. The projected increase in hospitalization and health care needs for this

Sociopolitical context and depressive symptoms in an older Mexican-origin population

NASA Astrophysics Data System (ADS)

Miranda, Patricia Yvonne

A large proportion of older adult Latinos have at least one chronic physical health condition; those same individuals who also exhibit depressive symptoms experience higher mortality rates. Given their projected population growth of 500% by 2050, it is important to disentangle the factors influencing the health status of Latinos aged 65 and older, specifically those who also experience depressive symptoms. Prior studies of depressive symptoms among Latino populations have often failed to consider the role of sociopolitical context---that is, the social, economic, political and historical circumstances that shape an individual's lived experience---and its contribution to understanding within-group differences for health outcomes. This study explores the relationships between sociopolitical context and number of depressive symptoms among an older Mexican-origin population in the U.S., and seeks to disentangle the importance of sociopolitical context from other widely used group stratifications for capturing U.S.-Mexican experiences, including nativity status, length of residence in the U.S., and place of residence during formative years. Study findings do not support rejecting the null hypothesis that there were differences in number of depressive symptoms by nativity status, length of residence in the U.S., or place of residence during formative years. Rather, findings suggest that the interaction of sociopolitical context and the age at which individuals arrive in the U.S. has a significant association with number of depressive symptoms among immigrants. This study takes a novel approach to examine the relationships between sociopolitical context at time of entry in the U.S. and symptoms of depression in later life. The implications of its findings for immigration as well as other social policies are discussed. The significant relationship between the interaction of sociopolitical context during time of entry into the U.S. and age of arrival into the U.S. suggests

Seroprevalence of 13 common pathogens in a rapidly growing U.S. minority population: Mexican Americans from San Antonio, TX

PubMed Central

2011-01-01

Background Infection risks vary among individuals and between populations. Here we present information on the seroprevalence of 13 common infectious agents in a San Antonio-based sample of Mexican Americans. Mexican Americans represent the largest and most rapidly growing minority population in the U.S., and they are also considered a health disparities population. Methods We analyzed 1227 individuals for antibody titer to Chlamydophila pneumoniae, Helicobacter pylori, Toxoplasma gondii, cytomegalovirus, Epstein-Barr virus, herpes simplex virus-1, herpes simplex virus-2 (HSV-2), human herpesvirus-6 (HHV-6), varicella zoster virus (VZV), adenovirus-36, hepatitis A virus, and influenza A and B. Seroprevalence was examined as a function of sex, age, household income, and education. Results Seroprevalence estimates ranged from 9% for T. gondii to 92% for VZV, and were similar in both sexes except for HSV-2, which was more prevalent in women. Many pathogens exhibited a significant seroprevalence change over the examined age range (15-94 years), with 7 pathogens increasing and HHV-6 decreasing with age. Socioeconomic status significantly correlated with serostatus for some pathogens. Conclusions Our findings demonstrate substantial seroprevalence rates of these common infections in this sample of Mexican Americans from San Antonio, Texas that suffers from high rates of chronic diseases including obesity and type-2 diabetes. PMID:22018212

Discretionary Foods Have a High Contribution and Fruit, Vegetables, and Legumes Have a Low Contribution to the Total Energy Intake of the Mexican Population.

PubMed

Aburto, Tania C; Pedraza, Lilia S; Sánchez-Pimienta, Tania G; Batis, Carolina; Rivera, Juan A

2016-09-01

Overweight and obesity prevalences in Mexico are among the highest in the world, with dietary factors being the third-leading category of risk contributing to the burden of disease. Consequently, studying the compliance of the Mexican population to food-based dietary recommendations is essential for informing nutritional policies. We described the energy contribution of food groups to total dietary energy intake of the Mexican population and by sociodemographic subgroups and compared these results with Mexican dietary recommendations. Twenty-four-hour dietary recalls for participants aged ≥5 y (n = 7983) from the 2012 Mexican National Health and Nutrition Survey were used. Foods and beverages were classified into 8 groups (the first 6 were called "basic foods" and the last 2 "discretionary foods"), as follows: 1) cereals, 2) legumes, 3) milk and dairy, 4) meat and animal products, 5) fruit and vegetables, 6) fats and oils, 7) sugar-sweetened beverages (SSBs), and 8) products high in saturated fat and/or added sugar (HSFAS). Recommendations were based on the Mexican Dietary Guidelines (MDG). Energy contributions from the food groups by age, sex, region, residence (rural or urban), and socioeconomic status (SES) were estimated. The highest contribution to total energy intake came from cereals (33%) followed by HSFAS (16%), meat and animal products (14%), and SSBs (9.8%). Fruit and vegetables (5.7%) and legumes (3.8%) had the lowest contribution. Energy contribution of several food groups differed significantly between population subgroups. Overall, discretionary foods contributed more than one-quarter of total energy intake (26%) and were 13 percentage points above the maximum allowed by the recommendations, whereas the intakes of legumes and fruit and vegetables were much lower than recommended. Our results show the need to generate a food environment conducive to a healthier diet in the Mexican population. © 2016 American Society for Nutrition.

Romantic Relationship Experiences from Late Adolescence to Young Adulthood: The Role of Older Siblings in Mexican-Origin Families.

PubMed

Wheeler, Lorey A; Killoren, Sarah E; Whiteman, Shawn D; Updegraff, Kimberly A; McHale, Susan M; Umaña-Taylor, Adriana J

2016-05-01

Youth's experiences with romantic relationships during adolescence and young adulthood have far reaching implications for future relationships, health, and well-being; yet, although scholars have examined potential peer and parent influences, we know little about the role of siblings in youth's romantic relationships. Accordingly, this study examined the prospective longitudinal links between Mexican-origin older and younger siblings' romantic relationship experiences and variation by sibling structural and relationship characteristics (i.e., sibling age and gender similarity, younger siblings' modeling) and cultural values (i.e., younger siblings' familism values). Data from 246 Mexican-origin families with older (M = 20.65 years; SD = 1.57; 50 % female) and younger (M = 17.72 years; SD = .57; 51 % female) siblings were used to examine the likelihood of younger siblings' involvement in dating relationships, sexual relations, cohabitation, and engagement/marriage with probit path analyses. Findings revealed older siblings' reports of involvement in a dating relationship, cohabitation, and engagement/marriage predicted younger siblings' relationship experiences over a 2-year period. These links were moderated by sibling age spacing, younger siblings' reports of modeling and familism values. Our findings suggest the significance of social learning dynamics as well as relational and cultural contexts in understanding the links between older and younger siblings' romantic relationship experiences among Mexican-origin youth.

Contemporary Fertility Patterns and First-Birth Timing among Mexican-Origin Women

ERIC Educational Resources Information Center

Batson, Christie D.

2013-01-01

This article examines first-birth timing among Mexican women in the United States over two birth cohorts. Currently, Mexican women are one of a small group that maintains above-replacement fertility in the United States, contributing to both Mexican population growth and overall national population growth. Yet, the fertility timing of Mexican…

Variants and Haplotypes in Angiotensinogen Gene Are Associated With Plasmatic Angiotensinogen Level in Mexican Population

PubMed Central

Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Alfaro-Ruiz, Luis; Carrillo, Karol; Elizalde, Adela; Gil, Trinidad; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

2011-01-01

Introduction The plasmatic angiotensinogen (AGT) level has been associated with essential hypertension. Linkage analysis has found a relationship between the AGT gene locus and hypertension in the Mexican-American population, but studies have failed to identify genetic variants associated with hypertension or plasma AGT levels. This study analyzes the relationship between polymorphisms in the AGT gene and plasmatic AGT levels in Mexican population. Methods Nine polymorphisms in AGT gene were genotyped, and plasma AGT level was determined by enzyme-linked immunosorbent assay. Results Differences in AGT plasma levels were associated with 2 polymorphisms: T-20G, TT = 25.3 ± 8.3 versus TG + GG = 21.6 ± 8.8 μg/mL; P = 0.008 and C3389T (T174M), CC = 25.8 ± 9.9 versus TC + TT = 20.5 ± 5.4 μg/mL; P = 0.0002. Haplotype 2 was associated with low plasma AGT (−5.1 μg/mL [95% confidence interval: −8.6 to −1.6], P = 0.004) and Haplotype 8 was associated with high plasma AGT (6.5 μg/mL [95% confidence interval: 2.5 to 10.6], P = 0.001). This association remained after adjustment for covariates. A Likelihood Ratio Test for haplotype-phenotype association adjusted for covariates resulted in χ2 = 38.9, P = 0.0005. The total effect of the haplotypes on plasma AGT level variance was 19.5%. No association was identified between haplotypes and quantitative traits of blood pressure. Conclusions Two polymorphisms (T-20G and C3389T) and 2 haplotypes (H2 and H8) showed an association with plasma AGT levels in Mexican population. PMID:21629041

Cardiovascular risk factors in a Mexican middle-class urban population. The Lindavista Study. Baseline data.

PubMed

Meaney, Alejandra; Ceballos-Reyes, Guillermo; Gutiérrez-Salmean, Gabriela; Samaniego-Méndez, Virginia; Vela-Huerta, Agustín; Alcocer, Luis; Zárate-Chavarría, Elisa; Mendoza-Castelán, Emma; Olivares-Corichi, Ivonne; García-Sánchez, Rubén; Martínez-Marroquín, Yolanda; Ramírez-Sánchez, Israel; Meaney, Eduardo

2013-01-01

The aim of this communication is to describe the cardiovascular risk factors affecting a Mexican urban middle-class population. A convenience sample of 2602 middle class urban subjects composed the cohort of the Lindavista Study, a prospective study aimed to determine if conventional cardiovascular risks factors have the same prognosis impact as in other populations. For the baseline data, several measurements were done: obesity indexes, smoking, blood pressure, fasting serum glucose, total cholesterol, HDL-c, LDL-c and triglycerides. This paper presents the basal values of this population, which represents a sample of the Mexican growing urban middle-class. The mean age in the sample was 50 years; 59% were females. Around 50% of the entire group were overweighed, while around 24% were obese. 32% smoked; 32% were hypertensive with a 20% rate of controlled pressure. 6% had diabetes, and 14% had impaired fasting glucose; 66% had total cholesterol ≥ 200 mg/dL; 62% showed HDL-c levels<40 mg/dL; 52% triglycerides>150 mg/dL, and 34% levels of LDL-c ≥ 160 mg/dL. Half of the population studied had the metabolic syndrome. These data show a population with a high-risk profile, secondary to the agglomeration of several cardiovascular risk factors. Copyright © 2012 Instituto Nacional de Cardiología Ignacio Chávez. Published by Masson Doyma México S.A. All rights reserved.

Mexican-Origin Youth's Risk Behavior from Adolescence to Young Adulthood: The Role of Familism Values

PubMed Central

Wheeler, Lorey A.; Zeiders, Katharine H.; Updegraff, Kimberly A.; Umaña-Taylor, Adriana J.; Rodríguez de Jesús, Sue A.; Perez-Brena, Norma J.

2016-01-01

Engagement in risk behavior has implications for individuals' academic achievement, health, and well-being, yet there is a paucity of developmental research on the role of culturally-relevant strengths in individual and family differences in risk behavior involvement among ethnic minority youth. In this study, we used a longitudinal cohort-sequential design to chart intraindividual trajectories of risk behavior and test variation by gender and familism values in 492 youth from 12 to 22 years of age. Participants were older and younger siblings from 246 Mexican-origin families who reported on their risk behaviors in interviews spaced over eight years. Multilevel cohort-sequential growth models revealed that youth reported an increase in risk behavior from 12 to 18 years of age, and then a decline to age 22. Male youth reported greater overall levels and a steeper increase in risk behavior from ages 12 to 18, compared to female youth. For familism values, on occasions when youth reported higher levels, they also reported lower levels of risk behavior (i.e., within-person effect). For sibling dyads characterized by higher average levels of familism values, youth reported lower average levels of risk behavior (i.e., between-family effect). Findings provide unique insights into risk behavior from adolescence to young adulthood among Mexican-origin youth. PMID:28026193

Mexican agencies reach teenagers.

PubMed

Brito Lemus, R; Beamish, J

1992-08-01

The Gente Joven project of the Mexican Foundation for Family Planning (MEXFAM) trains young volunteers in 19 cities to spread messages about sexually transmitted diseases and population growth to their peers. They also distribute condoms and spermicides. It also uses films and materials to spread its messages. The project would like to influence young men's behavior, but the Latin image of machismo poses a big challenge. It would like to become more responsible toward pregnancy prevention. About 50% of adolescents have sexual intercourse, but few use contraceptives resulting in a high adolescent pregnancy rate. Many of these pregnant teenagers choose not to marry. Adolescent pregnancy leads to girls leaving school, few marketable skills, and rearing children alone. Besides women who began childbearing as a teenager have 1.5 times more children than other women. Male involvement in pregnancy prevention should improve these statistics. As late as 1973, the Health Code banned promotion and sales of contraceptives, but by 1992 about 50% of women of reproductive age use contraceptives. The Center for the Orientation of Adolescents has organized 8 Young Men's Clubs in Mexico City to involve male teenagers more in family planning and to develop self-confidence. It uses a holistic approach to their development through discussions with their peers. A MEXFAM study shows that young men are not close with their fathers who tend to exude a machismo attitude, thus the young men do not have a role model for responsible sexual behavior. MEXFAM's work is cut out for them, however, since the same study indicates that 50% of the young men believe it is fine to have 1 girlfriend and 33% think women should earn more than men. A teenager volunteer reports, however, that more boys have been coming to him for contraception and information than girls in 1992 while in other years girls outnumbered the boys.

Anemia and iron deficiency in Mexican elderly population: Results from the Ensanut 2012.

PubMed

Contreras-Manzano, Alejandra; Cruz, Vanessa de la; Villalpando, Salvador; Rebollar, Rosario; Shamah-Levy, Teresa

2015-01-01

To describe de prevalence of iron deficiency (ID) and anemia in a sample of Mexican elderly population from the National Health and Nutrition Survey (Ensanut) 2012. 1 920 subjects ≥60 years of age were included. Hemoglobin, serum concentrations of ferritin and CRP were measured. The risk for ID and anemia adjusted for potential confounders was assessed in logistic regression models. The overall prevalence of anemia was 13.9%, 15.2% in males and 12.8% females. For ID, overall it was 4.2%, males 4.0% and females 4.3%. The greatest prevalence of ID was found in males and females over 80 years old (6.9 and 7.0%, respectively). ID was present in 1.5 of 10 Mexican elders with anemia. The prevalence of anemia was high in the elderly, however the prevalence of ID was low; there is a need to further investigate the causes of anemia in this age group.

Familism, machismo and child rearing practices among Mexican Americans.

PubMed

Tamez, E G

1981-09-01

Mexican Americans form the 2nd largest minority group in the US. Fertility is 50% higher than in any other ethnic group. Income levels are inordinately low. In 1970, 42% of Mexican Americans were indigent, making approxiamtely 4200 annually. The Mexican American poor can be categorized into newly arrived aliens or 2nd or 3rd generation American citizens. In the 1st instance, the couple is young and English is not spoken. 2nd or 3rd generation Mexican Americans speak English. The persistent socioeconomic status of the Mexican American relates directly to the level of education. 52% of all Mexican Americans do not finish high school. Paz and Remos described the Mexican in terms of Adler's inferiority model. Murillo stated that to an individual, the family--whether nuclear or extended--is the center of life. The inherent responsibility is that the individual behave properly lest the family be disgraced. The family provides emotional and material security. Familism was seen as a deterrant to utilization of health care services, although some studies claim opposing views. Familism and occupational stability related positively to seeking medical care when ill. Hayden believed that supreme male dominance, individualism, pride, wife beating, aversion to contraceptives, and other characteristics were attributable to machismo. A predominant pattern in Mexican American culture is that of elders' ordering young men and women to establish obedience and male dominance. The husband represents authority and the wife-mother maintains a role of complete devotion to her husband and children. Role differentiation is taught implicitly and explicitly from infancy. Studies on the psychological differences between the sexes indicated that females were oppressed and had lower self esteem than males. 18-24 year old Mexican Americans are becoming less insistent upon strict separation of sex roles and are beginning to reject the traditional Mexican notion of masculine superiority. The word

Because difficulty is not the same for everyone: the impact of complexity in working memory is associated with cannabinoid 1 receptor genetic variation in young adults.

PubMed

Ruiz-Contreras, Alejandra E; Román-López, Talía V; Caballero-Sánchez, Ulises; Rosas-Escobar, Cintia B; Ortega-Mora, E Ivett; Barrera-Tlapa, Miguel A; Romero-Hidalgo, Sandra; Carrillo-Sánchez, Karol; Hernández-Morales, Salvador; Vadillo-Ortega, Felipe; González-Barrios, Juan Antonio; Méndez-Díaz, Mónica; Prospéro-García, Oscar

2017-03-01

Individual differences in working memory ability are mainly revealed when a demanding challenge is imposed. Here, we have associated cannabinoid 1 (CB1) receptor genetic variation rs2180619 (AA, AG, GG), which is located in a potential CNR1 regulatory sequence, with performance in working memory. Two-hundred and nine Mexican-mestizo healthy young participants (89 women, 120 men, mean age: 23.26 years, SD = 2.85) were challenged to solve a medium (2-back) vs. a high (3-back) difficulty N-back tasks. All subjects responded as expected, performance was better with the medium than the high demand task version, but no differences were found among genotypes while performing each working memory (WM) task. However, the cost of the level of complexity in N-back paradigm was double for GG subjects than for AA subjects. It is noteworthy that an additive-dosage allele relation was found for G allele in terms of cost of level of complexity. These genetic variation results support that the endocannabinoid system, evaluated by rs2180619 polymorphism, is involved in WM ability in humans.

Employment Hardship among Mexican-Origin Women

ERIC Educational Resources Information Center

De Anda, Roberto M.

2005-01-01

This study compares the prevalence and causes of employment hardship between Mexican-origin and White women. Data come from the March 1992, 1996, and 2000 Current Population Surveys. Using logistic regression, the author assesses whether there is a difference between Mexican-origin and White women in employment hardship, controlling for personal…

Present status and perspective of pharmacogenetics in Mexico.

PubMed

Cuautle-Rodríguez, Patricia; Llerena, Adrián; Molina-Guarneros, Juan

2014-01-01

Drug costs account for up to 24% of the country's health expenditure and there are 13,000 registered drugs being prescribed. Diabetes is the main cause of death in the country, with over 85% of diabetic patients currently under drug treatment. The importance of knowing interindividual variability in drug metabolism on Mexican populations is thus evident. The purpose of this article is to provide an overlook of the current situation of pharmacogenetic research in Mexico, focusing on drug-metabolizing enzymes, and the possibility of developing a phenotyping cocktail for Mexican populations. So far, 21 pharmacogenetic studies on Mexican population samples (Mestizos and Amerindian) have been published. These have reported interindividual variability through phenotyping and/or genotyping cytochromes: CYP2D6, 2C19, 2C9, 2E1, and phase II enzymes UGT and NAT2. Some cytochromes with important clinical implications have not yet been phenotyped in Mexican populations. The development of a cocktail adapted to them could be a significant contribution to a larger knowledge on drug response variability at a lower price and shorter time. There are validated phenotyping cocktails that present several practical advantages, being valuable, safe, and inexpensive tools in drug metabolism characterization, which require only a single experiment to provide information on several cytochrome activities.

Some Thoughts on Mexican Poverty Viewed from the Perspective of the World Population Plan of Action.

ERIC Educational Resources Information Center

Serron, Luis A.

The paper summarizes findings of a study of Mexican poverty (SO 010 522), and relates these findings to guidelines of the World Population Plan of Action. The study indicated that poverty in Mexico is based upon national and international economic, political, and social factors. Included among these factors are exploitation of labor, rapid…

Cultural significance of wild mammals in Mayan and mestizo communities of the Lacandon Rainforest, Chiapas, Mexico.

PubMed

García Del Valle, Yasminda; Naranjo, Eduardo J; Caballero, Javier; Martorell, Carlos; Ruan-Soto, Felipe; Enríquez, Paula L

2015-05-07

Several ethnobiology studies evaluate the cultural significance (CS) of plants and mushrooms. However, this is not the case for mammals. It is important to make studies of CS allowing the comparison of cultural groups because the value given to groups of organisms may be based on different criteria. Such information would be valuable for wildlife preservation plans. In this study, the most culturally significant species of mammals from the Lacandon Rainforest (Chiapas, Mexico) for people from two Mayan-Lacandon and mestizo communities were identified. The reasons behind the CS of the studied species were explored and the existence of differences among the cultural groups was evaluated. One hundred ninety-eight semi-structured and structured interviews were applied to compile socio-demographic information, qualitative data on CS categories, and free listings. Frequency of mention was a relative indicator to evaluate the CS of each species of mammal. Comparison of responses between communities was carried out through multivariate analyses. The non-parametric Mann-Whitney U test was used to compare the number of mentioned species by Lacandons and mestizos as well as different responses in the qualitative categories. A χ2 test was used to compare frequency of categories. 38 wild mammal species were identified. The classification and Principal Components Analyses show an apparent separation between Lacandon and mestizo sites based on the relative importance of species. All four communities mentioned the lowland paca the most, followed by peccary, white-tailed deer, armadillo, and jaguar. No significant difference was found in the number of mentioned species between the two groups. Eight CS categories were identified. The most important category was "harmful mammals", which included 28 species. Other relevant categories were edible, medicinal, and appearing in narratives. The data obtained in this study demonstrates the existence of differential cultural patterns in the

HIV and Mexican migrant workers in the United States: a review applying the vulnerable populations conceptual model.

PubMed

Albarrán, Cynthia R; Nyamathi, Adeline

2011-01-01

Mexican migrant workers residing in the United States are a vulnerable population at high risk for HIV infection. This article critically appraises the published data surrounding HIV prevalence in this vulnerable group, as seen through the lens of the Vulnerable Populations Conceptual Model. This model demonstrates how exposure to risk and resource availability affect health status. The health status of Mexican migrants in the United States is compromised by a number of factors that increase risk of HIV: limited access to health services, multiple sexual partners, low rates of condom use, men having sex with men, and lay injection practices. Migration from Mexico to the United States has increased the prevalence of HIV in rural Mexico, making this an issue of urgent binational concern. This review highlights the implications for further nursing research, practice, and policy. Copyright © 2011 Association of Nurses in AIDS Care. Published by Elsevier Inc. All rights reserved.

Epidemiology of diabetes mellitus in Mexico.

PubMed

Bello-Chavolla, Omar Y; Rojas-Martinez, Rosalba; Aguilar-Salinas, Carlos A; Hernández-Avila, Mauricio

2017-01-01

Type 2 diabetes is the main health problem in Mexico. The large and growing number of cases and the remarkable economic impact of the disease support this statement. The condition is expressed at an earlier age and at a lower body mass index in Mexican mestizos compared with the age and body mass index reported in Caucasians. In addition, Mexican mestizos have an increased susceptibility to developing diabetic nephropathy. The Mexican health system needs major adjustments in order to prevent and treat type 2 diabetes. Treatment is not currently based on the needs and expectations of the patient. As a result, it is insufficient, belated, and costly. Close to 20% of the preventable deaths in Mexico are caused by diabetes and related metabolic diseases. Even a small decrease in this rate could result in substantial savings for the Mexican healthcare system. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Association between -174G/C and -572G/C interleukin 6 gene polymorphisms and severe radiographic damage to the hands of Mexican patients with rheumatoid arthritis: a preliminary report.

PubMed

Zavaleta-Muñiz, S A; Gonzalez-Lopez, L; Murillo-Vazquez, J D; Saldaña-Cruz, A M; Vazquez-Villegas, M L; Martín-Márquez, B T; Vasquez-Jimenez, J C; Sandoval-Garcia, F; Ruiz-Padilla, A J; Fajardo-Robledo, N S; Ponce-Guarneros, J M; Rocha-Muñoz, A D; Alcaraz-Lopez, M F; Cardona-Müller, D; Totsuka-Sutto, S E; Rubio-Arellano, E D; Gamez-Nava, J I

2016-12-19

Several interleukin 6 gene (IL6) polymorphisms are implicated in susceptibility to rheumatoid arthritis (RA). It has not yet been established with certainty if these polymorphisms are associated with the severe radiographic damage observed in some RA patients, particularly those with the development of joint bone ankylosis (JBA). The objective of the present study was to evaluate the association between severe radiographic damage in hands and the -174G/C and -572G/C IL6 polymorphisms in Mexican Mestizo people with RA. Mestizo adults with RA and long disease duration (>5 years) were classified into two groups according to the radiographic damage in their hands: a) severe radiographic damage (JBA and/or joint bone subluxations) and b) mild or moderate radiographic damage. We compared the differences in genotype and allele frequencies of -174G/C and -572G/C IL6 polymorphisms (genotyped using polymerase chain reaction-restriction fragment length polymorphism) between these two groups. Our findings indicated that the -174G/C polymorphism of IL6 is associated with severe joint radiographic damage [maximum likelihood odds ratios (MLE_OR): 8.03; 95%CI 1.22-187.06; P = 0.03], whereas the -572G/C polymorphism of IL6 exhibited no such association (MLE_OR: 1.5; 95%CI 0.52-4.5; P = 0.44). Higher anti-cyclic citrullinated peptide antibody levels were associated with more severe joint radiographic damage (P = 0.04). We conclude that there is a relevant association between the -174G/C IL6 polymorphism and severe radiographic damage. Future studies in other populations are required to confirm our findings.

A Qualitative Study of Mexican American Adolescents and Depression

ERIC Educational Resources Information Center

Fornos, Laura B.; Mika, Virginia Seguin; Bayles, Bryan; Serrano, Alberto C.; Jimenez, Roberto L.; Villarreal, Roberto

2005-01-01

Depressive disorders are present in a high percentage of Mexican American adolescents. Among the US Mexican American population, suicide is the fourth leading cause of death among 10- to 19-year-olds. Little research, however, has focused on Mexican American adolescents' knowledge and views about depression and seeking help for depression. Results…

Captive breeding and the reintroduction of Mexican and red wolves.

PubMed

Hedrick, P W; Fredrickson, R J

2008-01-01

Mexican and red wolves were both faced with extinction in the wild until captive populations were established more than two decades ago. These captive populations have been successfully managed genetically to minimize mean kinship and retain genetic variation. Descendants of these animals were subsequently used to start reintroduced populations, which now number about 40-50 Mexican wolves in Arizona and New Mexico and about 100 red wolves in North Carolina. The original captive Mexican wolf population was descended from three founders. Merging this lineage with two other captive lineages, each with two founders, has been successfully carried out in the captive population and is in progress in the reintroduced population. This effort has resulted in increased fitness of cross-lineage wolves, or genetic rescue, in both the captive and reintroduced populations. A number of coyote-red wolf hybrid litters were observed in the late 1990s in the reintroduced red wolf population. Intensive identification and management efforts appear to have resulted in the elimination of this threat. However, population reintroductions of both Mexican and red wolves appear to have reached numbers well below the generally recommended number for recovery and there is no current effort to re-establish other populations.

Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

PubMed

Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

2015-11-01

Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

Mexican-origin youth's risk behavior from adolescence to young adulthood: The role of familism values.

PubMed

Wheeler, Lorey A; Zeiders, Katharine H; Updegraff, Kimberly A; Umaña-Taylor, Adriana J; Rodríguez de Jesús, Sue A; Perez-Brena, Norma J

2017-01-01

Engagement in risk behavior has implications for individuals' academic achievement, health, and well-being, yet there is a paucity of developmental research on the role of culturally relevant strengths in individual and family differences in risk behavior involvement among ethnic minority youth. In this study, we used a longitudinal cohort-sequential design to chart intraindividual trajectories of risk behavior and test variation by gender and familism values in 492 youth from 12 to 22 years of age. Participants were older and younger siblings from 246 Mexican-origin families who reported on their risk behaviors in interviews spaced over 8 years. Multilevel cohort-sequential growth models revealed that youth reported an increase in risk behavior from 12 to 18 years of age, and then a decline to age 22. Male youth reported greater overall levels and a steeper increase in risk behavior from ages 12 to 18, compared to female youth. For familism values, on occasions when youth reported higher levels, they also reported lower levels of risk behavior (i.e., within-person effect). For sibling dyads characterized by higher average levels of familism values, youth reported lower average levels of risk behavior (i.e., between-family effect). Findings provide unique insights into risk behavior from adolescence to young adulthood among Mexican-origin youth. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Differences Between Patients that Made an Impulsive or Premeditated Suicide Attempt in a Mexican Population.

PubMed

Reyes-Tovilla, Jorge E; Hernández Yánez, Homero Daniel; Peralta-Jiménez, Yesenia; Ramón-Frías, Teresa; Juárez-Rojop, Isela; Pool-García, Sherezada; Velázquez-Sánchez, Martha Patricia; López-Narvóez, Lilia; Fresán, Ana; Tovilla-Zárate, Carlos Alfonso

2015-01-01

We performed a study to identify differences between patients with impulsive suicide attempt and those with premeditated suicide attempt in a Mexican population. We studied 144 patients who recently attempted suicide. Impulsive and premeditated suicide attempts were evaluated with the Suicide Intent Scale. These data were divided according to the type of attempt. Subsequently, the characteristics between the two groups were compared. The rate of patients that made an impulsive attempt was 61.8% and only 9.7% of the patients carried out a premeditated suicide attempt. More years of schooling/education and less severity of the attempt were observed in patients that carried out an impulsive suicide attempt (p < 0.001). Alcohol consumption (0.003) and use of cannabis (0.002) were present in patients who premeditated a suicide attempt. Our findings demonstrate that there are clinical differences among the individuals who carried out an impulsive suicide attempt from those who premeditated an attempt in a Mexican population. As a result, when planning interventions and prevention efforts it may be helpful to consider these clinical differences and demographic characteristics. © 2015 The Author(s).

[Aortic valve calcification prevalence and association with coronary risk factors and atherosclerosis in Mexican population].

PubMed

Acuña-Valerio, Jorge; Rodas-Díaz, Marco A; Macias-Garrido, Enrico; Posadas-Sánchez, Rosalinda; Juárez-Rojas, Juan G; Medina-Urrutia, Aida X; Cardoso-Saldaña, Guillermo C; Joge-Galarza, Esteban; Torres-Tamayo, Margarita; Vargas-Alarcón, Gilberto; Posadas-Romero, Carlos

The prevalence of aortic valve calcification (AVC), strongly influenced by ethnicity, is unknown in Mexican population. The aim of this study was to investigate the prevalence of AVC and its associations with cardiovascular risk factors and coronary artery calcification (CAC), in Mexican subjects. In 1,267 subjects (53% women) without known coronary heart disease, aged 35 to 75 years, AVC and CAC were assessed by multidetector-computed tomography using the Agatston score. Cardiovascular risk factors were documented in all participants. The associations of AVC with CAC and risk factors were assessed by multivariable logistic regression analyses. The overall prevalence of AVC and CAC was 19.89% and 26.5%, respectively. AVC and CAC increased with age and were found more frequently in men (25.5% and 37.1%, respectively) than in women (14.9% and 13.0%, respectively). AVC was observed in only 8.5% of subjects without CAC, while those with CAC 1-99, 100-399, and >400 Agatston units had AVC prevalences of 36.8%, 56.8%, and 84.0%, respectively. The multivariable logistic regression analyses, adjusted for age, gender, obesity, physical inactivity, hypertension, dyslipidemia and high insulin levels, showed that the presence of CAC (OR [CI95%]: 3.23 [2.26-4.60]), obesity (1.94 [1.35-2.79]), male gender (1.44 [1.01-2.05]) and age (1.08 [1.03-1.10]), were significant independent predictors of AVC. Prevalence of AVC is high and significantly associated with atherosclerotic risk factors and CAC in this Mexican population. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary.

PubMed

Ugarte-Gil, Manuel F; Pons-Estel, Guillermo J; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K; Pons-Estel, Bernardo A; Alarcón-Riquelme, Marta; Alarcón, Graciela S

2016-03-01

To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student's t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights

Unpacking acculturation: cultural orientations and educational attainment among Mexican-origin youth.

PubMed

Roche, Kathleen M; Ghazarian, Sharon R; Fernandez-Esquer, Maria Eugenia

2012-07-01

Given educational risks facing Mexican-origin children of immigrant parents, it is important to understand how aspects of the acculturation process influence Mexican-origin youth's educational success. Drawing from selective assimilation theory, this study examined how cultural orientations across myriad facets of acculturation were associated with the educational attainment of second-generation Mexican immigrant youth. The sample included 755 Mexican-origin youth (50% female) in the "Children of Immigrants Longitudinal Study." Results from structural equation models indicated that youth reporting greater facility in the English language and a stronger value on familism attained higher levels of education in young adulthood than did other youth. Parents' U.S. social ties and youth's value on early paid work were associated with less educational attainment. Innovative findings from this study indicate the importance of considering both Mexican and American cultural orientations across myriad facets of acculturation for understanding second-generation immigrant Mexican youth's educational attainment.

The prevalence of diabetes and associated coronary risk factors in urban and rural older Mexican populations.

PubMed

Lerman, I G; Villa, A R; Martinez, C L; Cervantes Turrubiatez, L; Aguilar Salinas, C A; Wong, B; Gómez Pérez, F J; Gutierrez Robledo, L M

1998-11-01

To determine the prevalence of diabetes and examine its association with food intake, anthropometric and metabolic variables, and other coronary risk factors in urban and rural older Mexican populations. A cross-sectional study. Three Mexican communities (urban areas of medium and low income and a rural area). A total of 121 men and 223 women aged 60 years and older and 93 men and 180 women aged 35 to 59 years were selected randomly for inclusion in the survey, which was derived from the CRONOS study (Cross-Cultural Research on Nutrition in the Older Adult Study Group) promoted by the European Economic Community. A personal interview assessed demographic information, personal medical history, and functional status, and a 24-hour diet recall was obtained. A physical examination included anthropometric and blood pressure measurements. A fasting blood sample was obtained for measurements of lipids, insulin, and glucose. Diabetes prevalence was higher in men than in women for all age groups: 16.7% versus 9.5% in younger adults and 30.8% versus 22.8% in older adults. For all age groups, diabetes was more highly prevalent in urban communities. Using a multivariate stepwise logistic regression, variables associated independently with diabetes in older individuals were: gender (male sex: OR = 2.1; P < .009); diminished carbohydrate intake in the diet (OR = 0.77; P < .03); central distribution of adiposity (OR = 1.9; P < .03); and functional disability (OR = 2.3; P < .01). This relationship was not observed with living area, income, education, fiber and alcohol intake, body mass index, or age. Individuals 80 years and older had a diminished atherogenic risk profile. Diabetes in older people was associated significantly with hypertriglyceridemia, impaired functional status, and an increased prevalence of ischemic heart disease; in younger adults diabetes was associated with low density lipoprotein (LDL) hypercholesterolemia, hypertriglyceridemia, and a proportionally higher

Autonomy support, basic psychological needs and well-being in Mexican athletes.

PubMed

López-Walle, Jeanette; Balaguer, Isabel; Castillo, Isabel; Tristán, José

2012-11-01

Based on Basic Needs Theory, one of the mini-theories of Self-determination Theory (Ryan & Deci, 2002), the present study had two objectives: (a) to test a model in the Mexican sport context based on the following sequence: perceived coach autonomy support, basic psychological needs satisfaction, and psychological well-being, and b) to analyze the mediational effect of the satisfaction of perceived coach autonomy support on indicators of psychological well-being (satisfaction with life and subjective vitality). Six hundred and sixty-nine young Mexican athletes (Boys = 339; Girls = 330; M(age) = 13.95) filled out a questionnaire assessing the study variables. Structural equations analyses revealed that perceived coach autonomy support predicted satisfaction of the basic psychological needs for autonomy, competence, and relatedness. Furthermore, basic need satisfaction predicted subjective vitality and satisfaction with life. Autonomy, competence and relatedness partially mediated the path from perceived coach autonomy support to psychological well-being in young Mexican athletes.

Diabetic nephropathy among Mexican Americans

PubMed Central

Debnath, Subrata; Thameem, Farook; Alves, Tahira; Nolen, Jacqueline; Al-Shahrouri, Hania; Bansal, Shweta; Abboud, Hanna E.; Fanti, Paolo

2012-01-01

The incidence of diabetic nephropathy (DN) is growing rapidly worldwide as a consequence of the rising prevalence of Type 2 diabetes mellitus (T2DM). Among U.S. ethnic groups, Mexican Americans have a disproportionately high incidence and prevalence of DN and associated end-stage renal disease (ESRD). In communities bordering Mexico, as many as 90% of Mexican American patients with ESRD also suffer from T2DM compared to only 50% of non-Hispanic Whites (NHW). Both socio-economic factors and genetic predisposition appear to have a strong influence on this association. In addition, certain pathogenetic and clinical features of T2DM and DN are different in Mexican Americans compared to NHW, raising questions as to whether the diagnostic and treatment strategies that are standard practice in the NHW patient population may not be applicable in Mexican Americans. This article reviews the epidemiology of DN in Mexican Americans, describes the pathophysiology and associated risk factors, and identifies gaps in our knowledge and understanding that needs to be addressed by future investigations. PMID:22445478

Diabetic nephropathy among Mexican Americans.

PubMed

Debnath, Subrata; Thameem, Farook; Alves, Tahira; Nolen, Jacqueline; Al-Shahrouri, Hania; Bansal, Shweta; Abboud, Hanna E; Fanti, Paolo

2012-04-01

The incidence of diabetic nephropathy (DN) is growing rapidly worldwide as a consequence of the rising prevalence of Type 2 diabetes mellitus (T2DM). Among U.S. ethnic groups, Mexican Americans have a disproportionately high incidence and prevalence of DN and associated end-stage renal disease (ESRD). In communities bordering Mexico, as many as 90% of Mexican American patients with ESRD also suffer from T2DM compared to only 50% of non-Hispanic Whites (NHW). Both socio-economic factors and genetic predisposition appear to have a strong influence on this association. In addition, certain pathogenetic and clinical features of T2DM and DN are different in Mexican Americans compared to NHW, raising questions as to whether the diagnostic and treatment strategies that are standard practice in the NHW patient population may not be applicable in Mexican Americans. This article reviews the epidemiology of DN in Mexican Americans, describes the pathophysiology and associated risk factors, and identifies gaps in our knowledge and understanding that needs to be addressed by future investigations.

Clinico-pathologic study of odontogenic cysts in a Mexican sample population.

PubMed

Ledesma-Montes, C; Hernández-Guerrero, J C; Garcés-Ortíz, M

2000-01-01

Odontogenic cysts are uncommon lesions that frequently behave agressively and attain a large size. Unfortunately, information on the relative incidence of these cysts from different populations is not abundant. In Mexico, for example, only a few examples have been reported. The aim of this study was to ascertain the frequency of odontogenic cysts in a Mexican sample and to compare these data with previously reported studies from other countries. The files of the Oral and Maxillofacial Pathology Diagnosis Service at the School of Dentistry at the Universidad Nacional Autónoma de México (UNAM) were reviewed and all accessions of odontogenic cysts were listed. Clinical and radiographic data were recorded and microscopic slides evaluated according to the most recent World Health Organization (WHO) classification (1992). Three hundred and four cases of odontogenic cysts (55.9% male predominance) were found. The most frequent odontogenic cysts were the following: periapical cyst (38. 8%); dentigerous cyst (35.5%), and odontogenic keratocyst (18.8%). Periapical cyst was more frequent in females, and maxillary anterior teeth were most commonly involved. Dentigerous cysts appeared in males at a rate of 64.8%, this cyst found more frequently between the 1st and 2nd decades of life and in the molar zone. Odontogenic keratocyst was more frequent in males (59.6%), between the 2nd and 4th decades of life and more common in the molar zone. More than 50% of the sample were aggressive cysts (dentigerous and keratocyst). Our results suggest that Mexican patients develop aggressive odontogenic cysts more commonly than other populations. Our figures point to the need for a precise diagnosis in order to institute the correct surgical procedure, prevent recurrence, and forestall more extensive tissue destruction.

Epstein-Barr virus-associated gastric carcinoma: Evidence of age-dependence among a Mexican population

PubMed Central

Herrera-Goepfert, Roberto; Akiba, Suminori; Koriyama, Chihaya; Ding, Shan; Reyes, Edgardo; Itoh, Tetsuhiko; Minakami, Yoshie; Eizuru, Yoshito

2005-01-01

AIM: To investigate features of Epstein-Barr virus (EBV)-associated gastric carcinoma (EBVaGC) among a Mexican population. METHODS: Cases of primary gastric adenocarcinoma were retrieved from the files of the Departments of Pathology at the Instituto Nacional de Cancerología and the Instituto Nacional de la Nutrición in Mexico City. The anatomic site of the gastric neoplasia was identified, and carcinomas were histologically classified as intestinal and diffuse types and subclassified as proposed by the Japanese Research Society for Gastric Cancer. EBV-encoded small non-polyadenylated RNA-1 (EBER-1) in situ hybridization was conducted to determine the presence of EBV in neoplastic cells. RESULTS: We studied 330 consecutive, non-selected, primary gastric carcinomas. Among these, there were 173 male and 157 female patients (male/female ratio 1.1/1). EBER-1 was detected in 24 (7.3%) cases (male/female ratio: 1.2/1). The mean age for the entire group was 58.1 years (range: 20-88 years), whereas the mean age for patients harboring EBER-1-positive gastric carcinomas was 65.3 years (range: 50-84 years). Age and histological type showed statistically significant differences, when EBER-1-positive and -negative gastric carcinomas were compared. EBER-1 was detected in hyperplastic- and dysplastic-gastric mucosa surrounding two EBER-1-negative carcinomas, respectively. CONCLUSION: Among Latin-American countries, Mexico has the lowest frequency of EBVaGC. Indeed, the Mexican population >50 years of age was selectively affected. Ethnic variations are responsible for the epidemiologic behavior of EBVaGC among the worldwide population. PMID:16273633

Selected Characteristics of Persons and Families of Mexican, Puerto Rican, and Other Spanish Origin: March 1972. (Advance Data from March 1972 Sample Survey.) Population Characteristics: Current Population Reports.

ERIC Educational Resources Information Center

Bureau of the Census (DOC), Suitland, MD.

Data on a variety of social and economic characteristics for persons and families in the United States of Mexican, Puerto Rican, Cuban, and other Spanish origin and comparative data for the remaining population were selected from the March 1972 Bureau of the Census Current Population Survey (CPS). Revisions in the March 1972 CPS, as compared to…

Higher risk for obesity among Mexican-American and Mexican immigrant children and adolescents than among peers in Mexico.

PubMed

Hernández-Valero, María A; Bustamante-Montes, L Patricia; Hernández, Mike; Halley-Castillo, Elizabeth; Wilkinson, Anna V; Bondy, Melissa L; Olvera, Norma

2012-08-01

We conducted a cross-sectional study among 1,717 children and adolescents of Mexican origin ages 5-19 years living in Mexico and Texas to explore the influence of country of birth and country of longest residence on their overweight and obesity status. Descriptive statistics were used to compare demographic and anthropometric characteristics of participants born and raised in Mexico (Mexicans), born in Mexico and raised in the United States (Mexican immigrants), and born and raised in the United States (Mexican-Americans). Univariate and multivariate nominal logistic regression was used to determine the demographic predictors of obesity adjusted by country of birth, country of residence, age, and gender. Almost half (48.8%) of the Mexican-Americans and 43.2% of the Mexican immigrants had body mass index at the 85th percentile or above, compared to only 29.3% of the Mexicans (P < .001). Thus, Mexican-Americans and Mexican immigrants were more likely to be obese than their Mexican peers [Mexican-Americans: odds ratio (OR) = 2.5 (95% confidence interval [CI] 1.8-3.4); Mexican immigrants: OR = 2.2 (95% CI 1.6-3.0)]. In addition, males were more likely than females to be obese [OR = 1.6 (95% CI 1.2-2.1)], and adolescents 15-19 years of age were less likely than their younger counterparts [OR = 0.5 (95% CI 0.4-0.7)] to be obese. The high prevalence of obesity among children of Mexican origin in the United States is of great concern and underscores the urgent need to develop and implement obesity preventive interventions targeting younger children of Mexican origin, especially newly arrived immigrant children. In addition, future obesity research should take into consideration the country of origin of the study population to develop more culturally specific obesity interventions.

Mexican Perspectives on Mexican-U.S. Relations

DTIC Science & Technology

1993-04-01

while serving in the United States military, working in the Bracero program and in American factories. By working with Americans, Mexicans learned that...Mexican government blames the problem on the United States. During the history of the Bracero Program (1942 -1964) 4.6 million Mexicans traveled to...and became familiar to Mexican migrants.ŕ The termination of the Bracero Program did not discourage Mexican agricultural workers from entering the

Cultural Factors Moderating Links between Neighborhood Disadvantage and Parenting and Coparenting among Mexican Origin Families

ERIC Educational Resources Information Center

Barnett, Melissa A.; Mortensen, Jennifer A.; Gonzalez, Henry; Gonzalez, Jose-Michael

2016-01-01

Background: Mexican origin families with young children living in the United States are disproportionately likely to live in disadvantaged neighborhoods that may threaten engagement in positive parenting processes. However, the influences of contextual risks on family processes among Mexican origin families remain unclear. Objective: The goal of…

PCSK1 rs6232 is associated with childhood and adult class III obesity in the Mexican population.

PubMed

Villalobos-Comparán, Marisela; Villamil-Ramírez, Hugo; Villarreal-Molina, Teresa; Larrieta-Carrasco, Elena; León-Mimila, Paola; Romero-Hidalgo, Sandra; Jacobo-Albavera, Leonor; Liceaga-Fuentes, Adriana E; Campos-Pérez, Francisco J; López-Contreras, Blanca E; Tusié-Luna, Teresa; Del Río-Navarro, Blanca E; Aguilar-Salinas, Carlos A; Canizales-Quinteros, Samuel

2012-01-01

Common variants rs6232 and rs6235 in the PCSK1 gene have been associated with obesity in European populations. We aimed to evaluate the contribution of these variants to obesity and related traits in Mexican children and adults. Rs6232 and rs6235 were genotyped in 2382 individuals, 1206 children and 1176 adults. Minor allele frequencies were 0.78% for rs6232 and 19.99% for rs6235. Rs6232 was significantly associated with childhood obesity and adult class III obesity (OR = 3.01 95%CI 1.64-5.53; P = 4 × 10⁻⁴ in the combined analysis). In addition, this SNP was significantly associated with lower fasting glucose levels (P = 0.01) and with increased insulin levels and HOMA-B (P = 0.05 and 0.01, respectively) only in non-obese children. In contrast, rs6235 showed no significant association with obesity or with glucose homeostasis parameters in any group. Although rs6232 is rare in the Mexican population, it should be considered as an important risk factor for extreme forms of obesity.

Dynamics of Huanglongbing-associated Bacterium Candidatus Liberibacter asiaticus in Citrus aurantifolia Swingle (Mexican Lime).

PubMed

Abel Lopez-Buenfil, Jose; Abrahan Ramirez-Pool, Jose; Ruiz-Medrano, Roberto; Del Carmen Montes-Horcasitas, Maria; Chavarin-Palacio, Claudio; Moya-Hinojosa, Jesus; Javier Trujillo-Arriaga, Francisco; Carmona, Rosalia Lira; Xoconostle-Cazares, Beatriz

2017-01-01

The bacterial disease citrus huanglongbing (HLB), associated with "Candidatus Liberibacter asiaticus" (C.Las) has severely impacted the citrus industry, causing a significant reduction in production and fruit quality. In the present study, it was monitored the C.Las population dynamics in symptomatic, HLB-positive Mexican lime trees (Citrus aurantifolia Swingle) in a tropical, citrus-producing area of Mexico. The objective of this study was to identify the dynamics of the population of huanglongbing-associated bacterium Candidatus Liberibacter asiaticus and its insect vector in Citrus aurantifolia Swingle (Mexican lime). Leaf samples were collected every 2 months over a period of 26 months for quantification of bacterial titers and young and mature leaves were collected in each season to determine preferential sites of bacterial accumulation. The proportion of living and dead bacterial cells could be determined through the use of quantitative real-time PCR in the presence of ethidium monoazide (EMA-qPCR). It was observed a lower bacterial titer at high temperatures in the infected trees relative to titers in mild weather, despite a higher accumulation of the insect vector Diaphorina citri in these conditions. This study also revealed seasonal fluctuations in the titers of bacteria in mature leaves when compared to young leaves. No statistically significant correlation between any meteorological variable, C.Las concentration and D. citri population could be drawn. Although, HLB management strategies have focused on vector control, host tree phenology may be important. The evaluation of citrus phenology, C.Las concentration, ACP population and environmental conditions provides insights into the cyclical, seasonal variations of both the HLB pathogen and its vector. These findings should help in the design of integrative HLB control strategies that take into account the accumulation of the pathogen and the presence of its vector.

Peritoneal dialysis in Mexico.

PubMed

Cueto-Manzano, Alfonso M

2003-02-01

While Mexico has the thirteenth largest economy, a large portion of the population is impoverished. About 90% of the population is Mestizo, the result of the admixture of Mexican Indians and Spaniards, with the Indigenous peoples concentrated in the southeastern region. Treatment for end-stage renal disease (estimated 268 patients per million population) is largely determined by the limited healthcare system and the individual's access to resources such as private insurance ( approximately 15%) and governmental sources ( approximately 85%). With only 5% of the gross national product spent on healthcare and most treatment providers being public health institutions that are often under severe economic restrictions, it is not surprising that many Mexican patients do not receive renal replacement therapy. Mexico uses proportionately more peritoneal dialysis than other countries; 1% of the patients are on automated peritoneal dialysis, 19% on hemodialysis and 80% on CAPD. Malnutrition and diabetes, important risk factors for poor outcome, are prevalent among the patients in CAPD programs.

Mexican-Origin Parents' Stress and Satisfaction: The Role of Emotional Support.

PubMed

Popp, Tierney K; Delgado, Melissa Y; Wheeler, Lorey A

2018-01-24

Guided by a process model of parenting and the integrative model, this study examined sources of emotional support (i.e., partner, maternal, paternal) as related to stress and satisfaction resulting from the parenting role in a sample of Mexican-origin young adult parents who participated in the National Longitudinal Study of Adolescent to Adult Health (Add Health) during Wave IV. Participants were male and female parents (26-35 years of age; 59% female; N = 737) who had children and a partner. Results from structural equation modeling revealed support from mothers as salient; high levels of maternal support were associated with high levels of parenting satisfaction. Tests of indirect effects suggested that parenting satisfaction played an intervening role in the link between maternal support and parenting stress. The pattern of results held across levels of linguistic acculturation but varied by gender. Understanding the mechanisms that predict parenting stress and satisfaction within the Mexican-origin population may help in the identification of culturally sensitive intervention strategies. © 2018 Family Process Institute.

How Census 2000 Data Suggest Hostility toward Mexican-Origin Arizonians

ERIC Educational Resources Information Center

Hunnicutt, Kay; Castro, Mario

2005-01-01

Using the Arizona 5% Public Use Microdata Sample (PUMS) from the 2000 U.S. Census, we compare language-related figures for the Mexican-origin population with those for the total population. Additionally, we compare place of birth and educational attainment data for Mexican-origin persons who speak Spanish at home with those who speak English-only…

Biomarkers of Alzheimer’s Disease Among Mexican Americans

PubMed Central

O’Bryant, Sid E.; Xiao, Guanghua; Edwards, Melissa; Devous, Michael; Gupta, Veer Bala; Martins, Ralph; Zhang, Fan; Barber, Robert

2013-01-01

Background Mexican Americans are the fastest aging segment of the U.S. population yet little scientific literature exists regarding the Alzheimer disease (AD) among this segment of the population. The extant literature suggests that biomarkers of AD will vary according to race/ethnicity though no prior work has explicitly studied this possibility. The aim of this study was to create a serum-based biomarker profile of AD among Mexican American. Methods Data were analyzed from 363 Mexican American participants (49 AD and 314 normal controls) enrolled in the Texas Alzheimer’s Research & Care Consortium (TARCC). Non-fasting serum samples were analyzed using a luminex-based multi-plex platform. A biomarker profile was generated using random forest analyses. Results The biomarker profile of AD among Mexican Americans was different from prior work from non-Hispanic populations with regards to the variable importance plots. In fact, many of the top markers were related to metabolic factors (e.g. FABP, GLP-1, CD40, pancreatic polypeptide, insulin-like-growth factor, and insulin). The biomarker profile was a significant classifier of AD status yielding an area under the receiver operating characteristic curve (AUC), sensitivity (SN) and specificity (SP) of 0.77, 0.92 and 0.64, respectively. Combining biomarkers with clinical variables yielded a better balance of SN and SP. Conclusion The biomarker profile for AD among Mexican American cases is significantly different from that previously identified among non-Hispanic cases from many large-scale studies. This is the first study to explicitly examine and provide support for blood-based biomarkers of AD among Mexican Americans. Areas for future research are highlighted. PMID:23313927

Rare intronic variants of TCF7L2 arising by selective sweeps in an indigenous population from Mexico.

PubMed

Acosta, Jose Luis; Hernández-Mondragón, Alma Cristal; Correa-Acosta, Laura Carolina; Cazañas-Padilla, Sandra Nathaly; Chávez-Florencio, Berenice; Ramírez-Vega, Elvia Yamilet; Monge-Cázares, Tulia; Aguilar-Salinas, Carlos A; Tusié-Luna, Teresa; Del Bosque-Plata, Laura

2016-05-26

Genetic variations of the TCF7L2 gene are associated with the development of Type 2 diabetes (T2D). The associated mutations have demonstrated an adaptive role in some human populations, but no studies have determined the impact of evolutionary forces on genetic diversity in indigenous populations from Mexico. Here, we sequenced and analyzed the variation of the TCF7L2 gene in three Amerindian populations and compared the results with whole-exon-sequencing of Mestizo populations from Sigma and the 1000 Genomes Project to assess the roles of selection and recombination in diversity. The diversity in the indigenous populations was biased to intronic regions. Most of the variation was low frequency. Only mutations rs77961654 and rs61724286 were located on exon 15. We did not observe variation in intronic region 4-6 in any of the three indigenous populations. In addition, we identified peaks of selective sweeps in the mestizo samples from the Sigma Project within this region. By replicating the analysis of association with T2D between case-controls from the Sigma Project, we determined that T2D was most highly associated with the rs7903146 risk allele and to a lesser extent with the other six variants. All associated markers were located in intronic region 4-6, and their r(2) values of linkage disequilibrium were significantly higher in the Mexican population than in Africans from the 1000 Genomes Project. We observed reticulations in both the haplotypes network analysis from seven marker associates and the neighborNet tree based on 6061 markers in the TCF7L2 gene identified from all samples of the 1000 Genomes Project. Finally, we identified two recombination hotspots in the upstream region and 3' end of the TCF7L2 gene. The lack of diversity in intronic region 4-6 in Indigenous populations could be an effect of selective sweeps generated by the selection of neighboring rare variants at T2D-associated mutations. The survivors' variants make the intronic region 4-6 the

VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.

PubMed

Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2015-01-01

Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.

The prevalence of BRCA1 and BRCA2 mutations among young Mexican women with triple-negative breast cancer

PubMed Central

Villarreal-Garza, C.; Weitzel, J. N.; Llacuachaqui, M.; Sifuentes, E.; Magallanes-Hoyos, M. C.; Gallardo, L.; Alvarez-Gómez, R. M.; Herzog, J.; Castillo, D.; Royer, R.; Akbari, Mohammad; Lara-Medina, F.; Herrera, L. A.; Mohar, A.

2015-01-01

Various guidelines recommend that women with triple-negative breast cancer should be tested for BRCA1 mutations, but the prevalence of mutations may vary with ethnic group and with geographic region, and the optimal cutoff age for testing has not been established. We estimated the frequencies of BRCA1 and BRCA2 (BRCA) mutations among 190 women with triple-negative breast cancer, unselected for family history, diagnosed at age 50 or less at a single hospital in Mexico City. Patients were screened for 115 recurrent BRCA mutations, which have been reported previously in women of Hispanic origin, including a common large rearrangement Mexican founder mutation (BRCA1 ex9-12del). A BRCA mutation was detected in 44 of 190 patients with triple-negative breast cancer (23 %). Forty-three mutations were found in BRCA1 and one mutation was found in BRCA2. Seven different mutations accounted for 39 patients (89 % of the total mutations). The Mexican founder mutation (BRCA1 ex9-12del) was found 18 times and accounted for 41 % of all mutations detected. There is a high prevalence of BRCA1 mutations among young triple-negative breast cancer patients in Mexico. Women with triple-negative breast cancer in Mexico should be screened for mutations in BRCA1. PMID:25716084

PCSK1 rs6232 Is Associated with Childhood and Adult Class III Obesity in the Mexican Population

PubMed Central

Villalobos-Comparán, Marisela; Villamil-Ramírez, Hugo; Villarreal-Molina, Teresa; Larrieta-Carrasco, Elena; León-Mimila, Paola; Romero-Hidalgo, Sandra; Jacobo-Albavera, Leonor; Liceaga-Fuentes, Adriana E.; Campos-Pérez, Francisco J.; López-Contreras, Blanca E.; Tusié-Luna, Teresa; del Río-Navarro, Blanca E.; Aguilar-Salinas, Carlos A.; Canizales-Quinteros, Samuel

2012-01-01

Background Common variants rs6232 and rs6235 in the PCSK1 gene have been associated with obesity in European populations. We aimed to evaluate the contribution of these variants to obesity and related traits in Mexican children and adults. Methodology/Principal Findings Rs6232 and rs6235 were genotyped in 2382 individuals, 1206 children and 1176 adults. Minor allele frequencies were 0.78% for rs6232 and 19.99% for rs6235. Rs6232 was significantly associated with childhood obesity and adult class III obesity (OR = 3.01 95%CI 1.64–5.53; P = 4×10−4 in the combined analysis). In addition, this SNP was significantly associated with lower fasting glucose levels (P = 0.01) and with increased insulin levels and HOMA-B (P = 0.05 and 0.01, respectively) only in non-obese children. In contrast, rs6235 showed no significant association with obesity or with glucose homeostasis parameters in any group. Conclusion/Significance Although rs6232 is rare in the Mexican population, it should be considered as an important risk factor for extreme forms of obesity. PMID:22737226

[Size structure as evidence of population establishment of Pterois volitans (Scorpaeniformes: Scorpaenidae) in the South Mexican Caribbean].

PubMed

Sabido-Itzá, Miguel Mateo; Medina-Quej, Alejandro; de Jesús-Navarrete, Alberto; Gómez-Poot, Jorge Manuel; García-Rivas, María del Carmen

2016-03-01

The lionfish (P. volitans) has now invaded all the Mexican Caribbean and Gulf of Mexico, with the potential to cause negative impacts on the reefs. In the South Mexican Caribbean was firstly reported in July 2009, and six years after this report, some control measures such as fish tournament and local marketing have been implemented. However, information on its biology and invasion is still-lacking, so this study analyzed the population structure of 2 164 organisms collected from 2009 to 2012. An increase was observed in sizes for each year averaging Total length (Tl): 118 ± 34.8, 133 ± 56.3, 187 ± 74.8 and 219 ± 72.4 mm, respectively. Lionfish establishment at the study site is shown for the presence of juveniles’ sizes 20 mm TL up to 375 mm TL. When the back-calculation was obtained, we estimated that the larger fish could have recruited in early 2006, three years before the first report was made. A continuous population monitoring and an ecological study, will allow us to clarify the real impact in the ecosystems of the region and so to propose the most effective control actions.

Self-Reported Prevalence of Symptomatic Adverse Reactions to Gluten and Adherence to Gluten-Free Diet in an Adult Mexican Population.

PubMed

Ontiveros, Noe; López-Gallardo, Jesús A; Vergara-Jiménez, Marcela J; Cabrera-Chávez, Francisco

2015-07-21

The prevalence of symptomatic adverse reactions to gluten and adherence to gluten-free diet in Latin American countries is unknown. These measurements are strongly linked to gluten-related disorders. This work aimed to estimate the prevalence of adverse reactions to oral gluten and the adherence to gluten-free diet in the adult Mexican population. To reach this aim, a self-administered questionnaire was designed and tested for clarity/comprehension and reproducibility. Then, a self-administered questionnaire-based cross-sectional study was conducted in the Mexican population. The estimated prevalence rates were (95% CI): 11.9% (9.9-13.5) and 7.8 (6.4-9.4) for adverse and recurrent adverse reactions to gluten respectively; adherence to gluten-free diet 3.7% (2.7-4.8), wheat allergy 0.72% (0.38-1.37); celiac disease 0.08% (0.01-0.45), and NCGS 0.97% (0.55-1.68). Estimated pooled prevalence of self-reported physician-diagnosis of gluten-related disorders was 0.88% (0.49-1.5), and 93.3% respondents reported adherence to gluten-free diet without a physician-diagnosis of gluten-related disorders. Symptom comparisons between those who reported recurrent adverse reactions to gluten and other foods showed statistically significant differences for bloating, constipation, and tiredness (p < 0.05). Gluten-related disorders may be underdiagnosed in the Mexican population and most people adhering to a gluten-free diet are doing it without proper diagnostic work-up of these disorders, and probably without medical/dietician advice.

Self-Reported Prevalence of Symptomatic Adverse Reactions to Gluten and Adherence to Gluten-Free Diet in an Adult Mexican Population

PubMed Central

Ontiveros, Noe; López-Gallardo, Jesús A.; Vergara-Jiménez, Marcela J.; Cabrera-Chávez, Francisco

2015-01-01

The prevalence of symptomatic adverse reactions to gluten and adherence to gluten-free diet in Latin American countries is unknown. These measurements are strongly linked to gluten-related disorders. This work aimed to estimate the prevalence of adverse reactions to oral gluten and the adherence to gluten-free diet in the adult Mexican population. To reach this aim, a self-administered questionnaire was designed and tested for clarity/comprehension and reproducibility. Then, a self-administered questionnaire-based cross-sectional study was conducted in the Mexican population. The estimated prevalence rates were (95% CI): 11.9% (9.9–13.5) and 7.8 (6.4–9.4) for adverse and recurrent adverse reactions to gluten respectively; adherence to gluten-free diet 3.7% (2.7–4.8), wheat allergy 0.72% (0.38–1.37); celiac disease 0.08% (0.01–0.45), and NCGS 0.97% (0.55–1.68). Estimated pooled prevalence of self-reported physician-diagnosis of gluten-related disorders was 0.88% (0.49–1.5), and 93.3% respondents reported adherence to gluten-free diet without a physician-diagnosis of gluten-related disorders. Symptom comparisons between those who reported recurrent adverse reactions to gluten and other foods showed statistically significant differences for bloating, constipation, and tiredness (p < 0.05). Gluten-related disorders may be underdiagnosed in the Mexican population and most people adhering to a gluten-free diet are doing it without proper diagnostic work-up of these disorders, and probably without medical/dietician advice. PMID:26197336

Mexican-Americans: Problems and Prospects.

ERIC Educational Resources Information Center

Moore, Joan W.

Comprising the second largest minority group in the United States, 87% of the Mexican American population live in five states in the Southwest. Characterized by a high birth rate, continuous immigration, and low income, the Mexicqn American population is an increasing source of concern in a welfare-oriented society. Educational attainment levels…

Concordance with dietary and lifestyle population goals for cancer prevention in Dutch, Scottish, Mexican, and Guatemalan population samples.

PubMed

Vossenaar, Marieke; Solomons, Noel W; Valdés-Ramos, Roxana; Anderson, Annie S

2010-01-01

We assessed concordance with selected population goal components of the 1997 World Cancer Research Fund/American Institute for Cancer Research (WCRF/AICR) diet and lifestyle recommendations to decrease cancer risk across four population samples. This was a prospectively designed survey examining concordance with the population goals of the WCRF/AICR recommendations using target criteria across sites. Population samples were from the Netherlands, Scotland, Mexico, and Guatemala. A total of 3564 men and women aged 18 to 70 y were recruited in equal proportions by site and gender. None of the four pooled samples met the target population average criteria for body mass index or refined sugar intake. The Guatemalan sample had concordance with the largest number of recommended cancer-prevention goals (10 of 12 selected WCRF/AICR components). Successively, Mexican, Scottish, and Dutch samples were concordant with seven, four, and three selected components, respectively. A prospectively designed research instrument and exhaustive prior examination of operative criteria allow for the assessment of group-level concordance with cancer-prevention goals. To the extent that the study samples reflect the respective national situations, geographic variance in concordance exists, with conditions and behaviors in Guatemala bringing that nation into more general compliance with the 1997 WCRF/AICR goals.

Age and Time Population Differences: Young Adults, Gen Xers, and Millennials

ERIC Educational Resources Information Center

Menard, Lauren A.

2013-01-01

Age and Time disparities in young adult research populations are common because young adults are defined by varying age spans; members of Generation X and Millennial generations may both be considered young adults; study years vary, affecting populations; and qualitative methods with limited age/year samples are frequently utilized. The current…

Weight Status of Mexican Immigrant Women: A Comparison With Women in Mexico and With US-Born Mexican American Women

PubMed Central

Ritterman-Weintraub, Miranda L.; Fernald, Lia C. H.; Kaufer-Horwitz, Martha

2013-01-01

Objectives. We assessed the association between birthplace, residence, or years in the United States and actual weight (body mass index), perceived weight accuracy, or provider screens for overweight or obesity among Mexican immigrant women. Methods. We used linked data from Health and Nutrition Examination Survey waves 2001–2006 and 2006 National Mexican Health and Nutrition Survey to compare 513 immigrants with 9527 women in Mexico and 342 US-born Mexican American women. Results. Immigrants were more likely than women in Mexico to be obese and to perceive themselves as overweight or obese after adjustment for confounders. Recent immigrants had similar weight-related outcomes as women in Mexico. Immigrants were less likely to be obese than were US-born Mexican Americans. Within the overweight or obese population, reported provider screens were higher among immigrants than among women in Mexico, but lower than among US-born Mexican Americans. US residency of at least 5 years but less than 20 years and reporting insufficient provider screens elevated obesity risk. Conclusions. Mexican-origin women in the United States and Mexico are at risk for overweight and obesity. We found no evidence of a “healthy immigrant” effect. PMID:23865649

Weight status of Mexican immigrant women: a comparison with women in Mexico and with US-born Mexican American women.

PubMed

Guendelman, Sylvia D; Ritterman-Weintraub, Miranda L; Fernald, Lia C H; Kaufer-Horwitz, Martha

2013-09-01

We assessed the association between birthplace, residence, or years in the United States and actual weight (body mass index), perceived weight accuracy, or provider screens for overweight or obesity among Mexican immigrant women. We used linked data from Health and Nutrition Examination Survey waves 2001-2006 and 2006 National Mexican Health and Nutrition Survey to compare 513 immigrants with 9527 women in Mexico and 342 US-born Mexican American women. Immigrants were more likely than women in Mexico to be obese and to perceive themselves as overweight or obese after adjustment for confounders. Recent immigrants had similar weight-related outcomes as women in Mexico. Immigrants were less likely to be obese than were US-born Mexican Americans. Within the overweight or obese population, reported provider screens were higher among immigrants than among women in Mexico, but lower than among US-born Mexican Americans. US residency of at least 5 years but less than 20 years and reporting insufficient provider screens elevated obesity risk. Mexican-origin women in the United States and Mexico are at risk for overweight and obesity. We found no evidence of a "healthy immigrant" effect.

Risky behaviors and educational attainment among young Mexican-origin mothers: The role of acculturative stress and the educational aspiration–expectation gap

PubMed Central

Bravo, Diamond Y.; Umaña-Taylor, Adriana J.; Toomey, Russell B.; Updegraff, Kimberly A.; Jahromi, Laudan B.

2017-01-01

The current longitudinal study examined how Mexican-origin adolescent mothers’ (N = 204) reports of acculturative stress during late adolescence were associated with their educational attainment and engagement in risky behaviors in young adulthood, 4 years post-partum; we also examined whether this association was mediated by discrepancies between adolescents’ educational aspirations and expectations. Findings revealed that mothers’ greater reports of stress regarding English competency pressures and pressures to assimilate were associated with a larger gap between their aspirations and expectations. Mothers’ reports of greater stress from pressures against assimilation, however, were associated with a smaller gap between aspirations and expectations. As expected, a larger gap between aspirations and expectations was associated with lower educational attainment and increased engagement in risky behaviors. Finally, significant mediation emerged, suggesting that the influence of stress from English competency pressures and pressures to assimilate on young mothers’ educational attainment and engagement in risky behaviors was mediated through the aspiration–expectation gap. Findings are discussed with respect to understanding discrepancies between young mothers’ aspirations and expectations in the context of acculturative stress. PMID:29263563

Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities.

PubMed

Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse

2016-01-01

Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people.

Mobility and International Collaboration: Case of the Mexican Scientific Diaspora.

PubMed

Marmolejo-Leyva, Rafael; Perez-Angon, Miguel Angel; Russell, Jane M

2015-01-01

We use a data set of Mexican researchers working abroad that are included in the Mexican National System of Researchers (SNI). Our diaspora sample includes 479 researchers, most of them holding postdoctoral positions in mainly seven countries: USA, Great Britain, Germany, France, Spain, Canada and Brazil. Their research output and impact is explored in order to determine their patterns of production, mobility and scientific collaboration as compared with previous studies of the SNI researchers in the periods 1991-2001 and 2003-2009. Our findings confirm that mobility has a strong impact on their international scientific collaboration. We found no substantial influence among the researchers that got their PhD degrees abroad from those trained in Mexican universities. There are significant differences among the areas of knowledge studied: biological sciences, physics and engineering have better production and impact rates than mathematics, geosciences, medicine, agrosciences, chemistry, social sciences and humanities. We found a slight gender difference in research production but Mexican female scientists are underrepresented in our diaspora sample. These findings would have policy implications for the recently established program that will open new academic positions for young Mexican scientists.

Mobility and International Collaboration: Case of the Mexican Scientific Diaspora

PubMed Central

Marmolejo-Leyva, Rafael; Perez-Angon, Miguel Angel; Russell, Jane M.

2015-01-01

We use a data set of Mexican researchers working abroad that are included in the Mexican National System of Researchers (SNI). Our diaspora sample includes 479 researchers, most of them holding postdoctoral positions in mainly seven countries: USA, Great Britain, Germany, France, Spain, Canada and Brazil. Their research output and impact is explored in order to determine their patterns of production, mobility and scientific collaboration as compared with previous studies of the SNI researchers in the periods 1991–2001 and 2003–2009. Our findings confirm that mobility has a strong impact on their international scientific collaboration. We found no substantial influence among the researchers that got their PhD degrees abroad from those trained in Mexican universities. There are significant differences among the areas of knowledge studied: biological sciences, physics and engineering have better production and impact rates than mathematics, geosciences, medicine, agrosciences, chemistry, social sciences and humanities. We found a slight gender difference in research production but Mexican female scientists are underrepresented in our diaspora sample. These findings would have policy implications for the recently established program that will open new academic positions for young Mexican scientists. PMID:26047501

Medicinal use of wild fauna by mestizo communities living near San Guillermo Biosphere Reserve (San Juan, Argentina).

PubMed

Hernandez, Jorge; Campos, Claudia M; Borghi, Carlos E

2015-01-21

Wild and domestic animals and their by-products are important ingredients in the preparation of curative, protective and preventive medicines. Despite the medicinal use of animals worldwide, this topic has received less attention than the use of medicinal plants. This study assessed the medicinal use of animals by mestizo communities living near San Guillermo MaB Reserve by addressing the following questions: What animal species and body parts are used? What ailments or diseases are treated with remedies from these species? To what extent do mestizo people use animals as a source of medicine? Is the use related to people's age? We conducted semi-structured interviews with 171 inhabitants (15-93 years old) of four villages close to the Reserve: Tudcúm, Angualasto, Malimán and Colangüil. We calculated the informant consensus factor and fidelity level to test homogeneity of knowledge and to know the importance of different medicinal uses for a given species. The medicinal use of animals was reported by 57% of the surveyed people. Seven species were mentioned: Rhea pennata, Lama guanicoe, Puma concolor, Pseudalopex sp., Lama vicugna, Lepus europaeus and Conepatus chinga. Several body parts were used: fat, leg, bezoar-stone, stomach, feather, meat, blood, feces, wool, and liver. The fat of R. pennata was the most frequently used animal part, followed by the bezoar stone and the leg of L. guanicoe. Animals were used to treat 22 ailments, with respiratory and nervous system disorders being the most frequently treated diseases with a high degree of consensus. Old people used animals as remedies more frequently than young residents, showing some differences among villages. A low number of animal species was mentioned as used for medicinal purposes, which could be explained by the perception of strong control related the legislation that bans hunting and the erosion of traditional knowledge produced by mestizaje. However, the presence of a traditional medicine is deeply

Cardiovascular health status and metabolic syndrome in Ecuadorian natives/Mestizos aged 40 years or more with and without stroke and ischemic heart disease--an atahualpa project case-control nested study.

PubMed

Del Brutto, Oscar H; Mera, Robertino M; Montalván, Martha; Del Brutto, Victor J; Zambrano, Mauricio; Santamaría, Milton; Tettamanti, Daniel

2014-04-01

Knowledge of regional-specific cardiovascular risk factors is mandatory to reduce the growing burden of stroke and ischemic heart disease in Latin American populations. We conducted a population-based case-control study to assess which risk factors are associated with the occurrence of vascular events in natives/mestizos living in rural coastal Ecuador. We assessed the cardiovascular health (CVH) status and the presence of the metabolic syndrome in all Atahualpa residents aged 40 years or more with stroke and ischemic heart disease and in randomly selected healthy persons to evaluate differences in the prevalence of such risk factors between patients and controls. A total of 120 persons (24 with stroke or ischemic heart disease and 96 matched controls) were included. A poor CVH status (according to the American Heart Association) was found in 87.5% case-patients and 81.3% controls (P = .464). The metabolic syndrome was present in the same proportion (58.3%) of case-patients and controls. Likewise, both sets of risk factors (poor CVH status and the metabolic syndrome) were equally prevalent among both groups (58.3% versus 49%, P = .501). This case-control study suggests that none of the measured risk factors is associated with the occurrence of vascular events. It is possible that some yet unmeasured risk factors or an unknown genetic predisposition may account for a sizable proportion of stroke and ischemic heart disease occurring in the native/mestizo population of rural coastal Ecuador. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Evaluation of VEGF gene polymorphisms and proliferative diabetic retinopathy in Mexican population.

PubMed

Gonzalez-Salinas, Roberto; Garcia-Gutierrez, Maria C; Garcia-Aguirre, Gerardo; Morales-Canton, Virgilio; Velez-Montoya, Raul; Soberon-Ventura, Vidal R; Gonzalez, Victoria; Lechuga, Rodrigo; Garcia-Solis, Pablo; Garcia-Gutierrez, David G; Garcia-Solis, Marco Vinicio; Saenz de Viteri, Manuel; Solis-S, Juan C

2017-01-01

To assess if the included vascular endothelial growth factor (VEGF) polymorphisms rs3025035, rs3025021 and rs2010963 are associated to proliferative retinopathy in a Mexican population with type 2 diabetes mellitus (T2DM). A case-control study was conducted in adult individuals with T2DM associated to proliferative retinopathy or non-proliferative retinopathy from Oct. 2014 to Jun. 2015 from the Retina Department of the Asociation to Prevent Blindness in Mexico. The selected patients were adults with a diagnosis of T2DM ≥5y. All subjects had a comprehensive ocular examination and the classification of the retinopathy severity was made considering the Early Treatment Diabetic Retinopathy Study (ETDRS) standardization protocols. Genomic DNA was extracted from whole fresh blood. All samples were genotyped by qPCR for selected VEGF polymorphisms. Hardy-Weinberg equilibrium was calculated by comparing Chi-square values between the expected and the observed values for genotype counts. In total 142 individuals were enrolled, 71 individuals with T2DM and associated proliferative retinopathy and 71 individuals with non-proliferative retinopathy. One-sided Fisher's exact test was performed for rs3025021 [OR (95% CI)=0.44(0.08-2.2); P =0.25] and rs2010963 [OR (95% CI)=0.63(0.25-1.6); P =0.23]. The minor allelic frequencies obtained were 26% for rs3025021, 10% for rs3025035 and 61% for rs2010963. The pairwise linkage disequilibrium between the three SNP was assessed, and was as follows: rs3025021 vs rs3025035: D'=1.0, r 2 =0.1043, P ≤0.0001; rs3025021 vs rs2010963: D'=0.442, r 2 =0.0446, P =0.149; rs3025035 vs rs2010963: D'=0.505, r 2 =0.0214, P =0.142. This is the first analysis involving VEGF polymorphisms and proliferative diabetic retinopathy in a Mexican population. A major finding of the present study is that none of the polymorphisms studied was significantly associated with proliferative retinopathy. Based on these results, we can infer that different populations

Evaluation of VEGF gene polymorphisms and proliferative diabetic retinopathy in Mexican population

PubMed Central

Gonzalez-Salinas, Roberto; Garcia-Gutierrez, Maria C; Garcia-Aguirre, Gerardo; Morales-Canton, Virgilio; Velez-Montoya, Raul; Soberon-Ventura, Vidal R; Gonzalez, Victoria; Lechuga, Rodrigo; Garcia-Solis, Pablo; Garcia-Gutierrez, David G; Garcia-Solis, Marco Vinicio; Saenz de Viteri, Manuel; Solis-S, Juan C

2017-01-01

AIM To assess if the included vascular endothelial growth factor (VEGF) polymorphisms rs3025035, rs3025021 and rs2010963 are associated to proliferative retinopathy in a Mexican population with type 2 diabetes mellitus (T2DM). METHODS A case-control study was conducted in adult individuals with T2DM associated to proliferative retinopathy or non-proliferative retinopathy from Oct. 2014 to Jun. 2015 from the Retina Department of the Asociation to Prevent Blindness in Mexico. The selected patients were adults with a diagnosis of T2DM ≥5y. All subjects had a comprehensive ocular examination and the classification of the retinopathy severity was made considering the Early Treatment Diabetic Retinopathy Study (ETDRS) standardization protocols. Genomic DNA was extracted from whole fresh blood. All samples were genotyped by qPCR for selected VEGF polymorphisms. Hardy-Weinberg equilibrium was calculated by comparing Chi-square values between the expected and the observed values for genotype counts. RESULTS In total 142 individuals were enrolled, 71 individuals with T2DM and associated proliferative retinopathy and 71 individuals with non-proliferative retinopathy. One-sided Fisher's exact test was performed for rs3025021 [OR (95% CI)=0.44(0.08-2.2); P=0.25] and rs2010963 [OR (95% CI)=0.63(0.25-1.6); P=0.23]. The minor allelic frequencies obtained were 26% for rs3025021, 10% for rs3025035 and 61% for rs2010963. The pairwise linkage disequilibrium between the three SNP was assessed, and was as follows: rs3025021 vs rs3025035: D'=1.0, r2=0.1043, P≤0.0001; rs3025021 vs rs2010963: D'=0.442, r2=0.0446, P=0.149; rs3025035 vs rs2010963: D'=0.505, r2=0.0214, P=0.142. CONCLUSION This is the first analysis involving VEGF polymorphisms and proliferative diabetic retinopathy in a Mexican population. A major finding of the present study is that none of the polymorphisms studied was significantly associated with proliferative retinopathy. Based on these results, we can infer that

Craniofacial Secular Change in Recent Mexican Migrants.

PubMed

Spradley, Katherine; Stull, Kyra E; Hefner, Joseph T

2016-01-01

Research by economists suggests that recent Mexican migrants are better educated and have higher socioeconomic status (SES) than previous migrants. Because factors associated with higher SES and improved education can lead to positive secular changes in overall body form, secular changes in the craniofacial complex were analyzed within a recent migrant group from Mexico. The Mexican group represents individuals in the act of migration, not yet influenced by the American environment, and thus can serve as a starting point for future studies of secular change in this population group. The excavation of a historic Hispanic cemetery in Tucson, Arizona, also allows for a comparison between historic Hispanics and recent migrants to explore craniofacial trends over a broad time period, as both groups originate from Mexico. The present research addresses two main questions: (1) Are cranial secular changes evident in recent Mexican migrants? (2) Are historic Hispanics and recent Mexican migrants similar? By studying secular changes within a migrant population group, secular trends may be detected, which will be important for understanding the biological variation of the migrants themselves and will serve as a preliminary investigation of secular change within Mexican migrants. The comparison of a sample of recent Mexican migrants with a historic Hispanic sample, predominantly of Mexican origin, allows us to explore morphological similarities and differences between early and recent Mexicans within the United States. Vault and face size and a total of 82 craniofacial interlandmark distances were used to explore secular changes within the recent Mexican migrants (females, n = 38; males, n = 178) and to explore the morphological similarities between historic Hispanics (females, n = 54; males, n = 58) and recent migrants. Sexes were separated, and multivariate adaptive regression splines and basis splines (quadratic with one knot) were used to assess the direction and magnitude

Neighborhood Contexts, Fathers, and Mexican American Young Adolescents' Internalizing Symptoms

ERIC Educational Resources Information Center

White, Rebecca M. B.; Roosa, Mark W.

2012-01-01

The family stress model posits that contextual stressors, such as neighborhood danger, negatively influence youth adjustment, including internalizing symptoms, via disruptions in parenting and family processes. The current study examined a culturally and contextually modified family stress model in a diverse sample of Mexican-origin fathers and…

All Was Not Lost: The Political Victories of Mexican Immigrants in Guadalupe, California.

ERIC Educational Resources Information Center

Garcia, Victor

Since the 1970s, the Mexican-descent population of Guadalupe, California, has spearheaded a drive for local political representation. This paper examines their struggles and challenges the misconception of Mexican campesino immigrants as politically apathetic in their new homeland. From 1960 to 1990, the percentage of Guadalupe's population that…

South by Southwest: The Mexican-American and His Heritage.

ERIC Educational Resources Information Center

Tebbel, John; Ruiz, Ramon Eduardo

The heritage of the Mexican American people who settled in the Southwest is discussed in this book with regard to Mexico's history, its revolution with Spain, Mexico today, and its relations with the United States. The illustrated book is designed for use by or with young people. (NQ)

Population pharmacogenetics of Ibero-Latinoamerican populations (MESTIFAR 2014).

PubMed

Sosa-Macias, Martha; Moya, Graciela E; LLerena, Adrián; Ramírez, Ronald; Terán, Enrique; Peñas-LLedó, Eva M; Tarazona-Santos, Eduardo; Galaviz-Hernández, Carlos; Céspedes-Garro, Carolina; Acosta, Hildaura

2015-01-01

MESTIFAR 2014 28-30 November 2014, Panama City, Panama The CEIBA consortium was created within the Ibero-American network of Pharmacogenetics (RIBEF) to study population pharmacogenetics. The current status of these initiatives and results of the MESTIFAR project were analyzed in Panama, 28-30 November 2014. The MESTIFAR project focused on studying CYPs genetic polymorphisms in populations of different ethnic origin. So far, more than 6000 healthy volunteers have been evaluated, making this one of the largest population pharmacogenomic studies worldwide. Three symposia were organized, 'Pharmacogenetics of indigenous and mestizos populations and its clinical implications', 'Methodological innovation in pharmacogenetics and its application in health', and 'General discussion and concluding remarks', about mechanisms and proposals for training, diffusion of pharmacogenetics for Spanish- and Portuguese-speaking health professionals, and 'bench to bedside' pilot projects.

Differences by gender at twelve months in a brief intervention trial among Mexican-origin young adults in the emergency department.

PubMed

Bernstein, Judith; Bernstein, Edward; Hudson, Dantia; Belanoff, Candice; Cabral, Howard J; Cherpitel, Cheryl J; Bond, Jason; Ye, Yu; Woolard, Robert; Villalobos, Susana; Ramos, Rebeca

2017-01-01

In this study, we investigate the role of gender in prevalence and consequences of binge drinking and brief intervention outcomes among Mexican-origin young adults aged 18-30 years at the U.S.-Mexico border. We conducted a secondary analysis, stratified by gender, from a randomized controlled trial of a brief motivational intervention in a hospital emergency department. Intervention effects for males included reductions in drinking frequency, binge drinking, and alcohol-related consequences. For females the intervention was associated with reduction in drinking frequency and binge drinking but did not have a significant effect on alcohol-related consequences. Results suggest a new direction for tailoring interventions to gender.

Mexican-Origin Women's Employment Instability. Working Paper No. 51.

ERIC Educational Resources Information Center

De Anda, Roberto M.

This paper compares the causes and consequences of employment instability among Mexican-origin women, White women, and White men. Data came from the work experience supplement in the March 1995 file of the Current Population Survey for a sample that included 1,399 Mexican-origin women, 17,092 White women, and 24,440 White men. All were experienced…

Social Capital: Strengthening Mexican-American Families through Parenting Education

ERIC Educational Resources Information Center

Montanez, Marcel; Devall, Esther; VanLeeuwen, Dawn M.

2010-01-01

Development of social capital was explored from a scientific evaluation of adult and teen parents (N = 102) who voluntarily participated in a parenting program. Most were unmarried, young, low-income, and Mexican-American. A strengths-based, culturally specific method was utilized to recruit and retain participants. After training, parents had…

Adaptation of a culturally relevant nutrition and physical activity program for low-income, Mexican-origin parents with young children.

PubMed

Kaiser, Lucia; Martinez, Judith; Horowitz, Marcel; Lamp, Catherine; Johns, Margaret; Espinoza, Dorina; Byrnes, Michele; Gomez, Mayra Muñoz; Aguilera, Alberto; de la Torre, Adela

2015-05-14

Latino children experience higher rates of obesity than do non-Latino white children. Family-centered nutrition interventions can slow the rate of weight gain in this population. Niños Sanos, Familia Sana (Healthy Children, Healthy Family) is a 5-year, community-based, participatory research study that targets rural Mexican-origin farmworker families with children aged 2 to 8 years in California's Central Valley. Adaptation of a culturally relevant obesity prevention program involved qualitative research to tailor key obesity prevention messages, pilot testing and implementation of key messages and activities at family nights, and continual modification to incorporate culturally innovative elements. Of the 238 families enrolled, 53% (125) attended the recommended minimum of 5 (of 10 possible) classes during the first year. A university and community partnership can guide development of a culturally tailored obesity prevention program that is suitable for reaching a high-risk Mexican-origin audience through cooperative extension and other public health programs.

Adaptation of a Culturally Relevant Nutrition and Physical Activity Program for Low-Income, Mexican-Origin Parents With Young Children

PubMed Central

Martinez, Judith; Horowitz, Marcel; Lamp, Catherine; Johns, Margaret; Espinoza, Dorina; Byrnes, Michele; Gomez, Mayra Muñoz; Aguilera, Alberto; de la Torre, Adela

2015-01-01

Latino children experience higher rates of obesity than do non-Latino white children. Family-centered nutrition interventions can slow the rate of weight gain in this population. Niños Sanos, Familia Sana (Healthy Children, Healthy Family) is a 5-year, community-based, participatory research study that targets rural Mexican-origin farmworker families with children aged 2 to 8 years in California’s Central Valley. Adaptation of a culturally relevant obesity prevention program involved qualitative research to tailor key obesity prevention messages, pilot testing and implementation of key messages and activities at family nights, and continual modification to incorporate culturally innovative elements. Of the 238 families enrolled, 53% (125) attended the recommended minimum of 5 (of 10 possible) classes during the first year. A university and community partnership can guide development of a culturally tailored obesity prevention program that is suitable for reaching a high-risk Mexican-origin audience through cooperative extension and other public health programs. PMID:25974142

Overweight and mortality in Mexican Americans.

PubMed

Stern, M P; Patterson, J K; Mitchell, B D; Haffner, S M; Hazuda, H P

1990-07-01

The Geriatric Research Center (GRC) table of desirable weights is based on the mortality experience of holders of 4.2 million policies issued by 25 life insurance companies in the USA and Canada. The GRC table defines optimum weight-for-height as the weight range which is associated with below average mortality for a given age and height group. People who fall outside this range, i.e. overweight or underweight, experience above average mortality for their age and height group. We classified 3176 Mexican Americans and 1841 non-Hispanic whites who participated in the San Antonio Heart Study according to the GRC table and found that Mexican Americans were less likely than non-Hispanic whites to be underweight and more likely to be overweight. The two effects did not offset one another, however, and fewer Mexican Americans were found to be in the 'just right' range. If the mortality experience of the population which generated the GRC table (largely non-Hispanic) applied to Mexican Americans, these results imply that Mexican Americans should have higher mortality rates than non-Hispanic whites. Vital statistics data from the state of Texas for the years 1979-81, however, fail to corroborate this prediction. Beyond age 45 years, an age range in which obesity and obesity-related disorders would be expected to exert an important influence on mortality, age-specific and age-adjusted all cause mortality was at last as good if not better in Mexican Americans than in non-Hispanic whites. These results could not be explained by ethnic differences in body fat distribution, since fat was less favorably distributed in Mexican Americans.(ABSTRACT TRUNCATED AT 250 WORDS)

Nesting habitat of Mexican spotted owls in the Sacramento Mountains

Treesearch

Joseph L. Ganey; Darrell L. Apprill; Todd A. Rawlinson; Sean C. Kyle; Ryan S. Jonnes; James P. Ward

2013-01-01

Understanding the habitat relationships of rare species is critical to conserving populations and habitats of those species. Nesting habitat is suspected to limit distribution of the threatened Mexican spotted owl (Strix occidentalis lucida), and may vary among geographic regions. We studied selection of nesting habitat by Mexican spotted owls within their home ranges...

Explanatory Emotion Talk in Mexican Immigrant and Mexican American Families.

ERIC Educational Resources Information Center

Cervantes, Christi A.

2002-01-01

Mother-child conversations during story-telling play were analyzed for patterns of emotion talk. Subjects were 48 Mexican immigrant and Mexican American mothers and their children aged 3-4. Contrary to previous findings, Mexican immigrant mothers used more explanations of emotions than labels. Mexican American mothers used both, equally. Results…

Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities

PubMed Central

Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse

2016-01-01

Background Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. Objectives The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. Design A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. Results The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. Conclusions The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people. PMID:26787421

Do Mexican immigrants "import" social gradients in health to the US?

PubMed

Buttenheim, Alison; Goldman, Noreen; Pebley, Anne R; Wong, Rebeca; Chung, Chang

2010-10-01

Greater educational attainment is consistently associated with lower mortality and better health, a pattern known as the social gradient. However, recent research suggests that Mexican-origin adults in the US have weak or flat gradients, in contrast to steep gradients for non-Hispanic whites. In this study we evaluate one hypothesis for this finding: Is the relative weakness of education gradients in health behaviors observed among Mexican-origin adults in the US due to weak gradients in the sending population? We test this "imported gradients" hypothesis with data from two nationally-representative datasets: the US National Health Interview Survey (NHIS) and the Mexican National Health Survey (ENSA 2000). We compare education gradients in smoking and obesity for recently-arrived Mexican immigrants in the US to the corresponding gradients in high-migration regions of Mexico. Results partially support the imported gradients hypothesis and have implications for health education and promotion programs targeted to immigrant populations to reduce racial and ethnic disparities in health in the US.

Undocumented Migration and the Residential Segregation of Mexicans in New Destinations1

PubMed Central

Hall, Matthew; Stringfield, Jonathan

2014-01-01

This study uses data from the 2000 Census and 2005–2009 American Community Survey to examine the impact of undocumented Mexican migration to new destinations on residential segregation between Mexican immigrants and native-born whites and native-born blacks. We find that Mexican-white and Mexican-black segregation is higher in new Mexican gateways than in established areas and that, for Mexican-immigrant segregation from whites, this heightened level of residential segregation in new destinations can be explained by the high presence of unauthorized Mexican immigrants living there which tends to bolster segregation between the two groups. By contrast, Mexican-immigrant segregation from native-born blacks tends to be lower in areas with larger undocumented populations, a pattern that is especially true in new destinations. Neither of these opposing effects of legal status on Mexican-immigrant segregation can be explained by compositional differences in assimilation (English ability and earnings) between documented and undocumented immigrants nor by structural variation in metropolitan areas, suggesting a unique association between legal status and segregation. PMID:24913945

Genetic association analysis of Osteopontin and Matrix Gla Protein genes polymorphisms with primary knee osteoarthritis in Mexican population.

PubMed

Borgonio-Cuadra, Verónica Marusa; González-Huerta, Norma Celia; Rojas-Toledo, Emma Xochitl; Morales-Hernández, Eugenio; Pérez-Hernández, Nonanzit; Rodríguez-Pérez, José Manuel; Tovilla-Zárate, Carlos Alfonso; González-Castro, Thelma Beatriz; Hernández-Díaz, Yazmín; López-Narváez, María Lilia; Miranda-Duarte, Antonio

2018-05-18

Primary osteoarthritis (OA) is a complex entity in which several loci related to different molecular pathways or classes of molecules are associated with its development as demonstrated through genetic association studies. Genes involved in bone formation and mineralization, such as osteopontin (OPN) and Matrix Gla protein (MGP), could also be related with OA. The aim of this study was to evaluate the association between the genetic variants of OPN and MGP with primary knee osteoarthritis in a Mexican population. A case-control study was conducted in 296 patients with primary knee osteoarthritis and in 354 control subjects. Study groups were assessed radiologically. The rs11730582 of OPN and rs1800802, rs1800801, and rs4236 of MGP were determined by TaqMan allele discrimination assays. The haplotypes of the polymorphisms of MGP were constructed. The association was tested through univariate and multivariate non-conditional logistic regression analyses. The polymorphisms of MGP complied with Hardy-Weinberg (HW) equilibrium. The polymorphisms of OPN and MGP were not significantly associated with primary knee osteoarthritis in the codominant, dominant, and recessive models (p > 0.05). Our study suggests that there are no associations between OPN and MGP polymorphisms with primary knee osteoarthritis in Mexican population.

The Culture of Mexican-Americans: Its Importance for Early Childhood Educators

ERIC Educational Resources Information Center

Saracho, Olivia N.; Martinez-Hancock, Frances

2007-01-01

This paper provides an introduction to the Mexican-American culture, describing (1) cultural diversity and linguistic policies in the United States; (2) cultural and linguistic studies that have examined the backgrounds of Mexican-American individuals; (3) the characteristics of this population; (4) issues on discrimination and human relations;…

[Cerebral dominance. A study on left-handedness in a Mexican population group].

PubMed

Silva-Rodríguez, A; Escobar-Izquierdo, A

1996-01-01

The term "cerebral dominance" suggests that one hemisphere is leader and the other subordinate; however, cerebral dominance concerning all psychic functions is less frequent than we could suppose. Among the functions in which cerebral dominance is manifested the most notorious is the manual preference. Thus according to the hand being used for general motor activities the persons are named right-handers or left-handers; nevertheless people are less lateralized than we could suppose, and most right-handers may have hidden left-handedness. In order to obtain some data on this subject in Mexican population, a study was done in 300 university students. Of the 275 right-handers only 144 fulfilled the requirements to qualify as such after performing the complementary tests; 25 left-handers came to a mere amount of 5. The data indicate that partial lateralization is more frequent than total lateralization.

Y-chromosome diversity in Native Mexicans reveals continental transition of genetic structure in the Americas.

PubMed

Sandoval, Karla; Moreno-Estrada, Andres; Mendizabal, Isabel; Underhill, Peter A; Lopez-Valenzuela, Maria; Peñaloza-Espinosa, Rosenda; Lopez-Lopez, Marisol; Buentello-Malo, Leonor; Avelino, Heriberto; Calafell, Francesc; Comas, David

2012-07-01

The genetic characterization of Native Mexicans is important to understand multiethnic based features influencing the medical genetics of present Mexican populations, as well as to the reconstruct the peopling of the Americas. We describe the Y-chromosome genetic diversity of 197 Native Mexicans from 11 populations and 1,044 individuals from 44 Native American populations after combining with publicly available data. We found extensive heterogeneity among Native Mexican populations and ample segregation of Q-M242* (46%) and Q-M3 (54%) haplogroups within Mexico. The northernmost sampled populations falling outside Mesoamerica (Pima and Tarahumara) showed a clear differentiation with respect to the other populations, which is in agreement with previous results from mtDNA lineages. However, our results point toward a complex genetic makeup of Native Mexicans whose maternal and paternal lineages reveal different narratives of their population history, with sex-biased continental contributions and different admixture proportions. At a continental scale, we found that Arctic populations and the northernmost groups from North America cluster together, but we did not find a clear differentiation within Mesoamerica and the rest of the continent, which coupled with the fact that the majority of individuals from Central and South American samples are restricted to the Q-M3 branch, supports the notion that most Native Americans from Mesoamerica southwards are descendants from a single wave of migration. This observation is compatible with the idea that present day Mexico might have constituted an area of transition in the diversification of paternal lineages during the colonization of the Americas. Copyright © 2012 Wiley Periodicals, Inc.

Depression among older Mexican American caregivers.

PubMed

Hernandez, Ann Marie; Bigatti, Silvia M

2010-01-01

The authors compared depression levels between older Mexican American caregivers and noncaregivers while controlling for confounds identified but not controlled in past research. Mexican American caregivers and noncaregivers (N = 114) ages 65 and older were matched on age, gender, socioeconomic status, self-reported health, and acculturation. Caregivers reported higher scores on the Center for Epidemiologic Studies Depression scale (CES-D) and were more likely to score in the depressed range than noncaregivers. In a regression model with all participants, group classification (caregiver vs. noncaregiver) and health significantly predicted CES-D scores. A model with only caregivers that included caregiver burden, self-rated health, and gender significantly predicted CES-D scores, with only caregiver burden entering the regression equation. These results suggest that older Mexican American caregivers are more depressed than noncaregivers, as has been found in younger populations. (c) 2009 APA, all rights reserved.

Depression in the barrio: An analysis of the risk and protective nature of cultural values among Mexican American substance users.

PubMed

Villarreal, Yolanda R; Torres, Luis R; Stotts, Angela L; Ren, Yi; Sampson, Mcclain; Klawans, Michelle R; Bordnick, Patrick S

2017-06-07

Understanding the effect of cultural values on depression and how social networks influence these relationships may be important in the treatment of substance-using, Mexican American populations. Latino cultural values, familismo, personalismo, fatalismo, and machismo, may be associated with depression among Latinos. The current study identified the association of traditional Latino values on depressive symptomatology among a sample of Mexican American heroin injectors. A cross-sectional research design and field-intensive outreach methodology were utilized to recruit 227 Mexican American men. Participants were categorized into depressed and nondepressed groups. Relations among cultural values and depression were examined using logistic regression. Findings indicate that drug-using men with higher familismo and fatalismo scores are protected against depressive symptomatology. Relations between familismo and depression seem to be moderated by having a drug use network. In addition, findings reveal that age is inversely related to depressive symptomatology. Young Mexican American heroin users who do not ascribe to traditional Latino values may be highly associated with depression and therefore more vulnerable to riskier drug use behaviors. Moreover, drug-using social networks may affect the protective nature of certain cultural values. Further research is needed to identify whether culturally tailored treatments can cultivate these values while simultaneously undermining the effect of substance-using social networks in order to reduce depression symptoms among this group of high-risk substance users.

Examining a paradox: does religiosity contribute to positive birth outcomes in Mexican American populations?

PubMed

Magaña, A; Clark, N M

1995-02-01

A particularly interesting and consistent finding regarding the health of the Latino population is that Mexican American women, despite their relatively lower socioeconomic status, deliver significantly fewer low birth weight babies and lose fewer babies to all causes during infancy than do women of other ethnic groups. A central thesis of this discussion is that the religiosity and spirituality of many of these Latinas, a key factor in their culture, may protect them and their infants through the pre- and antenatal phases of life. We also suggest that lack of research, related to cultural similarities and differences in Hispanic/Latino subgroups, can lead to faulty or simplistic understanding regarding their health behavior and health status.

Validity of a parent vocabulary checklist for young Spanish speaking children of Mexican immigrants.

PubMed

Guiberson, Mark

2008-01-01

The primary objective of the current investigation was to examine the concurrent and predictive validity of a parent vocabulary checklist with young Spanish speaking children of Mexican immigrants. This study implemented a longitudinal approach. Nineteen families participated when children were 15-16 months of age, and then again at 30-32 months of age. The Spanish version of the MacArthur Communicative Development Inventory (Inventarios del Desarrollo de Habilidades Communicativas, INV) and spontaneous language samples collected during naturalistic play were used to examine the relationship between observed and reported vocabulary. Vocabulary reported through the INV-II and vocabulary observed at 30-32 months were significantly correlated, suggesting that the INV-II captures a valid representation of vocabulary at this age. Comparatively, vocabulary reported on the INV-I, was not correlated with observed vocabulary at 15-16 months of age or reported or observed vocabulary at 30-32 months of age. These results suggest that the INV-I, when used with 14-16-month-olds, demonstrates limited concurrent and predictive validity. Implications for the clinical use of the INV-I and INV-II are presented.

Periodontitis associated with chronic kidney disease among Mexican Americans.

PubMed

Ioannidou, Effie; Hall, Yoshio; Swede, Helen; Himmelfarb, Jonathan

2013-01-01

In comparison to non-Hispanic whites, a number of health-care disparities, including poor oral health, have been identified among Hispanics in general and Mexican Americans in particular. We hypothesized that Mexican Americans with chronic kidney disease (CKD) would have higher prevalence of chronic periodontitis compared with Mexican Americans with normal kidney function, and that the level of kidney function would be inversely related to the prevalence of periodontal disease. We examined this hypothesis using the National Health and Nutrition Examination Survey 1988-1994 (NHANES III) data set. We followed the American Academy of Periodontology/Center for Disease Control and Prevention case definition for periodontitis. Glomerular filtration rate was estimated using the CKD-Epidemiology equation for Hispanic populations. The classification to CKD stages was based on the National Kidney Foundation Kidney Disease Outcomes Quality Initiative. Periodontitis prevalence increased across the kidney function groups showing a statistically significant dose-response association (P<0.001). Mexican Americans with reduced kidney function were twofold more likely to have periodontitis compared with Mexican Americans with normal kidney function after adjusting for potential confounders such as smoking, diabetes, and socioeconomic status. Multivariate adjusted odds ratio for periodontitis significantly increased with 1, 5, and 10 mL/minute estimated glomerular filtration rate reduction from the mean. This is the first report, to the best our knowledge, that showed an increase of periodontitis prevalence with decreased kidney function in this population. © 2012 American Association of Public Health Dentistry.

Periodontitis associated with Chronic Kidney Disease among Mexican Americans

PubMed Central

Ioannidou, Effie; Hall, Yoshio; Swede, Helen; Himmelfarb, Jonathan

2012-01-01

Objective In comparison to non-Hispanic whites, a number of healthcare disparities, including poor oral health, have been identified among Hispanics in general and Mexican-Americans in particular. We hypothesized that Mexican-Americans with Chronic Kidney disease (CKD) would have higher prevalence of chronic periodontitis compared to Mexican Americans with normal kidney function, and that the level of kidney function would be inversely related to the prevalence of periodontal disease. Method We examined this hypothesis using the National Health and Nutrition Examination Survey 1988–1994 (NHANES III) dataset. We followed the American Academy of Periodontology (AAP)/Center for Disease Control and Prevention (CDC) case definition for periodontitis. Glomerular filtration rate was estimated using the CKD-Epidemiology (EPI) equation for Hispanic populations. The classification to CKD stages was based on the National Kidney Foundation Kidney Disease Outcomes Quality Initiative. Results Periodontitis prevalence increased across the kidney function groups showing a statistically significant dose-response association (p<0.001). Mexican Americans with reduced kidney function were 2-fold more likely to have periodontitis compared to Mexican Americans with normal kidney function after adjusting for potential confounders such as smoking, diabetes and socioeconomic status. Multivariate adjusted Odds Ratio for periodontitis significantly increased with 1, 5 and 10 mL/minute eGFR reduction from the mean. Conclusion This is the first report, to the best our knowledge, that showed an increase of periodontitis prevalence with decreased kidney function in this population. PMID:22775287

Immigration and suicidal behavior among Mexicans and Mexican Americans.

PubMed

Borges, Guilherme; Breslau, Joshua; Su, Maxwell; Miller, Matthew; Medina-Mora, Maria Elena; Aguilar-Gaxiola, Sergio

2009-04-01

We examined migration to the United States as a risk factor for suicidal behavior among people of Mexican origin. We pooled data from 2 nationally representative surveys in the United States (2001-2003; n = 1284) and Mexico (2001-2002; n = 5782). We used discrete time survival models to account for time-varying and time-invariant characteristics, including psychiatric disorders. Risk for suicidal ideation was higher among Mexicans with a family member in the United States (odds ratio [OR] = 1.50; 95% confidence interval [CI] = 1.06, 2.11), Mexican-born immigrants who arrived in the United States at 12 years or younger (OR = 1.84; 95% CI = 1.09, 3.09), and US-born Mexican Americans (OR = 1.56; 95% CI = 1.03, 2.38) than among Mexicans with neither a history of migration to the United States nor a family member currently living there. Risk for suicide attempts was also higher among Mexicans with a family member in the United States (OR = 1.68; 95% CI = 1.13, 2.52) and US-born Mexican Americans (OR = 1.97; 95% CI = 1.06, 3.65). Selection bias caused by differential migration or differential return migration of persons at higher risk of suicidal ideation or attempt did not account for these findings. Public health efforts should focus on the impact of Mexico-US migration on family members of migrants and on US-born Mexican Americans.

Immigration and Suicidal Behavior Among Mexicans and Mexican Americans

PubMed Central

Breslau, Joshua; Su, Maxwell; Miller, Matthew; Medina-Mora, Maria Elena; Aguilar-Gaxiola, Sergio

2009-01-01

Objectives. We examined migration to the United States as a risk factor for suicidal behavior among people of Mexican origin. Methods. We pooled data from 2 nationally representative surveys in the United States (2001–2003; n = 1284) and Mexico (2001–2002; n = 5782). We used discrete time survival models to account for time-varying and time-invariant characteristics, including psychiatric disorders. Results. Risk for suicidal ideation was higher among Mexicans with a family member in the United States (odds ratio [OR] = 1.50; 95% confidence interval [CI] = 1.06, 2.11), Mexican-born immigrants who arrived in the United States at 12 years or younger (OR = 1.84; 95% CI = 1.09, 3.09), and US-born Mexican Americans (OR = 1.56; 95% CI = 1.03, 2.38) than among Mexicans with neither a history of migration to the United States nor a family member currently living there. Risk for suicide attempts was also higher among Mexicans with a family member in the United States (OR = 1.68; 95% CI = 1.13, 2.52) and US-born Mexican Americans (OR = 1.97; 95% CI = 1.06, 3.65). Selection bias caused by differential migration or differential return migration of persons at higher risk of suicidal ideation or attempt did not account for these findings. Conclusions. Public health efforts should focus on the impact of Mexico–US migration on family members of migrants and on US-born Mexican Americans. PMID:19150909

Factors Contributing to Background Television Exposure in Low-Income Mexican-American Preschoolers.

PubMed

Thompson, Darcy A; Tschann, Jeanne M

2016-09-01

Objective Background television (TV) exposure is harmful to young children, yet few studies have focused on predictors of exposure. This study's objectives were to elucidate demographic, environmental, and behavioral correlates of background TV exposure in low-income Mexican-American preschoolers and to explore caregiver beliefs about the impact of such exposure. Methods A convenience sample of low-income Mexican-American female primary caregivers of preschoolers (3-5 years old, n = 309), recruited in safety-net clinics, were surveyed by phone. Caregivers reported the frequency of their child's exposure to background TV and responded to questions on the home media environment, TV use, and whether they had thought about background TV exposure and its impact on their child. Results Background TV exposure was common; 43 % reported that their child was often, very often, or always exposed to background TV. More hours of TV viewing by the caregiver and greater frequency of TV viewing during meals were associated with an increased frequency of exposure to background TV. Only 49 % of participants had ever thought about the impact of background TV. Believing that background TV is not harmful was associated with higher levels of background TV exposure. Conclusions Findings suggest that background TV exposure is frequent and caregiver awareness of its potential impact is low in low-income Mexican-American families. Beliefs that background TV is not harmful may predict risk of exposure. Potential targets for interventions focused on reducing background TV exposure in this population include increasing caregiver awareness of the potential negative impact of such TV exposure.

Factors contributing to background television exposure in low-income Mexican American preschoolers

PubMed Central

Thompson, Darcy A.; Tschann, Jeanne M.

2016-01-01

Objective Background television (TV) exposure is harmful to young children, yet few studies have focused on predictors of exposure. This study’s objectives were to elucidate demographic, environmental, and behavioral correlates of background TV exposure in low-income Mexican American preschoolers and to explore caregiver beliefs about the impact of such exposure. Methods A convenience sample of low-income Mexican American female primary caregivers of preschoolers (3–5 years old, n=309), recruited in safety-net clinics, were surveyed by phone. Caregivers reported the frequency of their child’s exposure to background TV and responded to questions on the home media environment, TV use, and whether they had thought about background TV exposure and its impact on their child. Results Background TV exposure was common; 43% reported that their child was often, very often, or always exposed to background TV. More hours of TV viewing by the caregiver and greater frequency of TV viewing during meals were associated with an increased frequency of exposure to background TV. Only 49% of participants had ever thought about the impact of background TV. Believing that background TV is not harmful was associated with higher levels of background TV exposure. Conclusions Findings suggest that background TV exposure is frequent and caregiver awareness of its potential impact is low in low-income Mexican American families. Beliefs that background TV is not harmful may predict risk of exposure. Potential targets for interventions focused on reducing background TV exposure in this population include increasing caregiver awareness of the potential negative impact of such TV exposure. PMID:27007983

Diabetes mellitus, hypertension and frailty: A population-based, cross-sectional study of Mexican older adults.

PubMed

Castrejón-Pérez, Roberto Carlos; Gutiérrez-Robledo, Luis Miguel; Cesari, Matteo; Pérez-Zepeda, Mario Ulises

2017-06-01

Chronic diseases are frequent in older adults, particularly hypertension and diabetes. The relationship between frailty and these two conditions is still unclear. The aim of the present analyses was to explore the association between frailty with diabetes and hypertension in Mexican older adults. Analyses of the Mexican Health and Nutrition Survey, a cross-sectional survey, are presented. Data on diabetes and hypertension were acquired along with associated conditions (time since diagnosis, pharmacological treatment, among others). A 36-item frailty index was constructed and rescaled to z-values (individual scores minus population mean divided by one standard deviation). Multiple linear regression models were carried out, adjusted for age and sex. From 7164 older adults, 54.8% were women, and their mean age was 70.6 years with a mean frailty index score of 0.175. The prevalence of diabetes was of 22.2%, and 37.3% for hypertension. An independent association between diabetes, hypertension or both conditions (coefficients 0.28, 0.4 and 0.63, respectively, P < 0.001) with frailty was found. Having any diabetic complication was significantly associated with frailty with a coefficient of 0.55 (95% CI 0.45-0.65, P < 0.001) in the adjusted model. The number of years since diagnosis was also associated with frailty for both conditions. Diabetes and hypertension are associated with frailty. In addition, an incremental association was found when both conditions were present or with worse associated features (any complication, more time since diagnosis). Frailty should be of particular concern in populations with a high prevalence of these conditions. Geriatr Gerontol Int 2017; 17: 925-930. © 2016 Japan Geriatrics Society.

Tailored combination prevention packages and PrEP for young key populations

PubMed Central

Pettifor, Audrey; Nguyen, Nadia L; Celum, Connie; Cowan, Frances M; Go, Vivian; Hightow-Weidman, Lisa

2015-01-01

Introduction Young key populations, defined in this article as men who have sex with men, transgender persons, people who sell sex and people who inject drugs, are at particularly high risk for HIV. Due to the often marginalized and sometimes criminalized status of young people who identify as members of key populations, there is a need for HIV prevention packages that account for the unique and challenging circumstances they face. Pre-exposure prophylaxis (PrEP) is likely to become an important element of combination prevention for many young key populations. Objective In this paper, we discuss important challenges to HIV prevention among young key populations, identify key components of a tailored combination prevention package for this population and examine the role of PrEP in these prevention packages. Methods We conducted a comprehensive review of the evidence to date on prevention strategies, challenges to prevention and combination prevention packages for young key populations. We focused specifically on the role of PrEP in these prevention packages and on young people under the age of 24, and 18 in particular. Results and discussion Combination prevention packages that include effective, acceptable and scalable behavioural, structural and biologic interventions are needed for all key populations to prevent new HIV infections. Interventions in these packages should meaningfully involve beneficiaries in the design and implementation of the intervention, and take into account the context in which the intervention is being delivered to thoughtfully address issues of stigma and discrimination. These interventions will likely be most effective if implemented in conjunction with strategies to facilitate an enabling environment, including increasing access to HIV testing and health services for PrEP and other prevention strategies, decriminalizing key populations’ practices, increasing access to prevention and care, reducing stigma and discrimination, and

Teaching English Critically to Mexican Children

ERIC Educational Resources Information Center

López-Gopar, Mario E.

2014-01-01

The purpose of this article is to present one significant part of a large-scale critical-ethnographic-action-research project (CEAR Project) carried out in Oaxaca, Mexico. The overall CEAR Project has been conducted since 2007 in different Oaxacan elementary schools serving indigenous and mestizo (mixed-race) children. In the CEAR Project, teacher…

Living Telenovelas/Telenovelizing Life: Mexican American Girls' Identities and Transnational Telenovelas.

ERIC Educational Resources Information Center

Mayer, Vicki

2003-01-01

Examines the local reception of global Spanish-language soap operas, or telenovelas. Explores how young people talked about Mexican telenovelas in daily life. Concludes that the telenovela, within certain limits, reflected some of the national, ethnic, gender, and class tensions that defined the viewers' identities as working-class, Mexican…

Mapping young stellar populations towards Orion with Gaia DR1

NASA Astrophysics Data System (ADS)

Zari, Eleonora; Brown, Anthony G. A.

2018-04-01

OB associations are prime sites for the study of star formation processes and of the interaction between young massive stars with the interstellar medium. Furthermore, the kinematics and structure of the nearest OB associations provide detailed insight into the properties and origin of the Gould Belt. In this context, the Orion complex has been extensively studied. However, the spatial distribution of the stellar population is still uncertain: in particular, the distances and ages of the various sub-groups composing the Orion OB association, and their connection to the surrounding interstellar medium, are not well determined. We used the first Gaia data release to characterize the stellar population in Orion, with the goal to obtain new distance and age estimates of the numerous stellar groups composing the Orion OB association. We found evidence of the existence of a young and rich population spread over the entire region, loosely clustered around some known groups. This newly discovered population of young stars provides a fresh view of the star formation history of the Orion region.

Acculturation and substance use in a Mexican American college student sample.

PubMed

Mercado, Alfonso; Ramirez, Maria; Sharma, Rachita; Popan, Jason; Avalos Latorre, Maria Luisa

2017-01-01

Although the association between acculturation and substance use among Latino groups is important, it is often understudied, especially within specific Latino groups living in geographically distinct communities, such as the Mexican American population in South Texas. The researchers of this study aimed to better understand the effect of acculturation on substance use and alcohol dependence in a Mexican American college student population. This survey study investigated the correlation between acculturation and substance use and dependence by using the Vancouver Index of Acculturation (VIA), items related to substance use (nicotine, marijuana, and cocaine) in a Mexican American college student sample (N = 1,494), and the Short Alcohol Dependence Data Questionnaire (SADD; N = 715). The study was conducted in the Texas-Mexico border region. The results suggest that higher levels of acculturation do not predict increased drug use or alcohol dependence in the Mexican American college students. However, acculturation was found to be associated with lower use of cocaine and marijuana. The discussion examines commonalities and differences in drug use and dependence. Specifically, acculturation seems to have an inverse relationship to substance use and may serve as a protective factor to licit and illicit drug use among Mexican American college students.

What's Values Got to Do with It? Thriving among Mexican/Mexican American College Students

ERIC Educational Resources Information Center

Morgan Consoli, Melissa L.; Llamas, Jasmín; Consoli, Andrés J.

2016-01-01

The authors examined traditional Mexican/Mexican American and perceived U.S. mainstream cultural values as predictors of thriving. One hundred twenty-four (37 men, 87 women) self-identified Mexican/Mexican American college students participated in the study. The traditional Mexican/Mexican American cultural values of family support and religion…

Health care access among Mexican Americans with different health insurance coverage.

PubMed

Treviño, R P; Treviño, F M; Medina, R; Ramirez, G; Ramirez, R R

1996-05-01

This study describes the rates of health care access among Mexican Americans with different health insurance coverage. An interview questionnaire was used to collect information regarding sociodemographics, perceived health status, health insurance coverage, and sources of health care from a random sample of 501 Mexican Americans from San Antonio, Texas. Health care access was determined more by having health insurance coverage than by health care needs. Poor Mexican Americans with health insurance had higher health care access rates than did poor Mexican Americans without health insurance. Health care access may improve health care outcomes, but more comprehensive community-based campaigns to promote health and better use of health services in underprivileged populations should be developed.

Depression, obesity, and metabolic syndrome: prevalence and risks of comorbidity in a population-based representative sample of Mexican Americans.

PubMed

Olvera, Rene L; Williamson, Douglas E; Fisher-Hoch, Susan P; Vatcheva, Kristina P; McCormick, Joseph B

2015-10-01

We examined the prevalence of depression, obesity, and metabolic syndrome and associations between them in a population-based representative cohort of Mexican Americans living on the United States-Mexico border. The sample in this cross-sectional analysis consisted of 1,768 Mexican American adults (≥ 18 years of age) assessed between the years 2004 and 2010, with whom we tested our central hypothesis of a significant relationship between obesity and depression. Depression was measured using the Center for Epidemiologic Studies-Depression scale (CES-D) with a cutoff score of ≥ 16 for depression and a cutoff score of ≥ 27 for severe depression. We categorized body mass index (BMI) values as obese (≥ 30kg/m(2)) and later subdivided the obese subjects into obese (30-39 kg/m(2)[inclusive]) and morbidly obese (≥ 40 kg/m(2)). Metabolic syndrome was defined using the American Heart Association definition requiring at least 3 of the following: increased waist circumference, elevated triglycerides, reduced high-density lipoprotein (HDL) cholesterol, elevated blood pressure, and elevated fasting glucose. Weighted data were analyzed to establish prevalence of depression, obesity, and metabolic syndrome. Univariate and multivariable weighted regression models were used to test potential associations between these disorders. Using weighted prevalence, we observed high rates of depression (30%), obesity (52%), and metabolic syndrome (45%). Univariate models revealed female gender (P = .0004), low education (P = .003), low HDL level (P = .009), and increased waist circumference (P = .03) were associated with depression. Female gender (P = .01), low education (P = .003), and morbid obesity (P = .002) were risk factors for severe depression and remained significant in multivariable models. In this large cohort of Mexican Americans, obesity, female gender, and low education were identified risk factors for depression. These indicators may serve as targets for early

Mexican Proverbs: The Philosophy, Wisdom and Humor of a People.

ERIC Educational Resources Information Center

Ballesteros, Octavio A.

Careful reading of proverbs can aid an individual to develop self-awareness by providing insights into what one cultural group considers desirable human behavior. Respect for the elderly can be taught to the young through the study of proverbs. Through their proverbs, the Mexicans reveal their friendliness, love of animals, sense of humor, and…

Primary Health Care Utilization by the Mexican Indigenous Population: The Role of the Seguro Popular in Socially Inequitable Contexts

PubMed Central

Leyva-Flores, Rene; Servan-Mori, Edson; Infante-Xibille, Cesar; Pelcastre-Villafuerte, Blanca Estela; Gonzalez, Tonatiuh

2014-01-01

Objective To analyze the relationship between primary health care utilization and extended health insurance coverage under the Seguro Popular (SP) among Mexican indigenous people. Methodology A cross-sectional analysis was conducted using data from the Mexican National Nutrition Survey 2012 (n = 194,758). Quasi-experimental matching methods and nonlinear regression probit models were used to estimate the influence of SP on primary health care utilization. Results 25% of the Mexican population reported having no health insurance coverage, while 59% of indigenous versus 35% of non-indigenous reported having SP coverage. Health problems were reported by 13.9% of indigenous vs. 10.5% of non-indigenous; of these, 52.8% and 57.7% respectively, received primary health care (p<0.05). Economic barriers were the most frequent reasons for not using primary health care services. The probability of utilizing primary health care services was 11.5 percentage points higher (p<0.01) for indigenous SP affiliates in comparison with non-indigenous, in similar socioeconomic conditions. Conclusion Socioeconomic conditions, not ethnicity per-se, determine whether people utilize primary health care services. Therefore, SP can be conceived as a public policy strategy which acts as a social buffer by enhancing health care utilization regardless of ethnicity. Further analysis is required to explore the potential gaps as a result of SP coverage among socially vulnerable groups. PMID:25099399

The United Mexican States: an update.

PubMed

Hakkert, R; Aguirre, E J

1988-09-01

Although the popular North American opinion of Mexico is one that paints a picture of a poor, disadvantaged country, South America sees Mexico has a richer more prosperous nation. It is observed that only in the Latin American countries of Venezuela, Suriname and Trinidad and Tobago do consumers have higher incomes than Mexican consumers. Moreover, while millions of Mexicans migrate to the United States to seek a better standard of living, several thousand Central American refugees illegally migrate to Mexico in search of a better life. This better life includes an increased age of lie expectancy from 51 years in the 1950s to 64 years in the late 1970s. There have also been improvements in health care and school enrollments and in the low cost availability of education. Tourism and the prospect of the manufacturing of energy are significant, positive factors working in favor of an improved Mexican economy and a higher overall quality of life. However, Mexico faces serious problems such as a mounting foreign debt. Also rising is Mexico's population which has doubled since 1964 and which continues to grow at a rate of 1.9%. Economic programs and reforms and family development planning have been instituted in response to the countries' current recession and population growth and have begun to show positive results.

Prevalence of metabolic syndrome among elderly Mexicans.

PubMed

Ortiz-Rodríguez, María Araceli; Yáñez-Velasco, Lucía; Carnevale, Alessandra; Romero-Hidalgo, Sandra; Bernal, Demetrio; Aguilar-Salinas, Carlos; Rojas, Rosalba; Villa, Antonio; Tur, Josep A

2017-11-01

One of the most prevalent chronic diseases among elderly population is the Metabolic Syndrome (MetS). The aim of this study was to assess the prevalence of MetS and associated factors among Mexican elderly people. Cross-sectional survey carried out in Mexico (2007). A random sample (n=516) of the elderly population (≥65years; 277 female, 239 male) was interviewed. Anthropometric and analytical measurements, and a general questionnaire incorporating questions related to socio-demographic and life-style factors were used. MetS definition AHA/NHLBI/IDF was applied. The prevalence of MetS in the elderly (≥65years) was of 72.9% (75.7% men; 70.4% women). Participants with values above MetS cut-off points were 92.4% (hypertension), 77.8% (hypertriglyceridemia), 77.1% (low HDL-cholesterol), 71.1% (hyperglycaemia), and 65.4% (central obesity). People with MetS showed higher values of anthropometric and biochemical variables than those without MetS, except for the height, cholesterol and creatinine. Mid-high education level (9-12 years), no smokers and former smokers, and Central-Western inhabitants of Mexico were associated with MetS components. BMI status was the main determinant of MetS prevalence and MetS components. The reported prevalence of MetS among the elderly Mexican population was higher than those previously obtained in the geographical area, showing a major public health problem in Mexican elders. Copyright © 2017 Elsevier B.V. All rights reserved.

Mexico, Mexicans and Mexican Americans in Secondary-School United States History Textbooks.

ERIC Educational Resources Information Center

Salvucci, Linda K.

1991-01-01

Discusses coverage of Mexican history and Mexican Americans in 10 U.S. history textbooks approved for use in Texas. Criticizes the lack of complete information, ethnocentricity, and failure to present the Mexican point of view. Argues that U.S. history courses should cover topics of Mexican history, including Spanish colonialism, the Texas…

The meaning of numbers in health: exploring health numeracy in a Mexican-American population.

PubMed

Schapira, Marilyn M; Fletcher, Kathlyn E; Ganschow, Pamela S; Walker, Cindy M; Tyler, Bruce; Del Pozo, Sam; Schauer, Carrie; Jacobs, Elizabeth A

2011-07-01

Health numeracy can be defined as the ability to use numeric information in the context of health. The interpretation and application of numbers in health may vary across cultural groups. To explore the construct of health numeracy among persons who identify as Mexican American. Qualitative focus group study. Groups were stratified by preferred language and level of education. Audio-recordings were transcribed and Spanish groups (n = 3) translated to English. An analysis was conducted using principles of grounded theory. A purposeful sample of participants from clinical and community sites in the Milwaukee and Chicago metropolitan areas. A theoretical framework of health numeracy was developed based upon categories and major themes that emerged from the analysis. Six focus groups were conducted with 50 participants. Initial agreement in coding was 59-67% with 100% reached after reconciliation by the coding team. Three major themes emerged: 1) numeracy skills are applied to a broad range of communication and decision making tasks in health, 2) affective and cognitive responses to numeric information influence use of numbers in the health setting, and 3) there exists a strong desire to understand the meaning behind numbers used in health. The findings informed a theoretical framework of health numeracy. Numbers are important across a range of skills and applications in health in a sample of an urban Mexican-American population. This study expands previous work that strives to understand the application of numeric skills to medical decision making and health behaviors.

Mexico: The Crisis of Identity.

ERIC Educational Resources Information Center

Ewen, Alexander

1994-01-01

Examines the place of Indian people in Mexican society and politics, from the conquest to the 1994 Zapatista uprising in Chiapas (fueled by the threat to rural indigenous communal lands posed by economic reforms). Although Indianness is celebrated as contributing to the idealized mestizo "race," self-identification as Indian threatens…

Volunteerism among Mexican Youth in the United States: The Role of Family Capital

ERIC Educational Resources Information Center

Ishizawa, Hiromi

2014-01-01

This study investigates patterns of volunteerism within a rapidly growing segment of the population, Mexican immigrant and Mexican origin youth, using data from the Education Longitudinal Study of 2002. These data show that volunteerism varies by immigrant generational status. Contradicting classical assimilation theory, first-generation Mexican…

Process and dynamics of traditional selling wild edible mushrooms in tropical Mexico

PubMed Central

Ruán-Soto, Felipe; Garibay-Orijel, Roberto; Cifuentes, Joaquín

2006-01-01

Background More than twelve temperate-inhabitant Mexican ethnic groups are considered to be mycophilic and to have extensive traditional mycological knowledge. In contrast, inhabitants of tropical lands have been studied only superficially and their mycological knowledge is less well known. In this paper, we report the results of an ethnomycological research in markets of a wide area of the Mexican tropics. Our aims were to describe the dynamics related to the traditional selling process of wild mushrooms and to determine the tendencies of informants toward mushrooms (mycophily vs. mycophoby). Methods We visited 25 markets of 12 different settlements in the states of Oaxaca, Tabasco and Veracruz and collected information by participant observation as well as by 291 non-structured and semi-structured interviews. Results Mushroom selling was observed in four towns in Oaxaca and in two in Tabasco. Women represented 81.82% of sellers, while indigenous people (Chinantecos, Chontales, Ch'oles and Zoques) comprised 68.18%. Mushroom commercialization took place in secondary mobile markets and only in peasant stands. Mushroom collectors gather the resource in places with secondary vegetation, farmed areas and cattle fields. Because of land tenure restrictions mushroom sellers did not normally collect mushrooms themselves. In Oaxaca, we observed economic dynamics not based on capitalism, such as exchange, reciprocity and barter. Conclusion The sale of some wild edible mushrooms, the large amounts of commercialization of Schizophyllum commune, the complicated intermediary process, as well as the insertion of mushrooms into different informal economic practices are all evidence of an existent mycophily in a sector of the population of this region of the Mexican tropics. Among our informants, urban mestizo people were mycophobic, rural mestizo people were non-mycophilic and indigenous people were true mycophilic. PMID:16393345

Do Mexican immigrants “import” social gradients in health to the US?

PubMed Central

Buttenheim, Alison; Goldman, Noreen; Pebley, Anne R; Wong, Rebeca; Chung, Chang

2011-01-01

Greater educational attainment is consistently associated with lower mortality and better health, a pattern known as the social gradient. However, recent research suggests that Mexican-origin adults in the US have weak or flat gradients, in contrast to steep gradients for non-Hispanic whites. In this study we evaluate one hypothesis for this finding: Is the relative weakness of education gradients in health behaviors observed among Mexican-origin adults in the US due to weak gradients in the sending population? We test this “imported gradients” hypothesis with data from two nationally-representative datasets: the US National Health Interview Survey (NHIS) and the Mexican National Health Survey (ENSA 2000). We compare education gradients in smoking and obesity for recently-arrived Mexican immigrants in the US to the corresponding gradients in high-migration regions of Mexico. Results partially support the imported gradients hypothesis and have implications for health education and promotion programs targeted to immigrant populations to reduce racial and ethnic disparities in health in the US. PMID:20692753

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

PubMed

de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

2016-10-01

Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

Association between G1733A (rs6152) polymorphism in androgen receptor gene and recurrent spontaneous abortions in Mexican population.

PubMed

Porras-Dorantes, Ángela; Brambila-Tapia, Aniel Jessica Leticia; Lazcano-Castellanos, Alma Benita; Da Silva-José, Thiago Donizete; Juárez-Osuna, Jesús Alejandro; García-Ortiz, José Elías

2017-10-01

Recurrent spontaneous abortion (RSA) is a multifactorial condition that occurs with a frequency of 0.2-5% in women of reproductive age. Among genetic factors, the single nucleotide polymorphism (SNP) G1733A in the androgen receptor (AR) gene has been associated with its presence in Greek and Iranian populations. Therefore, the aim of this study is to determine its possible association with RSA in this population. A total of 156 Mexican RSA (with at least 2 consecutive abortions) unrelated patients and 152 unrelated healthy women were included, the presence of karyotype anomalies in the parents as well as uterine anomalies as well as antiphospholipid antibodies was excluded in patients; while all the controls presented at least two healthy pregnancies and no abortion. In all the included women, the presence of the SNP G1733A was determined by restriction fragment length polymorphism (RFLP) technique. No significant differences were observed in age between groups. The genotype GG, GA, and AA had a frequency of 0.70, 0.27, and 0.03 in controls and of 0.89, 0.10, and 0.01 in patients (p < 0.001); while the A allele frequency was of 0.06 and 0.16 in controls and patients, respectively (p < 0.0001). The difference in allele frequency increased 10-15% when patients with primary RSA (with no live births) and with at least three abortions were included. The SNP G1733A of the AR gene is significantly associated with RSA in Mexican patients. These results coincide with previous reports in other populations.

Genetic, Ecological and Morphological Divergence between Populations of the Endangered Mexican Sheartail Hummingbird (Doricha eliza)

PubMed Central

Licona-Vera, Yuyini; Ornelas, Juan Francisco

2014-01-01

The Mexican Sheartail (Doricha eliza), an endangered hummingbird, is endemic to Mexico where two populations have a disjunct distribution. One population is distributed along the northern tip of the Yucatan Peninsula whereas the other is mostly restricted to central Veracruz. Despite their disjunct distribution, previous work has failed to detect morphological or behavioral differences between these populations. Here we use variation in morphology, mtDNA and nuDNA sequences to determine the degree of morphological and molecular divergence between populations, their divergence time, and historical demography. We use species distribution modeling and niche divergence tests to infer the relative roles of vicariance and dispersal in driving divergence in the genus. Our Bayesian and maximum likelihood phylogenetic analyses revealed that Doricha eliza populations form a monophyletic clade and support their sister relationship with D. enicura. We found marked genetic differentiation, with reciprocal monophyly of haplotypes and highly restricted gene flow, supporting a history of isolation over the last 120,000 years. Genetic divergence between populations is consistent with the lack of overlap in environmental space and slight morphological differences between males. Our findings indicate that the divergence of the Veracruz and Yucatan populations is best explained by a combination of a short period of isolation exacerbated by subsequent divergence in climate conditions, and that rather than vicariance, the two isolated ranges of D. eliza are the product of recent colonization and divergence in isolation. PMID:24992589

Gender differences of suicides in children and adolescents: Analysis of 167 suicides in a Mexican population from 2003 to 2013.

PubMed

Aguilar-Velázquez, Daniela Georgina; González-Castro, Thelma Beatriz; Tovilla-Zárate, Carlos Alfonso; Juárez-Rojop, Isela E; López-Narváez, Maria Lilia; Frésan, Ana; Hernández-Díaz, Yazmin; Guzmán-Priego, Crystell Guadalupe

2017-12-01

Suicide is the second cause of death in youth population. The aim of the present study was to analyze demographic characteristics and suicide methods used, as well as to identify gender differences among Mexican children and adolescents (aged 10-17 years) that committed suicide. Between January 2003 and December 2013, 167 suicides of children and adolescents between 10 and 17 years of age were documented by the Secretary of Health of the state of Tabasco, Mexico. All sociodemographic characteristics were compared according to gender. Our sample included 67.7% males and 32.3% females (male to female 2.1:1). The predominant marital status was single (89.6%) and hanging (93.7%) was the principal method of suicide used. Both female and male adolescents were predominantly students (50%); however, female adolescents were more frequently married (17%) and were housewives (26.4%). Our results identified that hanging is the principal suicide method used by children and adolescents in Mexican population; we also detected main gender differences in terms of poisoning/drug toxicity as the method used, occupation and marital status. These results should be taken into consideration when designing suicide prevention programs due to the differences found by gender. Copyright © 2017 Elsevier B.V. All rights reserved.

Chamomile Consumption and Mortality: A Prospective Study of Mexican Origin Older Adults

PubMed Central

Howrey, Bret T.; Peek, M. Kristen; McKee, Juliet M.; Raji, Mukaila A.; Ottenbacher, Kenneth J.; Markides, Kyriakos S.

2016-01-01

Purpose: Approximately 20% of adults use some kind of herbal; however, little data exists from population-based study or clinical trials to support effectiveness of most herbal products. Chamomile is a commonly used herb among older adults of Mexican origin. We examined the effects of herbal chamomile consumption on mortality among older adults of Mexican origin. Methods and Design. A sample from the Hispanic Established Populations for Epidemiologic Study of the Elderly, a population-based study of noninstitutionalized Mexican Americans aged 65 and older from five Southwestern states (Texas, California, New Mexico, Colorado, and Arizona). We included all men and women from 2000 to 2007 (n = 1,677). Results. Chamomile was used by 14% of the sample. Cox proportional hazards regression analyses showed that chamomile was associated with a decreased risk of mortality in the total sample (hazard ratio [HR] 0.71, 95% confidence interval [CI] 0.55–0.92) and for women (HR 0.67, 95% CI 0.49–0.92) but not for men. In models adjusted for sociodemographic variables, health behaviors, and chronic conditions, chamomile remained significantly associated with reduced mortality in women (HR 0.72, 95% CI 0.53–0.98). Implications. The use of chamomile shows protective effects against mortality in this sample of older adults of Mexican origin for women. Further research is warranted in other populations to determine if these effects are consistent. PMID:26035879

Chronicles of Change: Models of Mexican Immigrant Identity in Suburban Community Narratives

ERIC Educational Resources Information Center

Wortham, Stanton; Allard, Elaine; Mortimer, Katherine

2006-01-01

In the past fifteen years, the town of New Marshall has experienced major changes that have influenced the ways its residents view each other. Mexican immigration to New Marshall, a suburb of 30,000 located outside a large Eastern city, grew dramatically between 1990 and 2000. Where once Mexicans comprised less than 0.5% of the population, they…

Relationship between epicardial adipose tissue, coronary artery disease and adiponectin in a Mexican population.

PubMed

Yañez-Rivera, Teresa G; Baños-Gonzalez, Manuel A; Ble-Castillo, Jorge L; Torres-Hernandez, Manuel E; Torres-Lopez, Jorge E; Borrayo-Sanchez, Gabriela

2014-09-08

The amount of epicardial adipose tissue (EAT) around the heart has been identified as an independent predictor of coronary artery disease (CAD), potentially through local release of inflammatory cytokines. Ethnic differences have been observed, but no studies have investigated this relationship in the Mexican population. The objective of the present study was to evaluate whether a relationship exist between EAT thickness assessed via echocardiography with CAD and adiponectin levels in a Mexican population. We studied 153 consecutive patients who underwent coronary angiography and transthoracic echocardiography (TTE). EAT thickness on the free wall of the right ventricle was measured at the end of systole from parasternal long and short axis views of three consecutive cardiac cycles. Coronary angiograms were analyzed for the presence, extent and severity of CAD. Serum adiponectin, lipids, glucose, C-reactive protein and fibrinogen were determined. EAT thickness was greater in patients with CAD than in those without CAD from both parasternal long (5.39 ± 1.75 mm vs 4.00 ± 1.67 mm p<0.0001) and short-axis views (5.23 ± 1.67 vs 4.12 ± 1.77, p=0.001). EAT thickness measured from parasternal long and short-axis showed a statistically significant positive correlation with age (r=0.354, p<0.001; r=0.286, p<0.001 respectively), and waist circumference (r=0.189, p=0.019; r=0.217, p=0.007 respectively). A significant negative correlation between EAT thickness from the parasternal long axis with cholesterol-HDL was observed (r=-0.163, p=0.045). No significant correlation was found between epicardial fat thickness and serum adiponectin or with the severity of CAD. EAT thickness was greater in patients with CAD. However, no correlation was observed with the severity of the disease or with serum adiponectin levels. EAT thickness measured by echocardiography might provide additional information for risk assessment and prediction of CAD.

[Diabetes mellitus as a risk factor for dementia in the Mexican elder population].

PubMed

Mejía-Arango, Silvia; Zúñiga-Gil, Clemente

2011-10-01

Diabetes and dementia are growing problems throughout the world and especially in developing countries. To determine the risk of developing dementia in subjects with type 2 diabetes mellitus. Diabetic elders free of dementia from the Mexican Health and Aging study, a prospective community-based cohort research were followed after two years. Socio-demographic factors, comorbid conditions and type of diabetes treatment were analyzed in subjects who become demented. At baseline, 749 participants (13.8%) had diabetes mellitus. During the follow-up period (mean: 2.02 years; range: 1-3 years), 306 of 749 persons with diabetes mellitus developed dementia, yielding a relative risk (RR) of 2.08 (95% confidence interval, 95% CI = 1.59-2.73). The effect was strongest in persons aged 80 years or older with a RR of 2.44 (95% CI = 1.46-4.08), men had a greater relative risk than women (RR = 2.25; 95% CI = 1.46-3.49 vs. RR = 1.98; 95% CI = 1.08-1.11) and subjects with low education (< 7 years of schooling) had a significant RR while those with higher education didn't. Individuals treated with insulin where at highest risk of dementia (RR = 2.83; 95% CI = 1.58-5.06). Hypertension (RR = 2.75; 95% CI = 1.86-4.06) and depression (RR = 3.78; 95% CI = 2.37-6.04) where the two comorbidities which increased the risk of dementia. Subjects with diabetes mellitus have an increased risk of developing dementia. Sociodemographic factors and other co-morbidities highly prevalent in the Mexican population contribute to the diabetes-dementia association.

Ritual drinks in the pre-Hispanic US Southwest and Mexican Northwest.

PubMed

Crown, Patricia L; Gu, Jiyan; Hurst, W Jeffrey; Ward, Timothy J; Bravenec, Ardith D; Ali, Syed; Kebert, Laura; Berch, Marlaina; Redman, Erin; Lyons, Patrick D; Merewether, Jamie; Phillips, David A; Reed, Lori S; Woodson, Kyle

2015-09-15

Chemical analyses of organic residues in fragments of pottery from 18 sites in the US Southwest and Mexican Northwest reveal combinations of methylxanthines (caffeine, theobromine, and theophylline) indicative of stimulant drinks, probably concocted using either cacao or holly leaves and twigs. The results cover a time period from around A.D. 750-1400, and a spatial distribution from southern Colorado to northern Chihuahua. As with populations located throughout much of North and South America, groups in the US Southwest and Mexican Northwest likely consumed stimulant drinks in communal, ritual gatherings. The results have implications for economic and social relations among North American populations.

Links between occupational activities and depressive mood in young adult populations.

PubMed

Ohayon, Maurice M; Roberts, Laura Weiss

2014-02-01

To examine how occupational activities (work, school), separation from parents, environmental conditions, stressors ad social insertion affect on the prevalence of Major Depressive Disorder (MDD) and mental health care-seeking among young adults. Cross-sectional study conducted in two samples: 1) 19,136 subjective representative of the US non-institutionalized general population including 2082 18-26 y.o. subjects. 2) 2196 subjects representative of the students' population living on an university campus. Telephone interviews were realized using the Sleep-EVAL system to assess sleeping habits, general health, organic, sleep and mental disorders. One-month prevalence of depressed mood was similar between community and campus student groups (21.7% and 23.4%), and less common than for working (23.6%) and non-working (28.2%) young adults in the community. One-month MDD was found in 12.0% of non-working young people, compared with 6.6% of young workers, 3.2% of on-campus students and 4.1% of students in the general population (p < 0.01). Correlates for depressive mood and MDD such as female gender, dissatisfaction with social life, obesity, living with pain and other factors were identified across groups. A minority of on-campus (10.8%) and general population students (10.3%) had sought mental health services in the prior year. Individuals with MDD had higher rates of care-seeking than other young people (p < 0.001), high rates of psychotropic medication use (p < 0.001). Being a student appears to have a protective effect with respect to having depressive symptoms or MDD and seeking needed mental health care. Stress and social isolation were important determinants for depression among young adults. Copyright © 2013. Published by Elsevier Ltd.

Acculturative stress negatively impacts maternal depressive symptoms in Mexican-American women during pregnancy

PubMed Central

D’Anna-Hernandez, Kimberly L.; Aleman, Brenda; Flores, Ana-Mercedes

2015-01-01

Background Mexican-American women exhibit high rates of prenatal maternal depressive symptoms relative to the general population. Though pregnant acculturated Mexican-American women experience cultural stressors such as acculturation, acculturative stress and discrimination that may contribute to elevated depressive symptoms, the contribution of these socio-cultural correlates to depressive symptomology is unknown. Method Ninety-eight pregnant women of Mexican descent were recruited from a community hospital clinic during their first trimester. Women completed surveys about acculturation, acculturative stress, perceived discrimination, general perceived stress, and maternal depressive symptoms as well as the potential protective factor of Mexican cultural values. Results Women who experienced greater acculturative and perceived stress, but not perceived discrimination or acculturation, reported significantly elevated depressive symptoms during pregnancy. Also, women who experienced greater acculturative stress identified with a mixture of Mexican and American cultural values. However, only the Mexican cultural value of respect was protective against maternal depressive symptoms while adhering to the Anglo value of independence and self-reliance was a risk factor. Limitations A limitation in the study is the cross-sectional and descriptive self-report nature of the work, underscoring the need for additional research. Moreover, physiological measures of stress were not analyzed in the current study. Conclusions Results point to acculturative stress, above other cultural stressors, as a potential intervention target in culturally competent obstetric care. These findings have implications for maternal mental health treatment during pregnancy, which likely affects maternal-fetal programming and may favorably affect perinatal outcomes in the vulnerable Mexican-American population. PMID:25699668

Seasonal influenza vaccination among Mexican migrants traveling through the Mexico-US border region.

PubMed

Ejebe, Ifna H; Zhang, Xiao; Rangel, Maria Gudelia; Martinez-Donate, Ana P

2015-02-01

Mobile populations are at high risk for communicable diseases and can serve as a bridge between sending and receiving communities. The objective of this study is to determine the rates of, and factors associated with, seasonal influenza vaccination among Mexican migrants traveling through the US-Mexico border. We used a 2013 cross-sectional population-based survey of adult mobile Mexican migrants traveling through the Mexico-US border region (N=2313; weighted N=652,500). We performed a multivariable logistic regression analysis to model the odds of receiving an influenza vaccination in the past year by sociodemographics, migration history, health status, and access to health care. The seasonal influenza vaccination rate in this population was 18.6%. Gender, health status, and health insurance were associated with the likelihood to receive an influenza vaccination. Overall, the rates of seasonal influenza vaccination in circular Mexican migrants are low compared to adults in Mexico and the US Efforts are needed to increase influenza vaccination among this highly mobile population, particularly in adults with chronic conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

PubMed

Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2013-01-01

Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

Early Childhood Internalizing Problems in Mexican- and Dominican-Origin Children: The Role of Cultural Socialization and Parenting Practices.

PubMed

Calzada, Esther; Barajas-Gonzalez, R Gabriela; Huang, Keng-Yen; Brotman, Laurie

2017-01-01

This study examined mother- and teacher-rated internalizing behaviors (i.e., anxiety, depression, and somatization symptoms) among young children using longitudinal data from a community sample of 661 Mexican and Dominican families and tested a conceptual model in which parenting (mother's socialization messages and parenting practices) predicted child internalizing problems 12 months later. Children evidenced elevated levels of mother-rated anxiety at both time points. Findings also supported the validity of the proposed parenting model for both Mexican and Dominican families. Although there were different pathways to child anxiety, depression, and somatization among Mexican and Dominican children, socialization messages and authoritarian parenting were positively associated with internalizing symptoms for both groups.

Social support, stressors, and frailty among older Mexican American adults.

PubMed

Peek, M Kristen; Howrey, Bret T; Ternent, Rafael Samper; Ray, Laura A; Ottenbacher, Kenneth J

2012-11-01

There is little research on the effects of stressors and social support on frailty. Older Mexican Americans, in particular, are at higher risk of medical conditions, such as diabetes, that could contribute to frailty. Given that the Mexican American population is rapidly growing in the United States, it is important to determine whether there are modifiable social factors related to frailty in this older group. To address the influence of social support and stressors on frailty among older Mexican Americans, we utilized five waves of the Hispanic Established Populations for the Epidemiologic Study of the Elderly (Hispanic EPESE) to examine the impact of stressors and social support on frailty over a 12-year period. Using a modified version of the Fried and Walston Frailty Index, we estimated the effects of social support and stressors on frailty over time using trajectory modeling (SAS 9.2, PROC TRAJ). We first grouped respondents according to one of three trajectories: low, progressive moderate, and progressive high frailty. Second, we found that the effects of stressors and social support on frailty varied by trajectory and by type of stressor. Health-related stressors and financial strain were related to increases in frailty over time, whereas social support was related to less-steep increases in frailty. Frailty has been hypothesized to reflect age-related physiological vulnerability to stressors, and the analyses presented indicate partial support for this hypothesis in an older sample of Mexican Americans. Future research needs to incorporate measures of stressors and social support in examining those who become frail, especially in minority populations.

Marital Relationships of Interethnically and Intraethnically Married Mexican American Women: A Developmental Perspective.

ERIC Educational Resources Information Center

Guajardo, Maria Resendez; Markman, Howard J.

Mexican American women have higher fertility rates and higher divorce rates than does the general population of the United States. In light of these data and the documented negative effects of marital distress and divorce on spouses, Mexican American women appear to be at risk for psychological stress. To provide some insight into the marital…

An Anglo View of Mexican Americans. "Public Service", Vol. 1, No. 2, February 1974.

ERIC Educational Resources Information Center

Baird, Frank L.

1974-01-01

A survey, conducted in late 1972, assessed Anglos' views of Lubbock's 17.3 percent Mexican American population and their perceptions of local Anglos' feelings concerning Mexican Americans. Respondents were 550 Lubbock Anglo households randomly selected from the local city directory. Respondents represented a cross-section of Anglo Lubbockites,…

Comparison and evaluation of dietary quality between older and younger Mexican-American women.

PubMed

Pignotti, Giselle A P; Vega-López, Sonia; Keller, Colleen; Belyea, Michael; Ainsworth, Barbara; Nagle Williams, Allison; Records, Kathie; Coonrod, Dean; Permana, Paska

2015-10-01

To compare and evaluate the dietary quality of young and older sedentary Mexican-American women. Understanding key dietary concerns, while considering developmental transition periods and cultural relevance, can provide insight for developing appropriate nutrition interventions. Cross-sectional dietary data were collected using unannounced 24 h diet recalls to assess nutrient intake adequacy (Estimated Average Requirement cut-point method) and dietary quality (Healthy Eating Index (HEI) 2010). Mujeres en Acción and Madres para la Salud, two community-based physical activity interventions. Participants were 139 young (28 (sd 6) years) and 124 older (55 (sd 7) years) overweight/obese sedentary Mexican-American women (BMI=25·0-35·0 kg/m2) of low socio-economic status. Older women consumed less Ca, Fe, folate, empty calories and energy from carbohydrate, but more fruit, vegetables, greens and beans, and fibre than younger women (all P<0·05). Over 60 % of all participants had an intake below recommendations for fibre, Ca, vitamin E, vitamin C and folate. Both groups had low total HEI-2010 scores (62 for older and 63 for younger women; NS), with 57 % of older and 48 % of younger women classified as having a poor diet. Despite differences in nutrient requirements according to developmental transition periods (childbearing v. perimenopausal), overall, older and younger Mexican-American women generally had low-quality diets and may benefit from dietary quality improvement.

High Prevalence of Inadequate Calcium and Iron Intakes by Mexican Population Groups as Assessed by 24-Hour Recalls.

PubMed

Sánchez-Pimienta, Tania G; López-Olmedo, Nancy; Rodríguez-Ramírez, Sonia; García-Guerra, Armando; Rivera, Juan A; Carriquiry, Alicia L; Villalpando, Salvador

2016-09-01

A National Health and Nutrition Survey (ENSANUT) conducted in Mexico in 1999 identified a high prevalence of inadequate mineral intakes in the population by using 24-h recall questionnaires. However, the 1999 survey did not adjust for within-person variance. The 2012 ENSANUT implemented a more up-to-date 24-h recall methodology to estimate usual intake distributions and prevalence of inadequate intakes. We examined the distribution of usual intakes and prevalences of inadequate intakes of calcium, iron, magnesium, and zinc in the Mexican population in groups defined according to sex, rural or urban area, geographic region of residence, and socioeconomic status (SES). We used dietary intake data obtained through the 24-h recall automated multiple-pass method for 10,886 subjects as part of ENSANUT 2012. A second measurement on a nonconsecutive day was obtained for 9% of the sample. Distributions of usual intakes of the 4 minerals were obtained by using the Iowa State University method, and the prevalence of inadequacy was estimated by using the Institute of Medicine's Estimated Average Requirement cutoff. Calcium inadequacy was 25.6% in children aged 1-4 y and 54.5-88.1% in subjects >5 y old. More than 45% of subjects >5 y old had an inadequate intake of iron. Less than 5% of children aged <12 y and 25-35% of subjects aged >12 y had inadequate intakes of magnesium, whereas zinc inadequacy ranged from <10% in children aged <12 y to 21.6% in men aged ≥20 y. Few differences were found between rural and urban areas, regions, and tertiles of SES. Intakes of calcium, iron, magnesium, and zinc are inadequate in the Mexican population, especially among adolescents and adults. These results suggest a public health concern that must be addressed. © 2016 American Society for Nutrition.

Prevalence of the BCR/ABL1 transcripts in Mexican patients with chronic myelogenous leukemia.

PubMed

Meza-Espinoza, Juan Pablo; Gutiérrez-Angulo, Melva; Vázquez-Cárdenas, Alejandra; Delgado-Lamas, José Luis; Esparza-Flores, María Amparo; González-García, Juan Ramón

2007-01-01

RT-PCR studies in 93 patients with chronic myelogenous leukemia from the Mexican West were done in order to know the proportion of b2a2 and b3a2 BCR/ABL1 transcripts. Forty-five patients showed the b3a2 transcript (48%), 37 (40%) displayed the b2a2 and in 11 cases (12%) both transcripts were detected. Statistical analyses showed that these figures are in accordance with two of three similar studies realized in Mexican population. Moreover, significant differences were found among Mexican people and patients from other countries, namely Ecuador, England, Italy, Poland, Japan, and Thailand. Ecuadorian patients showed differences with all the populations analyzed. These variations could be due to a different genetic background.

Mexican American female adolescents' perceptions of relationships and dating violence.

PubMed

Haglund, Kristin; Belknap, Ruth Ann; Garcia, Juanita Terrie

2012-09-01

This study fills a gap regarding the perspectives of Mexican American female adolescents on dating relationships and dating violence (DV). This was a qualitative descriptive study. Focus groups included 20 Mexican American young women, primarily first and second generation, mean age 14.5 years (SD= 2.5). Data were analyzed with categorical analysis. Participants described key components of DV and identified cultural aspects that may serve to promote healthy dating relationships. Family-based interventions to promote exploration of gender roles and parent-child communication may foster biculturalism as well as promote healthy dating relationships and prevent violence within this cultural group. In the United States, 10% to 40% of teens experience DV. Hispanic females experience more physical DV than their White peers. © 2012 Sigma Theta Tau International.

Intermarriage and the Intergenerational Transmission of Ethnic Identity and Human Capital for Mexican Americans

PubMed Central

Duncan, Brian; Trejo, Stephen J.

2011-01-01

We investigate whether selective intermarriage and endogenous ethnic identification interact to hide some of the intergenerational progress achieved by the Mexican-origin population in the United States. In part, we do this by comparing an “objective” indicator of Mexican descent (based on the countries of birth of the respondent and his parents and grandparents) with the standard “subjective” measure of Mexican self-identification (based on the respondent’s answer to the Hispanic origin question). For third-generation Mexican-American youth, we show that ethnic attrition is substantial and could produce significant downward bias in standard measures of attainment which rely on ethnic self-identification. PMID:22058602

Chamomile Consumption and Mortality: A Prospective Study of Mexican Origin Older Adults.

PubMed

Howrey, Bret T; Peek, M Kristen; McKee, Juliet M; Raji, Mukaila A; Ottenbacher, Kenneth J; Markides, Kyriakos S

2016-12-01

Approximately 20% of adults use some kind of herbal; however, little data exists from population-based study or clinical trials to support effectiveness of most herbal products. Chamomile is a commonly used herb among older adults of Mexican origin. We examined the effects of herbal chamomile consumption on mortality among older adults of Mexican origin. A sample from the Hispanic Established Populations for Epidemiologic Study of the Elderly, a population-based study of noninstitutionalized Mexican Americans aged 65 and older from five Southwestern states (Texas, California, New Mexico, Colorado, and Arizona). We included all men and women from 2000 to 2007 (n = 1,677). Chamomile was used by 14% of the sample. Cox proportional hazards regression analyses showed that chamomile was associated with a decreased risk of mortality in the total sample (hazard ratio [HR] 0.71, 95% confidence interval [CI] 0.55-0.92) and for women (HR 0.67, 95% CI 0.49-0.92) but not for men. In models adjusted for sociodemographic variables, health behaviors, and chronic conditions, chamomile remained significantly associated with reduced mortality in women (HR 0.72, 95% CI 0.53-0.98). The use of chamomile shows protective effects against mortality in this sample of older adults of Mexican origin for women. Further research is warranted in other populations to determine if these effects are consistent. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Social cohesion, cultural identity, and drug use in Mexican rural communities.

PubMed

Wagner, Fernando; Diaz, David B; López, Aida L; Collado, Ma Elena; Aldaz, Evelyn

2002-01-01

The objective of this study was to explore drug use in Mexican rural communities and its relationship to social cohesion, cultural identity, migration, and transculturation. Community models typification was used, considering cohesion as the central point of analysis. The research was conducted during 15-day periods in each of nine communities during 1991. Both documentary and ethnographic techniques were used to gather information. Results indicated that rural communities where there was little or no drug use among its members show more social cohesion, cultural identity, and community links consolidation, and more capacity for integrating change. This pattern is most apparent among young community members who have had more contact with the outer world (drug trafficking, North American culture, and Mexican urban culture).

Modifications in the Consumption of Energy, Sugar, and Saturated Fat among the Mexican Adult Population: Simulation of the Effect When Replacing Processed Foods that Comply with a Front of Package Labeling System.

PubMed

Mendoza, Rosario; Tolentino-Mayo, Lizbeth; Hernández-Barrera, Lucia; Nieto, Claudia; Monterrubio-Flores, Eric A; Barquera, Simón

2018-01-19

A Mexican Committee of Nutrition Experts (MCNE) from the National Institute of Public Health (INSP), free from conflict of interest, established food content standards to place the front-of-package (FOP) logo on foods that meet these nutrition criteria. The objectives were to simulate the effect on nutrient intake in the Mexican adult population (20-59 years old) after replacing commonly consumed processed foods with those that meet the FOP nutrition-labeling criteria. Twenty-four hour dietary recalls were collected from the 2012 Mexican National Health and Nutrition Survey ( n = 2164 adults). A food database from the INSP was used. Weighted medians and 25-75 inter-quartile ranges (IQR) of energy and nutrient intake were calculated for all subjects by sociodemographic characteristics before and after replacing foods. Significant decreases were observed in energy (-5.4%), saturated fatty acids (-18.9%), trans-fatty acids (-20%), total sugar (-36.8%) and sodium (-10.7%) intake and a significant increase in fiber intake (+15.5%) after replacing foods, using the MCNE nutrition criteria. Replacing commonly consumed processed foods in the diet with foods that meet the FOP nutrition-labeling criteria set by the MCNE can lead to improvements in energy and nutrient intake in the Mexican adult population.

Modifications in the Consumption of Energy, Sugar, and Saturated Fat among the Mexican Adult Population: Simulation of the Effect When Replacing Processed Foods that Comply with a Front of Package Labeling System

PubMed Central

Mendoza, Rosario; Tolentino-Mayo, Lizbeth; Hernández-Barrera, Lucia; Monterrubio-Flores, Eric A.; Barquera, Simón

2018-01-01

A Mexican Committee of Nutrition Experts (MCNE) from the National Institute of Public Health (INSP), free from conflict of interest, established food content standards to place the front-of-package (FOP) logo on foods that meet these nutrition criteria. The objectives were to simulate the effect on nutrient intake in the Mexican adult population (20–59 years old) after replacing commonly consumed processed foods with those that meet the FOP nutrition-labeling criteria. Twenty-four hour dietary recalls were collected from the 2012 Mexican National Health and Nutrition Survey (n = 2164 adults). A food database from the INSP was used. Weighted medians and 25–75 inter-quartile ranges (IQR) of energy and nutrient intake were calculated for all subjects by sociodemographic characteristics before and after replacing foods. Significant decreases were observed in energy (−5.4%), saturated fatty acids (−18.9%), trans-fatty acids (−20%), total sugar (−36.8%) and sodium (−10.7%) intake and a significant increase in fiber intake (+15.5%) after replacing foods, using the MCNE nutrition criteria. Replacing commonly consumed processed foods in the diet with foods that meet the FOP nutrition-labeling criteria set by the MCNE can lead to improvements in energy and nutrient intake in the Mexican adult population. PMID:29351257

Ritual drinks in the pre-Hispanic US Southwest and Mexican Northwest

PubMed Central

Crown, Patricia L.; Gu, Jiyan; Hurst, W. Jeffrey; Ward, Timothy J.; Bravenec, Ardith D.; Ali, Syed; Kebert, Laura; Berch, Marlaina; Redman, Erin; Lyons, Patrick D.; Merewether, Jamie; Phillips, David A.; Reed, Lori S.; Woodson, Kyle

2015-01-01

Chemical analyses of organic residues in fragments of pottery from 18 sites in the US Southwest and Mexican Northwest reveal combinations of methylxanthines (caffeine, theobromine, and theophylline) indicative of stimulant drinks, probably concocted using either cacao or holly leaves and twigs. The results cover a time period from around A.D. 750–1400, and a spatial distribution from southern Colorado to northern Chihuahua. As with populations located throughout much of North and South America, groups in the US Southwest and Mexican Northwest likely consumed stimulant drinks in communal, ritual gatherings. The results have implications for economic and social relations among North American populations. PMID:26372965

How Mexican Is a Spanish-Speaking Mexican American?

ERIC Educational Resources Information Center

Patella, Victoria M.

To investigate the validity of language usage as an indicator of identification with the Mexican American subculture, this study hypothesized that greater use of Spanish than English would be correlated with characteristics consistent with the ideal, typical, Mexican American family in terms of family of orientation and aspirations for future…

Parent-reported prevalence of food allergy in Mexican schoolchildren: A population-based study.

PubMed

Ontiveros, N; Valdez-Meza, E E; Vergara-Jiménez, M J; Canizalez-Román, A; Borzutzky, A; Cabrera-Chávez, F

Food allergy (FA) prevalence is well documented in developed countries and appears to be increasing, but remains unknown in most Latin American countries. We aimed to evaluate on a population basis the parent-reported prevalence of FA and its clinical characteristics in Mexican schoolchildren. A validated Spanish version of a structured written questionnaire was administered to parents of schoolchildren aged 5-13 years old from Culiacan, Mexico. A total of 1049 parents responded to the survey (response rate, 84%). The estimated prevalence rates (95% CI) were: adverse food reactions 10.0% (8.3-11.9), "perceived FA, ever" 5.5% (4.3-7.0), "physician-diagnosed FA, ever" 4.9% (3.7-6.3), "immediate-type FA, ever" 4.4% (3.3-5.8), "immediate-type FA, current" 3.5% (2.6-4.8), and anaphylaxis 1.2% (0.72-2.1). Immediate hypersensitivity reactions were mainly triggered by the consumption of shrimp (1.3%), other shellfish (0.7%), strawberry (0.6%), chocolate (0.5%), and egg (0.4%). Schoolchildren with "immediate-type FA, current" had more atopic dermatitis and allergic rhinitis (p<0.05), but not asthma or drug allergy (p>0.05) than children without FA. All cases of anaphylaxis sought medical attention, but only one child had physician-diagnosed anaphylaxis and was advised to acquire an epinephrine autoinjector. The prevalence of "immediate-type FA, current" to any food is 3.5% in Mexican schoolchildren. The poor recognition of anaphylaxis and the low frequency of prescription of epinephrine autoinjectors suggest that acute food-induced allergic reactions are not optimally managed in Mexico. Copyright © 2016 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

Seasonal influenza vaccination among Mexican migrants traveling through the Mexico-U.S. border region

PubMed Central

Ejebe, Ifna H.; Zhang, Xiao; Rangel, Maria Gudelia; Martinez-Donate, Ana P.

2014-01-01

Objective Mobile populations are at high risk for communicable diseases and can serve as a bridge between sending and receiving communities. The objective of this study is to determine the rates of, and factors associated with, seasonal influenza vaccination among Mexican migrants traveling through the US-Mexico border. Methods We used a 2013 cross-sectional population-based survey of adult mobile Mexican migrants traveling through the Mexico-U.S. border region (N = 2,313; weighted N = 652,500). We performed a multivariable logistic regression analysis to model the odds of receiving an influenza vaccination in the past year by sociodemographics, migration history, health status, and access to health care. Results The seasonal influenza vaccination rate in this population was 18.6%. Gender, health status, and health insurance were associated with the likelihood to receive an influenza vaccination. Conclusion Overall, the rates of seasonal influenza vaccination in circular Mexican migrants are low compared to adults in Mexico and the U.S. Efforts are needed to increase influenza vaccination among this highly mobile population, particularly in adults with chronic conditions. PMID:25514546

Brief Intervention in the Emergency Department Among Mexican-Origin Young Adults at the US-Mexico Border: Outcomes of a Randomized Controlled Clinical Trial Using Promotores.

PubMed

Cherpitel, Cheryl J; Ye, Yu; Bond, Jason; Woolard, Robert; Villalobos, Susana; Bernstein, Judith; Bernstein, Edward; Ramos, Rebeca

2016-03-01

A randomized controlled trial of brief intervention (BI), for drinking and related problems, using peer health promotion advocates (promotores), was conducted among at-risk and alcohol-dependent Mexican-origin young adult emergency department (ED) patients, aged 18-30. Six hundred and ninety-eight patients were randomized to: screened only (n = 78), assessed (n = 310) and intervention (n = 310). Primary outcomes were at-risk drinking and Rapid Alcohol Problems Screen (RAPS4) scores. Secondary outcomes were drinking days per week, drinks per drinking day, maximum drinks in a day and negative consequences of drinking. At 3- and 12-month follow-up the intervention condition showed significantly lower values or trends on all outcome variables compared to the assessed condition, with the exception of the RAPS4 score; e.g. at-risk drinking days dropped from 2.9 to 1.7 at 3 months for the assessed condition and from 3.2 to 1.2 for the intervention condition. Using random effects modeling controlling for demographics and baseline values, the intervention condition showed significantly greater improvement in all consumption measures at 12 months, but not in the RAPS4 or negative consequences of drinking. Improvements in outcomes were significantly more evident for non-injured patients, those reporting drinking prior to the event, and those lower on risk taking disposition. At 12-month follow-up this study demonstrated significantly improved drinking outcomes for Mexican-origin young adults in the ED who received a BI delivered by promotores compared to those who did not. ClinicalTrials.gov. NCT02056535. © The Author 2015. Medical Council on Alcohol and Oxford University Press. All rights reserved.

Early Childhood Internalizing Problems in Mexican- and Dominican-Origin Children: The Role of Cultural Socialization and Parenting Practices

PubMed Central

Calzada, Esther; Barajas-Gonzalez, R. Gabriela; Huang, Keng-Yen; Brotman, Laurie

2015-01-01

This study examined mother- and teacher-rated internalizing behaviors (i.e., anxiety, depression and somatization symptoms) among young children using longitudinal data from a community sample of 661 Mexican and Dominican families, and tested a conceptual model in which parenting (mother’s socialization messages and parenting practices) predicted child internalizing problems 12 months later. Children evidenced elevated levels of mother-rated anxiety at both time points. Findings also supported the validity of the proposed parenting model for both Mexican and Dominican families. Though there were different pathways to child anxiety, depression and somatization among Mexican and Dominican children, socialization messages and authoritarian parenting were positively associated with internalizing symptoms for both groups. PMID:26042610

Developing metapopulation connectivity criteria from genetic and habitat data to recover the endangered Mexican wolf.

PubMed

Carroll, Carlos; Fredrickson, Richard J; Lacy, Robert C

2014-02-01

Restoring connectivity between fragmented populations is an important tool for alleviating genetic threats to endangered species. Yet recovery plans typically lack quantitative criteria for ensuring such population connectivity. We demonstrate how models that integrate habitat, genetic, and demographic data can be used to develop connectivity criteria for the endangered Mexican wolf (Canis lupus baileyi), which is currently being restored to the wild from a captive population descended from 7 founders. We used population viability analysis that incorporated pedigree data to evaluate the relation between connectivity and persistence for a restored Mexican wolf metapopulation of 3 populations of equal size. Decreasing dispersal rates greatly increased extinction risk for small populations (<150-200), especially as dispersal rates dropped below 0.5 genetically effective migrants per generation. We compared observed migration rates in the Northern Rocky Mountains (NRM) wolf metapopulation to 2 habitat-based effective distance metrics, least-cost and resistance distance. We then used effective distance between potential primary core populations in a restored Mexican wolf metapopulation to evaluate potential dispersal rates. Although potential connectivity was lower in the Mexican wolf versus the NRM wolf metapopulation, a connectivity rate of >0.5 genetically effective migrants per generation may be achievable via natural dispersal under current landscape conditions. When sufficient data are available, these methods allow planners to move beyond general aspirational connectivity goals or rules of thumb to develop objective and measurable connectivity criteria that more effectively support species recovery. The shift from simple connectivity rules of thumb to species-specific analyses parallels the previous shift from general minimum-viable-population thresholds to detailed viability modeling in endangered species recovery planning. © 2013 Society for Conservation

Genetic differentiation of Mexican Holstein cattle and its relationship with Canadian and U.S. Holsteins

PubMed Central

García-Ruiz, Adriana; Ruiz-López, Felipe de J.; Van Tassell, Curtis P.; Montaldo, Hugo H.; Huson, Heather J.

2015-01-01

The Mexican Holstein (HO) industry has imported Canadian and US (CAN + USA) HO germplasm for use in two different production systems, the conventional (Conv) and the low income (Lowi) system. The objective of this work was to study the genetic composition and differentiation of the Mexican HO cattle, considering the production system in which they perform and their relationship with the Canadian and US HO populations. The analysis included information from 149, 303, and 173 unrelated or with unknown pedigree HO animals from the Conv, Lowi, and CAN + USA populations, respectively. Canadian and US Jersey (JE) and Brown Swiss (BS) genotypes (162 and 86, respectively) were used to determine if Mexican HOs were hybridized with either of these breeds. After quality control filtering, a total of 6,617 out of 6,836 single nucleotide polymorphism markers were used. To describe the genetic diversity across the populations, principal component (PC), admixture composition, and linkage disequilibrium (LD; r2) analyses were performed. Through the PC analysis, HO × JE and HO × BS crossbreeding was detected in the Lowi system. The Conv system appeared to be in between Lowi and CAN + USA populations. Admixture analysis differentiated between the genetic composition of the Conv and Lowi systems, and five ancestry groups associated to sire’s country of origin were identified. The minimum distance between markers to estimate a useful LD was found to be 54.5 kb for the Mexican HO populations. At this average distance, the persistence of phase across autosomes of Conv and Lowi systems was 0.94, for Conv and CAN + USA was 0.92 and for the Lowi and CAN + USA was 0.91. Results supported the flow of germplasm among populations being Conv a source for Lowi, and dependent on migration from CAN + USA. Mexican HO cattle in Conv and Lowi populations share common ancestry with CAN + USA but have different genetic signatures. PMID:25709615

Genetic differentiation of Mexican Holstein cattle and its relationship with Canadian and U.S. Holsteins.

PubMed

García-Ruiz, Adriana; Ruiz-López, Felipe de J; Van Tassell, Curtis P; Montaldo, Hugo H; Huson, Heather J

2015-01-01

The Mexican Holstein (HO) industry has imported Canadian and US (CAN + USA) HO germplasm for use in two different production systems, the conventional (Conv) and the low income (Lowi) system. The objective of this work was to study the genetic composition and differentiation of the Mexican HO cattle, considering the production system in which they perform and their relationship with the Canadian and US HO populations. The analysis included information from 149, 303, and 173 unrelated or with unknown pedigree HO animals from the Conv, Lowi, and CAN + USA populations, respectively. Canadian and US Jersey (JE) and Brown Swiss (BS) genotypes (162 and 86, respectively) were used to determine if Mexican HOs were hybridized with either of these breeds. After quality control filtering, a total of 6,617 out of 6,836 single nucleotide polymorphism markers were used. To describe the genetic diversity across the populations, principal component (PC), admixture composition, and linkage disequilibrium (LD; r(2) ) analyses were performed. Through the PC analysis, HO × JE and HO × BS crossbreeding was detected in the Lowi system. The Conv system appeared to be in between Lowi and CAN + USA populations. Admixture analysis differentiated between the genetic composition of the Conv and Lowi systems, and five ancestry groups associated to sire's country of origin were identified. The minimum distance between markers to estimate a useful LD was found to be 54.5 kb for the Mexican HO populations. At this average distance, the persistence of phase across autosomes of Conv and Lowi systems was 0.94, for Conv and CAN + USA was 0.92 and for the Lowi and CAN + USA was 0.91. Results supported the flow of germplasm among populations being Conv a source for Lowi, and dependent on migration from CAN + USA. Mexican HO cattle in Conv and Lowi populations share common ancestry with CAN + USA but have different genetic signatures.

Two Decades of Negative Educational Selectivity of Mexican Migrants to the United States

PubMed Central

Rendall, Michael S.; Parker, Susan W.

2015-01-01

Immigration is commonly considered to be selective of more able individuals. Studies comparing the educational attainment of Mexican immigrants in the United States to that of the Mexican resident population support this characterization. Upward educational-attainment biases in both coverage and measurement, however, may be substantial in U.S. data sources. Moreover, differences in educational attainment by place size are very large within Mexico, and U.S. data sources provide no information on immigrants’ places of origin within Mexico. To address these problems, we use multiple sources of nationally-representative Mexican survey data to re-evaluate the educational selectivity of working-age Mexican migrants to the United States over the 1990s and 2000s. We document disproportionately rural and small-urban-area origins of Mexican migrants and a steep positive gradient of educational attainment by place size. We show that together these conditions induced strongly negative educational selection of Mexican migrants throughout the 1990s and 2000s. We interpret this finding as consistent with low returns to the education of unauthorized migrants and few opportunities for authorized migration. PMID:25995526

The Economic Condition of the Mexican-American.

ERIC Educational Resources Information Center

Schmidt, Fred H.; Koford, Kenneth

Persons of Spanish heritage constitute the only minority in the United States whose numbers continue to grow through large-scale immigration. Mexican nationals, the "invisible people", incessantly infiltrate the U.S. population from Mexico. From 1939 through 1969, more than 7.4 million nationals entered the country unlawfully and were…

Factors Associated with Overweight and Obesity among Children of Mexican Descent: Results of a Binational Study

PubMed Central

Rosas, Lisa G.; Guendelman, Sylvia; Harley, Kim; Fernald, Lia C. H.; Neufeld, Lynnette; Mejia, Fabiola

2010-01-01

The prevalence of childhood obesity is high among young children of Mexican origin in the United States, however, the determinants are poorly understood. We conducted a binational study with a sample from California (CA) and Mexico (MX), to identify and compare the most important factors associated with overweight and obesity among children of Mexican descent. Significantly more children were classified as overweight or obese in CA compared to MX (53.3 vs. 14.9%, P < 0.01). In CA and MX, having an obese mother was significantly associated with being overweight or obese. In MX, male gender, high socioeconomic status and very low food insecurity were associated with being overweight or obese. These data offer hypotheses for how migration may influence the high prevalence of overweight among the Mexican children in California. PMID:20217234

Stability and Change in Health Insurance Among Older Mexican Americans: Longitudinal Evidence From the Hispanic Established Populations for Epidemiologic Study of the Elderly

PubMed Central

Angel, Ronald J.; Angel, Jacqueline L.; Markides, Kyriakos S.

2002-01-01

Objectives. This study examined the association between health insurance coverage, medical care use, limitations in activities of daily living, and mortality among older Mexican-origin individuals. Methods. We analyzed longitudinal data from the Hispanic Established Populations for Epidemiologic Study of the Elderly (H-EPESE). Results. The uninsured tend to be younger, female, poor, and foreign born. They report fewer health care visits, are less likely to have a usual source of care, and more often receive care in Mexico. Conversely, those with private health insurance are economically better off and use more health care services. Over time, the data reveal substantial changes in type of insurance coverage. Conclusions. The data reveal serious vulnerabilities among older Mexican Americans that result from a lack of private Medigap supplemental coverage. (Am J Public Health. 2002;92:1264–1271) PMID:12144982

Towards an Informed Mexican and Mexican-American Citizenry: Bridging the Gap to Increase Human Capacity and Information Dissemination

NASA Astrophysics Data System (ADS)

Ramirez, M. D.; Ramirez, D. M.

2008-12-01

The research translation and community outreach goal of The University of Arizona's (UA) Superfund Basic Research Program and U.S.-Mexico Binational Center for Environmental Sciences and Toxicology is to increase human capacity and information dissemination to diverse stakeholders, including federal, state, and local government agencies as well as northern Mexican and border community stakeholders. Due to Arizona's demographic characteristics and the UA's proximity to the U.S. - Mexico border, activities target primarily Mexican and Mexican-American populations. With this in mind, a model has been established that pulls from human capital, community-based participatory research and public participation theories. The theories applied to our target population have resulted in the creation of a successful model that is used in both research translation and community outreach work. The model contains four components: community needs (participation), science translation (information), engagement (outreach), and training (education). Examples of how this model operates for various stakeholders involved in environmental science and health issues will be discussed. A case in point of how this model has been applied effectively is the partnership with promotoras (community health advocates) to do environmental science and health trainings to increase the knowledge base of specific populations disproportionately exposed to contaminants of concern. Additional case studies and methodologies used to develop innovative communicative tools (that takes into consideration cultural idiosyncrasies) for stakeholders at all levels in Arizona, the border, and Mexico will be highlighted, such as: 1) information sheets regarding local environmental issues for communities neighboring contaminated sites, 2) SciTransfer Bulletins targeting professional level stakeholders such as Project Managers, Community Involvement Coordinators and the general public, 3) coordinating technical and

The Evolution of the Mexican Military: From the Mexican Revolution In 1910 to 2014

DTIC Science & Technology

2015-03-01

government, the Mexican army’s track record and SEDENA’s laissez - faire approach demonstrate that the sheltering of the military, which was...Changes to the Modern Military’s Leadership and Structure ......41 D. THE MEXICAN MILITARY AND THE HUMAN RIGHTS VIOLATIONS... leadership and structure of the contemporary Mexican military was directly shaped by the events and actions of the Mexican Revolution. Through the research

Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients.

PubMed

Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

2016-01-01

The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients.

The Living Conditions of U.S.-Born Children of Mexican Immigrants in Unmarried Families

ERIC Educational Resources Information Center

Padilla, Yolanda C.; Radey, Melissa Dalton; Hummer, Robert A.; Kim, Eunjeong

2006-01-01

Recent research has brought attention to the hardship faced by children of immigrants in the United States, particularly in the Mexican-origin population. In this study, the authors are concerned with the extent to which U.S.-born children of Mexican immigrants who live in unmarried families may face exceptional risks. Using data from the Fragile…

Changes in the incidence of intestinal giardiosis in Mexican population during five years (2011-2015).

PubMed

Ibáñez-Cervantes, Gabriela; León-Ávila, Gloria; Bello-López, Juan Manuel; Pérez-Rangel, Armando; León-García, Gregorio; Nogueda-Torres, Benjamín; Hernández, José Manuel

2018-03-26

Giardiosis is a parasitic disease caused by the protozoan Giardia intestinalis, which is distributed worldwide. Most of the data on the prevalence of giardiosis in Mexico comes from research, but it is also necessary to study the data provided by the Mexican Health Ministry and issued by the General Directorate of Epidemiology. The aim of this work was analyse the national surveillance data for human giardiosis in order to update the epidemiological data of this disease in Mexico. A retrospective observational analysis of giardiosis (from January 2011 to December 2015) was performed in the annual reports emitted by the GDE in Mexico. The cases were classified by year, state, age group, gender and seasons of the year. During the period of 2011-2015, a reduction of 38.51% was observed in the total number of new cases of giardiosis reported in the whole country The states of Sinaloa, Yucatan, and Chiapas presented the highest number of new cases reported during the analysed period. Giardiosis rates were always higher among women in all age groups, but the maximum incidence was observed in both sexes in the age group of 1-4 years old (the most susceptible group). On the other hand, the number of cases increased dramatically in southern states during warmer months. Giardiosis is influenced by ambient temperature changes along the year, although this study suggests that tends to decrease in all the analysed states and could be related to the overall improvement of hygienic practices within the Mexican population.

Development of an Ecological Momentary Assessment Mobile App for a Low-Literacy, Mexican American Population to Collect Disordered Eating Behaviors

PubMed Central

Stein, Karen F; Chaudry, Beenish; Trabold, Nicole

2016-01-01

Background Ecological momentary assessment (EMA) is a popular method for understanding population health in which participants report their experiences while in naturally occurring contexts in order to increase the reliability and ecological validity of the collected data (as compared to retrospective recall). EMA studies, however, have relied primarily on text-based questionnaires, effectively eliminating low-literacy populations from the samples. Objective To provide a case study of design of an EMA mobile app for a low-literacy population. In particular, we present the design process and final design of an EMA mobile app for low literate, Mexican American women to record unhealthy eating and weight control behaviors (UEWCBs). Methods An iterative, user-centered design process was employed to develop the mobile app. An existing EMA protocol to measure UEWCBs in college-enrolled Mexican American women was used as the starting point for the application. The app utilizes an icon interface, with optional audio prompts, that is culturally sensitive and usable by a low-literacy population. A total of 41 women participated over the course of 4 phases of the design process, which included 2 interview and task-based phases (n=8, n=11), focus groups (n=15), and a 5-day, in situ deployment (n=7). Results Participants’ mental models of UEWCBs differed substantially from prevailing definitions found in the literature, prompting a major reorganization of the app interface. Differences in health literacy and numeracy were better identified with the Newest Vital Sign tool, as compared with the Short Assessment of Health Literacy tool. Participants had difficulty imagining scenarios in the interviews to practice recording a specific UEWCB; instead, usability was best tested in situ. Participants were able to use the EMA mobile app over the course of 5 days to record UEWCBs. Conclusions Results suggest that the iterative, user-centered design process was essential for designing

The association between insulin resistance, metabolic variables, and depressive symptoms in Mexican-American elderly: A population-based study.

PubMed

Diniz, Breno S; Fisher-Hoch, Susan; McCormick, Joseph

2018-02-01

Depressive symptoms are common among older adults with obesity and diabetes. Nonetheless, the mechanisms for this association are not clear but may involve changes in the insulin cascade signaling. We aimed to investigate the association, and potential mediators, between obesity, insulin resistance, and depressive symptoms among older adults from a homogenous cohort of Mexican-Americans. We included a total of 500 Mexican-American older adults assessed in the Cameron County Health Study. We evaluated depressive symptoms using the Center for Epidemiologic Survey Depression Scale (CES-D). Central obesity was defined by waist circumference. Insulin resistance was evaluated by the HOMA-IR index. We estimated the association between obesity, insulin resistance, and depressive symptoms by carrying out univariate and multivariate regression analyses. In unadjusted regression analysis, HOMA-IR (unstandardized β = 0.31 ± 0.12, P = 0.007), waist circumference (unstandardized β = 0.066 ± 0.0.028, P = 0.017), and Hb1Ac levels (unstandardized β = 0.52 ± 0.24, P = 0.03) were significantly associated with CES-D scores. The association of HOMA-IR and CES-D remained statistically significant after controlling for socio-demographic and clinical variables in multivariate analysis (unstandardized β = 0.28 ± 0.11, P = 0.01). Our results suggest that depressive symptoms are associated with insulin resistance in older Mexican-American adults. In addition, poorer glucose control and obesity are important mediators of this relationship. Additional studies are needed to evaluate whether interventions that increase insulin sensitivity can also reduce depressive symptoms in this population. Copyright © 2017 John Wiley & Sons, Ltd.

Atlas of Mexican Triatominae (Reduviidae: Hemiptera) and vector transmission of Chagas disease

PubMed Central

Ramsey, Janine M; Peterson, A Townsend; Carmona-Castro, Oscar; Moo-Llanes, David A; Nakazawa, Yoshinori; Butrick, Morgan; Tun-Ku, Ezequiel; de la Cruz-Félix, Keynes; Ibarra-Cerdeña, Carlos N

2015-01-01

Chagas disease is one of the most important yet neglected parasitic diseases in Mexico and is transmitted by Triatominae. Nineteen of the 31 Mexican triatomine species have been consistently found to invade human houses and all have been found to be naturally infected with Trypanosoma cruzi. The present paper aims to produce a state-of-knowledge atlas of Mexican triatomines and analyse their geographic associations with T. cruzi, human demographics and landscape modification. Ecological niche models (ENMs) were constructed for the 19 species with more than 10 records in North America, as well as for T. cruzi. The 2010 Mexican national census and the 2007 National Forestry Inventory were used to analyse overlap patterns with ENMs. Niche breadth was greatest in species from the semiarid Nearctic Region, whereas species richness was associated with topographic heterogeneity in the Neotropical Region, particularly along the Pacific Coast. Three species, Triatoma longipennis, Triatoma mexicana and Triatoma barberi, overlapped with the greatest numbers of human communities, but these communities had the lowest rural/urban population ratios. Triatomine vectors have urbanised in most regions, demonstrating a high tolerance to human-modified habitats and broadened historical ranges, exposing more than 88% of the Mexican population and leaving few areas in Mexico without the potential for T. cruzi transmission. PMID:25993505

Relationship styles of self-focused autonomy, other-focused connection, and mutuality among Mexican American and European American college students.

PubMed

Neff, Kristin D; Brabeck, Kalina M; Kearney, Lisa K

2006-10-01

The author examined relationship styles of self-focused autonomy (SFA), other-focused connection (OFC), and mutuality among 415 European and Mexican American young adults in 2 U.S. colleges. Mutuality was the most commonly reported style for both ethnic groups, although Mexican American men were more likely than the others to indicate that they had the SFA style. Mexican American participants perceived their fathers' styles as SFA more often than did the others regarding either of their parents' styles. Mutuality was associated with the best mental-health outcomes regardless of gender or ethnicity. The present results indicate that the cultural influences on autonomy and connection are complex and that collectivistic cultural contexts may sometimes promote autonomy concerns in men.

Nineteenth century Mexican statures in the United States and their relationship with insolation and vitamin D.

PubMed

Carson, Scott Alan

2010-01-01

The use of height data to measure living standards is now a well-established method in economics. However, there are still some populations, places and times for which the comparison across groups remains unclear. One example is 19th century Mexicans in the US. This study demonstrates that after comparing the statures of Mexicans born in Mexico and the US the primary source of the stature difference between the two groups was birth year, and the stature gap increased as the US economy developed while the Mexican economy stagnated. Moreover, the stature growth of Mexicans born in the US was related to vitamin D, and the Mexican relationship between stature and insolation was more like that of Europeans than Africans.

Growth status among low-income Mexican and Mexican-American elementary school children.

PubMed

Winham, Donna M

2012-01-01

Childhood obesity remains a problem among Latino children in the United States. Acculturation to an American diet and sedentary lifestyle may be causative factors. The research purpose was to assess child growth status, including sitting height, in relation to acculturation among Mexican and Mexican-American children. Anthropometric measures of weight, height, and sitting height were taken in a cross-sectional survey of Mexican and Mexican-American elementary school children (N = 484) in Phoenix, Arizona. Height-for-age (HAZ), weight-for-age (WAZ), and body mass index (BMI) Z-scores were calculated based on the Centers for Disease Control 2000 growth reference. Sitting height Z-scores (SHZ) were determined from the NHANES III reference values. Questions about language usage were asked of the children as a proxy for acculturation. Differences in growth measures and acculturation between those born in the United States or Mexico were evaluated by chi-square or t-tests. The mean HAZ value (-0.23) was close to the reference median. There were no significant differences in HAZ or SHZ by birth country or gender. WAZ values for boys were significantly higher than for girls. More girls (64%) than boys (54%) had normal BMIs. More Mexican-born boys (28%) were obese than Mexican-born girls (17%; P = 0.026) in comparison to the US-born boys (31%) and girls (24%; P = n.s.). Acculturation scale score and male gender predicted a small percentage of the variation in BMIZ. Environmental and cultural factors that promote obesity among low-income Mexican and Mexican-American children are similar regardless of birth country but boys may be at greater risk of obesity than girls. Copyright © 2012 Wiley Periodicals, Inc.

Longitudinal relations among Mexican-origin mothers' cultural characteristics, cultural socialization, and 5-year-old children's ethnic-racial identification.

PubMed

Derlan, Chelsea L; Umaña-Taylor, Adriana J; Updegraff, Kimberly A; Jahromi, Laudan B

2017-11-01

The current longitudinal study examined the intergenerational transmission of ethnic-racial identity/identification and cultural orientation among Mexican-origin adolescent young mothers and their children (N = 161 dyads). Findings indicated that mothers' ethnic-racial identity and their cultural involvement were significantly associated with children's ethnic-racial identification via mothers' cultural socialization; however, associations varied significantly by children's gender and skin tone. For example, mothers' ethnic-racial centrality was positively associated with cultural socialization efforts among mothers with sons (regardless of skin tone); but with daughters, a positive association only emerged among those with lighter skin tones. Associations between cultural socialization and children's ethnic-racial identification also varied by children's gender and skin tone. For example, the relation between mothers' cultural socialization and children's self-labeling as Mexican was positive for girls regardless of skin tone, and for boys with lighter skin tones, but was not significant for boys with darker skin tones. Findings highlight the critical role of children's own characteristics, mothers' ethnic-racial identity and adaptive cultural characteristics, and mothers' cultural socialization efforts in the formation of young Mexican-origin children's ethnic-racial identification. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Suicide mortality of young, middle-aged and elderly males and females in Japan for the years 1953-96: time series analysis for the effects of unemployment, female labour force, young and aged population, primary industry and population density.

PubMed

Yamasaki, Akiko; Araki, Shunichi; Sakai, Ryoji; Yokoyama, Kazuhito; Voorhees, A Scott

2008-12-01

Effects of nine social life indicators on age-adjusted and age-specific annual suicide mortality of male and female Japanese population in the years 1953-96 were investigated by multiple regression analysis on time series data. Unemployment rate was significantly related to the age-adjusted mortality in both males and females. Also, female labour force participation was positively related to the male mortality; persons and 65 and above was inversely related to the male mortality. Results on the age-specific mortality indicated that: during the 44 yr, (1) unemployment significantly related with the mortality of young, middle-aged and elderly males and young females; (2) female labour force participation significantly related with the mortality of young and elderly males and young females; aged population significantly related with the mortality of middle-aged and elderly males; (4) young population significantly related with the mortality of young and middle-aged males and females; (5) divorce significantly related with the mortality of middle-aged and elderly males and young males and females; (6) persons employed in primary industries significantly related with the mortality in middle-aged males and young males and females; and (7) population density significantly related with the mortality of middle-aged males and young females.

Gender differences in socio-demographic, clinical characteristics and psychiatric diagnosis in/of suicide attempters in a Mexican population.

PubMed

Fresán, Ana; González-Castro, Thelma Beatriz; Peralta-Jiménez, Yesenia; Juárez-Rojop, Isela; Pool-García, Sherezada; Velázquez-Sánchez, Martha Patricia; López-Narváez, Lilia; Tovilla-Zárate, Carlos Alfonso

2015-06-01

The aim of the present study was to analyse demographic and clinical characteristics, as well as psychiatric diagnoses to identify gender differences in patients with attempted suicide in a Mexican population. Between September 2010 and September 2012, 140 suicide attempts were documented in the Department of Psychiatry at the General Hospital of Comalcalco (Hospital General de Comalcalco in Spanish) in Tabasco, Mexico. Diagnoses were established using the DSM-IV questionnaire in which Axis I and II were considered. The Suicide Intent Scale was also applied. In our sample, 63.6% were females and 36.4% males. With regard to socio-demographic characteristics, the predominant marital status in males was single, and in females married (χ2=5.93, df=2, p=0.05). In occupation the male group was mainly unemployed and housewife in females (χ2=55.51, df=4, p<0.001). Male subjects were more likely to consume alcohol (χ2=20.40, df=1, p≤0.001), cannabis (χ2=16.62, df=1, p≤0.001) or tobacco. The prevalence of psychiatric diagnosis was significantly different because, the male group was mainly diagnosed with substance-related disorders, whereas female participants showed a prevalence of stress-related disorders (χ2=34.17, gl=4, p=0.0001). Our results provide evidence that the characteristics of suicide attempt are different by gender in the Mexican population. Interventions are necessary for the development of prevention strategies that may lead to a reduction in suicidal behaviour. These preventive activities should consider the occupation for the female group and consumption of alcohol, cannabis or tobacco in the male group.

Mexican Parenting Questionnaire (MPQ)

ERIC Educational Resources Information Center

Halgunseth, Linda C.; Ispa, Jean M.

2012-01-01

The present study was conducted in four phases and constructed a self-report parenting instrument for use with Mexican immigrant mothers of children aged 6 to 10. The 14-item measure was based on semistructured qualitative interviews with Mexican immigrant mothers (N = 10), was refined by a focus group of Mexican immigrant mothers (N = 5), and was…

Binary Populations and Stellar Dynamics in Young Clusters

NASA Astrophysics Data System (ADS)

Vanbeveren, D.; Belkus, H.; Van Bever, J.; Mennekens, N.

2008-06-01

We first summarize work that has been done on the effects of binaries on theoretical population synthesis of stars and stellar phenomena. Next, we highlight the influence of stellar dynamics in young clusters by discussing a few candidate UFOs (unconventionally formed objects) like intermediate mass black holes, η Car, ζ Pup, γ2 Velorum and WR 140.

Population data and mutation rate of nine Y-STRs in a mestizo Mexican population from Guadalajara, Jalisco, México.

PubMed

Padilla-Gutiérrez, Jorge Ramón; Valle, Yeminia; Quintero-Ramos, Antonio; Hernández, Guillermo; Rodarte, Katya; Ortiz, Rocío; Olivares, Norma; Rivas, Fernando

2008-11-01

Nine Y-STR (DYS19, DYS390, DYS391, DYS392, DYS446, DYS447, DYS448, DYS456 and DYS458) were analyzed in a male sample of 285 unrelated individuals from Guadalajara, Jalisco, México. The haplotype diversity (0.996) and discrimination capacity (0.986) were calculated. A family study of around 200 father/son pairs and among 1828 meiosis showed five mutational events. All mutations were single step. The overall mutation rate estimated across the nine Y-STRs was 2.7 x 10(-3) (95% CI 1.2-6.4 x 10(-3))/locus/meiosis. The results indicate that these nine loci are useful Y-linked markers for forensic applications.

Sibling Relationship Quality and Mexican-Origin Adolescents' and Young Adults' Familism Values and Adjustment

ERIC Educational Resources Information Center

Killoren, Sarah E.; De Jesús, Sue A. Rodríguez; Updegraff, Kimberly A.; Wheeler, Lorey A.

2017-01-01

We examined profiles of sibling relationship qualities in 246 Mexican-origin families living in the United States using latent profile analyses. Three profiles were identified: "Positive," "Negative," and "Affect-Intense." Links between profiles and youths' familism values and adjustment were assessed using…

GLU298ASP and 4G/5G Polymorphisms and the Risk of Ischemic Stroke in Young Individuals.

PubMed

Esparza-García, Juan Carlos; Santiago-Germán, David; Guadalupe Valades-Mejía, María; Hernández-Juárez, Jesus; Aguilar-Sosa, Eberth; Leaños-Miranda, Alfredo; Alvarado-Moreno, Antonio; Majluf-Cruz, Abraham; Isordia-Salas, Irma

2015-09-01

Polymorphisms in the endothelial nitric oxide synthase (eNOS) and in the plasminogen activator inhibitor -1 (PAI-1) genes have been implicated in stroke pathogenesis but results are still controversial. The aim of this study was to examine the possible contribution of Glu298Asp in the eNOS and 4G/5G in the PAI-1polymorphisms with ischemic stroke in a young Mexican population. In a case-control study, conducted between January 2006 and June 2010, 204 patients ≤45 years of age with ischemic stroke and 204 controls matched by age and gender, were recruited. The Glu298Asp and 4G/5G polymorphisms were determined in all participants by polymerase chain reaction-restriction fragment length polymorphism. There was a significant difference in the Glu298Asp genotype distribution (P=0.001) and allele frequency between the two groups (P=0.001). The 4G/5G genotype distribution (P=0.40) and the allele frequency was similar between groups; (P=0.13). There were independent factors for ischemic stroke: Asp carriage (GluAsp+AspAsp) (P=0.02); smoking (P=0.01); hypertension (P=0.03), and familial history of atherothrombotic disease (P=0.04). The Asp allele from the Gu298Asp gene represents an independent risk factor for ischemic stroke in a young Mexican population. In contrast, the 4G/5G was not associated with an increased risk for this disease in the same group of patients, as previously has been demonstrated in other populations.

Age of Migration Life Expectancy with Functional Limitations and Morbidity in Mexican Americans.

PubMed

Garcia, Marc A; Valderrama-Hinds, Luis M; Chiu, Chi-Tsun; Mutambudzi, Miriam S; Chen, Nai-Wei; Raji, Mukaila

2017-07-01

The U.S. Mexican American population enjoys longer life expectancies relative to other racial/ethnic groups but is disproportionately affected by chronic conditions and functional limitations. Studying the impact of heterogeneity in age, time and other characteristics of migration among older Mexican Americans can inform our understanding of health disparities and healthcare needs in later-life. This research used 20 years of data from the Hispanic Established Populations for the Epidemiologic Study of the Elderly to assess the proportion of life spent with functional limitations and one or more morbidity (according to age of migration and sex) in the U.S. Mexican-American population. The results indicate that early-life and late-life migrant women spend more years with Performance-Oriented Mobility Assessment limitations than U.S.-born women. Conversely, midlife migrant women were not statistically different from U.S.-born women in years spent disabled. In men, midlife migrants had longer life expectancies and had more disability-free years than U.S.-born men. For morbidity, late-life migrant women spent a significantly smaller proportion of their elderly years with morbidity than U.S.-born women, but late-life migrant men spent more years with morbidity than U.S.-born men. These findings illustrate that older Mexican Americans in the United States are heterogeneous in nativity and health outcomes. More years spent disabled or unhealthy may result in greater burden on family members and greater dependence on public resources. These findings have implications for the development of social and health policies to appropriately target the medical conditions and disabilities of older Mexican Americans entering late life. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

SES Gradients Among Mexicans in the United States and in Mexico: A New Twist to the Hispanic Paradox?

PubMed Central

Palloni, Alberto; Riosmena, Fernando; Wong, Rebeca

2016-01-01

Recent empirical findings have suggested the existence of a twist in the Hispanic paradox, in which Mexican and other Hispanic foreign-born migrants living in the United States experience shallower socioeconomic status (SES) health disparities than those in the U.S. population. In this article, we seek to replicate this finding and test conjectures that could explain this new observed phenomenon using objective indicators of adult health by educational attainment in several groups: (1) Mexicanborn individuals living in Mexico and in the United States, (2) U.S.-born Mexican Americans, and (3) non-Hispanic American whites. Our analytical strategy improves upon previous research on three fronts. First, we derive four hypotheses from a general framework that has also been used to explain the standard Hispanic paradox. Second, we study biomarkers rather than self-reported health and related conditions. Third, we use a binational data platform that includes both Mexicans living in Mexico (Mexican National Health and Nutrition Survey 2006) and Mexican migrants to the United States (NHANES 1999–2010). We find steep education gradients among Mexicans living in Mexico’s urban areas in five of six biomarkers of metabolic syndrome (MetS) and in the overall MetS score. Mexican migrants living in the United States experience similar patterns to Mexicans living in Mexico in glucose and obesity biomarkers. These results are inconsistent with previous findings, suggesting that Mexican migrants in the United States experience significantly attenuated health gradients relative to the non-Hispanic white U.S. population. Our empirical evidence also contradicts the idea that SES-health gradients in Mexico are shallower than those in the United States and could be invoked to explain shallower gradients among Mexicans living in the United States. PMID:27655408

Role of Age and Acculturation in Diet Quality Among Mexican Americans - Findings From the National Health and Nutrition Examination Survey, 1999-2012.

PubMed

Yoshida, Yilin; Scribner, Richard; Chen, Liwei; Broyles, Stephanie; Phillippi, Stephen; Tseng, Tung-Sung

2017-07-20

Age and acculturation may play a role in diet quality among Mexican Americans. This study examined diet quality in Mexican Americans by age and whether acculturation influences diet quality across different age groups, using data from the National Health and Nutrition Examination Survey (NHANES). Diet quality, measured by the Healthy Eating Index 2010, improved with age except in categories of dairy, sodium, and refined grains. More acculturation was associated with lower scores in overall diet quality and categories of vegetables, fruits, and sodium and empty calories across almost all ages, but higher scores in grain categories, especially in younger groups. A diet rich in fruits and vegetables but low in fat and sodium should be promoted among more acculturated Mexican Americans, and whole-grain foods should be promoted among young but less acculturated Mexican Americans.

Home range characteristics of Mexican Spotted Owls in the Rincon Mountains, Arizona

USGS Publications Warehouse

Willey, David W.; van Riper, Charles

2014-01-01

We studied a small isolated population of Mexican Spotted Owls (Strix occidentalis lucida) from 1996–1997 in the Rincon Mountains of Saguaro National Park, southeastern Arizona, USA. All mixed-conifer and pine-oak forest patches in the park were surveyed for Spotted Owls, and we located, captured, and radio-tagged 10 adult birds representing five mated pairs. Using radio-telemetry, we examined owl home range characteristics, roost habitat, and monitored reproduction within these five territories. Breeding season (Mar–Sep) home range size for 10 adult owls (95% adaptive kernel isopleths) averaged 267 ha (±207 SD), and varied widely among owls (range 34–652 ha). Mean home range size for owl pairs was 478 ha (±417 ha SD), and ranged from 70–1,160 ha. Owls that produced young used smaller home ranges than owls that had no young. Six habitat variables differed significantly between roost and random sites, including: percent canopy cover, number of trees, number of vegetation layers, average height of trees, average diameter of trees, and tree basal area. Radio-marked owls remained in their territories following small prescribed management fires within those territories, exhibiting no proximate effects to the presence of prescribed fire.

Perceived Social Support Trajectories and the All-Cause Mortality Risk of Older Mexican American Women and Men.

PubMed

Hill, Terrence D; Uchino, Bert N; Eckhardt, Jessica L; Angel, Jacqueline L

2016-04-01

Although numerous studies of non-Hispanic Whites and Blacks show that social integration and social support tend to favor longevity, it is unclear whether this general pattern extends to the Mexican American population. Building on previous research, we employed seven waves of data from the Hispanic Established Populations for the Epidemiologic Study of the Elderly to examine the association between perceived social support trajectories and the all-cause mortality risk of older Mexican Americans. Growth mixture estimates revealed three latent classes of support trajectories: high, moderate, and low. Cox regression estimates indicated that older Mexican American men in the low support trajectory tend to exhibit a higher mortality risk than their counterparts in the high support trajectory. Social support trajectories were unrelated to the mortality risk of older Mexican American women. A statistically significant interaction term confirmed that social support was more strongly associated with the mortality risk of men. © The Author(s) 2015.

Perceived Social Support Trajectories and the All-Cause Mortality Risk of Older Mexican American Women and Men

PubMed Central

Hill, Terrence D.; Uchino, Bert N.; Eckhardt, Jessica L.; Angel, Jacqueline L.

2016-01-01

Although numerous studies of non-Hispanic whites and blacks show that social integration and social support tend to favor longevity, it is unclear whether this general pattern extends to the Mexican American population. Building on previous research, we employed seven waves of data from the Hispanic Established Populations for the Epidemiologic Study of the Elderly to examine the association between perceived social support trajectories and the all-cause mortality risk of older Mexican Americans. Growth mixture estimates revealed three latent classes of support trajectories: high, moderate, and low. Cox regression estimates indicated that older Mexican American men in the low support trajectory tend to exhibit a higher mortality risk than their counterparts in the high support trajectory. Social support trajectories were unrelated to the mortality risk of older Mexican American women. A statistically significant interaction term confirmed that social support was more strongly associated with the mortality risk of men. PMID:26966256

Association between the -794 (CATT)5-8  MIF gene polymorphism and susceptibility to acute coronary syndrome in a western Mexican population.

PubMed

Valdés-Alvarado, Emmanuel; Muñoz-Valle, José Francisco; Valle, Yeminia; Sandoval-Pinto, Elena; García-González, Ilian Janet; Valdez-Haro, Angélica; De la Cruz-Mosso, Ulises; Flores-Salinas, Héctor Enrique; Padilla-Gutiérrez, Jorgé Ramón

2014-01-01

The macrophage migration inhibitory factor (MIF) is related to the progression of atherosclerosis, which, in turn, is a key factor in the development of acute coronary syndrome (ACS). MIF has a CATT short tandem repeat (STR) at position -794 that might be involved in its expression rate. The aim of this study was to investigate the association between the -794 (CATT)5-8  MIF gene polymorphism and susceptibility to ACS in a western Mexican population. This research included 200 ACS patients classified according to the criteria of the American College of Cardiology (ACC) and 200 healthy subjects (HS). The -794 (CATT)5-8  MIF gene polymorphism was analyzed using a conventional polymerase chain reaction (PCR) technique. The 6 allele was the most frequent in both groups (ACS: 54% and HS: 57%). The most common genotypes in ACS patients and HS were 6/7 and 6/6, respectively, and a significant association was found between the 6/7 genotype and susceptibility to ACS (68% versus 47% in ACS and HS, resp., P = 0.03). We conclude that the 6/7 genotype of the MIF -794 (CATT)5-8 polymorphism is associated with susceptibility to ACS in a western Mexican population.

Validation of the FRAIL scale in Mexican elderly: results from the Mexican Health and Aging Study.

PubMed

Díaz de León González, Enrique; Gutiérrez Hermosillo, Hugo; Martinez Beltran, Jesus Avilio; Chavez, Juan Humberto Medina; Palacios Corona, Rebeca; Salinas Garza, Deborah Patricia; Rodriguez Quintanilla, Karina Alejandra

2016-10-01

The aging population in Latin America is characterized by not optimal conditions for good health, experiencing high burden of comorbidity, which contribute to increase the frequency of frailty; thus, identification should be a priority, to classify patients at high risk to develop its negative consequences. The objective of this analysis was to validate the FRAIL instrument to measure frailty in Mexican elderly population, from the database of the Mexican Health and Aging Study (MHAS). Prospective, population study in Mexico, that included subjects of 60 years and older who were evaluated for the variables of frailty during the year 2001 (first wave of the study). Frailty was measured with the five-item FRAIL scale (fatigue, resistance, ambulation, illnesses, and weight loss). The robust, pre-frail or intermediate, and the frail group were considered when they had zero, one, and at least two components, respectively. Mortality, hospitalizations, falls, and functional dependency were evaluated during 2003 (second wave of the study). Relative risk was calculated for each complications, as well as hazard ratio (for mortality) through Cox regression model and odds ratio with logistic regression (for the rest of the outcomes), adjusted for covariates. The state of frailty was independently associated with mortality, hospitalizations, functional dependency, and falls. The pre-frailty state was only independently associated with hospitalizations, functional dependency, and falls. Frailty measured through the FRAIL scale, is associated with an increase in the rate of mortality, hospitalizations, dependency in activities of daily life, and falls.

Mental disability and discriminatory practices: effects of social representations of the Mexican population.

PubMed

Mariana, Espinola-Nadurille; Guadalupe, Delgado

2009-05-01

The prevalence of mental disorders in Mexico is 26.1%. This shows that an important percentage of the population suffers from mental disability. Despite this the country's healthcare system does not provide the least acceptable standard of care for the mentally disabled. The aim of this study was to describe the general population's social representations of the disabled and analyze their relationship with the discriminatory practices from the state towards the mentally ill with respect to their right to health. This study was a secondary analysis of the First National Survey on Discrimination in Mexico. In the survey 1,437 effective interviews that comprised a representative sample, were obtained from people aged 18 to 60 living in rural and urban settings. The response rate was 76.5%. The assessment tool was a self-administered questionnaire that yielded perceptions, attitudes, values and social representations about discrimination towards groups of people that supposedly were targets of discrimination by the general population. In the survey the mentally ill were included under disability. As a secondary analysis of the survey for the purpose of this study, we selected a subset of questions that provided important information about social representations of the general Mexican population towards persons with disabilities. The general population's social representations of the disabled were analyzed. The disabled are the second group after the elderly perceived as the most discriminated and neglected and bearing more suffering. A whole set of negative representations concerning the disabled, such as lack of acceptance and respect, low self-confidence, mistreatment, incomprehension, isolation, intolerance, indifference and bad attitudes from others, were elicited. Social representations are social correspondents of the discriminatory practices that the state exerts toward the mentally ill with respect to their right to health. These representations serve to

Parents and Siblings As Early Resources for Young Children's Learning in Mexican-Descent Families.

ERIC Educational Resources Information Center

Perez-Granados, Deanne R.; Callanan, Maureen A.

1997-01-01

Interviews with parents from 50 Mexican-descent families revealed that parents encouraged their preschool children to ask questions about science and causal relationships; older and younger siblings learned different skills from one another; and children learned through observation and imitation. Discusses issues of "match" between home…

Mexican-American and Mexican National Farm Workers: A Literature Review.

ERIC Educational Resources Information Center

Miller, Michael V.

This paper is concerned with the scholarly treatment accorded to Mexican American and Mexican National farm workers by historical, legal, social work, and social science journals. Only those articles published after the arbitrary date of 1960 are reviewed due to space and time limitations. Works published since then are briefly summarized and…

Mexican-Americans in the Midwest: An Annotated Bibliography.

ERIC Educational Resources Information Center

Saldana, Nancy

Some 128 sources dating from 1928 to 1968 comprise this selected bibliography of sources dealing with Mexican Americans living in parts of the Midwestern United States and with those factors most significant in migration and settlement by this population. Each source is discussed under one of the following headings: Acculturation and Assimilation,…

Trajectories of Mexican American and Mainstream Cultural Values Among Mexican American Adolescents

PubMed Central

Knight, George P.; Basilio, Camille D.; Cham, Heining; Gonzales, Nancy A.; Liu, Yu; Umaña-Taylor, Adriana J.

2013-01-01

Mexican Americans are one of the largest and fastest growing ethnic groups in the United States, yet we have limited knowledge regarding changes (i.e., developmental trajectories) in cultural orientation based upon their exposure to the Mexican American and mainstream cultures. We examined the parallel trajectories of Mexican American and mainstream cultural values in a sample of 749 Mexican American adolescents (49% female) across assessments during the fifth grade (approximately 11 years of age), the seventh grade (approximately 13 years of age) and the tenth grade (approximately 16 years of age). We expected that these values would change over this developmental period and this longitudinal approach is more appropriate than the often used median split classification to identify distinct types of acculturation. We found four distinct acculturation trajectory groups: two trajectory groups that were increasing slightly with age in the endorsement of mainstream cultural values, one of which was relatively stable in Mexican American cultural values while the other was declining in their endorsement of these values; and two trajectory groups that were declining substantially with age in their endorsement of mainstream cultural values, one of which was also declining in Mexican American cultural values and the other which was stable in these values. These four trajectory groups differed in expected ways on a number of theoretically related cultural variables, but were not highly consistent with the median split classifications. The findings highlight the need to utilize longitudinal data to examine the developmental changes of Mexican American individual’s adaptation to the ethnic and mainstream culture in order to understand more fully the processes of acculturation and enculturation. PMID:23877194

Trajectories of Mexican American and mainstream cultural values among Mexican American adolescents.

PubMed

Knight, George P; Basilio, Camille D; Cham, Heining; Gonzales, Nancy A; Liu, Yu; Umaña-Taylor, Adriana J

2014-12-01

Mexican Americans are one of the largest and fastest growing ethnic groups in the United States, yet we have limited knowledge regarding changes (i.e., developmental trajectories) in cultural orientation based upon their exposure to the Mexican American and mainstream cultures. We examined the parallel trajectories of Mexican American and mainstream cultural values in a sample of 749 Mexican American adolescents (49 % female) across assessments during the fifth grade (approximately 11 years of age), the seventh grade (approximately 13 years of age) and the tenth grade (approximately 16 years of age). We expected that these values would change over this developmental period and this longitudinal approach is more appropriate than the often used median split classification to identify distinct types of acculturation. We found four distinct acculturation trajectory groups: two trajectory groups that were increasing slightly with age in the endorsement of mainstream cultural values, one of which was relatively stable in Mexican American cultural values while the other was declining in their endorsement of these values; and two trajectory groups that were declining substantially with age in their endorsement of mainstream cultural values, one of which was also declining in Mexican American cultural values and the other which was stable in these values. These four trajectory groups differed in expected ways on a number of theoretically related cultural variables, but were not highly consistent with the median split classifications. The findings highlight the need to utilize longitudinal data to examine the developmental changes of Mexican American individual's adaptation to the ethnic and mainstream culture in order to understand more fully the processes of acculturation and enculturation.

Demography of Mexican spotted owls in the Sacramento Mountains, New Mexico

Treesearch

Joseph L. Ganey; Gary C. White; James P. Ward; Sean C. Kyle; Darrell L. Apprill; Todd A. Rawlinson; Ryan S. Jonnes

2014-01-01

Information on population dynamics is key to gauging the status of threatened or endangered species. We monitored demography of a population of threatened Mexican spotted owls (Strix occidentalis lucida) in the Sacramento Mountains, New Mexico from 2003 to 2011. We estimated reproductive output for territorial pairs of owls; used mark-recapture methodology and Pradel...

The Utility of Internal Colonialism as an Explanation for the Political and Social Marginality of Mexican Americans.

ERIC Educational Resources Information Center

Carroll, John M.

Three hypotheses were tested to determine whether the social and political marginality of the Mexican American community resulted from an internal colonial relationship with the dominant Anglo society: (1) an expanding Anglo American society in the 19th century established an unequal relationship by force with the indigenous Mexican population in…

A binational overview of reproductive health outcomes among US Hispanic and Mexican women in the border region.

PubMed

McDonald, Jill A; Mojarro, Octavio; Sutton, Paul D; Ventura, Stephanie J

2013-08-15

The US-Mexico border region has 15 million residents and 300,000 births annually. Reproductive health concerns have been identified on both sides of the border, but comparable information about reproductive health is not available. The objective of this study was to compare reproductive health indicators among populations in this region. We used 2009 US Hispanic and Mexican birth certificate data to compare births inside the border region, elsewhere within the border states, and in the United States and Mexico overall. We examined trends in total fertility and birth rates using birth data from 2000 through 2009 and intercensal population estimates. Among women in the border region, US women had more lifetime births than Mexican women in 2009 (2.69 births vs 2.15 births) and throughout the decade. Birth rates in the group aged 15 to 19 years were high in both the US (73.8/1,000) and Mexican (86.7/1,000) border regions. Late or no prenatal care was nearly twice as prevalent in the border regions as in the nonborder regions of border states. Low birth weight and preterm and early-term birth were more prevalent in the US border than in the Mexican border region; US border rates were higher and Mexican rates were lower than their corresponding nonborder and national rates. We found some variations within border states. These findings constitute the first population-based information on the reproductive health of the entire Hispanic US-Mexico border population. Evidence of disparities warrants exploration at state and local levels. Teen pregnancy and inadequate prenatal care are shared problems in US-Mexico border communities and suggest an area for binational cooperation.

The Wealth of Mexican Americans

ERIC Educational Resources Information Center

Cobb-Clark, Deborah A.; Hildebrand, Vincent A.

2006-01-01

This paper analyzes the sources of disparities in the relative wealth position of Mexican Americans. Results reveal that--unlike the racial wealth gap--Mexican Americans' wealth disadvantage is in large part not the result of differences in wealth distributions conditional on the underlying determinants of wealth. Rather, Mexican Americans' wealth…

Identifying Young People's Guidance Needs through Telephone Counseling.

ERIC Educational Resources Information Center

Cruz, Bettylu Rasmussen; San Martin, Alfredo Hidalgo; Gutierrez, Bertha Lidia Nuno; Farias, Martha Villasenor; Mora, Iliana Sahagun

2001-01-01

Examined needs expressed by young people in Guadalajara in Jalisco, Mexico, during phone calls to the Mexican Social Security Institute. Differences were significant by gender and age. Findings point to the need for more programs that reinforce good health practices, including avoiding risky behaviors. (BF)

Fair Start Program: Outreach to Mexican and Mexican American Farmworker Families.

ERIC Educational Resources Information Center

Winters-Smith, Carol; Larner, Mary

This presentation describes a home visiting health education program serving Mexican and Mexican-American migrant farmworkers in Florida. The purposes of the program were to educate farmworker families about pregnancy, childbirth, nutrition, and child development, and to encourage the use of preventive health care services. Home visitors were…

Perceived discrimination and health among Puerto Rican and Mexican Americans: buffering effect of the Lazo matrimonial?

PubMed

Lee, Min-Ah; Ferraro, Kenneth F

2009-06-01

An emerging body of research shows that perceived discrimination adversely influences the mental health of minority populations, but is it also deleterious to physical health? If yes, can marriage buffer the effect of perceived discrimination on physical health? We address these questions with data from Puerto Rican and Mexican American residents of Chicago. Multivariate regression analyses reveal that perceived discrimination is associated with more physical health problems for both Puerto Rican and Mexican Americans. In addition, an interaction effect between marital status and perceived discrimination was observed: married Mexican Americans with higher perceived discrimination had fewer physical health problems than their unmarried counterparts even after adjusting for differential effects of marriage by nativity. The findings reveal that perceived discrimination is detrimental to the physical health of both Puerto Rican and Mexican Americans, but that the stress-buffering effect of marriage on physical health exists for Mexican Americans only.

Erasing Differences for the Sake of Inclusion: How Mexican/Mexican American Students Construct Historical Narratives

ERIC Educational Resources Information Center

Santiago, Maribel

2017-01-01

"Mendez v. Westminster," a case about 1940s Mexican American school segregation, is a new vehicle for including Mexican Americans into U.S. history classrooms. This study explores how a class of primarily Mexican American students, who because of their heritage might develop a personal connection to the case, made sense of…

Mexican Fruit Fly Populations in the Semi-Arid Highlands of the Sierra Madre Oriental in Northeastern Mexico.

PubMed

Vanoye-Eligio, V; Mora-Olivo, A; Gaona-García, G; Reyes-Zepeda, F; Rocandio-Rodríguez, M

2017-08-01

The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most important pests of citrus in Mexico. We report the results of an analysis of A. ludens populations that inhabit the semi-arid highlands of the Sierra Madre Oriental in northeastern Mexico. This study aimed to provide information on population fluctuation of A. ludens and how it relates to climate variables, as well as insights into habitat and native parasitoids. Population peaked in the period July-November when ripe fruits of the wild host, Casimiroa pubescens Ramírez, were available. No adults were captured the rest of the year, suggesting that high populations depend on the availability of wild host fruit. No significant relationships between population fluctuation and climatic variables were observed, except for minimum temperature. Fruit samples of citron (Citrus medica L.), pomegranate (Punica granatum L.), and C. pubescens were collected to determine degree of infestation. Infestation levels (pupae/g) ranged between 0.0006 for citron, 0.0047 for pomegranate, and 0.0240 for C. pubescens. A native parasitoid of Tephritidae, Doryctobracon crawfordii (Viereck) (Braconidae), was identified. Parasitism percentage was calculated at 12.5% on C. pubescens fruits. No parasitoids were observed on citron or pomegranate fruit samples. These results contribute to knowledge on behavior of A. ludens native to temperate environments where no commercial hosts are available. Further research on host expansion of this pest in light of scenarios of global climate change is suggested.

The Mexican American Biculturalism Scale: Bicultural Comfort, Facility, and Advantages for Adolescents and Adults

PubMed Central

Basilio, Camille D.; Knight, George P.; O'Donnell, Megan; Roosa, Mark W.; Gonzales, Nancy A.; Umaña-Taylor, Adriana J.; Torres, Marisela

2014-01-01

Empirical research on biculturalism is limited, in part because of the lack of quality measures of biculturalism. The currently available measures have limitations due to scoring procedures and sampling of only a narrow range of behaviors and attitudes. We present a measure of biculturalism that captures a broader range of the bicultural experience and uses a scoring system that better represents the wide ranging levels of biculturalism that exist in the diverse population of Mexican American adolescents, mothers, and fathers born either in Mexico or the United States. The Mexican American Biculturalism Scale (MABS; 27 items) includes 3 subscales: bicultural comfort (9 items), bicultural facility (9 items), and bicultural advantages (9 items). We report on the reliability and construct validity of test scores, and confirmatory factor analyses findings for a diverse sample of 316 Mexican American families from a large southwestern metropolitan city. The MABS is available both in English and Spanish (see Appendix). The use of the scale has implications for future research studying how biculturalism is related to psychological outcomes for Mexicans/Mexican Americans. PMID:24548151

Validation of the FRAIL scale in Mexican elderly: results from the Mexican Health and Aging Study

PubMed Central

Díaz de León González, Enrique; Gutiérrez Hermosillo, Hugo; Martinez Beltran, Jesus Avilio; Medina Chavez, Juan Humberto; Palacios Corona, Rebeca; Salinas Garza, Deborah Patricia; Rodriguez Quintanilla, Karina Alejandra

2016-01-01

Background The aging population in Latin America is characterized by not optimal conditions for good health, experiencing high burden of comorbidity, which contribute to increase the frequency of frailty; thus, identification should be a priority, to classify patients at high risk to develop its negative consequences. Aim The objective of this analysis was to validate the FRAIL instrument to measure frailty in Mexican elderly population, from the database of the Mexican Health and Aging Study (MHAS). Materials and methods Prospective, population study in Mexico, that included subjects of 60 years and older who were evaluated for the variables of frailty during the year 2001 (first wave of the study). Frailty was measured with the five-item FRAIL scale (fatigue, resistance, ambulation, illnesses, and weight loss). The robust, pre-frail or intermediate, and the frail group were considered when they had zero, one, and at least two components, respectively. Mortality, hospitalizations, falls, and functional dependency were evaluated during 2003 (second wave of the study). Relative risk was calculated for each complications, as well as hazard ratio (for mortality) through Cox regression model and odds ratio with logistic regression (for the rest of the outcomes), adjusted for covariates. Results The state of frailty was independently associated with mortality, hospitalizations, functional dependency, and falls. The pre-frailty state was only independently associated with hospitalizations, functional dependency, and falls. Conclusions Frailty measured through the FRAIL scale, is associated with an increase in the rate of mortality, hospitalizations, dependency in activities of daily life, and falls. PMID:26646253

Pica during pregnancy among Mexican-born women: a formative study

PubMed Central

Lin, Janice; Temple, Luisa; Trujillo, Celina; Mejia-Rodriquez, Fabiola; Rosas, Lisa Goldman; Fernald, LIa; Young, Sera Lewise

2014-01-01

Although pica, the craving and purposive consumption of non-food substances, is common among many populations, especially during pregnancy, the health consequences are not well understood. Further, very little is known about pica among Mexican populations in the US and Mexico. Therefore, we conducted formative research to understand pica in this understudied population. Our objectives were to identify the frequency and types of pica behaviors, understand perceived etiologies and consequences of pica, and to ascertain if the behavior was common enough to warrant a larger study. We held 9 focus group discussions (FGDs, 3 in the Salinas Valley, California, 6 in Xoxocotla, Morelos, Mexico) with 76 Mexican-born women who were currently pregnant or had delivered within the past two years. Earth, adobe, bean stones, and ice were the most commonly reported pica substances. Twenty-eight of the 76 participants (37%) reported ever engaging in pica; 22 participants (29%) reported doing so during pregnancy. The proportion of women reporting pica in the US was 43% and 34% in Mexico. Women attributed pica to the overwhelming organoleptic appeal of pica substances (especially smell and texture) and to micronutrient deficiencies. Perceived consequences of unfulfilled pica cravings were birthmarks or fetal loss; fulfilled pica cravings were also thought to be generally harmful to the mother or child, with several women specifying toxic lead, pesticides, or “worms”. In sum, pica among Mexican women is common enough to warrant a larger epidemiologic study of its socio-demographic correlates and physiological consequences. PMID:24784797

Emergent Biliteracy in Young Mexican Immigrant Children

ERIC Educational Resources Information Center

Reyes, Iliana; Azuara, Patricia

2008-01-01

This article explores the relationship between emergent biliteracy and growing up in a biliterate environment. The study focuses on two questions: (1) What knowledge of biliteracy do young bilingual preschool children develop in the early years? (2) How do context and specific language environments influence the development of biliteracy in young…

Evaluating the transferability of 15 European-derived fasting plasma glucose SNPs in Mexican children and adolescents

PubMed Central

Langlois, Christine; Abadi, Arkan; Peralta-Romero, Jesus; Alyass, Akram; Suarez, Fernando; Gomez-Zamudio, Jaime; Burguete-Garcia, Ana I.; Yazdi, Fereshteh T.; Cruz, Miguel; Meyre, David

2016-01-01

Genome wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with fasting plasma glucose (FPG) in adult European populations. The contribution of these SNPs to FPG in non-Europeans and children is unclear. We studied the association of 15 GWAS SNPs and a genotype score (GS) with FPG and 7 metabolic traits in 1,421 Mexican children and adolescents from Mexico City. Genotyping of the 15 SNPs was performed using TaqMan Open Array. We used multivariate linear regression models adjusted for age, sex, body mass index standard deviation score, and recruitment center. We identified significant associations between 3 SNPs (G6PC2 (rs560887), GCKR (rs1260326), MTNR1B (rs10830963)), the GS and FPG level. The FPG risk alleles of 11 out of the 15 SNPs (73.3%) displayed significant or non-significant beta values for FPG directionally consistent with those reported in adult European GWAS. The risk allele frequencies for 11 of 15 (73.3%) SNPs differed significantly in Mexican children and adolescents compared to European adults from the 1000G Project, but no significant enrichment in FPG risk alleles was observed in the Mexican population. Our data support a partial transferability of European GWAS FPG association signals in children and adolescents from the admixed Mexican population. PMID:27782183

The Mexican American.

ERIC Educational Resources Information Center

Rowan, Helen

The purpose of this paper, prepared for the U. S. Commission on Civil Rights, is to indicate the types and ranges of problems facing the Mexican American community and to suggest ways in which these problems are peculiar to Mexican Americans. Specific examples are cited to illustrate major problems and personal experiences. Topics covered in the…

A Binational Overview of Reproductive Health Outcomes Among US Hispanic and Mexican Women in the Border Region

PubMed Central

Mojarro, Octavio; Sutton, Paul D.; Ventura, Stephanie J.

2013-01-01

Introduction The US–Mexico border region has 15 million residents and 300,000 births annually. Reproductive health concerns have been identified on both sides of the border, but comparable information about reproductive health is not available. The objective of this study was to compare reproductive health indicators among populations in this region. Methods We used 2009 US Hispanic and Mexican birth certificate data to compare births inside the border region, elsewhere within the border states, and in the United States and Mexico overall. We examined trends in total fertility and birth rates using birth data from 2000 through 2009 and intercensal population estimates. Results Among women in the border region, US women had more lifetime births than Mexican women in 2009 (2.69 births vs 2.15 births) and throughout the decade. Birth rates in the group aged 15 to 19 years were high in both the US (73.8/1,000) and Mexican (86.7/1,000) border regions. Late or no prenatal care was nearly twice as prevalent in the border regions as in the nonborder regions of border states. Low birth weight and preterm and early-term birth were more prevalent in the US border than in the Mexican border region; US border rates were higher and Mexican rates were lower than their corresponding nonborder and national rates. We found some variations within border states. Conclusion These findings constitute the first population-based information on the reproductive health of the entire Hispanic US–Mexico border population. Evidence of disparities warrants exploration at state and local levels. Teen pregnancy and inadequate prenatal care are shared problems in US–Mexico border communities and suggest an area for binational cooperation. PMID:23948338

Factor structure and internal reliability of an exercise health belief model scale in a Mexican population.

PubMed

Villar, Oscar Armando Esparza-Del; Montañez-Alvarado, Priscila; Gutiérrez-Vega, Marisela; Carrillo-Saucedo, Irene Concepción; Gurrola-Peña, Gloria Margarita; Ruvalcaba-Romero, Norma Alicia; García-Sánchez, María Dolores; Ochoa-Alcaraz, Sergio Gabriel

2017-03-01

Mexico is one of the countries with the highest rates of overweight and obesity around the world, with 68.8% of men and 73% of women reporting both. This is a public health problem since there are several health related consequences of not exercising, like having cardiovascular diseases or some types of cancers. All of these problems can be prevented by promoting exercise, so it is important to evaluate models of health behaviors to achieve this goal. Among several models the Health Belief Model is one of the most studied models to promote health related behaviors. This study validates the first exercise scale based on the Health Belief Model (HBM) in Mexicans with the objective of studying and analyzing this model in Mexico. Items for the scale called the Exercise Health Belief Model Scale (EHBMS) were developed by a health research team, then the items were applied to a sample of 746 participants, male and female, from five cities in Mexico. The factor structure of the items was analyzed with an exploratory factor analysis and the internal reliability with Cronbach's alpha. The exploratory factor analysis reported the expected factor structure based in the HBM. The KMO index (0.92) and the Barlett's sphericity test (p < 0.01) indicated an adequate and normally distributed sample. Items had adequate factor loadings, ranging from 0.31 to 0.92, and the internal consistencies of the factors were also acceptable, with alpha values ranging from 0.67 to 0.91. The EHBMS is a validated scale that can be used to measure exercise based on the HBM in Mexican populations.

Mexican doctors serve rural areas.

PubMed

Grossi, J

1991-02-01

The Mexican Foundation for Family Planning (MEXFAM) worked to solve the unemployment problems of physicians and to increase health services to underserved rural areas. In Mexico, 75% of practicing physicians were located in 16 urban areas. Mexico had a large population of 83 million, of whom many in rural areas have been deprived of family planning and medical services. MEXFAM initiated the Community Doctors Project in 1986. The aim was to help Mexican doctors set up a medical practice in marginal urban towns and small towns with low income residents. Funding to physicians was provided for conducting a market survey of the proposed region and for advertising the new medical services. Loans of furniture and medical supplies were provided, and options were provided for purchase of equipment at a later date. During the promotion, services for maternal and child health care were provided for a small fee, while family planning was provided for free. Doctors usually become self-sufficient after about two years. The MEXFAM project established 170 community doctor's offices in 30 out of 32 states. Services were provided for at least 2500 families per office. In 1990, 13 offices were opened to serve an estimated 182,000 clients. A new effort is being directed to owners of Mexican factories. MEXFAM will set up a medical and family planning clinic very close to factories for a company contribution of only $12,000. The clinic promotion is being marketed through videos. MEXFAM found two companies that agreed to support a clinic.

How does legal status matter for oral health care among Mexican-origin children in California?

PubMed

Oropesa, R S; Landale, Nancy S; Hillemeier, Marianne M

2017-12-01

This research examines the relationship between legal status and oral health care among Mexican-origin children. Using the 2001-2014 California Health Interview Surveys, the objectives are: (1) to demonstrate population-level changes in the legal statuses of parents, the legal statuses of children, and the likelihood of receiving dental care; (2) to reveal how the roles of legal status boundaries in dental care are changing; and (3) to determine whether the salience of these boundaries is attributable to legal status per se. The results reveal increases in the native-born share and dental care utilization for the total Mexican-origin population. Although dental care was primarily linked to parental citizenship early in this period, parental legal statuses are no longer a unique source of variation in utilization (despite the greater likelihood of insurance among citizens). These results imply that future gains in utilization among Mexican-origin children will mainly come from overcoming barriers to care among the native born.

Subjective Social Status, Mental and Psychosocial Health, and Birth Weight Differences in Mexican-American and Mexican Immigrant Women.

PubMed

Fleuriet, K Jill; Sunil, T S

2015-12-01

Recent Mexican immigrant women on average have an unexpectedly low incidence of low birth weight (LBW). Birth weights decline and LBW incidence increases in post-immigrant generations. This pilot project tested the hypothesis that subjective social status (SSS) of pregnant women predicts variation in birth weight between Mexican immigrant and Mexican-American women. 300 low-income pregnant Mexican immigrant and Mexican-American women in South Texas were surveyed for SSS, depression, pregnancy-related anxiety, perceived social stress and self-esteem and subsequent birth weight. No significant difference in SSS levels between pregnant Mexican immigrant and Mexican-American women were found. However, SSS better predicted variation in birth weight across both groups than mental and psychosocial health variables. Results suggest distinct relationships among SSS, mental and psychosocial health that could impact birth weight. They underscore the relevance of a multilevel, biopsychosocial analytical framework to studying LBW.

Young people's attitudes towards illicit drugs: A population-based study.

PubMed

Friis, Karina; Østergaard, Jeanette; Reese, Sidsel; Lasgaard, Mathias

2017-12-01

Previous studies indicate that young people who have positive attitudes towards illicit drugs are more inclined to experiment with them. The first aim of our study was to identify the sociodemographic and risk behaviour characteristics of young people (16-24 years) with positive attitudes towards illicit drug use. The second aim was to identify the characteristics of young people with positive attitudes towards illicit drugs among those who had never tried drugs, those who had tried cannabis but no other illicit drugs, and those who regularly used cannabis and/or had tried other illicit drugs. The analysis was based on a population-based survey from 2013 ( N = 3812). Multiple logistic regression was used to analyse the association between sociodemographic and risk behaviour characteristics and positive attitudes towards illicit drugs. Young men had twice the odds of having positive attitudes towards illicit drug use compared with young women (AOR = 2.1). Also, young age, being single, being employed, smoking tobacco, practising unprotected sex, and experimental cannabis use were associated with positive attitudes towards illicit drug use. Finally, use of cannabis at least 10 times during the previous year and/or use of other illicit drugs had the strongest association with positive attitudes to illicit drug use (AOR = 6.0). Young people who have positive attitudes towards illicit drug use are characterized by a broad range of risky behaviours. These findings may help to identify young people at risk of initiating illicit drug use and thereby support the development and implementation of prevention programmes.

Culture as an influence on the perceived risk of HIV infection: a differential analysis comparing young people from Mexico and Spain.

PubMed

Giménez-García, Cristina; Ballester-Arnal, Rafael; Gil-Llario, María Dolores; Cárdenas-López, Georgina; Duran-Baca, Ximena

2013-06-01

This study analyzes risk behaviors and attitudes related to HIV-AIDS transmission between young people from two Hispanic/Latino culture and origin (Mexico and Spain). For this purpose, 840 participants filled out the AIDS Prevention Questionnaire (Ballester et al., El "Cuestionario de Prevención del Sida (CPS)": Análisis de la fiabilidad y validez. Sociedad Española Interdisciplinaria del Sida, San Sebastián, 2007). From the Theory of reasoned action, our results revealed differences between the risk behaviour profiles of young people depending on their origin or gender, in terms of attitudes and behaviours. For example, Mexican participants have exhibited more levels of perceived risk or severity of HIV while for Spaniards, the fear of HIV was higher. Regarding the perception of condom use, loss of pleasure seems to be an important barrier for both groups of Mexican and Spanish young although others, such as lack of information would be reported only for Mexican women. Regarding self-efficacy, there are no significant differences in general but, in specific cases, we found them: Spanish participants seem to be more comfortable with putting on a condom while Mexican participants are more confident when it comes to buying it. However, these Spanish young people have reported more behavioural intention and present condom use in all sexual practices. In general, predictors of condom use are different depending on gender and origin. Thus, in order to develop effective strategies in AIDS prevention, cultural differences for HIV transmission should be considered even inside the group of Hispanic/Latino young people.

Ecological Speciation in Nolina parviflora (Asparagaceae): Lacking Spatial Connectivity along of the Trans-Mexican Volcanic Belt

PubMed Central

Ruiz-Sanchez, Eduardo; Specht, Chelsea D.

2014-01-01

The hypothesis of ecological speciation states that as populations diverge in different niches, reproductive isolation evolves as a by-product of adaptation to these different environments. In this context, we used Nolina parviflora as a model to test if this species evolved via ecological speciation and to explore current and historical gene flow among its populations. Nolina parviflora is a montane species endemic to Mexico with its geographical distribution restricted largely to the Trans-Mexican Volcanic Belt. This mountain range is one of the most complex geological regions in Mexico, having undergone volcanism from the mid-Miocene to the present. Ecologically, the Trans-Mexican Volcanic Belt possesses different types of vegetation, including tropical dry forest; oak, pine, pine-oak, and pine-juniper forests; and xerophytic scrub - all of which maintain populations of N. parviflora. Using species distribution models, climatic analyses, spatial connectivity and morphological comparisons, we found significant differences in climatic and morphological variables between populations of N. parviflora in two distinct Trans-Mexican Volcanic Belt regions (east vs. west). This could mean that the geographically isolated populations diverged from one another via niche divergence, indicating ecological speciation. Spatial connectivity analysis revealed no connectivity between these regions under the present or last glacial maximum climate models, indicating a lack of gene flow between the populations of the two regions. The results imply that these populations may encompass more than a single species. PMID:24905911

Ecological speciation in Nolina parviflora (Asparagaceae): lacking spatial connectivity along of the Trans-Mexican Volcanic Belt.

PubMed

Ruiz-Sanchez, Eduardo; Specht, Chelsea D

2014-01-01

The hypothesis of ecological speciation states that as populations diverge in different niches, reproductive isolation evolves as a by-product of adaptation to these different environments. In this context, we used Nolina parviflora as a model to test if this species evolved via ecological speciation and to explore current and historical gene flow among its populations. Nolina parviflora is a montane species endemic to Mexico with its geographical distribution restricted largely to the Trans-Mexican Volcanic Belt. This mountain range is one of the most complex geological regions in Mexico, having undergone volcanism from the mid-Miocene to the present. Ecologically, the Trans-Mexican Volcanic Belt possesses different types of vegetation, including tropical dry forest; oak, pine, pine-oak, and pine-juniper forests; and xerophytic scrub--all of which maintain populations of N. parviflora. Using species distribution models, climatic analyses, spatial connectivity and morphological comparisons, we found significant differences in climatic and morphological variables between populations of N. parviflora in two distinct Trans-Mexican Volcanic Belt regions (east vs. west). This could mean that the geographically isolated populations diverged from one another via niche divergence, indicating ecological speciation. Spatial connectivity analysis revealed no connectivity between these regions under the present or last glacial maximum climate models, indicating a lack of gene flow between the populations of the two regions. The results imply that these populations may encompass more than a single species.

Legal Status and Wage Disparities for Mexican Immigrants

PubMed Central

Hall, Matthew; Greenman, Emily; Farkas, George

2014-01-01

This paper employs a unique method of imputing the legal status of Mexican immigrants in the 1996-1999 and 2001-2003 panels of the Survey of Income and Program Participation to provide new evidence of the role of legal authorization in the U.S. on workers’ wages. Using growth curve techniques, we estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants, U.S-born Mexican Americans, and native non-Latino whites. Our estimates reveal a 17 percent wage disparity between documented and undocumented Mexican immigrant men, and a 9 percent documented-undocumented wage disparity for Mexican immigrant women. We also find that in comparison to authorized Mexicans, undocumented Mexican immigrants have lower returns to human capital and slower wage growth. PMID:25414526

Legal Status and Wage Disparities for Mexican Immigrants.

PubMed

Hall, Matthew; Greenman, Emily; Farkas, George

2010-12-01

This paper employs a unique method of imputing the legal status of Mexican immigrants in the 1996-1999 and 2001-2003 panels of the Survey of Income and Program Participation to provide new evidence of the role of legal authorization in the U.S. on workers' wages. Using growth curve techniques, we estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants, U.S-born Mexican Americans, and native non-Latino whites. Our estimates reveal a 17 percent wage disparity between documented and undocumented Mexican immigrant men, and a 9 percent documented-undocumented wage disparity for Mexican immigrant women. We also find that in comparison to authorized Mexicans, undocumented Mexican immigrants have lower returns to human capital and slower wage growth.

The Racial Wage Gap: The Importance of Labor Force Attachment Differences across Black, Mexican, and White Men

ERIC Educational Resources Information Center

Antecol, Heather; Bedard, Kelly

2004-01-01

Labor market attachment differs significantly across young black, Mexican, and white men. Although it has long been agreed that potential experience is a poor proxy for actual experience for women, many view it as an acceptable approximation for men. Using the NLSY, this paper documents the substantial difference between potential and actual…

[Interpersonal violence in Mexican young people and prevention opportunities].

PubMed

Valdez-Santiago, Rosario; Hidalgo-Solórzano, Elisa; Mojarro-Íñiguez, Mariana; Rivera-Rivera, Leonor; Ramos-Lira, Luciana

2013-01-01

To estimate the prevalence of health damage due to interpersonal violence in teenagers and young adults. The consequences of violence in Mexico are presented in this analysis, with data from the National Health and Nutrition Survey 2012 conducted between October 2011 and May 2012. Statistical analysis consisted in calculating general and specific prevalences and intervals obtained at 95% confidence for the group of adolescents and young people. Four of each hundred youngsters have presented health damage due to interpersonal violence. The prevalence of interpersonal violence is higher among men (5.0% men, 3.3% women), the most vulnerable age group is that of men 20 to 29 years old; one of four women reported domestic violence (24.5%). It is necessary to implement comprehensive measures for young people, designed to prevent this problem from growing in frequency as well as in its variety of forms and spaces.

Differences in body mass index according to fat mass- and obesity-associated (FTO) genotype in Mexican patients with bipolar disorder.

PubMed

Díaz-Anzaldúa, Adriana; Ocampo-Mendoza, Yolanda; Hernández-Lagunas, José Octavio; Díaz-Madrid, Federico Alejandro; Romo-Nava, Francisco; Juárez-García, Francisco; Ortega-Ortiz, Hiram; Díaz-Anzaldúa, Alejandro; Gutiérrez-Mora, Doris; Becerra-Palars, Claudia; Berlanga-Cisneros, Carlos

2015-09-01

The prevalence of obesity has dramatically increased in many countries and it is particularly high in patients with bipolar disorder (BD). A region in the first intron of the fat mass- and obesity-associated (FTO) gene, encompassing markers rs9939973, rs8050136, and rs9939609, has been consistently associated with obesity and body mass index (BMI) in different populations. We sought to determine whether FTO is associated with BMI and/or obesity in patients with BD. The sample included 129 Mexican Mestizo patients with bipolar I or bipolar II disorder. After obtaining informed consent, participants were evaluated with the Structured Clinical Interview for DSM-IV Axis I Disorders and weight, height, and body measurements were recorded. DNA was extracted from a 5-mL blood sample and real-time polymerase chain reaction was performed. The results were analyzed with Haploview v4.2 and SPSS v21. Differences in mean BMI were explained by rs8050136 and rs9939609 genotypes, especially by comparing non-carriers and carriers of two copies of the risk allele (Tukey's p ≤ 0.019), with a mean difference in BMI as high as 7.81 kg/m(2) . Differences in BMI were also explained by the interaction of the genotype (rs8050136 and/or rs9939609), the use of second-generation antipsychotics, and the use of mood stabilizers (p ≤ 0.41). Obesity was also associated with these two markers when patients with and without obesity were compared. In patients with BD, differences in BMI may be affected by the presence of FTO risk alleles, especially in homozygous individuals for these variants. Besides evaluating the possible metabolic effects of certain antipsychotics or mood stabilizers, it is important to evaluate the role of other factors such as FTO risk alleles. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Sibling Behaviors and Mexican-Origin Adolescents' After-School Activities

ERIC Educational Resources Information Center

Price, Chara D.; Simpkins, Sandra D.; Menjívar, Cecilia

2017-01-01

Families are theorized to influence adolescents' participation in skill-based after-school activities, but research has focused on the role of parents while neglecting the role of siblings. Siblings might be especially critical for Mexican-origin youth, the fastest growing youth population in the United States, due to a high value of family as…

Sexual function in adolescent and young adult cancer survivors-a population-based study.

PubMed

Olsson, Maria; Steineck, Gunnar; Enskär, Karin; Wilderäng, Ulrica; Jarfelt, Marianne

2018-03-05

Previous research has established that treatments for cancer can result in short- and long-term effects on sexual function in adult cancer patients. The purpose was to investigate patient-reported physical and psychosexual complications in adolescents and young adults after they have undergone treatment for cancer. In this population-based study, a study-specific questionnaire was developed by a method used in several previous investigations carried out by our research group, Clinical Cancer Epidemiology. The questionnaire was developed in collaboration with adolescent and young adult cancer survivors (15-29 years) and validated by professionals from oncology units, midwives, epidemiologists, and statisticians. The topics covered in the questionnaire were psychosocial health, body image, sexuality, fertility, education, work, and leisure. The web-based questionnaire was sent to adolescent and young adult cancer survivors and matched controls in Sweden. In this study, adolescent and young adult cancer survivors (15-29 years) showed low satisfaction regarding sexual function compared to controls (P < 0.01). Female adolescent and young adult cancer survivors had a statistically significant lower frequency of orgasm during sexual activity than the controls (P < 0.01). Male adolescent and young adult cancer survivors had statistically significant lower sexual desire than the controls (P = 0.04). We found that adolescent and young adult cancer survivors perceived themselves as being less satisfied with their sexual function than matched population-based controls. Adolescent and young adult cancer survivors need psychological rehabilitation support from the health care profession during and after cancer treatment to help them to reduce their reported poor sexual function to enhance a good sexual quality of life.

The relationship between Mexican American cultural values and resilience among Mexican American college students: a mixed methods study.

PubMed

Morgan Consoli, Melissa L; Llamas, Jasmin D

2013-10-01

The current study investigated the role of cultural values in the resilience of Mexican American college students. Utilizing mixed methodology, 124 self-identified Mexican American college students were asked to complete an online survey, including a demographic questionnaire, the Resilience Scale, Mexican American Cultural Values Scale, and 2 open-ended questions concerning overcoming adversity and cultural values. As hypothesized, Mexican American traditional cultural values (Familismo, Respeto, Religiosidad, and Traditional Gender Roles) predicted resilience, with Familismo accounting for the majority of the variance. Consensual qualitative research (Hill, Thompson, & Nutt Williams, 1997) was used to identify emergent domains and themes within the open-ended question responses. Traditional Mexican American Value themes included Familismo, Ethnic Identity, Religiosidad, Perseverance, and Respeto. Results highlight the important role that certain Mexican American cultural values play in providing strength for overcoming adversities.

Perceived social stress, pregnancy-related anxiety, depression and subjective social status among pregnant Mexican and Mexican American women in south Texas.

PubMed

Fleuriet, K Jill; Sunil, T S

2014-05-01

The purpose of this study was to determine differences in subjective social status, perceived social stress, depressive symptoms, and pregnancy-related anxiety between pregnant Mexican American and Mexican immigrant women. Three hundred pregnant Mexican immigrant and Mexican American women in South Texas were surveyed for pregnancy-related anxiety, perceived social stress, depressive symptoms, and subjective social status. Pregnant Mexican immigrant women had higher levels of pregnancy-related anxiety and lower levels of depression and perceived social stress than pregnant Mexican American women. Change in these variables among Mexican immigrant women was relatively linear as time of residence in the United States increased. Mexican immigrant and Mexican American women had significantly different correlations between subjective social status, self-esteem and perceived social stress. Results indicate that subjective social status is an important psychosocial variable among pregnant Hispanic women. Results contribute to ongoing efforts to provide culturally responsive prenatal psychosocial support services.

Measuring Violence Risk and Outcomes among Mexican American Adolescent Females

ERIC Educational Resources Information Center

Cervantes, Richard C.; Duenas, Norma; Valdez, Avelardo; Kaplan, Charles

2006-01-01

Central to the development of culturally competent violence prevention programs for Hispanic youth is the development of psychometrically sound violence risk and outcome measures for this population. A study was conducted to determine the psychometric properties of two commonly used violence measures, in this case for Mexican American adolescent…

A TWO-WAY ROAD: RATES OF HIV INFECTION AND BEHAVIORAL RISK FACTORS AMONG DEPORTED MEXICAN LABOR MIGRANTS

PubMed Central

Rangel, M. Gudelia; Martinez-Donate, Ana P.; Hovell, Melbourne; Sipan, Carol L.; Zellner, Jennifer A.; Gonzalez-Fagoaga, Eduardo; Kelley, Norma J.; Asadi-Gonzalez, Ahmed; Amuedo-Dorantes, Catalina; Magis-Rodriguez, Carlos

2012-01-01

A large number of Mexican migrants are deported to Mexico and released in the North Mexican border region every year. Despite their volume and high vulnerability, little is known about the level of HIV infection and related risk behaviors among this hard-to-reach population. We conducted a cross-sectional, probability survey with deported Mexican migrants in Tijuana, Mexico (N=693) and estimated levels of HIV infection and behavioral risk factors among this migrant flow. The sample and population estimated rates of HIV for deported males were 1.23% and 0.80%, respectively. No positive cases were found among the female sample. We found high lifetime rates of reported sexually transmitted infections (22.3%) and last 12-months rates of unprotected sex (63.0%), sex with multiple sexual partners (18.1%), casual partners (25.7%), and sex workers (8.6%), compared to U.S. and Mexico adults. HIV prevention, testing, and treatment programs for this large, vulnerable, and transnational population need to be implemented in both the U.S. and Mexico. PMID:22562390

Morphological variation among late holocene Mexicans: Implications for discussions about the human occupation of the Americas.

PubMed

Herrera, Brianne; Peart, Daniel; Hernandez, Nicole; Spradley, Kate; Hubbe, Mark

2017-05-01

Cranial morphology has previously been used to estimate phylogenetic relationships among populations, and has been an important tool in the reconstruction of ancient human dispersals across the planet. In the Americas, previous morphological studies support a scenario of people entering the Americas and dispersing from North America into South America through Meso America, making the Mexican territory the natural funnel through which biological diversity entered South America. We explore the cranial morphological affinities of three late Holocene Mexican series, in relation to ancient and modern crania from North and South America, Australo-Melanesia, and East Asia. Morphological affinities were assessed through Mahalanobis Distances, and represented via Multidimensional Scaling and Ward's Linkage Cluster analysis. Minimum F ST values were also calculated for each series. Our results show Mexican groups share morphological affinities with the Native American series, but do not cluster together as would be expected. The minimum F ST estimates show between-group variation in the Americas is higher than the Asian or Australo-Melanesian populations, and that Mexican series have high between-group variance (F ST  = 0.124), compared to the geographically larger South America (F ST  = 0.116) and North America (F ST  = 0.076). These results show that the Mexican series share morphological affinities with the East Asian series, but maintains high levels of between-group variation, similar to South America. This supports the suggestion that the high phenotypic variation seen the Americas is not a result of its size, as it can be found in more constricted areas, such as the Mexican territory. © 2017 Wiley Periodicals, Inc.

A Six-Wave Study of the Consistency of Mexican/Mexican American Preadolescents' Lifetime Substance Use Reports

ERIC Educational Resources Information Center

Wagstaff, David A.; Kulis, Stephen; Elek, Elvira

2009-01-01

In the Fall of 2004, 1,948 5th grade students from Phoenix, AZ enrolled in an evaluation of a school-based, substance use prevention intervention. To assess the consistency of Mexican and Mexican-American students' self-reports of lifetime substance use, the present study analyzed data reported by 1,418 students who reported Mexican ancestry and…

ELECTROCARDIOGRAPHIC ABNORMALITIES AMONG MEXICAN AMERICANS: CORRELATIONS WITH DIABETES, OBESITY, AND THE METABOLIC SYNDROME.

PubMed

Queen, Saulette R; Smulevitz, Beverly; Rentfro, Anne R; Vatcheva, Kristina P; Kim, Hyunggun; McPherson, David D; Hanis, Craig L; Fisher-Hoch, Susan P; McCormick, Joseph B; Laing, Susan T

2012-04-01

Resting ischemic electrocardiographic abnormalities have been associated with cardiovascular mortality. Simple markers of abnormal autonomic tone have also been associated with diabetes, obesity, and the metabolic syndrome in some populations. Data on these electrocardiographic abnormalities and correlations with coronary risk factors are lacking among Mexican Americans wherein these conditions are prevalent. This study aimed to evaluate the prevalent resting electrocardiographic abnormalities among community-dwelling Mexican Americans, and correlate these findings with coronary risk factors, particularly diabetes, obesity, and the metabolic syndrome. Study subjects (n=1280) were drawn from the Cameron County Hispanic Cohort comprised of community-dwelling Mexican Americans living in Brownsville, Texas at the United States-Mexico border. Ischemic electrocardiographic abnormalities were defined as presence of ST/T wave abnormalities suggestive of ischemia, abnormal Q waves, and left bundle branch block. Parameters that reflect autonomic tone, such as heart rate-corrected QT interval and resting heart rate, were also measured. Ischemic electrocardiographic abnormalities were more prevalent among older persons and those with hypertension, diabetes, obesity, and the metabolic syndrome. Subjects in the highest quartiles of QTc interval and resting heart rate were also more likely to be diabetic, hypertensive, obese, or have the metabolic syndrome. Among Mexican Americans, persons with diabetes, obesity, and the metabolic syndrome were more likely to have ischemic electrocardiographic abnormalities, longer QTc intervals, and higher resting heart rates. A resting electrocardiogram can play a complementary role in the comprehensive evaluation of cardiovascular risk in this minority population.

Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

PubMed

Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

2013-11-01

Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

Sleep moderates and mediates the relationship between acculturation and depressive symptoms in pregnant Mexican-American women

PubMed Central

D’Anna-Hernandez, Kimberly L.; Garcia, Esmeralda; Coussons-Read, Mary; Laudenslager, Mark L.; Ross, Randal G.

2016-01-01

Purpose Greater acculturation is associated with adverse perinatal outcomes in Mexican-American women, but the mechanisms by which acculturation influences perinatal outcomes are unclear. Pregnant acculturated Mexican-American women are more likely to engage in unhealthy prenatal behaviors relative to those less acculturated, including poor sleep. As sleep disruptions are associated with acculturation and negative perinatal outcomes, particularly maternal depression, alterations in sleep may adversely affect pregnant Mexican-American women. Methods Sixty pregnant women of Mexican descent completed surveys about sleep, acculturation, depressive symptoms and potential protective factor of social support. Results Acculturation, but not social support, significantly predicted increased sleep disruptions as well as overall feeling less refreshed upon waking across pregnancy. Moderation analysis indicated that more acculturated women who took longer to fall asleep reported increased depressive symptoms. Feeling refreshed upon waking also mediated the relationship between increased acculturation and elevated maternal depressive symptoms. Conclusions Acculturation and altered sleep contribute to greater risk in Mexican-American women for maternal depressive symptoms in the perinatal period. These findings have implications for prevention and treatment of maternal mental health disorders, which may adversely affect perinatal outcomes in the vulnerable Mexican-American population. PMID:26728897

Sleep Moderates and Mediates the Relationship Between Acculturation and Depressive Symptoms in Pregnant Mexican-American Women.

PubMed

D'Anna-Hernandez, Kimberly L; Garcia, Esmeralda; Coussons-Read, Mary; Laudenslager, Mark L; Ross, Randal G

2016-02-01

Greater acculturation is associated with adverse perinatal outcomes in Mexican-American women, but the mechanisms by which acculturation influences perinatal outcomes are unclear. Pregnant acculturated Mexican-American women are more likely to engage in unhealthy prenatal behaviors relative to those less acculturated, including poor sleep. As sleep disruptions are associated with acculturation and negative perinatal outcomes, particularly maternal depression, alterations in sleep may adversely affect pregnant Mexican-American women. Sixty pregnant women of Mexican descent completed surveys about sleep, acculturation, depressive symptoms and potential protective factor of social support. Acculturation, but not social support, significantly predicted increased sleep disruptions as well as overall feeling less refreshed upon waking across pregnancy. Moderation analysis indicated that more acculturated women who took longer to fall asleep reported increased depressive symptoms. Feeling refreshed upon waking also mediated the relationship between increased acculturation and elevated maternal depressive symptoms. Acculturation and altered sleep contribute to greater risk in Mexican-American women for maternal depressive symptoms in the perinatal period. These findings have implications for prevention and treatment of maternal mental health disorders, which may adversely affect perinatal outcomes in the vulnerable Mexican-American population.

Morphological and Color Differences between Island and Mainland Populations in the Mexican Red Rump Tarantula, Brachypelma vagans

PubMed Central

Vilchis-Nestor, Claudia A.; Machkour-M'Rabet, Salima; Barriga-Sosa, Irene de los A.; Winterton, Peter; Hénaut, Yann

2013-01-01

The introduction of species into new ecosystems, especially in small and isolated regions such as islands, offers an excellent opportunity to answer questions of the evolutionary processes occurring in natural conditions on a scale that could never be achieved in laboratory conditions. In this study, we examined the Mexican red rump tarantula Brachypelma vagans Ausserer (Mygalomorphae: Theraphosidae), a species that was introduced to Cozumel Island, Mexico, 40 years ago. This introduction provides an exceptional model to study effects such as morphological variation between island populations and those on the mainland in open habitats facing the island. Intraspecific variation related to the color polymorphism was compared. The aim of this study was to determine the phenotypic differences between continental populations of B. vagans and the introduced population on Cozumel Island. Phenotypic difference was evaluated using two approaches: 1) comparison of the morphometric measurements of adult and juvenile individuals at the local scale and between continental and island populations, and 2) comparison of individual color polymorphism between mainland and island populations. Two locations were sampled within the continental part of the Yucatan peninsula and two on the island of Cozumel. The number of samples analyzed at each site was 30 individuals. The morphometric results showed significant differences between continental and island populations, with bigger individuals on the island. In addition, three new variations of the typical color pattern of B. vagans recorded so far were observed. This study opens the door to further investigations to elucidate the origin of the phenotypic variation of the isolated individuals on Cozumel Island. Also, the widest range of color morphs found for a tarantula species is reported. PMID:24224805

[Acetabular anteversion angle of the hip in the Mexican adult population measured with computed tomography].

PubMed

Rubalcava, J; Gómez-García, F; Ríos-Reina, J L

2012-01-01

Knowledge of the radiogrametric characteristics of a specific skeletal segment in a healthy population is of the utmost clinical importance. The main justification for this study is that there is no published description of the radiogrametric parameter of acetabular anteversion in a healthy Mexican adult population. A prospective, descriptive and cross-sectional study was conducted. Individuals of both genders older than 18 years and orthopedically healthy were included. They underwent a two-dimensional axial tomographic study of both hips to measure the acetabular anteversion angles. The statistical analysis consisted of obtaining central trend and scatter measurements. A multivariate analysis of variance (ANOVA) and statistical significance were performed. 118 individuals were studied, 60 males and 58 females, with a mean age of 47.7 +/- 16.7, and a range of 18-85 years. The anteversion of the entire group was 18.6 degrees + 4.1 degrees. Anteversion in males was 17.3 degrees +/- 3.5 degrees (10 degrees - 25 degrees) and in females 19.8 degrees +/- 4.7 degrees (10 degrees - 31 degrees). There were no statistically significant differences (p < or = 0.05) in right and left anteversion in the entire group. However, there were statistically significant differences (p > or = 0.005) both in the right and left sides when males and females were compared. Our study showed that there are great variations in the anteversion ranges of a healthy population. When our results are compared with those published by other authors the mean of most measurements exceeds 15 degrees. This should be useful to make therapeutic decisions that involve acetabular anteversion.

Characterization of Mexican Americans with mild cognitive impairment and Alzheimer's disease.

PubMed

O'Bryant, Sid E; Johnson, Leigh; Balldin, Valerie; Edwards, Melissa; Barber, Robert; Williams, Benjamin; Devous, Michael; Cushings, Blair; Knebl, Janice; Hall, James

2013-01-01

The purpose of the study was to provide characterization of Mexican Americans who meet criteria for Alzheimer's disease (AD) and mild cognitive impairment (MCI). For the study, 1,069 participants ages 40 and above who self-identified as either non-Hispanic white (n = 633) or Mexican American (n = 436) were recruited using a community-based participatory research approach. Global cognition was assessed via the Mini-Mental State Examination (MMSE), dementia severity by the Clinical Dementia Rating Scale, and depression via the Geriatric Depression Scale 30-item version. Age, gender, education, ApoE ε4 allele frequency, and diabetic diagnoses were also analyzed. The findings showed that Mexican Americans (normal controls, MCI, and AD) were younger, less highly educated, performed more poorly on the MMSE, endorsed more symptoms of depression, were more likely to be diagnosed with diabetes, and possessed the ApoE ε4 allele less frequently. Age was the only significant risk factor for cognitive dysfunction (AD/MCI) among Mexican Americans (OR = 1.06, 95% CI = 1.03-1.09). Age (B = 0.07, std = 0.02, p < 0.001) and ApoE ε4 presence (B = 0.9, std = 0.4, p = 0.02) were significantly related to increased disease severity. Given the rapidly growing and aging Mexican American population, there is a substantial need for research into cognitive aging, MCI, and AD among this ethnic group. The current findings hold important implications for both clinic and research settings and point to additional research needs.

Mexican-American Cultural Assumptions and Implications.

ERIC Educational Resources Information Center

Carranza, E. Lou

The search for presuppositions of a people's thought is not new. Octavio Paz and Samuel Ramos have both attempted to describe the assumptions underlying the Mexican character. Paz described Mexicans as private, defensive, and stoic, characteristics taken to the extreme in the "pachuco." Ramos, on the other hand, described Mexicans as…

"Ni De Aqui Ni from There". Navigating between Contexts: Counter-Narratives of Undocumented Mexican Students in the United States

ERIC Educational Resources Information Center

Castro-Salazar, Ricardo; Bagley, Carl

2010-01-01

Research has documented the ways in which students of Mexican origin are not succeeding academically in the same proportion as the rest of the US population. This process of educational failure occurs in the context of overt and more subtle forms of racism experienced throughout their schooling and everyday lives. Undocumented Mexican students…

Risk factors associated to diabetes in Mexican population and phenotype of the individuals who will convert to diabetes.

PubMed

González-Villalpando, Clicerio; Dávila-Cervantes, Claudio Alberto; Zamora-Macorra, Mireya; Trejo-Valdivia, Belem; González-Villalpando, María Elena

2014-01-01

To describe risk factors associated to the incidence of type 2 diabetes (T2D) in Mexican population and to define phenotypic (clinical, anthropometric, metabolic) characteristics present in the individual who will convert to diabetes, regardless of time of onset. The Mexico City Diabetes Study began in 1990, with 2 282 participants, and had three subsequent phases: 1994, 1998, and 2008. A systematic evaluation with an oral glucose tolerance test was performed in each phase. For diagnosis of T2D, American Diabetes Association criteria were used. The population at risk was 1939 individuals. Subjects who were in the converter stage (initially non diabetic that eventually converted to T2D) had, at baseline, higher BMI (30 vs 27), systolic blood pressure (119 vs 116 mmHg), fasting glucose (90 vs 82mg/dl), triglycerides (239 vs 196mg/dl), and cholesterol (192 vs 190mg/dl), compared with subjects who remained non converters (p<0.05). The phenotype described represents a potentially identifiable phase and a target for preventive intervention.

Anthropometric measurements of a sixty-year and older Mexican urban group.

PubMed

Velasquez-Alva, M C; Irigoyen, M E; Zepeda, M; Sanchez, V M; Garcia Cisneros, M P; Castillo, L M

2004-01-01

In the Third World Countries, little attention has been paid to health and nutrition aspects of the elderly population. In Mexico, there are no data that provides anthropometric parameters of this group. The purpose of this study was to obtain anthropometric measurements of 60-year-old-and older Mexican men and women in Mexico City. A cross sectional study was carried out. The sample was selected from men and women registered as retired or pensioned by the Mexican Social Security Institute (IMSS) and from those requesting identification cards from the Elderly National Institute (INSEN). Standardized protocols were used to register anthropometric measurements. The group examined included 1091 people, 484 males and 607 females. The mean age of the population was 66.1 (s.d. 6.1). The values in the male group were higher than in the female group in height, weight and waist circumference; women showed higher values in body mass index (BMI), arm circumference, triceps skinfold and hip circumference (p < 0.01). The data gathered up were divided in five age groups; each one in a five-year interval. Percentiles of the anthropometric measurements according to the age group and gender are presented. Regression analysis indicated that the measurements of weight, body mass index, arm circumference and arm muscle area, showed lower values in the older groups. An important segment of the population studied had a BMI higher to the normal values. Additional studies covering other communities in Mexico with a different socioeconomic and ethnic composition, would be necessary to obtain a better characterization of the Mexican elderly.

Distribution of genetic variants of oxidative stress metabolism genes: Paraoxonase 1 (PON1) and Glutathione S-transferase (GSTM1/GSTT1) in a population from Southeastern Mexico.

PubMed

García-González, I; Mendoza-Alcocer, R; Pérez-Mendoza, G J; Rubí-Castellanos, R; González-Herrera, L

2016-11-01

Paraoxonase 1 (PON1) and glutathione S-transferases (GSTs) are involved in the biotransformation of xenobiotics. Variation in the enzyme concentration and activity suggests individual differences for the degree of protection against oxidative stress. This study analysed the distribution of SNPs Q192R, L55M (PON1) and variants in GSTM1 and GSTT1 genes in a population from Southeastern Mexico. One hundred and fifty-one Mexican Mestizo healthy volunteers were included. PON1 polymorphisms were determined by Taqman allele discrimination real time-PCR, whereas GSTM1 and GSTT1 genes were determined with a multiplex PCR-based method. All genotypes were in Hardy-Weinberg equilibrium, except for GSTM1. The genotypic distributions of Q192R and L55M were 22% QQ, 48% QR, 30% RR, 62% LL, 34% LM and 4% MM, respectively, whereas the allele frequencies were 0.46 (Q), 0.54 (R), 0.79 (L) and 0.21 (M). The most frequent haplotype was R/L (46.7%). It was found that 31% and 9% of the individuals had the GSTM1 and GSTT1 null genotype, respectively. The frequency of the combined null genotype GSTM1*0/GSTT1*0 was 4.64%. The results showed that the frequencies of polymorphisms of PON1, GSTM1 and GSTT1 in the Yucatán population differ to those observed in other ethnic groups and provide useful data for epidemiological studies.

Testing the weathering hypothesis among Mexican-origin women.

PubMed

Wildsmith, Elizabeth M

2002-01-01

To examine the "weathering hypothesis," as proposed by Geronimus (1986; 1987; 1992; 1996), among US-born and foreign-born Mexican-origin women. This hypothesis specifically argues that the relationship between age and a variety of reproductively related heath outcomes varies by socioeconomic and environmental context. 1989-1991 National Center for Health Statistics (NCHS) linked birth-death files. These files include all women who experienced a live birth in the United States and whose infants were issued a birth certificate during the years 1989 to 1991 (NCHS 1995). Age and nativity specific distributions on infant mortality, low birth weight, anemia, pregnancy related hypertension, and smoking were estimated for Mexican-origin women. For the foreign-born, levels of neonatal mortality are highest for younger women and tend to increase again in women at the oldest ages. For the US born, the lowest levels are for women aged 17 and 18 years, and 27-29 years. Levels for women aged 19-24 years and 30-34 years are higher than those for 17-and 18-year-olds. For both groups of women, giving birth to infants with low birth weight is most common at the earlier ages, declining more or less until the mid twenties when the rate begins to rise again slowly. Patterns for the maternal health indicators vary, with pregnancy related hypertension most strongly following the pattern suggested by weathering. Overall, this analysis suggests that there is evidence of weathering within the Mexican-origin population, particularly for the US-born population, and this is most clearly seen in levels of neonatal mortality and pregnancy related hypertension.

High depressive symptomatology among older community-dwelling Mexican Americans: the impact of immigration.

PubMed

Gerst, Kerstin; Al-Ghatrif, Majd; Beard, Holly A; Samper-Ternent, Rafael; Markides, Kyriakos S

2010-04-01

This analysis explores nativity differences in depressive symptoms among very old (75+) community-dwelling Mexican Americans. Cross-sectional analysis using the fifth wave (2004-2005) of the Hispanic Established Population for the Epidemiological Study of the Elderly (Hispanic EPESE). The sample consisted of 1699 non-institutionalized Mexican American men and women aged 75 years and above. Depressive symptoms were measured by the Center for Epidemiological Studies Depression Scale (CES-D). Logistic regression was used to predict high depressive symptoms (CES-D score 16 or higher) and multinomial logistic regression was used to predict sub-threshold, moderate, and high depressive symptoms. Results showed that elders born in Mexico had higher odds of more depressive symptoms compared to otherwise similar Mexican Americans born in the US. Age of arrival, gender, and other covariates did not modify that risk. The findings suggest that older Mexican American immigrants are at higher risk of depressive symptomatology compared to persons born in the US, which has significant implications for research, policy, and clinical practice.

Mexican Americans with type 2 diabetes: perspectives on definitions, motivators, and programs of physical activity.

PubMed

Mier, Nelda; Medina, Alvaro A; Ory, Marcia G

2007-04-01

Research documents that Mexican Americans bear excess health risk because of physical inactivity and have higher morbidity and mortality rates from chronic diseases than do other ethnic groups. Factors influencing physical activity in this minority population, however, are not well understood. This study examines perceptions of physical activity in a population of Mexican Americans who have type 2 diabetes and live in the Texas-Mexico border region and identifies motivators and barriers to physical activity in this group. This study used a qualitative research design and employed six focus groups comprising 39 Mexican Americans with type 2 diabetes who live in the Texas-Mexico border region. A team of bilingual Mexican American researchers systematically reviewed and analyzed focus group data by means of qualitative data analysis software. The study was conducted during 2005-2006. Most participants considered physical activity to be related not only to exercise but also to occupational and home activities. Walking was the preferred type of activity. Motivators to physical activity included family support and the sense of well-being derived from physical activity. Barriers to physical activity included individual and environmental factors, such as lack of time, physical pain, depression, being overweight, unsafe neighborhoods, and lack of facilities. Participants suggested that the ideal intervention would be low in cost, family-based, close to home, and led by bilingual instructors. Health promotion efforts to prevent or reduce the effects of chronic disease among Mexican Americans with type 2 diabetes in the Texas-Mexico border region should focus on implementing neighborhood-based, family-oriented walking interventions.

The Rural – Urban Divide: Health Services Utilization Among Older Mexicans in Mexico

PubMed Central

Salinas, Jennifer J.; Al Snih, Soham; Markides, Kyriakos; Ray, Laura A.; Angel, Ronald J.

2010-01-01

Context Mexico Purpose Using the health care service utilization model as a framework, this paper will analyze the differences in health care service use among older Mexicans living in urban and rural areas in Mexico. Methods The Mexican Health and Aging Survey (MHAS) data were used to test the applicability of Andersen’s “model of health services” of predisposing (ie, age, sex, etc.), enabling (education, insurance coverage, etc.) and need factors (diabetes, hypertension, etc.) to predict ever being in the hospital and physician visits in the past year by place of residence (urban, rural, semi-rural). Findings Results showed that older Mexicans living in the most rural areas (populations of 2500 or fewer) were significantly less likely to have been hospitalized in the previous year and visited the physician less often (P < .0001) than their urban counterparts. The significant difference in hospitalization between rural and urban residing older Mexicans was largely accounted for by having health care coverage. Certain need factors such as diabetes, previous heart attack, hypertension, depression, and functional limitations predicted frequency of physician visits and hospitalization, but they did not explain variations between rural and urban older Mexicans. Conclusions Not having insurance coverage was associated with a lower likelihood of spending an overnight visit in the hospital and visiting a physician for older Mexicans. This lower utilization may be due to barriers to access rather than better health. PMID:21029168

CFTR allelic heterogeneity in Mexican patients with cystic fibrosis: implications for molecular screening.

PubMed

Chávez-Saldaña, Margarita; Yokoyama, Emiy; Lezana, José Luis; Carnevale, Alessandra; Macías, Miguel; Vigueras, Rosa M; López, Marisol; Orozco, Lorena

2010-01-01

Cystic fibrosis, the most common autosomal recessive disorder, is caused by defects in the CF transmembrane conductance regulator gene (CFTR) that encodes a chloride channel. To date, over 1,800 mutations have been described related to the causative gene of CF, showing a variable frequency among populations. In a previous extensive analysis of the CFTR locus in 97 Mexican patients, 34 different mutations (75% of CF alleles) were found using several strategies for mutation screening; however, 63% had at least an uncharacterized allele. Despite the combined technologies used, there are still a great number of unknown mutations in the Mexican population. Screening of the CFTR gene to provide additional evidence of the mutational wide spectrum responsible for CF in Mexican patients. In this study, the number of unrelated CF patients was increased to 230, 133 new cases and the 97 previously reported to include 63% with at least an uncharacterized allele. Additional tools were used to improve the detection rate of CF mutations, such as a commercial kit for 36 mutations plus a single chain conformational polymorphism method and DNA sequencing. By using a combination of these strategies we characterized 77.7% of all the CF alleles, resulting in a total of 46 different mutations detected, including the identification of 12 additional mutations (p.R334W, p.A455E, c.3120+1G > A, c.3272-26A > G, c.711+1G > T, p.Q552X, p.W1282X, c.IVS8-5T, p.R1162X and p.R347P, p.D1152H and p.T1036N). Although these 12 mutations have been reported in other populations, they have not yet been reported in Mexican patients. This report shows that Mexico has one of the widest spectra of CFTR mutations worldwide. The knowledge of the ethnic and geographic distribution of CFTR mutations in this population will allow the development of more effective methods for diagnosis and treatment.

Mexican American Social Workers' Perceptions of Doctoral Education and Academia

ERIC Educational Resources Information Center

Tijerina, Mary; Deepak, Anne C.

2014-01-01

An increase in Latinos in the social work academy is critical due to current underrepresentation in social work education programs and rapid Latino population growth in the United States. In this qualitative study, perceptions of Mexican American master's of social work-level practitioners regarding social work doctoral education and academia were…