Ireland, Michael James; Pakenham, Kenneth Ian
2010-07-01
The purpose of this study was to develop an empirically derived multi-item scale of care tasks performed by young people in the context of family illness/disability: the Youth Activities of Caregiving Scale (YACS). A total of 135 youngsters aged 10-24 years with an ill/disabled family member completed questionnaires. Factor analyses performed on the YACS yielded four factors, instrumental care, social/emotional care, personal/intimate care and domestic/household care, accounting for 57.78% of the variance. The internal reliabilities of all factors ranged from 0.74 to 0.92. Higher scores on the YACS related to higher youth age and several caregiving context variables (i.e. household type [single or dual-parent household], relationship with care-recipient and perceived choice in caregiving). Higher scores on the YACS also related to care-recipient illness/disability variables (onset, functional impairment, prognosis, predictability and illness/disability type). Strong positive correlations between the YACS and a conceptually related measure of young caregiving experiences provided good convergent validity data. Criterion validity was established with evidence that the YACS predicted youth adjustment in the domains of health and prosocial behaviour.
Empowering Youth to Take Charge of School Wellness
ERIC Educational Resources Information Center
Hughes, Luanne J.; Savoca, LeeAnne; Grenci, Alexandra
2015-01-01
Youth Advisory Councils (YACs) ensure that students are represented in school wellness discussions. YACs empower students to present ideas, insights, and input on nutrition and physical activity; work alongside peers to assess wellness needs; and develop recommendations for enhancing/expanding the school wellness environment. YACs provide a…
Urban Youth Knowledge and Attitudes Regarding Lead Poisoning.
Bogar, Sandra; Szabo, Aniko; Woodruff, Shane; Johnson, Sheri
2017-12-01
Environmental health literacy (EHL) is a promising and evolving field of research that could benefit from youth engagement. Yet studies focused on youths' environmental health awareness and concerns are limited. For example, although lead exposure remains a threat to youth development in urban environments, no published studies have measured urban youth's knowledge of lead poisoning. A CBPR partnership established a youth advisory council (YAC) who helped to design, interpret and disseminate a mixed methods study exploring environmental health perceptions among urban youths ages 10-18. Surveys assessed awareness, attitudes, and knowledge regarding lead poisoning and five environmental health issues determined by the YAC. Focus group questions further contextualized youths' lead knowledge and understanding of youths' environmental health concerns. A majority of youth could identify specific sources of lead exposure but had minimal knowledge of prevention strategies, and focus group data revealed misinformation regarding lead sources and consequences. Survey and focus group respondents' level of awareness and concern regarding YAC-selected EH issues was high in comparison to lead poisoning. In particular, job opportunities and police brutality were endorsed as both neighborhood concerns and priorities. Awareness and knowledge of environmental health issues among urban youth have not been well described. These findings reinforce the importance of addressing problems of local relevance. Moving forward, lead poisoning prevention education for youth and youth EHL partnerships may benefit from incorporating an ecological approach wherein connections to the social and economic context are made explicit.
Assembly of YAC contigs on the long arm of human chromosome 2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, J.; Fujiwara, T.M.; Wang, J.X.
1994-09-01
We have previously identified approximately 2,000 chromosome 2-specific YACs by screening the CEPH Mark I YAC library (`Midi- YACs`). Using STS content mapping, we have been able to order groups of these YACs along chromosome 2q. The four biggest YAC groups were associated with VIL (2q35), FN (2q34), PAX3 (2q36), ALPI (2q37) and contained 113, 107, 79, and 63 YACs, respectively. We have identified the minimal tiling paths for most YAC groups and determined the insert sizes of over 300 YACs. Furthermore, on human chromosome 2q31-q37, 15 microsatellite markers were linked to various expressed genes through overlapping YACs and themore » physical distance of microsatellites to expressed genes was determined. The precise mapping of a set of highly informative microsatellite markers with respect to known genes provides a useful tool for linkage studies and the identification of disease genes from the long arm of human chromosome 2.« less
Assembly of ordered contigs of cosmids selected with YACs of human chromosome 13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, S.G.; Cayanis, E.; Boukhgalter, B.
1994-06-01
The authors have developed an efficient method for assembling ordered cosmid contigs aligned to mega-YACs and midi-YACs (average insert sizes of 1.0 and 0.35 Mb, respectively) and used this general method to initiate high-resolution physical mapping of human chromosome 13 (Chr 13). Chr 13-enriched midi-YAC (mYAC) and mega-YAC (MYAC) sublibraries were obtained from corresponding CEPH total human YAC libraries by selecting colonies with inter-Alu PCR probes derived from Chr 13 monochromosomal cell hybrid DNA. These sublibraries were arrayed on filters at high density. In this approach, the MYAC 13 sublibrary is screened by hybridization with cytogenetically assigned Chr 13 DNAmore » probes to select one or a small subset of MYACs. Inter-Alu PCR products from each mYAC are then hybridized to the MYAC and mYAC sublibraries to identify overlapping YACs and to an arrayed Chr 13-specific cosmid library to select corresponding cosmids. The set of selected cosmids, gridded on filters at high density, is hybridized with inter-Alu PCR products from each of the overlapping YACs to identify subsets of cosmids and also with riboprobes from each cosmid of the arrayed set ({open_quotes}cosmid matrix cross-hybridization{close_quotes}). From these data, cosmid contigs are assembled by a specifically designed computer program. Application of this method generates cosmid contigs spanning the length of a MYAC with few gaps. To provide a high-resolution map, ends of cosmids are sequenced at preselected sites to position densely spaced sequence-tagged sites. 33 refs., 7 figs., 1 tab.« less
The Transformative Power of Youth Action Coalition's Multimodal Arts-for-Change Programming
ERIC Educational Resources Information Center
Turner, K. C. Nat; Way, Kate; Gray, Robin R. R.
2013-01-01
This article analyzes the potential of a series of Youth Action Coalition's (YAC) Arts-for-Change (AfC) youth programs for literacy and identity development, as well as for engaging youth in addressing issues of social justice. Drawing primarily on transcripts of interviews, surveys, and participant-observation fieldnotes inventorying changes in…
Kipling, D; Wilson, H E; Thomson, E J; Cooke, H J
1995-06-01
Three Mus musculus DBA/2 YAC libraries were constructed using a half-YAC telomere cloning vector. This functional complementation approach yields libraries which include terminal restriction fragments of the mouse genome. Screening all three libraries led to the isolation of 32 independent clones which carry linear YACs containing the mouse terminal repeat sequence, (TTAGGG)n. These YACs provide a resource to isolate regions of the mouse genome close to chromosome termini and excluded from existing conventional YAC libraries. To demonstrate their utility, a hybridization probe was isolated from Mtel-1, the first (TTAGGG)n-containing YAC isolated. This probe detects a approximately 70 kb Kpnl fragment in the mouse genome which is sensitive to pretreatment with BAL31 exonuclease. A PCR-based genetic marker generated from the sequence of this probe maps 4.4 cM from the most distal anchor locus on chromosome 10 in the EUCIB interspecific backcross. STS primers for this locus, D10Hgu1, were used to isolate YAC 110F4 from a commercially available mouse YAC library. Fluorescence in situ hybridization demonstrates that YAC 110F4 hybridizes to the distal telomere of chromosome 10. Clones in this collection of telomere YACs therefore partially overlap clones in conventional YAC libraries, and thus the previously unavailable terminal regions of the mouse genome can now be linked with the developing mouse STS YAC contig. Genetic markers such as D10Hgu1 allow the ends of the mouse genetic map to be defined, thus closing the map.
NASA Astrophysics Data System (ADS)
Salinas, Juan Gabriel; Alvarado, Juan Antonio; Bergenståhl, Björn; Tornberg, Eva
2018-04-01
Yacón root is a natural source of fructans, which has many potential benefits. Convective drying has been applied to increase the shelf life of yacón roots. However, this processing may lead to detrimental effects on the physicochemical functionality. The drying was investigated using different conditions (drying temperatures of 45 °C, 50 °C and 55 °C at a drying air velocity of 2 m/s and 60 °C at a drying air velocity of 2 m/s, 3 m/s and 4 m/s). The dried samples were compared to the original yacón with regard to their physicochemical properties. From all the properties that were studied, the color of the dried material and the elastic modulus of the reconstituted yacón were the most important properties being minimized respectively. The results of this investigation indicate that the best drying conditions, where the physicochemical properties of the samples are kept closest to the original material, are obtained either by using temperatures of 55 °C and 2 m/s or using higher temperatures but increasing the air velocity.
Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington's Disease Mice.
Berggren, Kiersten L; Lu, Zhen; Fox, Julia A; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H
2016-01-01
Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington's disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363-74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Female neonatal mice were supplemented daily from days 10-17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later.
Hughes, Stephen R; Cox, Elby J; Bang, Sookie S; Pinkelman, Rebecca J; López-Núñez, Juan Carlos; Saha, Badal C; Qureshi, Nasib; Gibbons, William R; Fry, Michelle R; Moser, Bryan R; Bischoff, Kenneth M; Liu, Siqing; Sterner, David E; Butt, Tauseef R; Riedmuller, Steven B; Jones, Marjorie A; Riaño-Herrera, Néstor M
2015-12-01
A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system in yeast and to design an assembly process suitable for an automated platform. Expression of XI and XKS from the YAC was confirmed by Western blot and PCR analyses. The recombinant and wild-type strains showed similar growth on plates containing hexose sugars, but only recombinant grew on D-xylose and L-arabinose plates. In glucose fermentation, doubling time (4.6 h) and ethanol yield (0.44 g ethanol/g glucose) of recombinant were comparable to wild type (4.9 h and 0.44 g/g). In whole-corn hydrolysate, ethanol yield (0.55 g ethanol/g [glucose + xylose]) and xylose utilization (38%) for recombinant were higher than for wild type (0.47 g/g and 12%). In hydrolysate from spent coffee grounds, yield was 0.46 g ethanol/g (glucose + xylose), and xylose utilization was 93% for recombinant. These results indicate introducing a YAC expressing XI and XKS enhanced xylose utilization without affecting integrity of the host strain, and the process provides a potential platform for automated synthesis of a YAC for expression of multiple optimized genes to improve yeast strains. © 2015 Society for Laboratory Automation and Screening.
Ghilan, Mohamed; Bostrom, Crystal A; Hryciw, Brett N; Simpson, Jessica M; Christie, Brian R; Gil-Mohapel, Joana
2014-09-18
Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by a polyglutamine expansion in the gene encoding the protein huntingtin. The disease progresses over decades, but often patients develop cognitive impairments that precede the onset of the classical motor symptoms. Similar to the disease progression in humans, the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive dysfunction that precedes the onset of the neuropathological and motor impairments characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and long-term synaptic plasticity in the hippocampus, two related biological models of learning and memory processes, were altered in YAC128 mice in early stages of disease progression. We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced post-tetanic and short-term potentiation are apparent in YAC128 mice after high-frequency stimulation at this time. Early and late forms of long-term plasticity were not altered at this stage. Together these findings indicate that there may be elevated neurotransmitter release in response to synaptic stimulation in YAC128 mice during the initial phase of disease progression. These abnormalities in short-term plasticity detected at this stage in YAC128 HD transgenic mice indicate that aberrant information processing at the level of the synapses may contribute, at least in part, to the early onset of cognitive deficits that are characteristic of this devastating neurodegenerative disorder. Copyright © 2014 Elsevier B.V. All rights reserved.
The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geraghty, M.T.; Brody, L.C.; Martin, L.S.
1993-05-01
Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less
Development of a YAC contig covering the minimal region of a CSNB1 locus in Xp11
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boycott, K.M.; Gratton, K.J.; Moore, B.J.
1994-09-01
X-linked congenital stationary night blindness (CSNB1) is an eye disorder that includes impairment of night vision, reduced visual acuity and, in some cases, myopia and congenital nystagmus. Electroretinography reveals a marked reduction of the b-wave in affected individuals suggesting that X-linked CSNB is due to a molecular defect in the bipolar layer of the retina. Based on our studies of a large four generation family with X-linked CSNB, a CSNB1 locus was mapped to a 4-5 cM region at Xp11.23-Xp11.22 bounded telomerically by DXS426 and centromerically by DXS988. Using a panel of radiation and conventional somatic cell hybrids, a detailedmore » map of new and published STSs has been generated for the minimal region of CSNB1. PCR primer pairs for STSs has been generated for the minimal region of CSNB1. PCR primer pairs for twenty-five STSs, including eleven end-clones, were used to isolate YAC clones from CEPH, mega-CEPH, and X chromosome-specific YAC libraries. In total, fifty-two YACs were characterized for STS overlaps and assembled to provide a minimum of 3 Mb of physical coverage in the region between DXS426 and DXS988. Five gaps proximal to SYP are still to be closed. Our physical map suggests the following gene order: Xpter-OTAL1-GF1-DXS1011E-MG81-HUMCRAS2P-SYP-Xcen. STS analysis of the YACs revealed three subregions of the physical map which appear to be particularly susceptible to internal deletions and end-clone analysis demonstrated chimerism in six of seventeen YACs. A physical map of Xp11.23-Xp11.22 will provide a resource for the isolation of candidate genes for the X-linked CSNB gene which maps to this region.« less
A YAC contig encompassing the chromosome 7p locus for autosomal dominant retinitis pigmentosa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inglehearn, C.F.; Keen, T.J.; Ratel, R.
1994-09-01
Retinitis pigmentosa is an inherited retinal degeneration characterized by night blindness and loss of peripheral vision, often leading to complete blindness. The autosomal dominant form (adRP) maps to at least six different loci, including the rhodopsin and peripherin/Rds genes and four loci identified only by linkage analysis on chromosomes 7p, 7q, 8cen and 19q. The 7p locus was reported by this laboratory in a large English family, with a lod score of 16.5. Several new genetic markers have been tested in the family and this locus has now been refined to an interval of approximately 1 cM between markers D7S795more » and D7S484 in the 7p13-15 region. In order to clone the gene for adRP, we have used microsatellites and STSs from the region to identify over 80 YACs, from four different libraries, which map to this interval. End clones from key YACs were isolated for the generation of additional STSs. Eleven microsatellite markers between D7S435 (distal) and D7S484 (proximal) have been ordered by a combination of both physical and genetic mapping. In this way we have now obtained a YAC contig spanning approximately 3 megabases of chromosome 7p within which the adRP gene must lie. One gene (aquaporin) and one chromosome 7 brain EST have been placed on the contig but both map distal to the region of interest. Sixteen other ESTs and three further known 7p genes mapping in the region have been excluded. We are now attempting to build a cosmid contig in the defined interval and identify further expressed sequences from both YACs and cosmids to test as candidates for the adRP gene.« less
Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington’s Disease Mice
Berggren, Kiersten L.; Lu, Zhen; Fox, Julia A.; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H.
2016-01-01
Background: Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington’s disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363–74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. Objective: To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Methods: Female neonatal mice were supplemented daily from days 10–17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Results: Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Conclusions: Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later. PMID:27079948
Fedosyuk, Halyna; Peterson, Kenneth R
2007-01-01
A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lanyi, A.; Li, B.F.; Li, S.
1994-09-01
X-linked lymphoproliferative disease (XLP) is characterized by a marked vulnerability in Epstein-Barr virus (EBV) infection. Infection of XLP patients with EBV invariably results in fatal mononucleosis, agammaglobulinemia or B-cell lymphoma. The XLP gene lies within a 10 cM region in Xq25 between DXS42 and DXS10. Initial chromosome studies revealed an interstitial, cytogenetically visible deletion in Xq25 in one XLP family (43-004). We estimated the size of the Xq25 deletion by dual laser flow karyotyping to involve 2% of the X chromosome, or approximately 3 Mbp of DNA sequences. To further delineate the deletion we performed a series of pulsed fieldmore » gel electrophoresis (PFGE) analyses which showed that DXS6 and DXS100, two Xq25-specific markers, are missing from 45-004 DNA. Five yeast artificial chromosomes (YACs) from a chromosome X specific YAC library containing sequences deleted in patient`s 43-004 DNA were isolated. These five YACs did not overlap, and their end fragments were used to screen the CEPH MegaYAC library. Seven YACs were isolated from the CEPH MegaYAC library. They could be arranged into a contig which spans between DXS6 and DXS100. The contig contains a minimum of 2.5 Mbp of human DNA. A total of 12 YAC end clone, lambda subclones and STS probes have been used to order clones within the contig. These reagents were also used in Southern blot and patients showed interstitial deletions in Xq25. The size of these deletions range between 0.5 and 2.5 Mbp. The shortest deletion probably represents the critical region for the XLP gene.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mutirangura, A.; Jayakumar, A.; Sutcliffe, J.S.
1993-12-01
Since a previous report of a partial YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13), a complete contig spanning approximately 3.5 Mb has been developed. YACs were isolated from two human genomic libraries by PCR and hybridization screening methods. Twenty-three sequence-tagged sites (STSs) were mapped within the contig, a density of [approximately]1 per 200 kb. Overlaps between YAC clones were identified by Alu-PCR dot-blot analysis and confirmed by STS mapping or hybridization with ends of YAC inserts. The gene encoding small nuclear ribonucleoprotein-associated peptide N (SNRPN), recently identified as a candidate gene for Prader-Willi syndrome, was localized within this contigmore » between markers PW71 and TD3-21. Loci mapped within and immediately flanking the Prader-Willi/Angelman chromosome region contig are ordered as follows: cen-IR39-ML34-IR4-3R-TD189-1-PW71-SNRPN-TD3-21-LS6-1-GABRB3,D15S97-GABRA5-IR10-1-CMW1-tel. This YAC contig will be a useful resource for more detailed physical mapping of the region, for generation of new DNA markers, and for mapping or cloning candidate genes for the Prader-Willi and Angelman syndromes. 36 refs., 2 figs., 2 tabs.« less
A YAC contig encompassing the Treacher Collins syndrome critical region at 5q31. 3-32
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixon, J.; Gladwin, A.J.; Perveen, R.
Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development the features of which include conductive hearing loss and cleft palate. Previous studies have localized the TCOF1 locus between D5S519 (proximal) and SPARC (distal), a region of 22 centirays as estimated by radiation hybrid mapping. In the current investigation the authors have created a contig across the TCOF1 critical region, using YAC clones. Isolation of a novel short tandem repeat polymorphism corresponding to the end of one of the YACs has allowed reduction of the size of the critical region to [approximately] 840 kb, which has been coveredmore » with three nonchimeric YACs. Restriction mapping has revealed that the region contains a high density of clustered rare-cutter restriction sites, suggesting that it may contain a number of different genes. The results of the present investigation have further allowed confirmation that the RPS14 locus lies proximal to the critical region and can thereby be excluded from a role in the pathogenesis of TCOF1, while ANX6 lies within the TCOF1 critical region and remains a potential candidate for the mutated gene. 26 refs., 4 figs., 1 tab.« less
Automated analysis of free speech predicts psychosis onset in high-risk youths
Bedi, Gillinder; Carrillo, Facundo; Cecchi, Guillermo A; Slezak, Diego Fernández; Sigman, Mariano; Mota, Natália B; Ribeiro, Sidarta; Javitt, Daniel C; Copelli, Mauro; Corcoran, Cheryl M
2015-01-01
Background/Objectives: Psychiatry lacks the objective clinical tests routinely used in other specializations. Novel computerized methods to characterize complex behaviors such as speech could be used to identify and predict psychiatric illness in individuals. AIMS: In this proof-of-principle study, our aim was to test automated speech analyses combined with Machine Learning to predict later psychosis onset in youths at clinical high-risk (CHR) for psychosis. Methods: Thirty-four CHR youths (11 females) had baseline interviews and were assessed quarterly for up to 2.5 years; five transitioned to psychosis. Using automated analysis, transcripts of interviews were evaluated for semantic and syntactic features predicting later psychosis onset. Speech features were fed into a convex hull classification algorithm with leave-one-subject-out cross-validation to assess their predictive value for psychosis outcome. The canonical correlation between the speech features and prodromal symptom ratings was computed. Results: Derived speech features included a Latent Semantic Analysis measure of semantic coherence and two syntactic markers of speech complexity: maximum phrase length and use of determiners (e.g., which). These speech features predicted later psychosis development with 100% accuracy, outperforming classification from clinical interviews. Speech features were significantly correlated with prodromal symptoms. Conclusions: Findings support the utility of automated speech analysis to measure subtle, clinically relevant mental state changes in emergent psychosis. Recent developments in computer science, including natural language processing, could provide the foundation for future development of objective clinical tests for psychiatry. PMID:27336038
Anjomani Virmouni, Sara; Sandi, Chiranjeevi; Al-Mahdawi, Sahar; Pook, Mark A.
2014-01-01
Background Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC) transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats), YG8R (90 and 190 GAA repeats) and YG22R (190 GAA repeats). Methodology/Principal Findings We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH) analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R. Conclusions/Significance Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy. PMID:25198290
Wegrzynowicz, Michal; Holt, Hunter K; Friedman, David B; Bowman, Aaron B
2012-02-03
Huntington's disease (HD) is a neurodegenerative disorder caused by expansion of a CAG repeat within the Huntingtin (HTT) gene, though the clinical presentation of disease and age-of-onset are strongly influenced by ill-defined environmental factors. We recently reported a gene-environment interaction wherein expression of mutant HTT is associated with neuroprotection against manganese (Mn) toxicity. Here, we are testing the hypothesis that this interaction may be manifested by altered protein expression patterns in striatum, a primary target of both neurodegeneration in HD and neurotoxicity of Mn. To this end, we compared striatal proteomes of wild-type and HD (YAC128Q) mice exposed to vehicle or Mn. Principal component analysis of proteomic data revealed that Mn exposure disrupted a segregation of WT versus mutant proteomes by the major principal component observed in vehicle-exposed mice. Identification of altered proteins revealed novel markers of Mn toxicity, particularly proteins involved in glycolysis, excitotoxicity, and cytoskeletal dynamics. In addition, YAC128Q-dependent changes suggest that axonal pathology may be an early feature in HD pathogenesis. Finally, for several proteins, genotype-specific responses to Mn were observed. These differences include increased sensitivity to exposure in YAC128Q mice (UBQLN1) and amelioration of some mutant HTT-induced alterations (SAE1, ENO1). We conclude that the interaction of Mn and mutant HTT may suppress proteomic phenotypes of YAC128Q mice, which could reveal potential targets in novel treatment strategies for HD.
Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E
1996-01-01
Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809
A YAC contig spanning the dominant retinitis pigmentosa locus (RP9) on chromosome 7p
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keen, T.J.; Inglehearn, C.F.; Patel, R.J.
1995-08-10
The dominant retinitis pigmentosa locus RP9 has previously been localized to 7p13-p15, in the interval D7S526-D7S484. We now report refinement of the locus to the interval D7S795-D7S484 and YAC contig of approximately 4.8 Mb spanning this region and extending both distally and proximally from it. The contig was constructed by STS content mapping and physically orders 29 STSs in 28 YAC clones. The order of polymorphic markers in the contig is consistent with a genetic map that has been assembled using haplotype data from the CEPH pedigrees. This contig will provide a primary resource for the construction of a transcriptionalmore » map of this region and for the identification of the defective gene causing this form of adRP. 27 refs., 3 figs., 1 tab.« less
IGF-1 intranasal administration rescues Huntington's disease phenotypes in YAC128 mice.
Lopes, Carla; Ribeiro, Márcio; Duarte, Ana I; Humbert, Sandrine; Saudou, Frederic; Pereira de Almeida, Luís; Hayden, Michael; Rego, A Cristina
2014-06-01
Huntington's disease (HD) is an autosomal dominant disease caused by an expansion of CAG repeats in the gene encoding for huntingtin. Brain metabolic dysfunction and altered Akt signaling pathways have been associated with disease progression. Nevertheless, conflicting results persist regarding the role of insulin-like growth factor-1 (IGF-1)/Akt pathway in HD. While high plasma levels of IGF-1 correlated with cognitive decline in HD patients, other data showed protective effects of IGF-1 in HD striatal neurons and R6/2 mice. Thus, in the present study, we investigated motor phenotype, peripheral and central metabolic profile, and striatal and cortical signaling pathways in YAC128 mice subjected to intranasal administration of recombinant human IGF-1 (rhIGF-1) for 2 weeks, in order to promote IGF-1 delivery to the brain. We show that IGF-1 supplementation enhances IGF-1 cortical levels and improves motor activity and both peripheral and central metabolic abnormalities in YAC128 mice. Moreover, decreased Akt activation in HD mice brain was ameliorated following IGF-1 administration. Upregulation of Akt following rhIGF-1 treatment occurred concomitantly with increased phosphorylation of mutant huntingtin on Ser421. These data suggest that intranasal administration of rhIGF-1 ameliorates HD-associated glucose metabolic brain abnormalities and mice phenotype.
Towards cloning the WAS-gene locus: YAC-contigs and PFGE analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meindi, A.; Schindelhauer, D.; Hellebrand, H.
1994-09-01
Patients with X-linked recessive Wiskott-Aldrich syndrome (WAS) manifest eczema, thrombocytopenia and severe immunodeficiency. Mapping studies place the WAS gene locus between the markers TIMP and DXS255 which both have been shown to be recombinant with the disease locus. Linkage analysis in eight families including a large Swiss family showed tight linkage of the disease to the loci DXS255 and DXS1126 and exclusion of TIMP as well as polymorphic loci adjacent to the OATL1 pseudogene cluster (e.g., DXS6616). Physical mapping with established YAC contigs and a radiation hybrid encompassing the Xp11.22-11.3 region revealed the loci order TIMP-PFC-elk1-DXS1367-DXS6616-OATL1-(DXS11260DXS226)-C5-3-TGE-3, SYP and (DXS255-DXS146). Themore » markers TIMP and C5-3 are contained on the same 1.6 Mb MluI-fragment. A novel expressed sequence (R1) could be placed between elk-1 and the PFC gene while the STS C5-3 could be localized adjacent to DXS1126. The gene cluster around DXS1126 could be connected with the TFE-3 and synaptophysin genes which map on the same 400 kb MluI fragment and two overlapping YACs. The minimum distance between SYP and DXS255 is 1.2 Mb; the maximum distance is 2.2 Mb. Expressed sequences which are obtained from a cosmid contig around DXS1126 and C5-3 are being used for mutation screening in WAS patients.« less
Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S
2013-01-01
Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyake, Masashi; Nakahori, Yutaka; Matsushita, Ikumi
1997-03-01
Fukuyama-type congenital muscular dystrophy (FCMD), the second most common form of childhood muscular dystrophy in Japan, is an autosomal recessive severe muscular dystrophy associated with an anomaly of the brain. We had mapped the FCMD gene to an approximately 5-cM interval between D9S127 and D9S2111 on 9q31-q33 and had also found evidence for linkage disequilibrium between FCMD and D9S306 in this candidate region. Through further analysis, we have defined another marker, D9S172, which showed stronger linkage disequilibrium than D9S306. A yeast artificial chromosome (YAC) contig spanning 3.5 Mb, which includes this D9S306-D9S172 interval on 9q31, has been constructed by amore » combination of sequence-tagged site, Alu-PCR, and restriction mapping. Also, cosmid clones subcloned from the YAC were assembled into three contigs, one of which contains D9S2107, which showed the strongest linkage disequilibrium with FCMD. These contigs also allowed us to order the markers as follows: cen-D9S127-({approximately}800 kb)-D9S306 (identical to D9S53)-({approximately}700 kb)-A107XF9-({approximately}500 kb)-D9S172-({approximately}30 kb)-D9S299 (identical to D9S774)-({approximately}120 kb)-WI2269-tel. Thus, we have constructed the first high-resolution physical map of the FCMD candidate region. The YAC and cosmid contigs established here will be a crucial resource for identification of the FCMD gene and other genes in this region. 37 refs., 7 figs., 2 tabs.« less
Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A
1998-01-01
Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fejzo, M.S.; Yoon, S.J.; Kucherlapati, R.S.
1995-03-20
Uterine leiomyomata are the most common tumors in women and can cause abnormal uterine bleeding, pelvic pain, and infertility. Approximately 200,000 hysterectomies are performed annually in the U.S. to relieve patients of the medical sequelae of these benign neoplasms. Our efforts have focused on cloning the t(12;14)(q14-q15;q23-q24) breakpoint in uterine leiomyoma to further our understanding of the biology of these tumors. Thirty-nine YACs and six cosmids mapping to 12q14-q15 have been mapped by fluorescence in situ hybridization to tumor metaphase chromosomes containing a t(12;14). One YAC spanned the translocation breakpoint and was mapped to tumor metaphases from a pulmonary chondroidmore » hamartoma containing a t(12;14)(q14-q15;q23-q24) and a lipoma containing a t(12;15)(q15;q24); this YAC also spanned the breakpoint in these two tumors, suggesting that the same gene on chromosome 12 may be involved in the pathobiology of these distinct benign neoplasms. 41 refs., 2 figs., 1 tab.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Forbes, S.A.; Brennan, L.; Richardson, M.
1996-01-01
The gene for X-linked cleft palate (CPX) has previously been mapped in an Icelandic kindred between the unordered proximal markers DXS1002/DXS349/DXS95 and the distal marker DXYS1X, which maps to the proximal end of the X-Y homology region in Xq21.3. Using six sequence-tagged sites (STSs) within the region, a total of 91 yeast artificial chromosome (YAC) clones were isolated and overlapped in a single contig that spans approximately 3.1 Mb between DXS1002 and DXYS1X. The order of microsatellite and STS markers in this was established as DXS1002-DXS1168-DXS349-DXS95-DXS364-DXS1196-DXS472-DXS1217-DXYS1X. A long-range restriction map of this region was created using eight nonchimeric, overlapping YACmore » clones. Analysis of newly positioned polymorphic markers in recombinant individuals from the Icelandic family has enabled us to identify DXS1196 and DXS1217 as the flanking markers for CPX. The maximum physical distance containing the CPX gene has been estimated to be 2.0 Mb, which is spanned by a minimum set of five nonchimeric YAC clones. In addition, YAC end clone and STS analyses have pinpointed the location of the proximal boundary of the X-Y homology region within the map. 40 refs., 2 figs., 2 tabs.« less
A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Naruse, Kuniko; Nomiyama, Hisayuki; Miura, Retsu
1996-06-01
CC chemokines are cytokines that attract and activate leukocytes. The human genes for the CC chemokines are clustered on chromosome 17. To elucidate the genomic organization of the CC chemokine genes, we constructed a YAC contig comprising 34 clones. The contig was shown to contain all 10 CC chemokine genes reported so far, except for one gene whose nucleotide sequence is not available. The contig also contains 4 CC chemokine-like genes, which were deposited in GenBank as ESTs and are here referred to as NCC-1, NCC-2, NCC-3, and NCC-4. Within the contig, the CC chemokine genes were localized in twomore » regions. In addition, the CC chemokine genes were localized in two regions. In addition, the CC chemokine genes were more precisely mapped on chromosome 17q11.2 using a somatic cell hybrid cell DNA panel containing various portions of human chromosome 17. Interestingly, a reciprocal translocation t(Y;17) breakpoint, contained in the hybrid cell line Y1741, lay between the two chromosome 17 chemokine gene regions covered by our YAC contig. From these results, the order and the orientation of CC chemokine genes on chromosome 17 were determined as follows: centromere-neurofibromatosis 1-(MCP-3, MCP-1, NCC-1, I-309)-Y1741 breakpoint-RANTES-(LD78{gamma}, AT744.2, LD78{beta})-(NCC-3, NCC-2, AT744.1, LD78{alpha})-NCC-4-retinoic acid receptor {alpha}-telomere. 22 refs., 1 fig., 2 tabs.« less
Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.
2012-01-01
Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307
Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R
2012-01-01
Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.
Alto, Laura Taylor; Chen, Xi; Ruhn, Kelly A; Treviño, Isaac; Tansey, Malú G
2014-01-01
CNS inflammation is a hallmark of neurodegenerative disease, and recent studies suggest that the inflammatory response may contribute to neuronal demise. In particular, increased tumor necrosis factor (TNF) signaling is implicated in the pathology of both Parkinson's disease (PD) and Alzheimer's disease (AD). We have previously shown that localized gene delivery of dominant negative TNF to the degenerating brain region can limit pathology in animal models of PD and AD. TNF is upregulated in Huntington's disease (HD), like in PD and AD, but it is unknown whether TNF signaling contributes to neuronal degeneration in HD. We used in vivo gene delivery to test whether selective reduction of soluble TNF signaling could attenuate medium spiny neuron (MSN) degeneration in the YAC128 transgenic (TG) mouse model of Huntington's disease (HD). AAV vectors encoding cDNA for dominant-negative tumor necrosis factor (DN-TNF) or GFP (control) were injected into the striatum of young adult wild type WT and YAC128 TG mice and achieved 30-50% target coverage. Expression of dominant negative TNF protein was confirmed immunohistologically and biochemically and was maintained as mice aged to one year, but declined significantly over time. However, the extent of striatal DN-TNF gene transfer achieved in our studies was not sufficient to achieve robust effects on neuroinflammation, rescue degenerating MSNs or improve motor function in treated mice. Our findings suggest that alternative drug delivery strategies should be explored to determine whether greater target coverage by DN-TNF protein might afford some level of neuroprotection against HD-like pathology and/or that soluble TNF signaling may not be the primary driver of striatal neuroinflammation and MSN loss in YAC128 TG mice.
Steventon, Jessica J; Harrison, David J; Trueman, Rebecca C; Rosser, Anne E; Jones, Derek K; Brooks, Simon P
2015-01-01
Environmental enrichment has been shown to improve symptoms and reduce neuropathology in mouse models of Huntington's disease (HD); however results are limited to ex vivo techniques with associated shortcomings. In-vivo magnetic resonance imaging (MRI) can overcome some of the shortcomings and is applied for the first time here to assess the effect of a cognitive intervention in a mouse model of HD. We aimed to investigate whether in-vivo high-field MRI can detect a disease-modifying effect in tissue macrostructure following a cognitive enrichment regime. YAC128 transgenic and wild type mice were exposed to cognitive enrichment throughout their lifetime. At 20-months old, mice were scanned with a T2-weighted MRI sequence and a region-of-interest (ROI) approach was used to examine structural changes. Locomotor activity and performance on the rotarod and serial discrimination watermaze task were assessed to measure motor and cognitive function respectively. Mice exposed to cognitive enrichment were more active and able to stay on a rotating rod longer compared to control mice, with comparable rotarod performance between HD enriched mice and wild-type mice. YAC128 mice demonstrated cognitive impairments which were not improved by cognitive enrichment. In-vivo MRI revealed a reduction in the degree of caudate-putamen atrophy in the enriched HD mice. We provide in vivo evidence of a beneficial effect of environmental enrichment on neuropathology and motor function in a HD mouse model. This demonstrates the efficacy of MRI in a model of HD and provides the basis for an in-vivo non-destructive outcome measure necessary for longitudinal study designs to understand the effect of enrichment with disease progression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaerrman, C.; Holmgren, G.; Forsman, K.
1997-01-15
Amelogenesis imperfecta (Al) is a clinically and genetically heterogeneous group of inherited enamel defects. We recently mapped a locus for autosomal dominant local hypoplastic amelogenesis imperfecta (AIH2) to the long arm of chromosome 4. The disease gene was localized to a 17.6-cM region between the markers D4S392 and D4S395. The albumin gene (ALB), located in the same interval, was a candidate gene for autosomal dominant AI (ADAI) since albumin has a potential role in enamel maturation. Here we describe refined mapping of the AIH2 locus and the construction of marker maps by radiation hybrid mapping and yeast artificial chromosome (YAC)-basedmore » sequence tagged site-content mapping. A radiation hybrid map consisting of 11 microsatellite markers in the 5-cM interval between D4S409 and D4S1558 was constructed. Recombinant haplotypes in six Swedish ADAI families suggest that the disease gene is located in the interval between D4S2421 and ALB. ALB is therefore not likely to be the disease-causing gene. Affected members in all six families share the same allele haplotypes, indicating a common ancestral mutation in all families. The AIH2 critical region is less than 4 cM and spans a physical distance of approximately 4 Mb as judged from radiation hybrid maps. A YAC contig over the AIH2 critical region including several potential candidate genes was constructed. 35 refs., 4 figs., 1 tab.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, D.J.; Reis, A.
1994-09-01
Nevoid basal cell carcinoma syndrome (NBCCS, Gorlin syndrome) is an autosomal dominant disorder, characterized primarily by multiple basal cell carcinomas, epithelium-lined jaw cysts, and palmar and plantar pits, as well as various other features. Loss of heterozygosity studies and linkage analysis have mapped the NBCCS gene to chromosome 9q and suggested that it is a tumor suppressor. The apparent sensitivity of NBCCS patients to UV and X-irradiation raises the possibility of hypersensitivity to DNA-damaging reagents or defective DNA repair being etiological in the disorder. The recent mapping of the Fanconi anaemia group C (FACC) and xeroderma pigmentosum complementing group Amore » (XPAC) genes to the same region on 9q has led us to begin the molecular dissection of the 9q22-q31 region. PCR analysis of the presence or absence of 10 microsatellite markers and exons 3 and 4 of the XPAC and FACC genes, respectively, allowed us to order 12 YACs into an overlapping contig and to order the markers as follows: D9S151/D9S12P1-D9S12P2-D9S197-D9S196-D9S280-FACC-D9S287/XPAC-D9S180-D9S6-D9S176. Sizing of the YACs has provided an initial estimate of the size of the NBCCS candidate region between D9S12 and D9S180 to be less than 1.65 Mb. 45 refs., 1 fig., 1 tab.« less
Coleman, M P; Németh, A H; Campbell, L; Raut, C P; Weissenbach, J; Davies, K E
1994-05-15
The genes ARAF1, SYN1, TIMP, and PFC are clustered within 70 kb of one another, and, as reported in the accompanying paper (J. Knight et al., 1994, Genomics 21: 180-187), at least four more genes map within 400 kb: a cluster of Krüppel-type zinc finger genes (including ZNF21, ZNF41, and ZNF81) and ELK-1, a member of the ets oncogene superfamily. This gene-rich region is of particular interest because of the large number of disease genes mapping to Xp11.23: at least three eye diseases (retinitis pigmentosa type 2, congenital stationary night blindness CSNB1, and Aland Island eye disease), Wiskott-Aldrich syndrome, X-linked nephrolithiasis, and a translocation breakpoint associated with synovial sarcoma. We have constructed a 1.8-Mb YAC contig in this region, confirming the link between TIMP and OATL1 reported by Knight et al. (1994) and extending the map in the distal direction. To investigate the likelihood that more genes are located within this region, we have carried out detailed mapping of rare-cutter restriction sites in these YACs and identified seven CpG islands. At least six of these islands are located over 50 kb from any known gene locations, suggesting that the region contains at least this many as yet unidentified genes. We have also mapped the physical locations of six highly polymorphic CA repeats within the contig, thus integrating the physical, genetic, and transcriptional maps of the region and facilitating the mapping and identification of disease genes.(ABSTRACT TRUNCATED AT 250 WORDS)
Automation in Vocational Training of the Mentally Retarded. Final Report.
ERIC Educational Resources Information Center
Platt, Henry; And Others
Various uses of automation in teaching were studied with mentally retarded (IQ 70 to 90) and/or emotionally disturbed (IQ 80 to 90) youth aged 16 to 20. Programed instruction was presented by six audiovisual devices and techniques: the Devereux Model 50 Teaching Aid, the Learn-Ease Teaching Device, the Mast Teaching Machine, the Graflex…
Bobo, William V; Cooper, William O; Stein, C Michael; Olfson, Mark; Mounsey, Jackie; Daugherty, James; Ray, Wayne A
2012-08-24
We developed and validated an automated database case definition for diabetes in children and youth to facilitate pharmacoepidemiologic investigations of medications and the risk of diabetes. The present study was part of an in-progress retrospective cohort study of antipsychotics and diabetes in Tennessee Medicaid enrollees aged 6-24 years. Diabetes was identified from diabetes-related medical care encounters: hospitalizations, outpatient visits, and filled prescriptions. The definition required either a primary inpatient diagnosis or at least two other encounters of different types, most commonly an outpatient diagnosis with a prescription. Type 1 diabetes was defined by insulin prescriptions with at most one oral hypoglycemic prescription; other cases were considered type 2 diabetes. The definition was validated for cohort members in the 15 county region geographically proximate to the investigators. Medical records were reviewed and adjudicated for cases that met the automated database definition as well as for a sample of persons with other diabetes-related medical care encounters. The study included 64 cases that met the automated database definition. Records were adjudicated for 46 (71.9%), of which 41 (89.1%) met clinical criteria for newly diagnosed diabetes. The positive predictive value for type 1 diabetes was 80.0%. For type 2 and unspecified diabetes combined, the positive predictive value was 83.9%. The estimated sensitivity of the definition, based on adjudication for a sample of 30 cases not meeting the automated database definition, was 64.8%. These results suggest that the automated database case definition for diabetes may be useful for pharmacoepidemiologic studies of medications and diabetes.
2012-01-01
Background We developed and validated an automated database case definition for diabetes in children and youth to facilitate pharmacoepidemiologic investigations of medications and the risk of diabetes. Methods The present study was part of an in-progress retrospective cohort study of antipsychotics and diabetes in Tennessee Medicaid enrollees aged 6–24 years. Diabetes was identified from diabetes-related medical care encounters: hospitalizations, outpatient visits, and filled prescriptions. The definition required either a primary inpatient diagnosis or at least two other encounters of different types, most commonly an outpatient diagnosis with a prescription. Type 1 diabetes was defined by insulin prescriptions with at most one oral hypoglycemic prescription; other cases were considered type 2 diabetes. The definition was validated for cohort members in the 15 county region geographically proximate to the investigators. Medical records were reviewed and adjudicated for cases that met the automated database definition as well as for a sample of persons with other diabetes-related medical care encounters. Results The study included 64 cases that met the automated database definition. Records were adjudicated for 46 (71.9%), of which 41 (89.1%) met clinical criteria for newly diagnosed diabetes. The positive predictive value for type 1 diabetes was 80.0%. For type 2 and unspecified diabetes combined, the positive predictive value was 83.9%. The estimated sensitivity of the definition, based on adjudication for a sample of 30 cases not meeting the automated database definition, was 64.8%. Conclusion These results suggest that the automated database case definition for diabetes may be useful for pharmacoepidemiologic studies of medications and diabetes. PMID:22920280
Frías, Álvaro; Dickstein, Daniel P; Merranko, John; Gill, Mary Kay; Goldstein, Tina R; Goldstein, Benjamin I; Hower, Heather; Yen, Shirley; Hafeman, Danella M; Liao, Fangzi; Diler, Rasim; Axelson, David; Strober, Michael; Hunt, Jeffrey I; Ryan, Neal D; Keller, Martin B; Birmaher, Boris
2017-06-01
There is substantial interest in delineating the course of cognitive functioning in bipolar (BP) youth. However, there are no longitudinal studies aimed at defining subgroups of BP youth based on their distinctive cognitive trajectories and their associated clinical variables. Cognitive functioning was measured in 135 participants from the Course and Outcome of BP Youth (COBY) study using several subtests of the Cambridge Neuropsychological Test Automated Battery (CANTAB). Youth were prospectively evaluated three times on average every 13.75 months over 2.5 years. Clinical and functional outcomes were assessed using the Longitudinal Interval Follow-Up Evaluation (LIFE). Latent class growth analysis identified three longitudinal patterns of cognitive functioning based on a general cognitive index: class 1, "persistently high" (N=21; 15.6%); class 2, "persistently moderate" (N=82; 60.74%); and class 3, "persistently low" (N=32; 23.7%). All classes showed normal cognitive functioning when compared with the CANTAB normative data. After adjustment for confounders, youth from class 3 had a significantly greater percentage of time with overall, manic, and depressive syndromal symptoms than youth in the other two classes. Also, after adjustment for confounders, youth from class 3 had significantly poorer global, academic, and social functioning than youth from class 1. BP youth showed normal overall cognitive functioning that remained stable during the follow-up within each class. However, 24% of BP youth showed poorer cognitive functioning than the other BP youth. This subgroup had poorer mood course and functioning, and may benefit from cognitive remediation and early management with evidence-based pharmacological treatments. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Youth-Adult Partnerships and Youth Identity Style.
Ramey, Heather L; Rose-Krasnor, Linda; Lawford, Heather L
2017-02-01
Youth-adult partnerships (e.g., youth leading programs, participating as members of advisory boards) are a common and widely recommended practice in youth work and youth-serving program settings. Although researchers have suggested that these opportunities contribute to youth's identity development, empirical evidence is lacking. In the current study, we tested associations between identity style and degree of youth voice, collaborative youth-adult relationships, and youth's program engagement in 194 youth participating in youth-adult partnerships (M age = 17.6, 62 % female). We found that these characteristics of youth-adult partnerships predicted higher informational identity style, although only program engagement emerged as a unique predictor. Furthermore, exploratory analysis indicated that these associations were moderated by the type of organization. The findings suggest the need for more research on the multiple dimensions of youth-adult partnerships and their association with youth functioning, as well as pointing to the importance of the broader organizational context of youth-adult partnerships.
Youth Participation in Youth Development.
ERIC Educational Resources Information Center
Kothari, Roshani
Frequently, adults organize and implement youth projects without involving youth in the process. However, youth should be involved in problem identification and program design because they understand the needs of their peers and how to reach them effectively. This paper examines youth participation as a process for bringing about effective youth…
Visual memory and sustained attention impairment in youths with autism spectrum disorders.
Chien, Y-L; Gau, S S-F; Shang, C-Y; Chiu, Y-N; Tsai, W-C; Wu, Y-Y
2015-08-01
An uneven neurocognitive profile is a hallmark of autism spectrum disorder (ASD). Studies focusing on the visual memory performance in ASD have shown controversial results. We investigated visual memory and sustained attention in youths with ASD and typically developing (TD) youths. We recruited 143 pairs of youths with ASD (males 93.7%; mean age 13.1, s.d. 3.5 years) and age- and sex-matched TD youths. The ASD group consisted of 67 youths with autistic disorder (autism) and 76 with Asperger's disorder (AS) based on the DSM-IV criteria. They were assessed using the Cambridge Neuropsychological Test Automated Battery involving the visual memory [spatial recognition memory (SRM), delayed matching to sample (DMS), paired associates learning (PAL)] and sustained attention (rapid visual information processing; RVP). Youths with ASD performed significantly worse than TD youths on most of the tasks; the significance disappeared in the superior intelligence quotient (IQ) subgroup. The response latency on the tasks did not differ between the ASD and TD groups. Age had significant main effects on SRM, DMS, RVP and part of PAL tasks and had an interaction with diagnosis in DMS and RVP performance. There was no significant difference between autism and AS on visual tasks. Our findings implied that youths with ASD had a wide range of visual memory and sustained attention impairment that was moderated by age and IQ, which supports temporal and frontal lobe dysfunction in ASD. The lack of difference between autism and AS implies that visual memory and sustained attention cannot distinguish these two ASD subtypes, which supports DSM-5 ASD criteria.
Using mass media campaigns to reduce youth tobacco use: a review.
Allen, Jane Appleyard; Duke, Jennifer C; Davis, Kevin C; Kim, Annice E; Nonnemaker, James M; Farrelly, Matthew C
2015-01-01
This review synthesizes the published literature on using mass media campaigns to reduce youth tobacco use, with particular focus on effects within population subgroups and the relative effectiveness of campaign characteristics. A search of PubMed and PsycINFO conducted in March of 2014 yielded 397 studies with 34 suitable for inclusion. Included were quantitative studies that evaluate an antitobacco media campaign intended to influence youth cognitions or behavior or explore the relative effectiveness of campaign characteristics among youth. An automated search and assessment of suitability for inclusion was done. Study outcomes were compared and synthesized. Antitobacco media campaigns can be effective across racial/ethnic populations, although the size of the campaign effect may differ by race/ethnicity. Evidence is insufficient to determine whether campaign outcomes differ by socioeconomic status (SES) and population density. Youth are more likely to recall and think about advertising that includes personal testimonials; a surprising narrative; and intense images, sound, and editing. Evidence in support of using a health consequences message theme is mixed; an industry manipulation theme may be effective in combination with a health consequences message. Research is insufficient to determine whether advertising with a secondhand smoke or social norms theme influences youth tobacco use. Our recommendation is to develop antitobacco campaigns designed to reach all at-risk youth, which can be effective across racial/ethnic populations. Research priorities include assessing campaign influence among lower SES and rural youth, disentangling the effects of message characteristics, and assessing the degree to which this body of evidence may have changed as a result of changes in youth culture and communication technology.
MEDICAL SPORTS INJURIES IN THE YOUTH ATHLETE: EMERGENCY MANAGEMENT
Molony Jr, Joseph T.
2012-01-01
As the number of youth sports participants continues to rise over the past decade, so too have sports related injuries and emergency department visits. With low levels of oversight and regulation observed in youth sports, the responsibility for safety education of coaches, parents, law makers, organizations and institutions falls largely on the sports medicine practitioner. The highly publicized catastrophic events of concussion, sudden cardiac death, and heat related illness have moved these topics to the forefront of sports medicine discussions. Updated guidelines for concussion in youth athletes call for a more conservative approach to management in both the acute and return to sport phases. Athletes younger than eighteen suspected of having a concussion are no longer allowed to return to play on the same day. Reducing the risk of sudden cardiac death in the young athlete is a multi‐factorial process encompassing pre‐participation screenings, proper use of safety equipment, proper rules and regulations, and immediate access to Automated External Defibrillators (AED) as corner stones. Susceptibility to heat related illness for youth athletes is no longer viewed as rooted in physiologic variations from adults, but instead, as the result of various situations and conditions in which participation takes place. Hydration before, during and after strenuous exercise in a high heat stress environment is of significant importance. Knowledge of identification, management and risk reduction in emergency medical conditions of the young athlete positions the sports physical therapist as an effective provider, advocate and resource for safety in youth sports participation. This manuscript provides the basis for management of 3 major youth emergency sports medicine conditions. PMID:22530197
Anthropometry of Infants, Children, and Youths to Age 18 for Product Safety Design. Final Report.
ERIC Educational Resources Information Center
Snyder, Richard G.; And Others
A total of 87 traditional and functional body measurements were taken on a sample of 4,127 infants, children, and youths representing the U.S. population aged two weeks through 18 years. Measurements were taken throughout the United States by two teams of anthropometrists using an automated anthropometric data acquisition system. Standard…
Prediction of psychosis across protocols and risk cohorts using automated language analysis
Corcoran, Cheryl M.; Carrillo, Facundo; Fernández‐Slezak, Diego; Bedi, Gillinder; Klim, Casimir; Javitt, Daniel C.; Bearden, Carrie E.; Cecchi, Guillermo A.
2018-01-01
Language and speech are the primary source of data for psychiatrists to diagnose and treat mental disorders. In psychosis, the very structure of language can be disturbed, including semantic coherence (e.g., derailment and tangentiality) and syntactic complexity (e.g., concreteness). Subtle disturbances in language are evident in schizophrenia even prior to first psychosis onset, during prodromal stages. Using computer‐based natural language processing analyses, we previously showed that, among English‐speaking clinical (e.g., ultra) high‐risk youths, baseline reduction in semantic coherence (the flow of meaning in speech) and in syntactic complexity could predict subsequent psychosis onset with high accuracy. Herein, we aimed to cross‐validate these automated linguistic analytic methods in a second larger risk cohort, also English‐speaking, and to discriminate speech in psychosis from normal speech. We identified an automated machine‐learning speech classifier – comprising decreased semantic coherence, greater variance in that coherence, and reduced usage of possessive pronouns – that had an 83% accuracy in predicting psychosis onset (intra‐protocol), a cross‐validated accuracy of 79% of psychosis onset prediction in the original risk cohort (cross‐protocol), and a 72% accuracy in discriminating the speech of recent‐onset psychosis patients from that of healthy individuals. The classifier was highly correlated with previously identified manual linguistic predictors. Our findings support the utility and validity of automated natural language processing methods to characterize disturbances in semantics and syntax across stages of psychotic disorder. The next steps will be to apply these methods in larger risk cohorts to further test reproducibility, also in languages other than English, and identify sources of variability. This technology has the potential to improve prediction of psychosis outcome among at‐risk youths and identify
Prediction of psychosis across protocols and risk cohorts using automated language analysis.
Corcoran, Cheryl M; Carrillo, Facundo; Fernández-Slezak, Diego; Bedi, Gillinder; Klim, Casimir; Javitt, Daniel C; Bearden, Carrie E; Cecchi, Guillermo A
2018-02-01
Language and speech are the primary source of data for psychiatrists to diagnose and treat mental disorders. In psychosis, the very structure of language can be disturbed, including semantic coherence (e.g., derailment and tangentiality) and syntactic complexity (e.g., concreteness). Subtle disturbances in language are evident in schizophrenia even prior to first psychosis onset, during prodromal stages. Using computer-based natural language processing analyses, we previously showed that, among English-speaking clinical (e.g., ultra) high-risk youths, baseline reduction in semantic coherence (the flow of meaning in speech) and in syntactic complexity could predict subsequent psychosis onset with high accuracy. Herein, we aimed to cross-validate these automated linguistic analytic methods in a second larger risk cohort, also English-speaking, and to discriminate speech in psychosis from normal speech. We identified an automated machine-learning speech classifier - comprising decreased semantic coherence, greater variance in that coherence, and reduced usage of possessive pronouns - that had an 83% accuracy in predicting psychosis onset (intra-protocol), a cross-validated accuracy of 79% of psychosis onset prediction in the original risk cohort (cross-protocol), and a 72% accuracy in discriminating the speech of recent-onset psychosis patients from that of healthy individuals. The classifier was highly correlated with previously identified manual linguistic predictors. Our findings support the utility and validity of automated natural language processing methods to characterize disturbances in semantics and syntax across stages of psychotic disorder. The next steps will be to apply these methods in larger risk cohorts to further test reproducibility, also in languages other than English, and identify sources of variability. This technology has the potential to improve prediction of psychosis outcome among at-risk youths and identify linguistic targets for remediation
Toche-Manley, Linda L.; Dietzen, Laura; Nankin, Jesse; Beigel, Astrid
2013-01-01
Among youth in child welfare ages 6 to 17, 40% meet criteria for one or more DSM diagnoses. For minority youth in child welfare, poor mental health is compounded by limited access to care and racial disparity bias, leading to poorer outcomes. This paper uses data collected and analyzed by an automated behavioral health assessment system for a multi-year study that focused on ways to improve case planning in child welfare. Youth, their caseworkers and, in some cases, parents completed assessments that measured and monitored the youths’ needs and strengths. More than 60% of youth participating in the study were African American; permanency rates after six months of case planning were found to be only one-third. Predictive factors related to better behavioral health and permanency outcomes are identified and discussed, as well as the implications for improving case planning by incorporating the views of multiple informants, including the youth. PMID:22566058
Brain volumes in psychotic youth with schizophrenia and mood disorders
El-Sayed, Mohamed; Steen, R. Grant; Poe, Michele D.; Bethea, T. Carter; Gerig, Guido; Lieberman, Jeffrey; Sikich, Linmarie
2010-01-01
Background We sought to test the hypothesis that deficits in grey matter volume are characteristic of psychotic youth with early-onset schizophrenia-spectrum disorders (EOSS) but not of psychotic youth with early-onset mood disorders (EOMD). Methods We used magnetic resonance imaging to examine brain volume in 24 psychotic youth (13 male, 11 female) with EOSS (n = 12) or EOMD (n = 12) and 17 healthy controls (10 male, 7 female). We measured the volume of grey and white matter using an automated segmentation program. Results After adjustment for age and intracranial volume, whole brain volume was lower in the EOSS patients than in the healthy controls (p = 0.001) and EOMD patients (p = 0.002). The EOSS patients had a deficit in grey matter volume (p = 0.005), especially in the frontal (p = 0.003) and parietal (p = 0.006) lobes, with no significant differences in white matter volume. Limitations The main limitations of our study were its small sample size and the inclusion of patients with depression and mania in the affective group. Conclusion Adolescents with EOSS have grey matter deficits compared with healthy controls and psychotic adolescents with EOMD. Our results suggest that grey matter deficits are not generally associated with psychosis but may be specifically associated with schizophrenia. Larger studies with consistent methods are needed to reconcile the contradictory findings among imaging studies involving psychotic youth. PMID:20569649
Adolescent Hopefulness in Tanzania: Street Youth, Former Street Youth, and School Youth
ERIC Educational Resources Information Center
Nalkur, Priya G.
2009-01-01
This study compares hope in street youth, former street youth, and school youth (aged 12-18) in Tanzania. Responding to Snyder's hope theory, the author argues that not only personal agency but also the stability of living context (street, shelter, home) shapes hopefulness. Employing qualitative and quantitative analyses, the author presents a…
Devine, Sharon; Leeds, Caroline; Shlay, Judith C; Leytem, Amber; Beum, Robert; Bull, Sheana
2015-08-01
Youth are prolific users of cell phone minutes and text messaging. Numerous programs using short message service text messaging (SMS) have been employed to help improve health behaviors and health outcomes. However, we lack information on whether and what type of interaction or engagement with SMS program content is required to realize any benefit. We explored youth engagement with an automated SMS program designed to supplement a 25-session youth development program with demonstrated efficacy for reductions in teen pregnancy. Using two years of program data, we report on youth participation in design of message content and response frequency to messages among youth enrolled in the intervention arm of a randomized controlled trial (RCT) as one indicator of engagement. There were 221 youth between the ages of 14-18 enrolled over two years in the intervention arm of the RCT. Just over half (51%) were female; 56% were Hispanic; and 27% African American. Youth were sent 40,006 messages of which 16,501 were considered bi-directional where youth were asked to text a response. Four-fifths (82%) responded at least once to a text. We found variations in response frequency by gender, age, and ethnicity. The most popular types of messages youth responded to include questions and quizzes. The first two months of the program in each year had the highest response frequency. An important next step is to assess whether higher response to SMS results in greater efficacy. This future work can facilitate greater attention to message design and content to ensure messages are engaging for the intended audience. Copyright © 2015 Elsevier Inc. All rights reserved.
Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas
2000-01-01
We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894
McCormick, M K; Campbell, E; Deaven, L; Moyzis, R
1993-01-01
Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075
NASA Astrophysics Data System (ADS)
Gorlach, Igor; Wessel, Oliver
2008-09-01
In the global automotive industry, for decades, vehicle manufacturers have continually increased the level of automation of production systems in order to be competitive. However, there is a new trend to decrease the level of automation, especially in final car assembly, for reasons of economy and flexibility. In this research, the final car assembly lines at three production sites of Volkswagen are analysed in order to determine the best level of automation for each, in terms of manufacturing costs, productivity, quality and flexibility. The case study is based on the methodology proposed by the Fraunhofer Institute. The results of the analysis indicate that fully automated assembly systems are not necessarily the best option in terms of cost, productivity and quality combined, which is attributed to high complexity of final car assembly systems; some de-automation is therefore recommended. On the other hand, the analysis shows that low automation can result in poor product quality due to reasons related to plant location, such as inadequate workers' skills, motivation, etc. Hence, the automation strategy should be formulated on the basis of analysis of all relevant aspects of the manufacturing process, such as costs, quality, productivity and flexibility in relation to the local context. A more balanced combination of automated and manual assembly operations provides better utilisation of equipment, reduces production costs and improves throughput.
Youth Gangs: An Overview. Juvenile Justice Bulletin. Youth Gang Series.
ERIC Educational Resources Information Center
Howell, James C.
1998-01-01
This bulletin provides an overview of the problems that youth gangs pose. It pinpoints the differences between youth gangs and adult criminal organizations and examines the risk factors that lead to youth gang membership. Some promising strategies being used to curb youth gang involvement are reviewed. The proliferation of youth gangs since 1980…
Youth Politics and Local Constructions of Youth
ERIC Educational Resources Information Center
Hansson, Kristian; Lundahl, Lisbeth
2004-01-01
In the 1990s, temporary youth projects became a common approach to handling youth unemployment and the social integration of young people in Sweden. In a longitudinal, qualitative study, 35 unemployed men and women, attending local youth projects in three Swedish municipalities, were followed over a two-year period. The selected contexts…
Youth and Caregiver Physical Activity and Sedentary Time: HCHS/SOL Youth.
Gallo, Linda C; Roesch, Scott P; McCurley, Jessica L; Isasi, Carmen R; Sotres-Alvarez, Daniela; Delamater, Alan M; Van Horn, Linda; Arredondo, Elva M; Perreira, Krista M; Buelna, Christina; Qi, Qibin; Vidot, Denise C; Carnethon, Mercedes R
2017-01-01
We examined associations between youth and caregiver moderate/ vigorous physical activity (MVPA) and sedentary (SED) time, using accelerometery, in the Hispanic Community Health Study/Study of Latino Youth (HCHS/ SOL) Youth. Participants were 623 caregivers and 877 youth 8-16 years old, enrolled in 2012-2014. Associations of youth and caregiver MVPA time, SED time, and meeting MVPA recommendations ( 150 min/week, adults; 420 min/week, youth) were examined in regression models that controlled for sample weights, design effects, and demographic and health covariates. Youth whose caregivers met MVPA recommendations were nearly twice as likely to meet these recommendations themselves when compared to youth whose caregivers did not meet MVPA recommendations (OR = 1.9, 95 CI 1.1, 3.3). Youth and caregiver SED time also were significantly related (p .05). A similar pattern of findings was observed in analyses limited to relationships in which the caregiver was a biological parent of the youth (N = 485 caregivers; N = 795 youth). MVPA and SED are correlated within Latino families as observed by statistically significant relationships of youth and caregiver activity. Additional research is needed to understand underlying genetic and environmental factors that explain these findings.
ERIC Educational Resources Information Center
Conner, Jerusha O.; Cosner, Katherine
2016-01-01
Although youth have long been at the forefront of social change, the last two decades have seen an upsurge in the number of organizations, agencies, and governmental bodies dedicated to supporting the idea of youth voice in public policy. Drawing on in-depth individual interviews with 32 youth in one major urban center, this study compares how…
Zhong, Victor W.; Pfaff, Emily R.; Beavers, Daniel P.; Thomas, Joan; Jaacks, Lindsay M.; Bowlby, Deborah A.; Carey, Timothy S.; Lawrence, Jean M.; Dabelea, Dana; Hamman, Richard F.; Pihoker, Catherine; Saydah, Sharon H.; Mayer-Davis, Elizabeth J.
2014-01-01
Background The performance of automated algorithms for childhood diabetes case ascertainment and type classification may differ by demographic characteristics. Objective This study evaluated the potential of administrative and electronic health record (EHR) data from a large academic care delivery system to conduct diabetes case ascertainment in youth according to type, age and race/ethnicity. Subjects 57,767 children aged <20 years as of December 31, 2011 seen at University of North Carolina Health Care System in 2011 were included. Methods Using an initial algorithm including billing data, patient problem lists, laboratory test results and diabetes related medications between July 1, 2008 and December 31, 2011, presumptive cases were identified and validated by chart review. More refined algorithms were evaluated by type (type 1 versus type 2), age (<10 versus ≥10 years) and race/ethnicity (non-Hispanic white versus “other”). Sensitivity, specificity and positive predictive value were calculated and compared. Results The best algorithm for ascertainment of diabetes cases overall was billing data. The best type 1 algorithm was the ratio of the number of type 1 billing codes to the sum of type 1 and type 2 billing codes ≥0.5. A useful algorithm to ascertain type 2 youth with “other” race/ethnicity was identified. Considerable age and racial/ethnic differences were present in type-non-specific and type 2 algorithms. Conclusions Administrative and EHR data may be used to identify cases of childhood diabetes (any type), and to identify type 1 cases. The performance of type 2 case ascertainment algorithms differed substantially by race/ethnicity. PMID:24913103
Association between youth-focused firearm laws and youth suicides.
Webster, Daniel W; Vernick, Jon S; Zeoli, April M; Manganello, Jennifer A
2004-08-04
Firearms are used in approximately half of all youth suicides. Many state and federal laws include age-specific restrictions on the purchase, possession, or storage of firearms; however, the association between these laws and suicides among youth has not been carefully examined. To evaluate the association between youth-focused firearm laws and suicides among youth. Quasi-experimental design with annual state-level data on suicide rates among US youth aged 14 through 20 years, for the period 1976-2001. Negative binomial regression models were used to estimate the association between state and federal youth-focused firearm laws mandating a minimum age for the purchase or possession of handguns and state child access prevention (CAP) laws requiring safe storage of firearms on suicide rates among youth. Association between youth-focused state and federal firearm laws and rates of firearm, nonfirearm, and total suicides among US youth aged 14 to 17 and 18 through 20 years. There were 63 954 suicides among youth aged 14 through 20 years during the 1976-2001 study period, 39 655 (62%) of which were committed with firearms. Minimum purchase-age and possession-age laws were not associated with statistically significant reductions in suicide rates among youth aged 14 through 20 years. State CAP laws were associated with an 8.3% decrease (rate ratio [RR], 0.92; 95% confidence interval [CI], 0.86-0.98) in suicide rates among 14- to 17-year-olds. The annual rate of suicide in this age group in states with CAP laws was 5.97 per 100 000 population rather than the projected 6.51. This association was also statistically significant for firearm suicides (RR, 0.89; 95% CI, 0.83-0.96) but not for nonfirearm suicides (RR, 1.00; 95% CI, 0.91-1.10). CAP laws were also associated with a significant reduction in suicides among youth aged 18 through 20 years (RR, 0.89; 95% CI, 0.85-0.93); however, the association was similar for firearm suicides (RR, 0.87; 95% CI, 0.82-0.92) and nonfirearm
Correlates of parent-youth discordance about youth-witnessed violence: a brief report.
Lewis, Terri; Thompson, Richard; Kotch, Jonathan B; Proctor, Laura J; Litrownik, Alan J; English, Diana J; Runyan, Desmond K; Wiley, Tisha R; Dubowitz, Howard
2013-01-01
Studies have consistently demonstrated a lack of agreement between youth and parent reports regarding youth-witnessed violence (YWV). However, little empirical investigation has been conducted on the correlates of disagreement. Concordance between youth and parents about YWV was examined in 766 parent-youth dyads from the Longitudinal Studies of Child Abuse and Neglect (LONGSCAN). Results showed that significantly more youth (42%) than parents (15%) reported YWV. Among the dyads in which at least one informant reported YWV (N = 344), we assessed whether youth delinquency, parental monitoring, parent-child relationship quality, history of child maltreatment, income, and parental depression were predictive of parent-youth concordance. Findings indicated that youth engagement in delinquent activities was higher in the groups in which the youth reported violence exposure. More empirical study is needed to assess correlates of agreement in high-risk youth to better inform associations found between exposures and outcomes as well as practice and policy for violence exposed youth.
Youth Organizing: From Youth Development to School Reform
ERIC Educational Resources Information Center
Warren, Mark R.; Mira, Meredith; Nikundiwe, Thomas
2008-01-01
Over the past twenty years, youth organizing has grown across the country. Through organizing, young people identify issues of concern and mobilize their peers to build action campaigns to achieve their objectives. Youth organizing has been appreciated for its contributions to youth and community development. The authors use two case studies to…
Youth lead youth in Marshall Islands.
Johnson, G
1988-01-01
The promotion of family planning and birth control in Pacific countries is often frustrated by traditional and religious beliefs, if not deterred by tremendous funding and logistics problems. In the central Pacific republic of the Marshall Islands, however, youthful health workers are taking a unique approach to health promotion that has spurred acceptance of the once controversial subjects of family planning and birth control. A group known as Youth to Youth in Health is spearheading a family planning outreach drive in the schools and community in the Marshall Islands. Coupling health presentations with traditional island music and dance to produce lively health shows, the group's programs on family planning, birth control, nutrition, and cancer have struck a responsive chord in a culture known for its religious and traditional conservatism. The group makes creative use of puppet shows, skits, health songs, and pantomimes, interspersed with contemporary renditions of Marshall Islands music and traditional dances. These have rekindled pride in their culture among the group and sparked a sense of urgency about the need to improve health conditions in the islands. As evidence of the group's impact, family planning staff point to a nearly 4-fold rise in the number of youth clients under 19 years since the Youth to Youth started in mid-1986. Their combination of traditional custom with family planning and other health information has proved to be an innovative and needed program for the islands.
ERIC Educational Resources Information Center
Barliba, Dan Mihai
1984-01-01
The complex and dynamic relationship of youth and peace is examined, educational priorities regarding peace education of youth are discussed, and characterisitcs of youth movements for peace and disarmament are described. Peace is one of the main priorities expressed by the themes of International Youth Year 1985. (RM)
ERIC Educational Resources Information Center
Goldwasser, Matthew L.
2016-01-01
By establishing a set of theoretical frameworks to view and compare the work of youth organizers and youth commissioners, and through personal interviews, the authors of the paper "Youth Change Agents: Comparing the Sociopolitical Identities of Youth Organizers and Youth Commissioners" presented their explanation of the development of…
Extension Youth Educators' Technology Use in Youth Development Programming
ERIC Educational Resources Information Center
McClure, Carli; Buquoi, Brittany; Kotrlik, Joe W.; Machtmes, Krisanna; Bunch, J. C.
2014-01-01
The purpose of this descriptive-correlational study was to determine the use of technology in youth programming by Extension youth development educators in Louisiana, Mississippi, and Tennessee. Data were collected via e-mail and a SurveyMonkey© questionnaire. Extension educators are using some technology in youth development programming. More…
Alcohol brand use of youth-appealing advertising and consumption by youth and adults
Padon, Alisa A.; Rimal, Rajiv N.; Siegel, Michael; DeJong, William; Naimi, Timothy S.; JernFigan, David H.
2018-01-01
Background Youth exposure to alcohol marketing has been shown to be an important contributor to the problem of underage drinking in the U.S. More work is needed on identifying and minimizing content with particular appeal to youth. Design and Methods We tested the association between the youth-appeal of marketing content of televised alcohol advertisements and the brand-specific alcohol consumption of both underage youth and adults. We used existing data from three sources: a brand-specific alcohol consumption survey among underage youth (N=1032), a brand-specific alcohol consumption survey among adults (N ~13,000), and an analysis of content appealing to youth (CAY) in a sample of televised alcohol advertisements (n=96) aired during the youth survey. The association between CAY scores for the 96 alcohol ads and youth (age 13-20) versus adult (age 21+) consumption of those ads’ brands was tested through bivariate and multivariate models. Results Brand CAY scores were (a) positively associated with brand-specific youth consumption after controlling for adult brand consumption; (b) positively associated with a ratio of youth-toadult brand-specific consumption; and (c) not associated with adult brand consumption. Conclusions Alcohol brands with youth-appealing advertising are consumed more often by youth than adults, indicating that these ads may be more persuasive to relatively younger audiences, and that youth are not simply mirroring adult consumption patterns in their choice of brands. Future research should consider the content of alcohol advertising when testing marketing effects on youth drinking, and surveillance efforts might focus on brands popular among youth. Significance for public healthYouth are overexposed to alcohol advertising. This contributes to youth having positive expectations of drinking, initiating drinking, and drinking more in quantity and frequency. The alcohol industry’s self-regulatory guidelines stipulate that marketing content
The Multiple Roles that Youth Development Program Leaders Adopt with Youth
ERIC Educational Resources Information Center
Walker, Kathrin C.
2011-01-01
The roles that program leaders establish in their relationships with youth structure how leaders are able to foster youth development. This article examines the complex roles program leaders create in youth programs and investigates how they balanced multiple roles to most effectively respond to the youth they serve. Analyses of qualitative data…
Youth Civic Engagement: Do Youth Councils Reduce or Reinforce Social Inequality?
ERIC Educational Resources Information Center
Augsberger, Astraea; Collins, Mary Elizabeth; Gecker, Whitney; Dougher, Meaghan
2018-01-01
Youth engagement in municipal government has the potential to benefit both youth and the community. Yet, some forms of youth civic engagement may be related to social class and race resulting in benefits to select youth and communities, thus perpetuating a longer term trajectory of privilege or marginalization. Informed by theories of social…
USDA-ARS?s Scientific Manuscript database
A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system ...
Alcohol brand use of youth-appealing advertising and consumption by youth and adults.
Padon, Alisa A; Rimal, Rajiv N; Siegel, Michael; DeJong, William; Naimi, Timothy S; JernFigan, David H
2018-02-05
Youth exposure to alcohol marketing has been shown to be an important contributor to the problem of underage drinking in the U.S. More work is needed on identifying and minimizing content with particular appeal to youth. We tested the association between the youth-appeal of marketing content of televised alcohol advertisements and the brand-specific alcohol consumption of both underage youth and adults. We used existing data from three sources: a brand-specific alcohol consumption survey among underage youth ( N =1032), a brand-specific alcohol consumption survey among adults ( N ~13,000), and an analysis of content appealing to youth (CAY) in a sample of televised alcohol advertisements ( n =96) aired during the youth survey. The association between CAY scores for the 96 alcohol ads and youth (age 13-20) versus adult (age 21+) consumption of those ads' brands was tested through bivariate and multivariate models. Brand CAY scores were (a) positively associated with brand-specific youth consumption after controlling for adult brand consumption; (b) positively associated with a ratio of youth-toadult brand-specific consumption; and (c) not associated with adult brand consumption. Alcohol brands with youth-appealing advertising are consumed more often by youth than adults, indicating that these ads may be more persuasive to relatively younger audiences, and that youth are not simply mirroring adult consumption patterns in their choice of brands. Future research should consider the content of alcohol advertising when testing marketing effects on youth drinking, and surveillance efforts might focus on brands popular among youth.
Measuring and Understanding Authentic Youth Engagement: The Youth-Adult Partnership Rubric
ERIC Educational Resources Information Center
Wu, Heng-Chieh Jamie; Kornbluh, Mariah; Weiss, John; Roddy, Lori
2016-01-01
Commonly described as youth-led or youth-driven, the youth-adult partnership (Y-AP) model has gained increasing popularity in out-of-school time (OST) programs in the past two decades (Larson, Walker, & Pearce, 2005; Zeldin, Christens, & Powers, 2013). The Y-AP model is defined as "the practice of (a) multiple youth and multiple…
Youth Employment Programs: A Survey of National Voluntary Youth Serving Organizations.
ERIC Educational Resources Information Center
National Assembly of National Voluntary Health and Social Welfare Organizations, New York, NY.
This report presents a survey of local youth-serving agencies affiliated with the National Collaboration for Youth to determine to what degree and in what way the agencies are involved in providing employment and training activities for youth. The eleven agencies focused on are American Red Cross Youth Services; Boys' Clubs of America; Boy Scouts…
Ramey, Heather L; Lawford, Heather L; Rose-Krasnor, Linda
2017-02-01
Youth contributions to others (e.g., volunteering) have been connected to indicators of successful development, including self-esteem, optimism, social support, and identity development. Youth-adult partnerships, which involve youth and adults working together towards a shared goal in activity settings, such as youth-serving agencies or recreation organizations, provide a unique opportunity for examining youth contributions. We examined associations between measures of youth's participation in youth-adult partnerships (psychological engagement and degree of partnering) in activity settings and youth contributing behaviors, in two Canadian samples: (a) community-involved youth (N = 153, mean age = 17.1 years, 65% female) and (b) undergraduates (N = 128, mean age = 20.1 years, 92.2% female). We found that degree of partnering and psychological engagement were related to each other yet independently predicted contributing behaviors. Our findings suggest that youth-adult partnerships might be one potentially rich context for the promotion of youth's contributions to others. Copyright © 2017 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.
Altering user' acceptance of automation through prior automation exposure.
Bekier, Marek; Molesworth, Brett R C
2017-06-01
Air navigation service providers worldwide see increased use of automation as one solution to overcome the capacity constraints imbedded in the present air traffic management (ATM) system. However, increased use of automation within any system is dependent on user acceptance. The present research sought to determine if the point at which an individual is no longer willing to accept or cooperate with automation can be manipulated. Forty participants underwent training on a computer-based air traffic control programme, followed by two ATM exercises (order counterbalanced), one with and one without the aid of automation. Results revealed after exposure to a task with automation assistance, user acceptance of high(er) levels of automation ('tipping point') decreased; suggesting it is indeed possible to alter automation acceptance. Practitioner Summary: This paper investigates whether the point at which a user of automation rejects automation (i.e. 'tipping point') is constant or can be manipulated. The results revealed after exposure to a task with automation assistance, user acceptance of high(er) levels of automation decreased; suggesting it is possible to alter automation acceptance.
ERIC Educational Resources Information Center
Erbstein, Nancy
2010-01-01
Youth who are most vulnerable to challenging community conditions, more limited opportunities and poor health, educational and economic trajectories derive especially strong benefits from engagement in community youth development efforts (Gambone, Yu, et al. 2004). Like many community youth development efforts, the REACH Youth Program called upon…
Complacency and Automation Bias in the Use of Imperfect Automation.
Wickens, Christopher D; Clegg, Benjamin A; Vieane, Alex Z; Sebok, Angelia L
2015-08-01
We examine the effects of two different kinds of decision-aiding automation errors on human-automation interaction (HAI), occurring at the first failure following repeated exposure to correctly functioning automation. The two errors are incorrect advice, triggering the automation bias, and missing advice, reflecting complacency. Contrasts between analogous automation errors in alerting systems, rather than decision aiding, have revealed that alerting false alarms are more problematic to HAI than alerting misses are. Prior research in decision aiding, although contrasting the two aiding errors (incorrect vs. missing), has confounded error expectancy. Participants performed an environmental process control simulation with and without decision aiding. For those with the aid, automation dependence was created through several trials of perfect aiding performance, and an unexpected automation error was then imposed in which automation was either gone (one group) or wrong (a second group). A control group received no automation support. The correct aid supported faster and more accurate diagnosis and lower workload. The aid failure degraded all three variables, but "automation wrong" had a much greater effect on accuracy, reflecting the automation bias, than did "automation gone," reflecting the impact of complacency. Some complacency was manifested for automation gone, by a longer latency and more modest reduction in accuracy. Automation wrong, creating the automation bias, appears to be a more problematic form of automation error than automation gone, reflecting complacency. Decision-aiding automation should indicate its lower degree of confidence in uncertain environments to avoid the automation bias. © 2015, Human Factors and Ergonomics Society.
Dabelea, Dana; DeGroat, Joquetta; Sorrelman, Carmelita; Glass, Martia; Percy, Christopher A.; Avery, Charlene; Hu, Diana; D'Agostino, Ralph B.; Beyer, Jennifer; Imperatore, Giuseppina; Testaverde, Lisa; Klingensmith, Georgeanna; Hamman, Richard F.
2009-01-01
OBJECTIVE—To estimate the prevalence and incidence of diabetes, clinical characteristics, and risk factors for chronic complications among Navajo youth, using data collected by the SEARCH for Diabetes in Youth Study (SEARCH study). RESEARCH DESIGN AND METHODS—The SEARCH study identified all prevalent cases of diabetes in 2001 and all incident cases in 2002–2005 among Navajo youth. We estimated denominators with the user population for eligible health care facilities. Youth with diabetes also attended a research visit that included questionnaires, physical examination, blood and urine collection, and extended medical record abstraction. RESULTS—Diabetes is infrequent among Navajo youth aged <10 years. However, both prevalence and incidence of diabetes are high in older youth. Among adolescents aged 15–19 years, 1 in 359 Navajo youth had diabetes in 2001 and 1 in 2,542 developed diabetes annually. The vast majority of diabetes among Navajo youth with diabetes is type 2, although type 1 diabetes is also present, especially among younger children. Navajo youth with either diabetes type were likely to have poor glycemic control, high prevalence of unhealthy behaviors, and evidence of severely depressed mood. Youth with type 2 diabetes had more metabolic factors associated with obesity and insulin resistance (abdominal fat deposition, dyslipidemia, and higher albumin-to-creatinine ratio) than youth with type 1 diabetes. CONCLUSIONS—Our data provide evidence that diabetes is an important health problem for Navajo youth. Targeted efforts aimed at primary prevention of diabetes in Navajo youth and efforts to prevent or delay the development of chronic complications among those with diabetes are warranted. PMID:19246579
Fan, Li-Ying; Shang, Chi-Yung; Tseng, Wen-Yih Isaac; Gau, Susan Shur-Fen; Chou, Tai-Li
2018-05-10
Deficits in inhibitory control and visual processing are common in youths with attention-deficit/hyperactivity disorder (ADHD), but little is known about endophenotypes for unaffected siblings of youths with ADHD. This study aimed to investigate the potential endophenotypes of brain activation and performance in inhibitory control and visual processing among ADHD probands, their unaffected siblings, and neurotypical youths. We assessed 27 ADHD probands, 27 unaffected siblings, and 27 age-, gender-, and IQ-matched neurotypical youths using the counting Stroop functional magnetic resonance imaging and two tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB): rapid visual information processing (RVP) for inhibitory control and spatial span (SSP) for visual processing. ADHD probands showed greater activation than their unaffected siblings and neurotypical youths in the right inferior frontal gyrus (IFG) and anterior cingulate cortex. Increased activation in the right IFG was positively correlated with the mean latency of the RVP in ADHD probands. Moreover, ADHD probands and their unaffected siblings showed less activation in the left superior parietal lobule (SPL) than neurotypical youths. Increased activation in the left SPL was positively correlated with the spatial length of the SSP in neurotypical youths. Our findings suggest that less activation in the left SPL might be considered as a candidate imaging endophenotype for visual processing in ADHD. © 2018 Wiley Periodicals, Inc.
YouthALIVE! From Enrichment to Employment: The YouthALIVE! Experience.
ERIC Educational Resources Information Center
Association of Science-Technology Centers, Washington, DC.
This document introduces the national initiative YouthALIVE (Youth Achievement through Learning, Involvement, Volunteering, and Employment). The YouthALIVE program focuses on the needs of children of color from low-income communities and provides financial and technical assistance to science centers, zoos, botanical gardens, and museums for the…
Involving youth in program decision-making: how common and what might it do for youth?
Akiva, Thomas; Cortina, Kai S; Smith, Charles
2014-11-01
The strategy of sharing program decision-making with youth in youth programs, a specific form of youth-adult partnership, is widely recommended in practitioner literature; however, empirical study is relatively limited. We investigated the prevalence and correlates of youth program decision-making practices (e.g., asking youth to help decide what activities are offered), using single-level and multilevel methods with a cross-sectional dataset of 979 youth attending 63 multipurpose after-school programs (average age of youth = 11.4, 53 % female). The prevalence of such practices was relatively high, particularly for forms that involved low power sharing such as involving youth in selecting the activities a program offers. Hierarchical linear modeling revealed positive associations between youth program decision-making practices and youth motivation to attend programs. We also found positive correlations between decision-making practices and youth problem-solving efficacy, expression efficacy, and empathy. Significant interactions with age suggest that correlations with problem solving and empathy are more pronounced for older youth. Overall, the findings suggest that involving youth in program decision-making is a promising strategy for promoting youth motivation and skill building, and in some cases this is particularly the case for older (high school-age) youth.
A Youth-Friendly Intervention for Homeless and Street-Involved Youth.
ERIC Educational Resources Information Center
O'Connor, Barbara Virley; MacDonald, Brian J.
1999-01-01
Describes a community intervention for a population of youth who are often distrustful of mainstream mental health services. Program focuses on not viewing youth as patients but as experts in working with adults to design youth-friendly interventions. Outlines the development and implementation of a support-group model tailored specifically to the…
ERIC Educational Resources Information Center
Trout Unlimited, Arlington, VA.
Part of the Trout Unlimited program involves the development of cooperative programs to educate youth and their communities about environmental conservation. This handbook provides guidelines for conducting youth education events and information to facilitate the development and implementation of youth education activities with various community…
ERIC Educational Resources Information Center
Zeldin, Shepherd; Gauley, Josset; Krauss, Steven Eric; Kornbluh, Mariah; Collura, Jessica
2017-01-01
Across the world, community-based youth organizations are engaging youth as partners with adults to promote youth civic development. A sample of 528 youth from the United States, Portugal, and Malaysia were surveyed to explore associations between youth-adult partnership (youth voice in decision making; supportive adult relationships) and two key…
ERIC Educational Resources Information Center
Barnard, David, Ed.
With the goal of enhancing cooperation and interaction among youth, youth organizations, and other service providers to the youth sector, this directory aims to give youth, as well as people and organizations involved and interested in youth-related issues, a comprehensive source of information on South African youth organizations and related…
Youth Activists, Youth Councils, and Constrained Democracy
ERIC Educational Resources Information Center
Taft, Jessica K.; Gordon, Hava R.
2013-01-01
This article provides a critical examination of a common form of adult attempts to promote civic engagement among young people, namely, youth advisory councils. While youth councils have been widely celebrated as an effective way to integrate young people into political processes, little research has explored why some politically active youth…
ERIC Educational Resources Information Center
Hauge, Chelsey
2014-01-01
This article addresses how capacity is conceived of and understood in youth media/civic education programming, and how beliefs about agency, development, relationality and youth manifests in the discourses, programmes, and practices of organizations operating youth media programmes. Through attention to a youth media and development programme in…
Improving the driver-automation interaction: an approach using automation uncertainty.
Beller, Johannes; Heesen, Matthias; Vollrath, Mark
2013-12-01
The aim of this study was to evaluate whether communicating automation uncertainty improves the driver-automation interaction. A false system understanding of infallibility may provoke automation misuse and can lead to severe consequences in case of automation failure. The presentation of automation uncertainty may prevent this false system understanding and, as was shown by previous studies, may have numerous benefits. Few studies, however, have clearly shown the potential of communicating uncertainty information in driving. The current study fills this gap. We conducted a driving simulator experiment, varying the presented uncertainty information between participants (no uncertainty information vs. uncertainty information) and the automation reliability (high vs.low) within participants. Participants interacted with a highly automated driving system while engaging in secondary tasks and were required to cooperate with the automation to drive safely. Quantile regressions and multilevel modeling showed that the presentation of uncertainty information increases the time to collision in the case of automation failure. Furthermore, the data indicated improved situation awareness and better knowledge of fallibility for the experimental group. Consequently, the automation with the uncertainty symbol received higher trust ratings and increased acceptance. The presentation of automation uncertaintythrough a symbol improves overall driver-automation cooperation. Most automated systems in driving could benefit from displaying reliability information. This display might improve the acceptance of fallible systems and further enhances driver-automation cooperation.
ERIC Educational Resources Information Center
Wright, Wynne; Nault, Katherine
2013-01-01
How can youth be educated and empowered to become responsible food citizens? Evidence from a university-community partnership with youth in Michigan is presented to illuminate participatory approaches to youth engagement in food systems. We found that youth have valuable knowledge to enhance our understanding of food environments. At the same…
Politics, gender and youth citizenship in Senegal: Youth policing of dissent and diversity
NASA Astrophysics Data System (ADS)
Crossouard, Barbara; Dunne, Máiréad
2015-02-01
This paper reports on empirical research on youth as active citizens in Senegal with specific reference to their education and their sexual and reproductive health rights. In a context of postcoloniality which claims to have privileged secular, republican understandings of the constitution, the authors seek to illuminate how youth activists sustain patriarchal, metropolitan views of citizenship and reinforce ethnic and locational (urban/rural) hierarchies. Their analysis is based on a case study of active youth citizenship, as reflected in youth engagement in the recent presidential elections in Senegal. This included involvement in youth protests against pre-election constitutional abuse and in a project monitoring the subsequent elections using digital technologies. The authors compare how youth activists enacted different notions of citizenship, in some instances involving a vigorous defence of Senegal's democratic constitution, while in others dismissing this as being irrelevant to youth concerns. Here the authors make an analytic distinction between youth engagement in politics, seen as the public sphere of constitutional democracy, and the political, which they relate to the inherently conflictual and agonistic processes through which (youth) identities are policed, in ways which may legitimate or marginalise. Despite the frequent construction of youth as being agents of change, this analysis shows how potentially productive and open spaces for active citizenship were drawn towards conformity and the reproduction of existing hegemonies, in particular through patriarchal gender relations and sexual norms within which female youth remained particularly vulnerable.
School absenteeism and mental health among sexual minority youth and heterosexual youth.
Burton, Chad M; Marshal, Michael P; Chisolm, Deena J
2014-02-01
Adolescent school absenteeism is associated with negative outcomes such as conduct disorders, substance abuse, and dropping out of school. Mental health factors, such as depression and anxiety, have been found to be associated with increased absenteeism from school. Sexual minority youth (youth who are attracted to the same sex or endorse a gay, lesbian, or bisexual identity) are a group at risk for increased absenteeism due to fear, avoidance, and higher rates of depression and anxiety than their heterosexual peers. The present study used longitudinal data to compare sexual minority youth and heterosexual youth on excused and unexcused absences from school and to evaluate differences in the relations between depression and anxiety symptoms and school absences among sexual minority youth and heterosexual youth. A total of 108 14- to 19-years-old adolescents (71% female and 26% sexual minority) completed self-report measures of excused and unexcused absences and depression and anxiety symptoms. Compared to heterosexual youth, sexual minority youth reported more excused and unexcused absences and more depression and anxiety symptoms. Sexual minority status significantly moderated the effects of depression and anxiety symptoms on unexcused absences such that depression and anxiety symptoms were stronger predictors of unexcused absences for sexual minority youth than for heterosexual youth. The results demonstrate that sexual minority status and mental health are important factors to consider when assessing school absenteeism and when developing interventions to prevent or reduce school absenteeism among adolescents. Copyright © 2014 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.
Youth Social Action Trials: Youth United. Evaluation Report and Executive Summary
ERIC Educational Resources Information Center
Gorard, Stephen; See, Beng Huat; Siddiqui, Nadia; Smith, Emma; White, Patrick
2016-01-01
The intervention evaluated here is one of two "youth social action" projects jointly funded by the Education Endowment Foundation, the U.K. Cabinet Office, the Pears Foundation and the Stone Family Foundation. It was delivered by the Youth United Foundation (YUF) and involved uniformed youth organisations being established in schools in…
Malt Beverage Brand Popularity Among Youth and Youth-Appealing Advertising Content.
Xuan, Ziming; DeJong, William; Siegel, Michael; Babor, Thomas F
2017-11-01
This study examined whether alcohol brands more popular among youth are more likely to have aired television advertisements that violated the alcohol industry's voluntary code by including youth-appealing content. We obtained a complete list of 288 brand-specific beer advertisements broadcast during the National Collegiate Athletic Association (NCAA) men's and women's basketball tournaments from 1999 to 2008. All ads were rated by a panel of health professionals using a modified Delphi method to assess the presence of youth-appealing content in violation of the alcohol industry's voluntary code. The ads represented 23 alcohol brands. The popularity of these brands was operationalized as the brand-specific popularity of youth alcohol consumption in the past 30 days, as determined by a 2011 to 2012 national survey of underage drinkers. Brand-level popularity was used as the exposure variable to predict the odds of having advertisements with youth-appealing content violations. Accounting for other covariates and the clustering of advertisements within brands, increased brand popularity among underage youth was associated with significantly increased odds of having youth-appeal content violations in ads televised during the NCAA basketball tournament games (adjusted odds ratio = 1.70, 95% CI: 1.38, 2.09). Alcohol brands popular among underage drinkers are more likely to air television advertising that violates the industry's voluntary code which proscribes youth-appealing content. Copyright © 2017 by the Research Society on Alcoholism.
NASA Technical Reports Server (NTRS)
Wiener, Earl L.
1988-01-01
The aims and methods of aircraft cockpit automation are reviewed from a human-factors perspective. Consideration is given to the mixed pilot reception of increased automation, government concern with the safety and reliability of highly automated aircraft, the formal definition of automation, and the ground-proximity warning system and accidents involving controlled flight into terrain. The factors motivating automation include technology availability; safety; economy, reliability, and maintenance; workload reduction and two-pilot certification; more accurate maneuvering and navigation; display flexibility; economy of cockpit space; and military requirements.
What Makes a Youth-Produced Film Good? The Youth Audience Perspective
ERIC Educational Resources Information Center
Halverson, Erica Rosenfeld; Gibbons, Damiana; Copeland, Shelby; Andrews, Alon; Llorens, Belen Hernando; Bass, Michelle B.
2014-01-01
In this article, we explore how youth audiences evaluate the quality of youth-produced films. Our interest stems from a dearth of ways to measure the quality of what youth produce in artistic production processes. As a result, making art in formal learning settings devolves into either romanticized creativity or instrumental work to improve skills…
ERIC Educational Resources Information Center
Owadokun, Remi Manoela; Aviles, Pearlie
2005-01-01
In the Fall of 2004, after many years of discussion by adults in the City of Somerville, Massachusetts, the Somerville Youth Council started. For several months, a youth planning group met weekly to craft the mission of the council and the by-laws. There was a critical need to create a process to enable youth of the city to explore possible…
Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji
2010-05-07
Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.
Employer's Pocket Guide on Youth Employment. Youth Rules!
ERIC Educational Resources Information Center
US Department of Labor, 2004
2004-01-01
Through the YouthRules! initiative, the U.S. Department of Labor and its strategic partners seek to promote positive and safe work experiences for young workers. YouthRules! strives to educate teens, parents, educators, employers and the public on Federal and State rules regarding young workers. Components of the initiative include a website…
ERIC Educational Resources Information Center
Gordon, James S.
1976-01-01
Outlines the evaluation of a suburban hotline. Among its foci is the interrelationship between the growth and development of a core group of youthful phone aides and that of the organization as a whole. (Author/AM)
Thompson, Richard; Jones, Deborah J.; Litrownik, Alan J.; English, Diana J.; Kotch, Jonathan B.; Lewis, Terri; Dubowitz, Howard
2014-01-01
Evidence suggests that parenting attitudes are transmitted within families. However, limited research has examined this prospectively. The current prospective study examined direct effects of early maternal attitudes toward parenting (as measured at child age 4 by the Adult-Adolescent Parenting Inventory [AAPI]) on later youth parenting attitudes (as measured by the AAPI at youth age 18). Indirect effects via child maltreatment (physical abuse, sexual abuse, neglect, and emotional maltreatment), parent involvement, and youth functioning (internalizing and externalizing problems) were also assessed. Analyses were conducted on data from 412 families enrolled in the Longitudinal Studies of Child Abuse and Neglect (LONGSCAN). There were significant direct effects for three of the four classes of mother parenting attitudes (appropriate developmental expectations of children, empathy toward children, and appropriate family roles) on youth attitudes but not for rejection of punishment. In addition, the following indirect effects were obtained: Mother expectations influenced youth expectations via neglect; mother empathy influenced youth empathy via both parental involvement and youth externalizing problems; and mother rejection of punishment influenced youth rejection of punishment via youth internalizing problems. None of the child or family process variables, however, affected the link between mother and youth attitudes about roles. PMID:25113632
Tribal Youth Media: Toward a Positive Tribal Youth Development Model
NASA Astrophysics Data System (ADS)
Tynan, Timothy J.
The low representation of Indigenous people in the sciences is often described as an effect of colonization and the result of a dominant western science paradigm that ignores or dismisses Indigenous Knowledge Systems (IKS) and Traditional Ecological Knowledge (TEK). Initiated by Indigenous faculty of the University of Wisconsin, the Tribal Youth Media Program (TYM) is a Native-science based documentary filmmaking workshop for Anishinaabe adolescents in northern Wisconsin. Several years of the TYM program were interpreted with an Organic Video Approach (OVA) and an Indigenous research method known as the 4 R's: Respect, Relationships, Relevance, and Reciprocity. Planners and facilitators from the University of Wisconsin-Madison co-directed and coordinated the program with members of the Lac Courte Oreilles and Bad River Bands of Lake Superior Chippewa as well as the Great Lakes Indian Fish and Wildlife Commission (GLIFWC). Immersed in Anishinaabe settings and institutions, TYM emphasized the story-telling traditions and intergenerational relationships that are central to Anishinaabe youth learning and modeling. The filmmaking process and supportive program dynamics created opportunities for critical media production, science learning within a TEK framework, and significant spaces for positive youth development. The youth-produced documentaries reframe environmental and resource issues with an Anishinaabe perspective and community voice. The importance of opportunities for collective identity work and community engagement with youth is discussed as an integral part of decolonization and positive tribal youth development.
Song, Long; Zhang, Hong; Liu, Xin; Zhao, Zhi-Li; Chen, Shi-Lin; Wang, Zheng-Tao; Xu, Hong-Xi
2012-12-01
Yunaconitine (YAC) is a toxic aconite alkaloid that is considered to be a hidden aconite poison since it is frequently found in body fluids from aconite poisoning patients, but has not been well studied in commonly used herbal drugs. In this paper, a rapid and sensitive ultra high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) detection combined with microwave-assisted extraction (MAE) was developed for high throughput simultaneous determination of YAC and six other toxic aconite alkaloids in 31 samples of crude, processed aconites and aconite-containing drugs. The optimized method showed excellent linearity, precision, accuracy and recovery for all target compounds with short run time. YAC was detected in some samples with contents from 0.015 to 10.41 mg/g. This is the first report on the determination of YAC in Radix Aconiti, Radix Aconiti Kusnezoffii and aconite-containing drugs. This newly developed method facilitates the rapid screening of YAC and related toxic aconite alkaloids and allows YAC to be used as a chemical marker for the quality control of aconites and aconite-containing drugs. Copyright © 2012 John Wiley & Sons, Ltd.
Dawes, Nickki Pearce; Larson, Reed
2011-01-01
For youth to benefit from many of the developmental opportunities provided by organized programs, they need to not only attend but become psychologically engaged in program activities. This research was aimed at formulating empirically based grounded theory on the processes through which this engagement develops. Longitudinal interviews were conducted with 100 ethnically diverse youth (ages 14–21) in 10 urban and rural arts and leadership programs. Qualitative analysis focused on narrative accounts from the 44 youth who reported experiencing a positive turning point in their motivation or engagement. For 38 of these youth, this change process involved forming a personal connection. Similar to processes suggested by self-determination theory (Ryan & Deci, 2000), forming a personal connection involved youth's progressive integration of personal goals with the goals of program activities. Youth reported developing a connection to 3 personal goals that linked the self with the activity: learning for the future, developing competence, and pursuing a purpose. The role of purpose for many youth suggests that motivational change can be driven by goals that transcend self-needs. These findings suggest that youth need not enter programs intrinsically engaged--motivation can be fostered--and that programs should be creative in helping youth explore ways to form authentic connections to program activities.
Youth Organisations and Youth Service Institutions in the Federal Republic of Germany.
ERIC Educational Resources Information Center
Verlag, Juventa
This reference book describes the many groups and organizations in Germany that are involved in youth work. Its purpose is to facilitate the development of international contacts and to contribute to the international education of German youth. Youth work in Germany is briefly described in the book's introduction. The annotated listing is…
NASA Technical Reports Server (NTRS)
Shively, Jay
2017-01-01
A significant level of debate and confusion has surrounded the meaning of the terms autonomy and automation. Automation is a multi-dimensional concept, and we propose that Remotely Piloted Aircraft Systems (RPAS) automation should be described with reference to the specific system and task that has been automated, the context in which the automation functions, and other relevant dimensions. In this paper, we present definitions of automation, pilot in the loop, pilot on the loop and pilot out of the loop. We further propose that in future, the International Civil Aviation Organization (ICAO) RPAS Panel avoids the use of the terms autonomy and autonomous when referring to automated systems on board RPA. Work Group 7 proposes to develop, in consultation with other workgroups, a taxonomy of Levels of Automation for RPAS.
Thompson, Richard; Jones, Deborah J; Litrownik, Alan J; English, Diana J; Kotch, Jonathan B; Lewis, Terri; Dubowitz, Howard
2014-01-01
Evidence suggests that parenting attitudes are transmitted within families. However, limited research has examined this prospectively. The current prospective study examined direct effects of early maternal attitudes toward parenting (as measured at child age 4 by the Adult-Adolescent Parenting Inventory [AAPI]) on later youth parenting attitudes (as measured by the AAPI at youth age 18). Indirect effects via child maltreatment (physical abuse, sexual abuse, neglect, and emotional maltreatment), parent involvement, and youth functioning (internalizing and externalizing problems) were also assessed. Analyses were conducted on data from 412 families enrolled in the Longitudinal Studies of Child Abuse and Neglect (LONGSCAN). There were significant direct effects for three of the four classes of mother parenting attitudes (appropriate developmental expectations of children, empathy toward children, and appropriate family roles) on youth attitudes but not for rejection of punishment. In addition, the following indirect effects were obtained: Mother expectations influenced youth expectations via neglect; mother empathy influenced youth empathy via both parental involvement and youth externalizing problems; and mother rejection of punishment influenced youth rejection of punishment via youth internalizing problems. None of the child or family process variables, however, affected the link between mother and youth attitudes about roles. © The Author(s) 2014.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false May youth participate in both youth and adult... Enrollment § 664.500 May youth participate in both youth and adult/dislocated worker programs concurrently? (a) Yes, under the Act, eligible youth are 14 through 21 years of age. Adults are defined in the Act...
Code of Federal Regulations, 2013 CFR
2013-04-01
... 20 Employees' Benefits 4 2013-04-01 2013-04-01 false May youth participate in both youth and adult... Concurrent Enrollment § 664.500 May youth participate in both youth and adult/dislocated worker programs concurrently? (a) Yes, under the Act, eligible youth are 14 through 21 years of age. Adults are defined in the...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false May youth participate in both youth and adult... Enrollment § 664.500 May youth participate in both youth and adult/dislocated worker programs concurrently? (a) Yes, under the Act, eligible youth are 14 through 21 years of age. Adults are defined in the Act...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 20 Employees' Benefits 4 2014-04-01 2014-04-01 false May youth participate in both youth and adult... Concurrent Enrollment § 664.500 May youth participate in both youth and adult/dislocated worker programs concurrently? (a) Yes, under the Act, eligible youth are 14 through 21 years of age. Adults are defined in the...
Code of Federal Regulations, 2012 CFR
2012-04-01
... 20 Employees' Benefits 4 2012-04-01 2012-04-01 false May youth participate in both youth and adult... Concurrent Enrollment § 664.500 May youth participate in both youth and adult/dislocated worker programs concurrently? (a) Yes, under the Act, eligible youth are 14 through 21 years of age. Adults are defined in the...
ERIC Educational Resources Information Center
Children Today, 1988
1988-01-01
Lists the four young people cited as exceptional youth by President Ronald Reagan on September 9, 1988, during Youth 2000 Week. Cited were Andrea Taylor of Kansas City, Missouri, Peggy Lee Rogers of Denver, Colorado, Annette Pino of Pueblo, Colorado, and Ed Lucero, a student at Colorado State University. (SKC)
Imagining the Future: Perspectives Among Youth and Caregivers in the Trans Youth Family Study
Katz-Wise, Sabra L.; Budge, Stephanie L.; Orovecz, Joe J.; Nguyen, Bradford; Nava-Coulter, Brett; Thomson, Katharine
2016-01-01
Future perspectives of transgender youth and their caregivers may be shaped by knowledge of discrimination and adverse mental health among transgender adults. Qualitative data from the Trans Youth Family Study were used to examine how transgender and gender nonconforming (TGN) youth and their caregivers imagine the youth's future. A community-based sample of 16 families (16 TGN youth, ages 7-18 years, and 29 caregivers) was recruited from two regions in the United States. Participants completed in-person qualitative interviews and surveys. Interview transcripts were analyzed using grounded theory methodology for coding procedures. Analyses yielded 104 higher order themes across 45 interviews, with eight prominent themes: comparing experiences with others, gender affirming hormones, gender affirming surgery, gender norms, questioning whether the youth is really transgender, expectations for romantic relationships, uncertainty about the future, and worries about physical and emotional safety. A conceptual model of future perspectives in TGN youth and caregivers is presented and clinical implications are discussed. PMID:28068129
Comparison of Positive Youth Development for Youth With Chronic Conditions With Healthy Peers.
Maslow, Gary R; Hill, Sherika N; Pollock, McLean D
2016-12-01
Adolescents with childhood-onset chronic condition (COCC) are at increased risk for physical and psychological problems. Despite being at greater risk and having to deal with traumatic experiences and uncertainty, most adolescents with COCC do well across many domains. The Positive Youth Development (PYD) perspective provides a framework for examining thriving in youth and has been useful in understanding positive outcomes for general populations of youth as well as at-risk youth. This study aimed to compare levels of PYD assets between youth with COCC and youth without illness. Participants with COCC were recruited from specialty pediatric clinics while healthy participants were recruited from a large pediatric primary care practice. Inclusion criteria for participants included being (1) English speaking, (2) no documented intellectual disability in electronic medical record, and (3) aged between 13 and 18 years during the recruitment period. Univariate and bivariate analyses on key variables were conducted for adolescents with and without COCC. Finally, we performed multivariable linear regressions for PYD and its subdomains. There were no significant differences between overall PYD or any of the subdomains between the two groups. Multivariable linear regression models showed no statistically significant relationship between chronic condition status and PYD or the subdomains. The findings from this study support the application of the PYD perspective to this population of youth. The results of this study suggest that approaches shown to benefit healthy youth, could be used to promote positive outcomes for youth with COCC. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
The Clifton Youth StrengthsExplorer Assessment: Identifying the Talents of Today's Youth
ERIC Educational Resources Information Center
Educational Horizons, 2006
2006-01-01
The aim of many educators is to help youth reach their maximum potential. The Clifton Youth StrengthsExplorer gives teachers a tool to help identify the talents of their students, as well as actionable suggestions for utilizing those talents. Such information can help teachers to individualize the ways in which they respond to youths, and the…
A longitudinal study of youth assets, neighborhood conditions, and youth sexual behaviors.
Oman, Roy F; Vesely, Sara K; Aspy, Cheryl B; Tolma, Eleni L; Gavin, Lorrie; Bensyl, Diana M; Mueller, Trisha; Fluhr, Janene D
2013-06-01
To prospectively determine whether individual, family, and community assets help youth to delay initiation of sexual intercourse (ISI); and for youth who do initiate intercourse, to use birth control and avoid pregnancy. The potential influence of neighborhood conditions was also investigated. The Youth Asset Study was a 4-year longitudinal study involving 1,089 youth (mean age = 14.2 years, standard deviation = 1.6; 53% female; 40% white, 28% Hispanic, 23% African American, 9% other race) and their parents. Participants were living in randomly selected census tracts. We accomplished recruitment via door-to-door canvassing. We interviewed one youth and one parent from each household annually. We assessed 17 youth assets (e.g., responsible choices, family communication) believed to influence behavior at multiple levels via in-person interviews methodology. Trained raters who conducted annual windshield tours assessed neighborhood conditions. Cox proportional hazard or marginal logistic regression modeling indicated that 11 assets (e.g., family communication, school connectedness) were significantly associated with reduced risk for ISI; seven assets (e.g., educational aspirations for the future, responsible choices) were significantly associated with increased use of birth control at last sex; and 10 assets (e.g., family communication, school connectedness) were significantly associated with reduced risk for pregnancy. Total asset score was significantly associated with all three outcomes. Positive neighborhood conditions were significantly associated with increased birth control use, but not with ISI or pregnancy. Programming to strengthen youth assets may be a promising strategy for reducing youth sexual risk behaviors. Copyright © 2013 Society for Adolescent Health and Medicine. All rights reserved.
Expanding the Reach of Youth Mentoring: Partnering with Youth for Personal Growth and Social Change
ERIC Educational Resources Information Center
Liang, Belle; Spencer, Renee; West, Jennifer; Rappaport, Nancy
2013-01-01
The goals of youth mentoring have broadened from redressing youth problems to promoting positive youth development. Yet, many of the principles associated with contemporary conceptualizations of development found in the positive youth development (PYD) and community psychology (CP) literature have yet to be fully integrated into mentoring research…
ERIC Educational Resources Information Center
Freeman, Richard B.; And Others
This collection of papers on the youth employment problem consists of 15 papers that cover the dimensions, causes, and consequences of youth unemployment and that also focus on problems in measuring the extent of the problem, the dynamic aspects of youth labor force participation, and problems associated with adequately assessing the consequences…
ERIC Educational Resources Information Center
Siqueira, Lorena; Crandall, Lee A.
2006-01-01
Purpose: To determine (1) the prevalence of use, (2) risk and protective factors for use of inhalants in Florida youth. Methods: The Florida Youth Substance Abuse Survey 2004 is a comprehensive assessment of youth substance abuse attitudes and practices obtained by sampling youth from sixty-five counties. Results: The sample consisted of 60,345…
Indian Youth Leadership Development Program.
ERIC Educational Resources Information Center
Hall, McClellan
The Indian Youth Leadership Program and the Indian Youth Leadership Camp (IYLC) were created in 1981 in response to the need to develop specific skills in Indian youth who will assume leadership positions in the future at the family, school, community, tribal, and national level. Patterned after the National Youth Leadership Camp, the IYLC emerged…
Summer Youth Forestry Institute
ERIC Educational Resources Information Center
Roesch, Gabrielle E.; Neuffer, Tamara; Zobrist, Kevin
2013-01-01
The Summer Youth Forestry Institute (SYFI) was developed to inspire youth through experiential learning opportunities and early work experience in the field of natural resources. Declining enrollments in forestry and other natural resource careers has made it necessary to actively engage youth and provide them with exposure to careers in these…
Breda, Carolyn S; Riemer, Manuel
2012-03-01
Treatment motivation can be important for treatment adherence and outcomes, yet few measures of motivation are available for youths in mental health settings. These authors describe the psychometric properties of the motivation for youth's treatment scale (MYTS), an 8-item measure with forms for youths and caregivers that assesses their problem recognition and treatment readiness. Results indicate that the MYTS offers practitioners and researchers a brief, psychometrically sound tool for assessing treatment motivation of youths and their caregivers. Multivariate analyses of clinical and non-clinical characteristics of youths and caregivers show that youths' symptom severity consistently predicts treatment motivation for both groups. However, the strain of caring for the youth adds significantly to caregivers' recognition of the youth's troubles. While caregiver and youth motivations correlate, their agreement is low. Caregivers are nearly always more treatment motivated than youths. The authors discuss the implications of their findings for measurement, treatment planning, and future research.
ERIC Educational Resources Information Center
Miner, Jennifer; Elshof, Leo; Redden, Anna; Terry, John
2004-01-01
The Gulf of Maine Institute (GOMI) is striving to empower youth to take on stewardship roles in their communities. Through its Community Based Initiative (CBI) program, GOMI addresses environmental degradation by working with teams of students, teachers, and community members from around the Gulf of Maine to inspire youth to be stewards of the…
Youth empowerment solutions for violence prevention.
Reischl, Thomas M; Zimmerman, Marc A; Morrel-Samuels, Susan; Franzen, Susan P; Faulk, Monique; Eisman, Andria B; Roberts, Everett
2011-12-01
The limited success of youth violence prevention interventions suggests that effective prevention needs to address causes at multiple levels of analysis and empower youth in developing and implementing prevention programs. In this article, we review published studies of youth violence prevention efforts that engage youth in developing or implementing violence prevention activities. The reviewed studies suggest the promise of youth empowerment strategies and the need for systematic outcome studies of empowerment programs. After reviewing empowerment theory applied to youth violence prevention programs, we present a case study of the Youth Empowerment Solutions (YES) for Peaceful Communities program. YES engages middle-school youth in an after-school and summer program that includes a culturally tailored character development curriculum and empowers the youth to plan and implement community improvement projects with assistance from adult neighborhood advocates. The case study focuses on outcome evaluation results and presents evidence of the YES program effects on community-level outcomes (eg, property improvements, violent crime incidents) and on individual-level outcomes (eg, conflict avoidance, victimization). The literature review and the case study suggest the promise of engaging and empowering youth to plan and implement youth violence prevention programs.
Progress towards mapping the constitutional t(11:22) breakpoint
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barnoski, B.L.; Emanuel, B.S.; Bell, C.J.
1994-09-01
The reciprocal t(11;22)(q23;q11) is the most frequent, recurrent, non-Robertsonian, constitutional translocation in humans. Balanced carriers of this rearrangement are phenotypically normal, but are at risk for producing abnormal offspring with the Supernumerary der(22)t(11;22) Syndrome. Further, a recent report of association between t(11;22) balanced translocation carriers and breast cancer, suggests the involvement of genes on 11q and/or 22q in breast cancer tumorigenesis. Studies are in progress to examine the similarity between 11q23 and 22q11 breakpoints in multiple families with the constitutional t(11;22). A 750 kb YAC, which contains markers known to flank the 11q23 breakpoint, was identified in CEPH/Genethon database. FISHmore » with this YAC to two independent t(11;22) cell lines demonstrates signal on both derivative chromosomes. Numerous YACs containing BCRL2, the closest marker proximal to the breakpoint, were identified. Analysis of these YACs to determine which contain the actual breakpoint sequences is complicated by the presence of a duplicated segment of 22q11 which contains a GGTL and a BCRL locus. Sequences homologous to these loci are present at several other locations in 22q11. The BCRL positive YACs were analyzed by Southern hybridization under conditions which distinguish the four members of the BCR/BCRL family. FISH of total yeast DNA plus YAC DNA labeled by nick translation, or biotin-labeled inter-Alu PCR products confirmed the localization of these YACs to 22q11. Additional FISH with these YACS to metaphase spreads prepared from balanced t(11;22) carriers confirm that these clones span the breakpoint, and will allow rapid isolation and definition of the genetic region adjacent to the t(11;22) breakpoint.« less
ERIC Educational Resources Information Center
Reid, Joan A.; Sullivan, Christopher J.
2016-01-01
Using latent class analysis (LCA), this study identified a dyadic taxonomy of delinquent youth categorized by varying types of maternal-youth reporting discrepancies (i.e., youth < maternal, youth > maternal) within a sample of 764 14-year-old high-risk youth. Four distinctive subgroups of youth were identified, two of which reported more…
Zimmerman, Gregory M
2014-09-01
Survey data for studying youth's secondary exposure to community violence (i.e., witnessing or hearing violence in the community) come from both parents and their children. There are benefits of considering multiple informants in psychosocial assessments, but parents and youths often disagree about comparable information. These reporting differences present challenges for both researchers and clinicians. To shed new light on the individual, family, and neighborhood factors that contribute to parent and youth reporting differences regarding youth's secondary exposure to community violence, this study analyzed hierarchical item response models on a sample of youth respondents from the Project on Human Development in Chicago Neighborhoods. Participants were aged approximately 9, 12, and 15 years (trimodal distribution; mean age = 12.0 years) at baseline (N = 2,344; 49.6% female). Descriptive analyses indicated that parents significantly underestimated their children's exposure to community violence. Logistic hierarchical item response models indicated that absolute discrepancies between parent and youth reports were a function of youth demographic characteristics (male, Hispanic or African American as compared to white, age, 3rd as compared to 1st generation immigrant), individual difference factors (lower levels of self-control, higher levels of violent peer exposure), and family factors (lower household socioeconomic status). Parental under-reporting of youth's exposure to violence was associated with youth demographic characteristics (male, age, 2nd as compared to 3rd generation immigrant), family factors (lower levels of parental supervision), and neighborhood characteristics (higher levels of violence, less access to youth services). The results suggest that a constellation of individual and contextual factors may contribute to the understanding of parent and youth reporting differences. The findings speak to the utility of examining parent and youth reporting
Suitable Enemies? Governmentality of Youth: Youth as a Threat
ERIC Educational Resources Information Center
Ostrowicka, Helena
2012-01-01
This article is a contribution to the discourse of politics towards (for) youth, which the author defines as the "cultural politics of risk". The article begins with scientific representations of youth as a threat, as a group inclined to engage in risky behaviours. It then focuses on theoretical approaches called the "risk…
ERIC Educational Resources Information Center
2002
A study surveyed 241 high-achieving youth aged 15-25 regarding how innovation can be made sustainable among youth in Canada. Results were insightful and pointed to actionable steps for the Youth Action Council for Sustainable Innovation and the federal government. Findings indicated the following: youth can be more innovative if they have the…
Shaping the Future of American Youth: Youth Policy in the 21st Century.
ERIC Educational Resources Information Center
Lewis, Anne, Ed.
This volume contains 14 essays and commentaries on youth development penned by educators, policymakers, and leaders of youth development organizations. The papers, written to commemorate 10 years of American Youth Policy Forum's service, were originally presented at a forum in Washington, D.C., in January 2003. Following are the papers: "Genesis…
Padon, Alisa A; Rimal, Rajiv N; DeJong, William; Siegel, Michael; Jernigan, David
2018-02-01
Underage drinking is a serious public health problem in the United States, and youth exposure to alcohol advertising has been indicated as a possible contributing factor. Although a number of studies have identified advertising content features that youth find appealing, a key limitation of this research is the absence of a broader tool to examine those features, especially those used by alcohol brands that are popular with underage drinkers. We created an index of content elements found in the research literature to be appealing to youth, and then used this index in a content analysis to identify the degree to which youth-appealing content appeared in a sample of alcohol ads that aired on television shows popular among youth. Finally, using bivariate analysis, we tested the relationship between alcohol brands' use of this content and the popularity of those brands among youth. We found that many of the ads featured youth-appealing content, and that the ads for the alcohol brands most popular among youth had more youth-appealing content than the less popular brands.
Elton-Marshall, Tara; Leatherdale, Scott T.; Burkhalter, Robin
2011-01-01
Background Despite the high prevalence of smoking among Aboriginal youth, there is a paucity of research related to tobacco use and other risk behaviours among Aboriginal youth living off-reserve in Canada. We used data from the national Youth Smoking Survey to characterize non-traditional tobacco use, exposure to second-hand smoke, and alcohol and drug use among Aboriginal youth living off-reserve. We examined whether these youth were at increased health risk compared with non-Aboriginal youth. Methods We examined cigarette smoking behaviour, use of other tobacco products, use of alcohol and other drugs, and exposure to second-hand smoke among 2620 Aboriginal youth living off-reserve and 26 223 non-Aboriginal youth in grades 9 to 12 who participated in the 2008/09 Youth Smoking Survey. Results The prevalence of current smoking among the Aboriginal youth was more than double that among non-Aboriginal youth (24.9% v. 10.4%). Aboriginal youth also had a higher prevalence of regular exposure to second-hand smoke at home (37.3% v. 19.7%) and in cars (51.0% v. 30.3%). Aboriginal youth were more likely than non-Aboriginal youth to be current smokers, to be regularly exposed to second-hand smoke, to have tried marijuana and other illicit drugs, and to engage in binge drinking. They were less likely than non-Aboriginal youth to have tried to quit smoking. Interpretation Current national estimates of smoking, and alcohol and illicit drug use among youth underestimate the prevalence of these behaviours among Aboriginal youth living off-reserve. Our findings highlight the need for culturally appropriate prevention and cessation policies and programs for this at-risk population. PMID:21555383
Elton-Marshall, Tara; Leatherdale, Scott T; Burkhalter, Robin
2011-05-17
Despite the high prevalence of smoking among Aboriginal youth, there is a paucity of research related to tobacco use and other risk behaviours among Aboriginal youth living off-reserve in Canada. We used data from the national Youth Smoking Survey to characterize non-traditional tobacco use, exposure to second-hand smoke, and alcohol and drug use among Aboriginal youth living off-reserve. We examined whether these youth were at increased health risk compared with non-Aboriginal youth. We examined cigarette smoking behaviour, use of other tobacco products, use of alcohol and other drugs, and exposure to second-hand smoke among 2620 Aboriginal youth living off-reserve and 26,223 non-Aboriginal youth in grades 9 to 12 who participated in the 2008/09 Youth Smoking Survey. The prevalence of current smoking among the Aboriginal youth was more than double that among non-Aboriginal youth (24.9% v. 10.4%). Aboriginal youth also had a higher prevalence of regular exposure to second-hand smoke at home (37.3% v. 19.7%) and in cars (51.0% v. 30.3%). Aboriginal youth were more likely than non-Aboriginal youth to be current smokers, to be regularly exposed to second-hand smoke, to have tried marijuana and other illicit drugs, and to engage in binge drinking. They were less likely than non-Aboriginal youth to have tried to quit smoking. Current national estimates of smoking, and alcohol and illicit drug use among youth underestimate the prevalence of these behaviours among Aboriginal youth living off-reserve. Our findings highlight the need for culturally appropriate prevention and cessation policies and programs for this at-risk population.
Rigotti, N A
1999-01-01
To start smoking, young people need a supply of tobacco products. Reducing youth access to tobacco is a new approach to preventing tobacco use that has been a focus of federal, state, and local tobacco control efforts over the past decade. All 50 states ban tobacco sales to minors, but compliance is poor because laws are not enforced. Consequently, young people have little trouble obtaining tobacco products. Commercial sources of tobacco (stores and vending machines) are important for underage smokers, who often purchase their own cigarettes. Underage youths also obtain tobacco from noncommercial sources such as friends, relatives, older adolescents, and adults. Educating retailers about tobacco sales laws has not produced long-term improvement in their compliance. Active enforcement of tobacco sales laws changes retailer behavior, but whether this reduces young people's access to tobacco or their tobacco use is not clear. The effectiveness of new local, state, and federal actions that aim to reduce youth access to tobacco remains to be determined. Can enforcing tobacco sales laws reduce young people's access to tobacco? If so, will this prevent or delay the onset of their tobacco use? How will youths' sources of tobacco change as commercial sources are restricted? What are the social (noncommercial) sources of tobacco for minors and how can youths' access to tobacco from these sources be reduced? What is the impact of the new federal policies aimed at reducing youth access to tobacco? Do new state and local laws that ban youth possession or use of tobacco have a net positive or negative impact on youth attitudes, access to tobacco, or tobacco use? What is the relative effectiveness and cost-effectiveness of efforts to reduce the supply of tobacco compared to those that aim to reduce demand for tobacco? Will either work alone or are both necessary to achieve reductions in youth smoking?
"Embedded" Youth Work: Ethical Questions for Youth Work Professionals
ERIC Educational Resources Information Center
Sercombe, Howard
2007-01-01
Most professions have wrestled with the problem of dual relationships, and the profession of youth work is no exception. Howard Sercombe holds that in order to understand how dual relationships can be avoided within youth work, it is necessary to be clear about what is involved in professional relationships. Sercombe also outlines policies that…
Youth Court: A Community Solution for Embracing At-Risk Youth. A National Update
ERIC Educational Resources Information Center
Pearson, Sarah S.; Jurich, Sonia
2005-01-01
Youth court, also called teen court, peer jury, or student court, is an alternative to the traditional juvenile justice system and school disciplinary proceedings that empower youth and communities to take an active role in addressing the early stages of youth delinquency. The program provides communities with an opportunity to ensure immediate…
ERIC Educational Resources Information Center
Calvert, Matthew; de Montmollin, John; Winnett, Tedi
2015-01-01
The Kenosha County Youth in Governance program was created to build leadership skills and civic engagement opportunities for high school-aged students by placing two youth representatives on each of the Kenosha County Board of Supervisors standing committees. In reviewing data from 3 years of youth participants, the program was effective in…
Wegman, D H; Davis, L K
1999-11-01
The National Research Council's report "Protecting Youth at Work" addresses the health and safety consequences of work by youth in the United States. The report finds that a higher proportion of U.S. youth work than in any other developed nation and that as much as 80% of youth will have worked during their high school years. The majority of adolescents are employed in the retail and service sectors. Positive aspects of this work include lessons in responsibility, punctuality, dealing with people, good money management, and gaining self-esteem, independence and new skills. On the negative side, however, students who work long hours are less likely to advance as far in school as other students, are more likely to smoke cigarettes and use illegal drugs, be involved in other deviant behavior, may get insufficient sleep and exercise, and may spend less time with their family. Working youth appear to have injury rates (4.9 per 100 FTE) almost twice that of adult workers (2.8 per 100 FTE). There is evidence that each year over 200,000 youth experience work injuries and at least 70 die. The report includes an extensive list of recommendations to safeguard the health and well-being of young workers: improved government regulations as well as their enforcement, better data collection and analysis to provide essential information on the distribution and consequences of youth employment, education of key actors such as employers, parents, teachers and the youth themselves, and research to fill critical knowledge gaps. Copyright 1999 Wiley-Liss, Inc.
Electronic case management with homeless youth.
Bender, Kimberly; Schau, Nicholas; Begun, Stephanie; Haffejee, Badiah; Barman-Adhikari, Anamika; Hathaway, Jessica
2015-06-01
Case management, a widely practiced form of service brokerage, is associated with a variety of positive outcomes for homeless youth, but it may be difficult to implement, as youth face logistical barriers to attending in-person meetings. As part of a larger clinical trial, the current study investigates the feasibility of providing electronic case management (ECM) to homeless youth, using cell-phones, texts, email, and Facebook. Youth were given prepaid cell-phones and a case manager who provided four ECM sessions every 2-3 weeks over a 3-month period. Contact logs were used to record how many youth engaged in ECM, how many attempts were necessary to elicit engagement, and youths' preferred technology methods for engaging. Although engagement in the number of ECM sessions varied, the majority of youth (87.5%) engaged in at least one ECM session. Youth (41%) most commonly needed one contact before they engaged in an ECM session, and the majority responded by the third attempt. While youth most commonly answered calls directly, their chosen method of returning calls was texting. The majority of youth (80%) described ECM positively, reporting themes of convenience, connection, and accountability. The use of ECM, particularly of texting, offers promising implications for providing services to homeless youth. Copyright © 2015 Elsevier Ltd. All rights reserved.
Characteristics of sports-based youth development programs.
Perkins, Daniel F; Noam, Gil G
2007-01-01
The term "sports-based youth development programs" is coined and defined in the context of the community youth development framework. Sports-based youth development programs are out-of-school-time programs that use a particular sport to facilitate learning and life skill development in youth. Community youth development programs use a community youth development approach to create opportunities for youth to connect to others, develop skills, and use those skills to contribute to their communities. This, in turn, increases their ability to succeed. The authors describe how sports-based youth development programs can be contexts that promote positive youth development. The features of positive developmental settings for youth from the work of the National Research Council and the Institute of Medicine, as well as the features identified by other researchers, are presented in the context of sports-based youth development programs. For example, a sports program that provides appropriate structure has delineated clear rules, expectations, and responsibilities for youth, parents, coaches, officials, and other organizers.
Lewis, Terri; Thompson, Richard; Kotch, Jonathan B; Proctor, Laura J; Litrownik, Alan J; English, Diana J; Runyan, Desmond K; Wiley, Tisha R A; Dubowitz, Howard
2012-01-01
Studies have consistently demonstrated a lack of agreement between youth and parent reports regarding youth-witnessed violence. However, little is known about whether disagreement is associated with poorer outcomes and less utilization of mental health services. The purpose of the current study was to examine disagreement among youth and parents about youth witnessed violence, and determine whether concordance predicted trauma symptoms and recognition of need and receipt of counseling services. Concordance about youth-witnessed violence was examined in 766 dyads from the Longitudinal Studies of Child Abuse and Neglect (LONGSCAN). Youth participants self-reported trauma symptoms, caregivers indicated youth need for and receipt of services. Both youth and parents provided information about youth-witnessed violence exposure in the last year. Results showed youth and caregivers differed significantly about youth-witnessed violence. Specifically, 42% of youth reported youth-witnessed violence, compared to only 15% of parents. For those parents who reported youth-witnessed violence, only 29% reported an identified need for services and only 17% reported the youth had received any mental health services. Concordance between parent-youth dyads was associated with greater identified need for services but was not associated with the use of counseling services or trauma symptoms. Youth who reported witnessing violence reported more frequent trauma symptoms regardless of concordance. Parents from dyads in which both informants reported youth-witnessed violence were more likely to endorse need for, but not receipt of counseling services. Given this association between youth-witnessed violence and mental health problems, more work is needed to identify barriers to concordance as well as service utilization. Copyright © 2012 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
LaVergne, Douglas D.
2013-01-01
The study reported here sought to examine the perceptions of 4-H youth professionals towards diversity inclusion in 4-H youth programs. A majority of professionals positively reported that there are benefits for youth of color and youth with disabilities in 4-H youth programs. Respondents indicated that the lack of information about 4-H youth…
Cumulative environmental risk and youth maladjustment: the role of youth attributes.
Gerard, Jean M; Buehler, Cheryl
2004-01-01
Using data from 5,070 youth ages 11 to 18 years old who participated in the National Longitudinal Study of Adolescent Health, concurrent and longitudinal associations among cumulative risk, protective factors, and youth maladjustment were examined. Cumulative risk was associated with concurrent conduct problems and depressed mood. For conduct problems, a compensatory effect was found for scholastic achievement and problem-solving ability. For depressed mood, a compensatory effect was found for scholastic achievement. A protective-reactive effect of self-esteem was found for both forms of maladjustment. Youth gender, grade, and ethnicity moderated these associations. Cumulative risk predicted change over time in depressed mood. Scholastic achievement and self-esteem compensated for this risk. Findings indicate that youth attributes offer limited protection when adolescents experience risk factors across life domains.
The Washington, DC, Youth Curfew: effect on transports of injured youth and homicides.
Moscovitz, H; Milzman, D; Haywood, Y
2000-01-01
Curfews are implemented to curtail youth violence. Trauma systems and emergency medical services (EMS) may need to prepare for changes in patient volume resulting from local ordinances. This study evaluated the impact of the 1995 Washington, DC, Juvenile Curfew Act on EMS transports of injured youth and on youth homicides. A retrospective, comparative cohort study was performed. Transports of injured youth and youth homicides were counted in corresponding months of 1994 and 1995. Cohorts were formed by year, time of day, age group, and mechanism of injury. Year-to-year statistical comparisons of injury proportions were performed using the chi square and Fisher's exact tests. One thousand forty-eight transports were included. No significant difference was observed in transports with curfew implementation. Most assaults on youth occurred outside the curfew time. No effect of the curfew on homicides was detected. Of 67 homicides, only two victims were under the curfew. No effect of the curfew on transports for injuries or on homicides was demonstrated. The curfew was not in effect during the period of highest risk.
Ladjali, M
1995-01-01
More than 100 young people from 56 countries voiced their needs and concerns in a Youth Consultation held just before the International Conference on Population and Development (ICPD), August 31 to September 4, 1994. Many journalists from the international press followed the consultation and interviewed the youths, with a short film even produced on the proceedings. After discussing the main topics of the ICPD, participants produced a Youth Declaration with recommendations for action and conclusions for partnership. More than 20 participants remained in Cairo to present consultation conclusions in well-attended workshops and role play at the ICPD NGO Forum. One representative presented the Youth Declaration in ICPD plenary session. These young men and women from all regions of the world, from a diversity of cultural, religious, and political backgrounds found common ground on the need for population concerns to be explicitly and consistently integrated with development in the context of a just and equitable international economic system; a strong focus upon youth education and mobilization in the areas of adolescent health, sexual and reproductive health, the environment, human rights, and political and economic systems; and the sense that now is the time to act at the individual, organizational, national, and national levels. Education and safe sexual behavior do not encourage promiscuity. On the contrary, they promote and enhance healthy, responsible relationships, minimizing the incidence of unplanned pregnancies and sexually transmitted infections when sex does take place. Participants recommend promoting peer education; involving and educating peers through artistic activities such as music and drama; implementing peer counseling and raising awareness through one-on-one interaction, group discussions, printed media, and radio programs; organizing services for youths in a variety of settings; creating jobs for youths in cooperatives and businesses; educating
ERIC Educational Resources Information Center
Walker, Kathrin C.; Saito, Rebecca N.
2011-01-01
Research demonstrates that involvement in high-quality youth programs benefits young people personally, socially, and academically. Yet many families--particularly low-income and minority families--are unsatisfied with the quality, affordability, and availability of options in their communities. Participation rates are especially low for youth who…
Wenzel, Suzanne L; Hsu, Hsun-Ta; Zhou, Annie; Tucker, Joan S
2012-11-01
Understanding factors associated with heavy drinking among homeless youth is important for prevention efforts. Social networks are associated with drinking among homeless youth, and studies have called for attention to racial differences in networks that may affect drinking behavior. This study investigates differences in network characteristics by the racial background of homeless youth, and associations of network characteristics with heavy drinking. (Heavy drinking was defined as having five or more drinks of alcohol in a row within a couple of hours on at least one day within the past 30 days.) A probability sample of 235 Black and White homeless youths ages 13-24 were interviewed in Los Angeles County. We used chi-square or one-way analysis of variance tests to examine network differences by race and logistic regressions to identify network correlates of heavy drinking among Black and White homeless youth. The networks of Black youth included significantly more relatives and students who attend school regularly, whereas the networks of White youth were more likely to include homeless persons, relatives who drink to intoxication, and peers who drink to intoxication. Having peers who drink heavily was significantly associated with heavy drinking only among White youth. For all homeless youth, having more students in the network who regularly attend school was associated with less risk of heavy drinking. This study is the first to our knowledge to investigate racial differences in network characteristics and associations of network characteristics with heavy drinking among homeless youth. White homeless youth may benefit from interventions that reduce their ties with peers who drink. Enhancing ties to school-involved peers may be a promising intervention focus for both Black and White homeless youth.
Global Youth Voices: engaging Bedouin youth in health promotion in the Middle East.
Bader, Russell; Wanono, Revital; Hamden, Sami; Skinner, Harvey A
2007-01-01
This study evaluated the six-phase Global Youth Voices model (EIPARS) for engaging youth in community health promotion in the Middle East: 1) engagement, 2) issue identification, 3) planning, 4) action, 5) Rs; research, reflect, reward and 6) sustainability. 20 Grade 9 students (10 boys, 10 girls) from two Bedouin communities: 10 from Tuba-Zangaria in North Israel; 10 from Segev Shalom in the Negev--South Israel. Using low-end (photo-voice, photography) and high-end internet-based technology, youth identified and documented the strengths and weaknesses of their communities, and then undertook a community action project focusing on one important issue. Workbooks including process guides and tools for each step of the EIPARS model are available online at: http://www.globalyouthvoices.org/resources.html. Similar issues were identified in each community: e.g., smoking, injuries, friendships, Bedouin culture. Unique issues identified were suicide at Tuba and industrial pollution at Segev Shalom. Students at Tuba selected Suicide Prevention for a community project and prepared a PowerPoint presentation for educating their peers, teachers and parents. Youth from Segev Shalom created a video and photo exhibit on Violence Prevention. Photo-essays and their action projects were uploaded to the Global Youth Voices website for virtual discussion and sharing with youth globally (www.globalyouthvoices.org/middle-east/greetings-en.html). This project demonstrated that the EIPARS model can be used successfully for engaging youth and creating youth-driven community action in the Middle East. This public health intervention provides a positive approach for building cooperation in conflicted regions.
Diemer, Matthew A
2012-09-01
This study examines the roles of parental political socialization and the moral commitment to change social inequalities in predicting marginalized youths' (defined here as lower-SES youth of color) political participation. These issues are examined by applying structural equation modeling to a longitudinal panel of youth. Because tests of measurement invariance suggested racial/ethnic heterogeneity, the structural model was fit separately for three racial/ethnic groups. For each group, parental political socialization: discussion predicted youths' commitment to produce social change and for two groups, longitudinally predicted political participation. This study contributes to the literature by examining civic/political participation among disparate racial/ethnic groups, addresses an open scholarly question (whether youths' commitment to create social change predicts their "traditional" participation), and emphasizes parents' role in fostering marginalized youths' civic and political participation.
Becoming a Gang Member: Youth Life and Gang Youth
ERIC Educational Resources Information Center
Morch, Sven; Andersen, Helle
2012-01-01
The purpose of this paper is to develop a framework for understanding the growth in youth gangs and gang behaviour. The paper builds on a youth theory perspective and describes how the social conditions work with or are against the young individual in such a way that gangs seem to be an option or an answer for some young people when faced with…
Koh, Li Lian; Zeng, Gerald; Teoh, Jennifer
2015-01-01
There has been an increased focus on understanding youth sexual offending in recent years, but there has been limited empirical research on the causes, pathways, and treatment of youth who have sexually offended—especially within a non-Western context. The Good Lives and Self-Regulation Models have often been used to understand and rehabilitate adult sexual offenders, but (unfortunately) there is scant research on youth who sexually offended using these models. The present study aims to describe the different primary goods that are associated with youth sexual offending behaviors in an Asian context. In addition, the study sought to explore whether the age of victim (child vs. nonchild) and nature of sexual offense (penetrative vs. nonpenetrative) influenced the youth’s engagement in offense pathways. The results suggest that pleasure, relatedness, and inner peace were the primary human goods that were most sought after by a sample of 168 youth who sexually offended in Singapore. In addition, offender classification (in relation to the age of victim and nature of sexual offense) influenced the pathways to sexual offending. Therefore, these findings have important clinical implications for assessment, management, and intervention planning for youth who sexually offended. PMID:24048701
Wasserman, Camilla; Postuvan, Vita; Herta, Dana; Iosue, Miriam; Värnik, Peeter; Carli, Vladimir
2018-01-01
The Youth Aware of Mental health (YAM) experience Youth stand at the core of much mental health promotion, yet little is written about their experiences of such efforts. We aimed to take this on by interviewing youth after they participated in Youth Aware of Mental Health (YAM), a universal mental health promotion program. YAM has a non-anticipatory methodology that provides youth with a safe space for reflection, role-play, and discussion. Addressing everyday mental health, YAM invites the experiences and issues relevant to the youth present to influence the program in a slightly different direction every time. The YAM instructor guides the participants but does not present the youth with given formulas on how to solve their problems. Like any mental health promotion, YAM appeals to some more than others in its intended audience and individuals engage with the program in many different ways. We set out to learn more about these experiences. Conversations about mental health Thirty-two semi-structured interviews were conducted with 15–17 year olds in Estonia, Italy, Romania and Spain. In these interviews, the researchers made an effort to discuss mental health in terms relevant to youth. Still, wide-ranging levels of motivation, ease with engaging in dialogue with mental health professionals, and comfort with the format and content of YAM were detected. The youth were clustered in five different groups relating to their positioning vis-à-vis the researcher during the interview. The following evocative labels were used: “interested”, “foot in the door”, “respect for authority”, “careful”, and “not my topic”. Corresponding labels were devised for their YAM experience: “engaged”, “initially hesitant”, “cautious”, “eager to please”, or “disengaged”. We also observed that the researchers brought their own expectations and employed a variety of approaches that led to anticipating answers, stating the obvious, or getting along
Wenzel, Suzanne L.; Hsu, Hsun-Ta; Zhou, Annie; Tucker, Joan S.
2012-01-01
Objective: Understanding factors associated with heavy drinking among homeless youth is important for prevention efforts. Social networks are associated with drinking among homeless youth, and studies have called for attention to racial differences in networks that may affect drinking behavior. This study investigates differences in network characteristics by the racial background of homeless youth, and associations of network characteristics with heavy drinking. (Heavy drinking was defined as having five or more drinks of alcohol in a row within a couple of hours on at least one day within the past 30 days.) Method: A probability sample of 235 Black and White homeless youths ages 13–24 were interviewed in Los Angeles County. We used chi-square or one-way analysis of variance tests to examine network differences by race and logistic regressions to identify network correlates of heavy drinking among Black and White homeless youth. Results: The networks of Black youth included significantly more relatives and students who attend school regularly, whereas the networks of White youth were more likely to include homeless persons, relatives who drink to intoxication, and peers who drink to intoxication. Having peers who drink heavily was significantly associated with heavy drinking only among White youth. For all homeless youth, having more students in the network who regularly attend school was associated with less risk of heavy drinking. Conclusions: This study is the first to our knowledge to investigate racial differences in network characteristics and associations of network characteristics with heavy drinking among homeless youth. White homeless youth may benefit from interventions that reduce their ties with peers who drink. Enhancing ties to school-involved peers may be a promising intervention focus for both Black and White homeless youth. PMID:23036205
ERIC Educational Resources Information Center
Tolma, Eleni L.; Oman, Roy F.; Vesely, Sara K.; Aspy, Cheryl B.; Boeckman, Lindsay
2013-01-01
The purpose of this study is to assess the relationship between youth assets and neighborhood environmental variables and future no-tobacco use among youth; examining differences by gender. Five waves of annual data were collected from 1,111 youth randomly selected to participate in the Youth Asset Study (YAS). A marginal logistic regression model…
Youth Sport Programs: An Avenue to Foster Positive Youth Development
ERIC Educational Resources Information Center
Fraser-Thomas, Jessica L.; Cote, Jean; Deakin, Janice
2005-01-01
Concern about the growth in adolescent problem behaviours (e.g. delinquency, drug use) has led to increased interest in positive youth development, and a surge in funding for "after school programs." We evaluate the potential of youth sport programs to foster positive development, while decreasing the risk of problem behaviours.…
The Distinctive Difficulties of Disagreeable Youth
ERIC Educational Resources Information Center
Laursen, Brett; Hafen, Christopher A.; Rubin, Kenneth H.; Booth-LaForce, Cathryn; Rose-Krasnor, Linda
2010-01-01
This study examines whether disagreeable youth are distinct from aggressive youth, victimized youth, and withdrawn youth. Young adolescents (120 girls and 104 boys, M = 13.59 years old) completed personality and adjustment inventories. Aggression, withdrawal, and victimization scores were derived from peer nominations (N = 807). Cluster analyses…
Promoting Positive Youth Development: The Miami Youth Development Project (YDP)
ERIC Educational Resources Information Center
Kurtines, William M.; Ferrer-Wreder, Laura; Berman, Steven L.; Lorente, Carolyn Cass; Briones, Ervin; Montgomery, Marilyn J.; Albrecht, Richard; Garcia, Arlen J.; Arrufat, Ondina
2008-01-01
The Miami Youth Development Project (YDP) had its beginnings in the early 1990s as a grassroots response to the needs of troubled (multiproblem) young people in the community (Arnett, Kurtines, & Montgomery, 2008, this issue). YDP is an important outcome of efforts to create positive youth development interventions that draw on the strengths…
The Voice of Youth: Atmosphere in Positive Youth Development Program
ERIC Educational Resources Information Center
Ward, Stefan; Parker, Melissa
2013-01-01
Background: Positive youth development (PYD) programs adhere to the notion that all children have strengths and assets to be promoted and nurtured rather than deficits that require "fixing." The study of PYD programs indicates three aspects which set them apart from other programs for youth: activities, goals, and atmosphere. Of these,…
Sideline coverage of youth football.
Rizzone, Katie; Diamond, Alex; Gregory, Andrew
2013-01-01
Youth football is a popular sport in the United States and has been for some time. There are currently more than 3 million participants in youth football leagues according to USA Football. While the number of participants and overall injuries may be higher in other sports, football has a higher rate of injuries. Most youth sporting events do not have medical personnel on the sidelines in event of an injury or emergency. Therefore it is necessary for youth sports coaches to undergo basic medical training in order to effectively act in these situations. In addition, an argument could be made that appropriate medical personnel should be on the sideline for collision sports at all levels, from youth to professional. This article will discuss issues pertinent to sideline coverage of youth football, including coaching education, sideline personnel, emergency action plans, age and size divisions, tackle versus flag football, and injury prevention.
Wasserman, Camilla; Postuvan, Vita; Herta, Dana; Iosue, Miriam; Värnik, Peeter; Carli, Vladimir
2018-01-01
Youth stand at the core of much mental health promotion, yet little is written about their experiences of such efforts. We aimed to take this on by interviewing youth after they participated in Youth Aware of Mental Health (YAM), a universal mental health promotion program. YAM has a non-anticipatory methodology that provides youth with a safe space for reflection, role-play, and discussion. Addressing everyday mental health, YAM invites the experiences and issues relevant to the youth present to influence the program in a slightly different direction every time. The YAM instructor guides the participants but does not present the youth with given formulas on how to solve their problems. Like any mental health promotion, YAM appeals to some more than others in its intended audience and individuals engage with the program in many different ways. We set out to learn more about these experiences. Thirty-two semi-structured interviews were conducted with 15-17 year olds in Estonia, Italy, Romania and Spain. In these interviews, the researchers made an effort to discuss mental health in terms relevant to youth. Still, wide-ranging levels of motivation, ease with engaging in dialogue with mental health professionals, and comfort with the format and content of YAM were detected. The youth were clustered in five different groups relating to their positioning vis-à-vis the researcher during the interview. The following evocative labels were used: "interested", "foot in the door", "respect for authority", "careful", and "not my topic". Corresponding labels were devised for their YAM experience: "engaged", "initially hesitant", "cautious", "eager to please", or "disengaged". We also observed that the researchers brought their own expectations and employed a variety of approaches that led to anticipating answers, stating the obvious, or getting along better with some of the youth. These modes of interaction were categorized under: "favoritism", "familiarity", "frustration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Todd, S.; Bolin, R.; Drabkin, H.A.
1995-01-01
Somatic deletions of chromosome 3p occur at high frequencies in cancers of kidney, breast, cervix, head and neck, nasopharynx, and lung. The frequency of 3p deletion in lung cancer approaches 100% among small cell lesions and 70 to 80% in non-small cell lesions. This evidence strongly implies that one or more tumor suppressor genes of potentially widespread significance reside within the deleted region(s). Precise definition of the deleted target region(s) has been difficult due to the extensive area(s) lost and use of markers with low informativeness. However, improved definition remains essential to permit isolation of putative tumor suppressor genes frommore » 3p. The identification of several small, homozygous 3p deletions in lung cancer cell lines has provided a critical resource that will assist this search. The U2020 cell line contains a small homozygous deletion that maps to a very proximal region of 3p and includes the marker D3S3. We previously identified a subset of DNA markers located within the deleted region and determined their relative order by pulsed-field gel mapping studies. In the present report, we describe the development of YAC contigs that span the majority of the deleted region and link up to flanking markers on both sides. The centromere proximal portion of the contig crosses the breakpoint from an X;3 translocation located within 3p12 providing both location and orientation to the map. PCR-based (CA){sub n} microsatellite polymorphisms have been localized within and flanking the deletion region. These markers should greatly facilitate loss-of-heterozygosity studies of this region in human cancer. The contig provides a direct means for isolation of putative tumor suppressor genes from this segment of 3p. 51 refs., 3 figs., 3 tabs.« less
Parent–Youth Agreement on Self-Reported Competencies of Youth With Depressive and Suicidal Symptoms
Mbekou, Valentin; MacNeil, Sasha; Gignac, Martin; Renaud, Johanne
2015-01-01
Objective: A multi-informant approach is often used in child psychiatry. The Achenbach System of Empirically Based Assessment uses this approach, gathering parent reports on the Child Behaviour Checklist (CBCL) and youth reports on the Youth Self-Report (YSR), which contain scales assessing both the child’s problems and competencies. Agreement between parent and youth perceptions of their competencies on these forms has not been studied to date. Method: Our study examined the parent–youth agreement of competencies on the CBCL and YSR from a sample of 258 parent–youth dyads referred to a specialized outpatient clinic for depressive and suicidal disorders. Intraclass correlation coefficients were calculated for all competency scales (activity, social, and academic), with further examinations based on youth’s sex, age, and type of problem. Results: Weak-to-moderate parent–youth agreements were reported on the activities and social subscales. For the activities subscale, boys’ ratings had a strong correlation with parents’ ratings, while it was weak for girls. Also, agreement on activities and social subscales was stronger for dyads with the youth presenting externalizing instead of internalizing problems. Conclusion: Agreement on competencies between parents and adolescents varied based on competency and adolescent sex, age, and type of problem. PMID:25886673
Who Are Truant Youth? Examining Distinctive Profiles of Truant Youth Using Latent Profile Analysis
ERIC Educational Resources Information Center
Maynard, Brandy R.; Salas-Wright, Christopher P.; Vaughn, Michael G.; Peters, Kristen E.
2012-01-01
The present study explored the heterogeneity of truant youth to provide a more nuanced examination of the nature of adolescent truancy and examine distinct profiles of truant youth as they relate to externalizing behaviors. Latent profile analysis was employed to examine the heterogeneity of truant youth by using a nationally representative sample…
ERIC Educational Resources Information Center
Villaseñor, Elodia; Alcalá, Miguel; Valladares, Ena Suseth; Torres, Miguel A.; Mercado, Vanessa; Gómez, Cynthia A.
2013-01-01
Youth perspectives are routinely absent from research and policy initiatives. This article presents a project that infuses youth participation, training and mentorship into the research process and teaches youth how to become policy advocates. Empower Latino Youth (ELAYO) studies the individual and systemic factors impacting sexuality and…
Nair, Rajni L; Roche, Kathleen M; White, Rebecca M B
2018-01-01
Latino youth have higher rates of educational and mental health difficulties compared to peers from other racial/ethnic groups. To understand the factors related to such maladjustment, a mediational model linking youth report of parent-youth acculturation gaps to prospective changes (from spring to fall semester) in youth report of academic performance, depressive symptoms and alcohol use via youth report of parent-youth conflict and family cohesion, was studied in a sample of 248 U.S.-and foreign-born Latino youth (Mage = 15.21 years; 50% female; 67% U.S.-born). Parent-youth acculturation gaps were associated with changes in youth academic performance across two semesters via their negative impact on family functioning. For U.S.-born youth, parent-youth acculturation gaps were also linked to changes in alcohol use via parent-adolescent conflict. Results provide some support for the acculturative gap hypotheses while unique findings across nativity groups suggest that such individual-level characteristics may serve as important sources of variation for Latino youth.
Frasquilho, Diana; de Matos, Margarida Gaspar; Marques, Adilson; Neville, Fergus G; Gaspar, Tânia; Caldas-de-Almeida, J M
2016-10-01
We investigated, in a sample of 112 unemployed parents of adolescents aged 10-19 years, the links between parental distress and change in youth emotional problems related to parental unemployment, and the moderation roles of parent-youth relationship and financial deprivation. Data were analyzed using descriptive statistics and correlations. Further, simple moderation, additive moderation, and moderated moderation models of regression were performed to analyze the effects of parental distress, parent-youth relationship and financial deprivation in predicting change in youth emotional problems related to parental unemployment. Results show that parental distress moderated by parent-youth relationship predicted levels of change in youth emotional problems related to parental unemployment. This study provides evidence that during job loss, parental distress is linked to youth emotional well-being and that parent-youth relationships play an important moderation role. This raises the importance of further researching parental distress impacts on youth well-being, especially during periods of high unemployment rates.
Youth Count: Exploring How KIDS COUNT Grantees Address Youth Issues
ERIC Educational Resources Information Center
Wilson-Ahlstrom, Alicia; Gaines, Elizabeth; Ferber, Thaddeus; Yohalem, Nicole
2005-01-01
Inspired by the 2004 Kids Count Databook essay, "Moving Youth From Risk to Opportunity," this new report highlights the history of data collection, challenges and innovative strategies of 12 Annie E. Casey Foundation KIDS COUNT grantees in their work to serve the needs of older youth. (Contains 3 figures, 2 tables, and 9 notes.)
Successful Programs for At-Risk Youths.
ERIC Educational Resources Information Center
Everett, Charlie; Chadwell, Jason; McChesney, Jon C.
2002-01-01
Describes five successful, ongoing programs that were designed to change the behavior of at-risk youths, including: Drug Free Youth in Touch; At-Risk Programs Promoting Leisure Education; Youth-in-Action; the Mayor's Night Hoops Program; and Youth Outdoor Adventures. Interviews with program managers pointed to the marketing concept as the most…
Children, Youth, and Gun Violence.
ERIC Educational Resources Information Center
Behrman, Richard E., Ed.
2002-01-01
This collection of articles summarizes knowledge and research about how gun violence affects children and youth and discusses which policies hold promise for reducing youth gun violence. The papers are: (1) "Statement of Purpose" (Richard E. Behrman); "Children, Youth, and Gun Violence: Analysis and Recommendations" (Kathleen…
Construction of human chromosome 21-specific yeast artificial chromosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCormick, M.K.; Shero, J.H.; Hieter, P.A.
1989-12-01
Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to > 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtainedmore » from a mouse-human hybrid, ranging in size from 200 to > 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from {approx} 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.« less
Youth Climate Summits: Empowering & Engaging Youth to Lead on Climate Change
NASA Astrophysics Data System (ADS)
Kretser, J.
2017-12-01
The Wild Center's Youth Climate Summits is a program that engages youth in climate literacy from knowledge and understanding to developing action in their schools and communities. Each Youth Climate Summit is a one to three day event that brings students and teachers together to learn about climate change science, impacts and solutions at a global and local level. Through speakers, workshops and activities, the Summit culminates in a student-driven Climate Action Plan that can be brought back to schools and communities. The summits have been found to be powerful vehicles for inspiration, learning, community engagement and youth leadership development. Climate literacy with a focus on local climate impacts and solutions is a key component of the Youth Climate Summit. The project-based learning surrounding the creation of a unique, student driven, sustainability and Climate Action Plan promotes leadership skills applicable and the tools necessary for a 21st Century workforce. Student driven projects range from school gardens and school energy audits to working with NYS officials to commit to going 100% renewable electricty at the three state-owned downhill ski facilities. The summit model has been scaled and replicated in other communities in New York State, Vermont, Ohio, Michigan and Washington states as well as internationally in Finland, Germany and Sri Lanka.
Effects of the National Youth Anti-Drug Media Campaign on Youths
Jacobsohn, Lela; Orwin, Robert; Piesse, Andrea; Kalton, Graham
2008-01-01
Objectives. We examined the cognitive and behavioral effects of the National Youth Anti-Drug Media Campaign on youths aged 12.5 to 18 years and report core evaluation results. Methods. From September 1999 to June 2004, 3 nationally representative cohorts of US youths aged 9 to 18 years were surveyed at home 4 times. Sample size ranged from 8117 in the first to 5126 in the fourth round (65% first-round response rate, with 86%–93% of still eligible youths interviewed subsequently). Main outcomes were self-reported lifetime, past-year, and past-30-day marijuana use and related cognitions. Results. Most analyses showed no effects from the campaign. At one round, however, more ad exposure predicted less intention to avoid marijuana use (γ = −0.07; 95% confidence interval [CI] = −0.13, −0.01) and weaker antidrug social norms (γ = −0.05; 95% CI = −0.08, −0.02) at the subsequent round. Exposure at round 3 predicted marijuana initiation at round 4 (γ = 0.11; 95% CI = 0.00, 0.22). Conclusions. Through June 2004, the campaign is unlikely to have had favorable effects on youths and may have had delayed unfavorable effects. The evaluation challenges the usefulness of the campaign. PMID:18923126
ERIC Educational Resources Information Center
Kakihara, Fumiko; Tilton-Weaver, Lauree; Kerr, Margaret; Stattin, Hakan
2010-01-01
Recent research suggests that youths interpret parental control and that this may have implications for how control affects youths' adjustment. In this study, we propose that youths' feelings about being over-controlled by parents and feeling connected to parents are intermediary processes linking parental control and youths' adjustment. We used…
Gun Possession among American Youth: A Discovery-Based Approach to Understand Gun Violence
Ruggles, Kelly V.; Rajan, Sonali
2014-01-01
Objective To apply discovery-based computational methods to nationally representative data from the Centers for Disease Control and Preventions’ Youth Risk Behavior Surveillance System to better understand and visualize the behavioral factors associated with gun possession among adolescent youth. Results Our study uncovered the multidimensional nature of gun possession across nearly five million unique data points over a ten year period (2001–2011). Specifically, we automated odds ratio calculations for 55 risk behaviors to assemble a comprehensive table of associations for every behavior combination. Downstream analyses included the hierarchical clustering of risk behaviors based on their association “fingerprint” to 1) visualize and assess which behaviors frequently co-occur and 2) evaluate which risk behaviors are consistently found to be associated with gun possession. From these analyses, we identified more than 40 behavioral factors, including heroin use, using snuff on school property, having been injured in a fight, and having been a victim of sexual violence, that have and continue to be strongly associated with gun possession. Additionally, we identified six behavioral clusters based on association similarities: 1) physical activity and nutrition; 2) disordered eating, suicide and sexual violence; 3) weapon carrying and physical safety; 4) alcohol, marijuana and cigarette use; 5) drug use on school property and 6) overall drug use. Conclusions Use of computational methodologies identified multiple risk behaviors, beyond more commonly discussed indicators of poor mental health, that are associated with gun possession among youth. Implications for prevention efforts and future interdisciplinary work applying computational methods to behavioral science data are described. PMID:25372864
Gun possession among American youth: a discovery-based approach to understand gun violence.
Ruggles, Kelly V; Rajan, Sonali
2014-01-01
To apply discovery-based computational methods to nationally representative data from the Centers for Disease Control and Preventions' Youth Risk Behavior Surveillance System to better understand and visualize the behavioral factors associated with gun possession among adolescent youth. Our study uncovered the multidimensional nature of gun possession across nearly five million unique data points over a ten year period (2001-2011). Specifically, we automated odds ratio calculations for 55 risk behaviors to assemble a comprehensive table of associations for every behavior combination. Downstream analyses included the hierarchical clustering of risk behaviors based on their association "fingerprint" to 1) visualize and assess which behaviors frequently co-occur and 2) evaluate which risk behaviors are consistently found to be associated with gun possession. From these analyses, we identified more than 40 behavioral factors, including heroin use, using snuff on school property, having been injured in a fight, and having been a victim of sexual violence, that have and continue to be strongly associated with gun possession. Additionally, we identified six behavioral clusters based on association similarities: 1) physical activity and nutrition; 2) disordered eating, suicide and sexual violence; 3) weapon carrying and physical safety; 4) alcohol, marijuana and cigarette use; 5) drug use on school property and 6) overall drug use. Use of computational methodologies identified multiple risk behaviors, beyond more commonly discussed indicators of poor mental health, that are associated with gun possession among youth. Implications for prevention efforts and future interdisciplinary work applying computational methods to behavioral science data are described.
Trends in youth internet victimization: findings from three youth internet safety surveys 2000-2010.
Jones, Lisa M; Mitchell, Kimberly J; Finkelhor, David
2012-02-01
The purpose of this research was to explore the trends in youth reports of unwanted online sexual solicitation, harassment, and exposure to pornography over time. The study was based on three separate cross-sectional national telephone surveys of approximately 1,500 youth Internet users, aged 10 through 17 years. Data were collected in 2000, 2005, and 2010. Nine percent of youth reported an unwanted sexual solicitation in 2010. This continued the decline in unwanted sexual solicitations that occurred between 2000 (19%) and 2005 (13%), resulting in a total 50% decrease between 2000 and 2010. Twenty-three percent of youth reported an unwanted exposure to pornography, a decline from 34% in 2005, following an increase between 2000 and 2005 (25% to 34%). However, marking the only trend to show an increase over the past 5 years, 11% of youth reported an online harassment experience, which was an increase from 9% in 2005, and 6% in 2000. Some differences in these trends were noted for subgroups of youth across age, gender, and race. The trends in unwanted experiences online over the past decade identified by three Youth Internet Safety Surveys may contradict impressions that the general population, professionals, and the media have about what is happening. Trends provide evidence for some optimism that protective adaptations to the online environment have been successful; however, online harassment appears to be increasing for youth, particularly girls, and may require additional mobilization. Copyright © 2012 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Summer Camp and Positive Youth Development: Program with Romanian Youth
ERIC Educational Resources Information Center
Feenstra, Jennifer S.
2015-01-01
A variety of activities are used in camps to help promote positive youth development, improving social skills and self-esteem in campers. I expanded on previous camp research in this study to address the influence camps have on trust, belief in the honesty of others, empowerment, and care for others in youth in Eastern Europe. Since 1999, New…
Bjornson, Kristie F; Belza, Basia; Kartin, Deborah; Logsdon, Rebecca; McLaughlin, John F
2007-01-01
Background and Purpose Assessment of walking activity in youth with cerebral palsy (CP) has traditionally been “capacity-based.” The purpose of this study was to describe the day-to-day ambulatory activity “performance” of youth with CP compared with youth who were developing typically. Subjects Eighty-one youth with CP, aged 10 to 13 years, who were categorized as being in Gross Motor Function Classification System (GMFCS) levels I to III and 30 age-matched youth who were developing typically were recruited. Methods Using a cross-sectional design, participants wore the StepWatch monitor for 7 days while documenting average daily total step counts, percentage of all time active, ratio of medium to low activity levels, and percentage of time at high activity levels. Results The youth with CP demonstrated significantly lower levels of all outcomes than the comparison group. Discussion and Conclusion Daily walking activity and variability decreased as functional walking level (GMFCS level) decreased. Ambulatory activity performance within the context of the daily life for youth with CP appears valid and feasible as an outcome for mobility interventions in CP. PMID:17244693
Characteristics of Sports-Based Youth Development Programs
ERIC Educational Resources Information Center
Perkins, Daniel F.; Noam, Gil G.
2007-01-01
The term "sports-based youth development programs" is coined and defined in the context of the community youth development framework. Sports-based youth development programs are out-of-school-time programs that use a particular sport to facilitate learning and life skill development in youth. Community youth development programs use a community…
Kakihara, Fumiko; Tilton-Weaver, Lauree; Kerr, Margaret; Stattin, Håkan
2010-12-01
Recent research suggests that youths interpret parental control and that this may have implications for how control affects youths' adjustment. In this study, we propose that youths' feelings about being over-controlled by parents and feeling connected to parents are intermediary processes linking parental control and youths' adjustment. We used three years of longitudinal data sampled from 1,022 Swedish youths in 7th, 8th, and 9th grade (47.3% girls; 12-17 years old, M age = 14.28 years, SD = .98) who were mainly Swedish in ethnic origin. We tested models linking parental control (i.e., rules, restriction of freedom, and coldness-rejection) to adjustment (i.e., norm-breaking, depressive symptoms, and self-esteem) through youths feeling over-controlled by and connected to parents. The overall model incorporating youths' feelings showed that restrictions and coldness-rejection were both indirectly linked to increases in norm-breaking and depressive symptoms through increases in youths feeling over-controlled. Parental rules still independently predicted decreases in norm-breaking and in self-esteem, and coldness-rejection predicted increases in norm-breaking. In addition, some paths (e.g., feeling over-controlled to self-esteem) depended on the youths' age, whereas others depended on their gender. These results suggest that when youths' feelings are taken into account, all behavioral control is not the same, and the line between behavioral control and psychological control is blurred. We conclude that it is important to consider youths' feelings of being controlled and suggest that future research focus more on exploring this idea.
Miller, A M; Savinelli, E A; Couture, S M; Hannigan, G M; Han, Z; Selden, R F; Treco, D A
1993-01-01
Recombination walking is based on the genetic selection of specific human clones from a yeast artificial chromosome (YAC) library by homologous recombination. The desired clone is selected from a pooled (unordered) YAC library, eliminating labor-intensive steps typically used in organizing and maintaining ordered YAC libraries. Recombination walking represents an efficient approach to library screening and is well suited for chromosome-walking approaches to the isolation of genes associated with common diseases. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8367472
Trauma among Street-Involved Youth
ERIC Educational Resources Information Center
Bender, Kimberly A.; Thompson, Sanna J.; Ferguson, Kristin M.; Yoder, Jamie R.; Kern, Leah
2014-01-01
Previous research documents that street-involved youth experience rates of trauma and posttraumatic stress disorder (PTSD) that are significantly higher than their housed counterparts. Trauma and PTSD are of particular concern for homeless youth as they can negatively affect youths' ability to function adaptively and to transition off the streets.…
ERIC Educational Resources Information Center
Radford, Joyce L.; And Others
Interviews were conducted with 712 Canadian street youth (ages 15-20 years) to assess their knowledge, attitudes, and behaviors with regard to Acquired Immune Deficiency Syndrome (AIDS) and other sexually transmitted diseases (STDs). Youth were interviewed in 10 cities across Canada on the basis of 5 street culture lifestyles: prostitution, drug…
ERIC Educational Resources Information Center
Wirtz, Willard; And Others
The document presents the proceedings of an international symposium analyzing the relationship among youth, education, and employment, with emphasis on youth employment trends and the need to find solutions for unemployment problems. The objectives are to evaluate the existing relationship in the light of changing values and expectations of young…
NASA Astrophysics Data System (ADS)
Miller, Diane
2008-04-01
This session features Youth Exploring Science (YES), Saint Louis Science Center's nationally recognized work-based teen development program. In YES, underserved audiences develop interest and understanding in physics through design engineering projects. I will discuss breaking down barriers, helping youth develop skills, and partnering with community organizations, universities and engineering firms.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-11-04
... Customs Automation Program Test Concerning Automated Commercial Environment (ACE) Cargo Release (Formerly... Simplified Entry functionality in the Automated Commercial Environment (ACE). Originally, the test was known...) test concerning Automated Commercial Environment (ACE) Simplified Entry (SE test) functionality is...
Zeldin, Shepherd; Krauss, Steven Eric; Kim, Taehan; Collura, Jessica; Abdullah, Haslinda
2016-08-01
After-school programs are prevalent across the world, but there is a paucity of research that examines quality within the "black box" of programs at the point of service. Grounded in current theory, this research examined hypothesized pathways between the experience of youth-adult partnership (youth voice in decision-making; supportive adult relationships), the mediators of program safety and engagement, and the developmental outcomes of youth empowerment (leadership competence, policy control) and community connectedness (community connections, school attachment). Surveys were administered to 207 ethnically diverse (47.3 % female; 63.3 % Malay) youth, age 15-16, attending after-school co-curricular programs in Kuala Lumpur, Malaysia. Results showed that youth voice in program decision-making predicted both indicators of youth empowerment. Neither youth voice nor supportive adult relationships was directly associated with community connectedness, however. Program engagement mediated the associations between youth-adult partnership and empowerment. In contrast, program safety mediated the associations between youth-adult partnership and community connectedness. The findings indicate that the two core components of youth-adult partnership-youth voice and supportive adult relationships-may operate through different, yet complementary, pathways of program quality to predict developmental outcomes. Implications for future research are highlighted. For reasons of youth development and youth rights, the immediate challenge is to create opportunities for youth to speak on issues of program concern and to elevate those adults who are able and willing to help youth exercise their voice.
Youthscaping Our Classrooms: Nurturing Youth Civic Agency through Youth-Centered Pedagogies
ERIC Educational Resources Information Center
Aponte-Martínez, Gerardo J.; Pellegrino, Anthony
2017-01-01
Youth are an ever-present component of conversations about culture, interconnectedness, and its effects, especially characterized as readily consuming all that globalization has to offer them. However, opportunities to acknowledge and legitimize the civic experiences youth have and the contributions they make to society have been overlooked in our…
Homeless youth: a concept analysis.
Washington, Philisie Starling
2011-07-01
INTRODUCTION. A variety of terms have been used to describe the homeless youth population. PURPOSE. The purpose of this article is to analyze the conceptual meanings of the term homeless youths by examining the evolution of the concept and its related terms in the current literature. Method. Online databases from 1990-2010 were analyzed using the Rodgers evolutionary approach. RESULTS. The 6 attributes relating to homeless youth were physical location, age, health, behavior, choice, and survival. CONCLUSION. The analysis provided insight and clarification of homeless youth from a variety of related terms in the literature.
ERIC Educational Resources Information Center
Cooper, Maudine Rice
1977-01-01
This article indicates some of the ways in which the National Urban League has dealt with the problem of minority youth. These ways include programs such as the Street Academy Program, student internship programs, and the Black Executive Exchange Program, a conference on youth employment, and affiliation with other programs. (Author/AM)
ERIC Educational Resources Information Center
Laursen, Erik K.
2014-01-01
Children are social beings who rely on interactions with others to survive and thrive. Since the human brain is wired to connect, cultures in schools and youth organizations must be designed so youth can bond to supportive peers and adults. Children learn through observation, modeling, and responding to people in their environments. Bronfenbrenner…
ERIC Educational Resources Information Center
Bush, Laura
2005-01-01
As First Lady of the United States, Laura Bush is leading the Helping America's Youth initiative of the federal government. She articulates the goal of enlisting public and volunteer resources to foster healthy growth by early intervention and mentoring of youngsters at risk. Helping America's Youth will benefit children and teenagers by…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davis, K.W.
1994-12-01
This is one of a series of topical reports dealing with the strategic, technical, and market development of home automation. Particular emphasis is placed upon identifying those aspects of home automation that will impact the gas industry and gas products. Communication standards, market drivers, key organizations, technical implementation, product opportunities, and market growth projects will all be addressed in this or subsequent reports. These reports will also discuss how the gas industry and gas-fired equipment can use home automation technology to benefit the consumer.
Creating a Seamless Web of Services for Youth: The DC Children and Youth Investment Partnership.
ERIC Educational Resources Information Center
Keegan, Sinead; Chaplin, Duncan
This report describes the DC Children and Youth Investment Partnership, which helps improve outcomes for DC youth by building a sustainable partnership to increase the quality and quantity of youth services. Data from interviews with key actors, attendance at Partnership meetings, and site visits with affiliated initiatives show progress in…
Creating an innovative youth mental health service in the United Kingdom: The Norfolk Youth Service.
Wilson, Jon; Clarke, Tim; Lower, Rebecca; Ugochukwu, Uju; Maxwell, Sarah; Hodgekins, Jo; Wheeler, Karen; Goff, Andy; Mack, Robert; Horne, Rebecca; Fowler, David
2017-08-04
Young people attempting to access mental health services in the United Kingdom often find traditional models of care outdated, rigid, inaccessible and unappealing. Policy recommendations, research and service user opinion suggest that reform is needed to reflect the changing needs of young people. There is significant motivation in the United Kingdom to transform mental health services for young people, and this paper aims to describe the rationale, development and implementation of a novel youth mental health service in the United Kingdom, the Norfolk Youth Service. The Norfolk Youth Service model is described as a service model case study. The service rationale, national and local drivers, principles, aims, model, research priorities and future directions are reported. The Norfolk Youth Service is an innovative example of mental health transformation in the United Kingdom, comprising a pragmatic, assertive and "youth-friendly" service for young people aged 14 to 25 that transcends traditional service boundaries. The service was developed in collaboration with young people and partnership agencies and is based on an engaging and inclusive ethos. The service is a social-recovery oriented, evidence-based and aims to satisfy recent policy guidance. The redesign and transformation of youth mental health services in the United Kingdom is long overdue. The Norfolk Youth Service represents an example of reform that aims to meet the developmental and transitional needs of young people at the same time as remaining youth-oriented. © 2017 John Wiley & Sons Australia, Ltd.
Vaiman, D; Schibler, L; Oustry-Vaiman, A; Pailhoux, E; Goldammer, T; Stevanovic, M; Furet, J P; Schwerin, M; Cotinot, C; Fellous, M; Cribiu, E P
1999-02-15
The genetic and cytogenetic map around the chromosome 1 region shown to be linked with polledness and intersexuality (PIS) in the domestic goat (Capra hircus) was refined. For this purpose, a goat BAC library was systematically screened with primers from human coding sequences, scraped chromosome 1 DNA, bovine microsatellites from the region, and BAC ends. All the BACs (n = 30) were mapped by fluorescence in situ hybridization (FISH) on goat chromosome 1q41-q45. The genetic mapping of 30 new goat polymorphic markers, isolated from these BACs, made it possible to reduce the PIS interval to a region of less than 1 cM on goat chromosome 1q43. The PIS locus is now located between the two genes ATP1B and COP, which both map to 3q23 in humans. Genetic, cytogenetic, and comparative data suggest that the PIS region is now probably circumscribed to an approximately 1-Mb DNA segment for which construction of a BAC contig is in progress. In addition, a human YAC contig encompassing the blepharophimosis-ptosis-epicanthus-inversus region was mapped by FISH to goat chromosome 1q43. This human disease, mapped to HSA 3q23 and affecting the development and maintenance of ovarian function, could be a potential candidate for goat PIS. Copyright 1999 Academic Press.
Natural Mentors and Youth Drinking: A Qualitative Study of Mexican Youths
ERIC Educational Resources Information Center
Strunin, Lee; Díaz-Martínez, Alejandro; Díaz-Martínez, L. Rosa; Kuranz, Seth; Hernández-Ávila, Carlos A.; Pantridge, Caroline E.; Fernández-Varela, Héctor
2015-01-01
Parental influences on youth drinking are well documented but not the influence of extended family members. This article explores extended family influences on alcohol use among Mexican youths and whether extended family members can be considered natural mentors. We conducted a qualitative study using ethnographic open ended interviews with 117…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haberhausen, G.; Schmitt, I.; Koehler, A.
1995-09-01
A YAC contig was constructed of Xq13.1 in order to sublocalize the X-linked dystonia-parkinsonism (XDP) syndrome locus, DYT3. The contig spans a region of {approximately}1.8 Mb and includes loci DXS453/DXS348/IL2R{gamma}/GJB1/CCG1/DXS559. For the construction of the contig, nine sequence-tagged sites and four short tandem repeat polymorphisms (STRPs) were isolated. The STRPs, designated as 4704 No. 6 (DXS7113), 4704 No. 7 (DXS7114), 67601 (DXS7117), and B4Pst (DXS7119) were assigned to a region flanked by DXS348 proximally and by DXS559 distally. Their order was DXS348/4704 No. 6/4704 No. 7/67601/B4Pst/DXS559. They were applied to the analysis of allelic association and of haplotypes in 47more » not-obviously-related XDP patients and in 105 Filipino male controls. The same haplotype was found at loci 67601 (DXS7117) and B4Pst (DXS7119) in 42 of 47 patients. This percentage of common haplotypes decreased at the adjacent loci. The findings, together with the previous demonstration of DXS559 being the distal flanking marker of DYT3, assign the disease locus to a small region in Xq13.1 defined by loci 67601 (DXS7117) and B4Pst (DXS7119). The location of DYT3 was born out by the application of a newly developed likelihood method for the analysis of linkage disequilibrium. 28 refs., 1 fig., 6 tabs.« less
Lippold, Melissa A.; Davis, Kelly D.; McHale, Susan M.; Almeida, David M.
2015-01-01
Considerable evidence documents linkages between parental knowledge of youth activities and youth risky behavior. We extended this research to determine whether parental knowledge was associated with youth physical health, including reports of physical symptoms (e.g., headaches, stomachaches) and a biomarker of hypothalamic pituitary adrenocortical (HPA) axis functioning (i.e., salivary cortisol levels). Participants were children of employees in the Information Technology division of a Fortune 500 company (N = 132, Mean Age Youth = 13.39 years, 55% female) who participated in a daily diary study. Data were collected via telephone calls on eight consecutive evenings. On four study days, cortisol samples were collected at 4 time points (waking, 30 min after waking, before dinner, bedtime). Multi-level models revealed that, at the between-person level, youth whose parents had higher average knowledge about their activities, exhibited lower bedtime cortisol levels. Furthermore, at the within-person level, on days when parents displayed more knowledge than usual (relative to their own eight-day average), youth had lower before-dinner cortisol than usual. Linkages between average parental knowledge and physical health symptoms were moderated by youth age: Younger but not older adolescents whose parents were more knowledgeable had fewer physical health symptoms, on average. A next step is to identify the processes that underlie these associations. PMID:26751757
ERIC Educational Resources Information Center
Jobs For the Future, 2016
2016-01-01
Youth unemployment has been a cause for concern in the United States for years. Youth unemployment costs society--through the loss of talent and costs of social supports and subsidies. Jobless young people are more vulnerable to a range of challenges, including the ills already plaguing their communities: high rates of unplanned pregnancy,…
Rojas, Erika Y; Gretton, Heather M
2007-09-01
Canada's Aboriginal peoples face a number of social and health issues. Research shows that Aboriginal youths are over-represented in the criminal justice system and youth forensic psychiatric programmes. Within the literature on sex offending youth, there appears to be no published data available to inform clinicians working with adjudicated Aboriginal youth. Therefore, the present study examines the background, offence characteristics, and criminal outcomes of Aboriginal (n = 102) and non-Aboriginal (n = 257) youths who engaged in sexual offending behaviour and were ordered to attend a sexual offender treatment programme in British Columbia between 1985 and 2004. Overall, Aboriginal youths were more likely than non-Aboriginal youths to have background histories of fetal alcohol spectrum disorders (FASD), substance abuse, childhood victimization, academic difficulties, and instability in the living environment. Both Aboriginal and non-Aboriginal youths had a tendency to target children under 12-years-old, females, and non-strangers. Aboriginal youths were more likely than non-Aboriginal youths to use substances at the time of their sexual index offence. Outcome data revealed that Aboriginal youths were more likely than their non-Aboriginal counterparts to recidivate sexually, violently, and non-violently during the 10-year follow-up period. Furthermore, the time between discharge and commission of all types of re-offences was significantly shorter for Aboriginal youths than for non-Aboriginal youths. Implications of these findings are discussed with regards to the needs of Aboriginal youth and intervention.
ERIC Educational Resources Information Center
Roholt, Ross VeLure; Hildreth, R. W.; Baizerman, Michael
2007-01-01
We propose civic youth work as a new craft orientation in the family of child and youth care, education, social work, recreation and other relevant semi-to-full professions. We envision this practice as based in the philosophies and practical sciences of pedagogy, politics, and human development. The ideal-type civic youth worker will have a…
Are Youth at Risk? Reevaluating the Deficit Model of Youth Development.
ERIC Educational Resources Information Center
Astroth, Kirk A.
1993-01-01
Puts the label "at risk" in perspective as it relates to youth. Points out that today's adolescents have lower rates of suicide, unwed pregnancy, drug abuse, smoking, and drunk driving than young and middle-aged adults. Suggests that extension youth education moves toward a condition-focused, resiliency model that recognizes the vitality and…
Hergeth, Sebastian; Lorenz, Lutz; Vilimek, Roman; Krems, Josef F
2016-05-01
The feasibility of measuring drivers' automation trust via gaze behavior during highly automated driving was assessed with eye tracking and validated with self-reported automation trust in a driving simulator study. Earlier research from other domains indicates that drivers' automation trust might be inferred from gaze behavior, such as monitoring frequency. The gaze behavior and self-reported automation trust of 35 participants attending to a visually demanding non-driving-related task (NDRT) during highly automated driving was evaluated. The relationship between dispositional, situational, and learned automation trust with gaze behavior was compared. Overall, there was a consistent relationship between drivers' automation trust and gaze behavior. Participants reporting higher automation trust tended to monitor the automation less frequently. Further analyses revealed that higher automation trust was associated with lower monitoring frequency of the automation during NDRTs, and an increase in trust over the experimental session was connected with a decrease in monitoring frequency. We suggest that (a) the current results indicate a negative relationship between drivers' self-reported automation trust and monitoring frequency, (b) gaze behavior provides a more direct measure of automation trust than other behavioral measures, and (c) with further refinement, drivers' automation trust during highly automated driving might be inferred from gaze behavior. Potential applications of this research include the estimation of drivers' automation trust and reliance during highly automated driving. © 2016, Human Factors and Ergonomics Society.
The Influence of Youth Assets on the Career Decision Self-Efficacy in Unattached Jamaican Youth
ERIC Educational Resources Information Center
Hayes, DeMarquis; Huey, Erron L.; Hull, Darrell M.; Saxon, Terrill F.
2012-01-01
The present study expands the career decision self-efficacy (CDSE) literature by focusing on a sample of unattached Jamaican youth to determine if youth assets (protective factors like family communication and peer role models) were predictive of increased CDSE. Unattached youth are defined as those that do not have a job or are not currently…
García, Jorge I Ramírez; Manongdo, Jennifer A; Ozechowski, Timothy J
2014-01-01
Mexican American youth (N = 146; age range: 14-19 years) living in an immigrant enclave who resided with both parents reported depression symptoms, paternal and maternal acceptance, paternal and maternal harsh parenting, and economic stress. Despite lower levels of youth-reported paternal parenting relative to maternal parenting, paternal acceptance was significantly related to youth depression symptoms in a path model that accounted for parenting intercorrelations as well as other significant correlates of youth depression symptoms. We found evidence suggesting that the relation between youth-reported paternal acceptance and depression might be stronger for girls than for boys. Using an ecological analytic framework, we found that: (a) the link between economic stress and youth depression was robust, and (b) only one parenting variable (paternal acceptance) may partially mediate the link between economic stress and depression symptoms. Our results suggest that paternal parenting and youth gender deserve further consideration in longitudinal research and intervention research addressing depression among Latino youth. Ecological models that highlight the influence of settings where Latino youth and families live should be considered in research on the family relationship context of youth depression.
Vidal, Ruben; Sammeta, Neeraja; Garringer, Holly J.; Sambamurti, Kumar; Miravalle, Leticia; Lamb, Bruce T.; Ghetti, Bernardino
2012-01-01
Genetically engineered mice have been generated to model cerebral β-amyloidosis, one of the hallmarks of Alzheimer disease (AD) pathology, based on the overexpression of a mutated cDNA of the amyloid-β precursor protein (AβPP) or by knock-in of the murine Aβpp gene alone or with presenilin1 mutations. Here we describe the generation and initial characterization of a new mouse line based on the presence of 2 copies of the human genomic region encoding the wild-type AβPP and the L166P presenilin 1 mutation. At ∼6 mo of age, double-mutant mice develop amyloid pathology, with signs of neuritic dystrophy, intracellular Aβ accumulation, and glial inflammation, an increase in AβPP C-terminal fragments, and an 8 times increase in Aβ42 levels with a 40% decrease in Aβ40 levels, leading to a significant increase (14 times) of Aβ42/Aβ40 ratios, with minimal effects on presenilin or the Notch1 pathway in the brain. We conclude that in mice, neither mutations in AβPP nor overexpression of an AβPP isoform are a prerequisite for Aβ pathology. This model will allow the study of AD pathogenesis and testing of therapeutic strategies in a more relevant environment without experimental artifacts due to the overexpression of a single-mutant AβPP isoform using exogenous promoters.—Vidal, R., Sammeta, N., Garringer, H. J., Sambamurti, K., Miravalle, L., Lamb B. T., Ghetti, B. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice. PMID:22459153
Youth Suicide Prevention Programs
ERIC Educational Resources Information Center
Kalafat, John
2006-01-01
Youth suicide prevention programs are described that promote the identification and referral of at-risk youth, address risk factors, and promote protective factors. Emphasis is on programs that are both effective and sustainable in applied settings.
ERIC Educational Resources Information Center
Nunes, Stephen A.
1980-01-01
Discusses the impact of media on youth and suggests some possible directions for the Catholic media, especially in the areas of textbooks, magazines, television, movies, and radio, in responding to the needs of youth. (Author/FM)
Pagano-Therrien, Jesica; Sullivan-Bolyai, Susan
The aims of this qualitative descriptive study were to describe how past experiences with research (including communication, information, values, and support) may contribute to research fatigue among youth and parents of youth with HIV, cystic fibrosis, and Type 1 diabetes. Eighteen parents and youth were purposively recruited from outpatient subspecialty clinics at a major academic medical center. They took part in qualitative interviews and completed a demographics form and the Decisional Conflict Scale. Youth participants also completed the Erikson Psychosocial Stage Inventory. Two major themes emerged: Blurred Lines and Hope for the Future. Research fatigue was not found in this sample. Results point to challenges with informed consent in settings where research and clinical care are integrated and suggest that protective factors allow for continued participation without excess burden on youth and parents. Strategies to minimize research fatigue and support engagement in research are offered. Copyright © 2016 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Sukarieh, Mayssoun; Tannock, Stuart
2008-01-01
Youth, and youth employment especially, have jumped to the forefront of the international development agenda, driven by new funding and reporting priorities of the World Bank and allied international and national aid organisations. Despite the seductive rhetoric of youth empowerment, however, we argue that the new turn to youth serves primarily to…
ERIC Educational Resources Information Center
French, Karen E.; Spurgeon, John H.; Nevett, Michael E.
2007-01-01
The purpose of this study was to compare measures of body size in two samples of youth baseball players with normative data from the United States National Center for Health Statistics (NCHS) growth charts. One sample of youth baseball players participated in a local little league. The second sample of youth baseball players were members of eight…
Investing in Our Nation's Youth. National Youth Anti-Drug Media Campaign: Phase II (Final Report).
ERIC Educational Resources Information Center
Office of National Drug Control Policy, Washington, DC.
This publication presents the findings from an evaluation of Phase II of the National Youth Anti-Drug Media Campaign. The number one goal of the campaign was to educate youth to reject illegal drugs. This report evaluates Phase II and focuses on the effect of paid television advertising on awareness of anti-drug messages among youth, teens, and…
ERIC Educational Resources Information Center
Shogren, Karrie A.; Shaw, Leslie A.; Raley, Sheida K.; Wehmeyer, Michael L.; Niemiec, Ryan M.; Adkins, Megan
2018-01-01
This article reports the results of an examination of the endorsement, reliability, and factorial validity of the VIA--Youth and assessment of character strengths and virtues developed for the general population in youth with and without intellectual disability. Findings suggest that, generally, youth with intellectual disability endorsed…
ERIC Educational Resources Information Center
Maertens, Rita
This social report concerns the efforts of the German Youth Institute in working with other institutes and with other countries to develop youth policies and programs. It begins by describing German and Soviet youth researchers working together to develop a concept for a long-term youth policy based on democratic structures. The German approach to…
Transgender youth and life-threatening behaviors.
Grossman, Arnold H; D'Augelli, Anthony R
2007-10-01
Sexual minority status is a key risk factor for suicide among lesbian, gay, and bisexual youth; however, it has not been studied among transgender youth. Fifty-five transgender youth reported on their life-threatening behaviors. Nearly half of the sample reported having seriously thought about taking their lives and one quarter reported suicide attempts. Factors significantly related to having made a suicide attempt included suicidal ideation related to transgender identity; experiences of past parental verbal and physical abuse; and lower body esteem, especially weight satisfaction and thoughts of how others evaluate the youths' bodies. Sexual minority status is a key risk factor for life-threatening behaviors among transgender youth.
Leave No Youth Behind: Opportunities for Congress To Reach Disconnected Youth.
ERIC Educational Resources Information Center
Levin-Epstein, Jodie, Ed.; Greenberg, Mark H., Ed.
This report discusses six programs being considered by the 108th Congress for reauthorization, focusing on policies designed to assist disconnected and at-risk youth. The review seeks to identify how the programs do or do not consider at-risk or disconnected youth ad how such programs might be improved. After an introduction by Alan Houseman, six…
Environmental Action as Context for Youth Development
ERIC Educational Resources Information Center
Schusler, Tania M.; Krasny, Marianne E.
2010-01-01
This study explored the practices of teachers, nonformal science educators, community organizers, youth program managers, and other educators facilitating youth participation in local environmental action, as well as the experiences of some of the youth involved. We conducted narrative interviews with 33 educators facilitating youth environmental…
Predictors of Resilience among Inner City Youths
ERIC Educational Resources Information Center
Tiet, Quyen Q.; Huizinga, David; Byrnes, Hilary F.
2010-01-01
Prior studies have suggested that living in high-risk neighborhoods is associated with youths' maladjustment. Youths who maintained favorable outcomes, despite being exposed to such neighborhood risks, were considered resilient. Using structural equation modeling techniques, longitudinal data of 877 youths from the Denver Youth Survey were…
ERIC Educational Resources Information Center
Wong, Nga-Wing Anjela
2010-01-01
This article will explore the role of "CYC," a community-based youth center, in providing a sense of what I call "Youth (Comm)Unity" for Chinese American youth from low-income immigrant families. While CYC combines the youths' home and school worlds, it is also distinct from these worlds by forming a new and hybrid culture/space. In doing so, I…
Intermediaries for youth: a vital target audience.
1997-01-01
Worldwide, youth are recognized as a key target audience for HIV/STD awareness and prevention campaigns. Rural young people, who often have less access to information and prevention tools than urban youth, may be particularly vulnerable to HIV/STD infection. Many initiatives have been organized by nongovernmental organizations, governments, churches, and other organizations to help youth. However, parents, relatives, guardians, teachers, church and youth leaders, social workers, and other adults in a position to influence youth must also be helped to undertake the role of an intermediary between youth and HIV/STD interventions and other youth-oriented programs. In training adults to openly address sexual and reproductive health issues with adolescents, adults must first be encouraged to feel comfortable about discussing such issues among themselves. Intermediaries and how to target them are discussed.
Bayram Özdemir, Sevgi; Stattin, Håkan; Özdemir, Metin
2016-11-01
Teachers are thought to play an important role in fostering youth civic engagement; however, the current literature is limited with regard to providing concrete suggestions as to what teachers can do to promote youth civic engagement and why teachers have an impact on youth. To address these limitations, we simultaneously tested three alternative explanations to identify the critical way(s) in which perceived teachers' behaviors might contribute to youth civic engagement in school. We also investigated the underlying processes that may explain why youth's perceptions of teachers' behaviors matter, by focusing on the mediating roles of young people's feelings about politics and their political efficacy beliefs. The sample included 7th (n = 876, M age = 13.42, SD = .71; 51 % girls) and 10th grade students (n = 857, M age = 16.62, SD = .71; 51 % girls) residing in Sweden. Among the different aspects of perceived teacher behaviors, only an engaged and inspiring teaching style fostered youth's initiations of civic and political discussions in class over time among both early and late adolescents. Moreover, youth's feelings about politics significantly mediated the effect of perceived teachers' behaviors on youth civic engagement in class. Contrary to our expectation, youth's political efficacy did not act as a mediator. The present study sheds light on what teachers can do to promote youth civic and political engagement in a school setting.
Alternative Youth Employment Strategies Project: Final Report.
ERIC Educational Resources Information Center
Sadd, Susan; And Others
The Alternative Youth Employment Strategies (AYES) Project began as one of the demonstration projects funded under the Youth Employment and Demonstration Project Act in 1980. The program, which features three training models, is targeted toward high-risk, disadvantaged youth, especially minority youths from urban areas who had prior involvement…
Padilla, Jenny; McHale, Susan M; Rovine, Michael J; Updegraff, Kimberly A; Umaña-Taylor, Adriana J
2016-12-01
A critical step in capturing family processes is to incorporate the perspectives and experiences of multiple family members toward characterizing how families operate as systems. Although some research has examined differences between parents' and youth's family experiences, most studies have focused on European American families, and we know little about the nature and implications of divergent parent-youth experiences in other ethnic groups. Accordingly, we focused on Mexican-origin families and assessed the links between mother-youth and father-youth differences in familism values and parent-youth conflict from early adolescence into young adulthood. Participants were mothers, fathers, and two siblings (248 female and 244 male, 51 % female; M age = 14.02 years) from 246 families who were interviewed in their homes on three occasions over 8 years. We operationalized parent-youth differences in familism values using difference scores, controlling for mean levels of familism. Multilevel models revealed that mothers' and fathers' familism values remained relatively stable over time, but youth's familism values declined until age 17, stabilized, and then increased slightly in young adulthood. Lagged models tested directions of effect by examining whether parent-youth differences in familism values predicted parent-youth conflict or vice versa. The findings revealed that parent-youth conflict predicted greater differences in parent-youth familism values, but differences in familism values did not predict conflict. Our findings align with a family systems perspective in documenting the significance of differences between family members' perspectives and highlighting that such processes are dynamic. Further, by testing bi-directional associations in longitudinal models, we were able to disentangle the temporal ordering of differences in familism values and parent-youth conflict thereby advancing understanding of parent-youth discrepancies in cultural values.
McHale, Susan M.; Rovine, Michael J.; Updegraff, Kimberly A.; Umaña-Taylor, Adriana J.
2016-01-01
A critical step in capturing family processes is to incorporate the perspectives and experiences of multiple family members toward characterizing how families operate as systems. Although some research has examined differences between parents' and youth's family experiences, most studies have focused on European American families, and we know little about the nature and implications of divergent parent-youth experiences in other ethnic groups. Accordingly, we focused on Mexican-origin families and assessed the links between mother-youth and father-youth differences in familism values and parent-youth conflict from early adolescence into young adulthood. Participants were mothers, fathers, and two siblings (248 female and 244 male; Mage = 14.02 years) from 246 families who were interviewed in their homes on three occasions over eight years. We operationalized parent-youth differences in familism values using difference scores, controlling for mean levels of familism. Multilevel models revealed that mothers' and fathers' familism values remained relatively stable over time, but youth's (51% female) familism values declined until age 17, stabilized, and then increased slightly in young adulthood. Lagged models tested directions of effect by examining whether parent-youth differences in familism values predicted parent-youth conflict or vice versa. The findings revealed that parent-youth conflict predicted greater differences in parent-youth familism values, but differences in familism values did not predict conflict. Our findings align with a family systems perspective in documenting the significance of differences between family members' perspectives and highlighting that such processes are dynamic. Further, by testing bidirectional associations in longitudinal models, we were able to disentangle the temporal ordering of differences in familism values and parent-youth conflict thereby advancing understanding of parent-youth discrepancies in cultural values. PMID
Process development for automated solar cell and module production. Task 4: Automated array assembly
NASA Technical Reports Server (NTRS)
1980-01-01
A process sequence which can be used in conjunction with automated equipment for the mass production of solar cell modules for terrestrial use was developed. The process sequence was then critically analyzed from a technical and economic standpoint to determine the technological readiness of certain process steps for implementation. The steps receiving analysis were: back contact metallization, automated cell array layup/interconnect, and module edge sealing. For automated layup/interconnect, both hard automation and programmable automation (using an industrial robot) were studied. The programmable automation system was then selected for actual hardware development.
Management Planning for Workplace Automation.
ERIC Educational Resources Information Center
McDole, Thomas L.
Several factors must be considered when implementing office automation. Included among these are whether or not to automate at all, the effects of automation on employees, requirements imposed by automation on the physical environment, effects of automation on the total organization, and effects on clientele. The reasons behind the success or…
Net Generation of Youth: A Case Study of Students in a Technology-Based Youth Development Program
ERIC Educational Resources Information Center
James, Coran
2013-01-01
The purpose of this interpretive study was to understand how students made sense of their experiences in a technology-based youth development program. This study was framed by James P. Connell and Michelle A. Gambone's, Community Action Framework for Youth Development, conceptual model for understanding youth development that identifies the…
International Youth Conference on the Poles
NASA Astrophysics Data System (ADS)
Church, A. K.; Kuhn, T. S.; Baeseman, J.; Garmulewicz, A.; Raymond, M.; Salmon, R.
2006-12-01
The International Polar Year (IPY) is an international effort, involving more than 50 countries, to focus research in both the sciences and social sciences on the world's Polar Regions. In order to secure youth involvement in the IPY, the Youth Steering Committee (YSC) has been formed, aiming specifically to network young polar researchers from all backgrounds enabling collaboration and to involve this group in outreach focused towards other young people. A conference targeted directly at an audience of early career researchers and international youth will be central to fulfilling these aims. The YSC has therefore developed the concept of the International Youth Conference on the Poles (IYCP). Proposed for 2008, this conference will bring together youth from a diverse set of backgrounds and nationalities to discuss the issues affecting the Polar Regions, their effects on a global scale and ways of addressing these issues. The conference will also serve to highlight ongoing IPY research, especially research being undertaken by young researchers, and provide a perennial framework for youth involvement in polar research and policies. The IYCP will run for three days in May 2008, attracting an international youth audience, as well as representatives from polar organizations, teachers, politicians, policy makers, the general public and media. The IYCP will be divided into three sections. Youth Roundtable Discussions will bring youth together to discuss issues affecting the Polar Regions and potential solutions to these. A Young Researchers Conference will provide the opportunity for young researchers working in the Polar Regions to present their work to an interdisciplinary audience. The Polar Fair will provide an interactive environment for youth to learn about the Polar Regions. The IYCP will be of great importance to the IPY because it will serve as the principle venue during the Polar Year where youth from many different disciplines, backgrounds and countries will
From Deficit to Disenfranchisement: Reframing Youth Electoral Participation
ERIC Educational Resources Information Center
Edwards, Kathy
2007-01-01
Low youth electoral turnouts are considered problematic in many democracies. Here I explore youth electoral engagement in the Australian context where the policy literature attributes low youth electoral enrolments to apathetic and disassociated youth, and the response is Civics and Citizenship education. This construction of youth and advocacy of…
ERIC Educational Resources Information Center
Hepburn, Mary A.
This examination of political and social attitudes of American youth in the 1980's begins with a comparison of the youth of the 1960's with the youth of the 1970's. Results from four major studies are presented and a composite picture of youth in the eighties is presented. Findings show that the personal and professional values of American…
NASA Technical Reports Server (NTRS)
Wampler, E. J.
1972-01-01
Description and evaluation of the remotely operated Lick Observatory Cassegrain focus of the 120-inch telescope. The experience with this instrument has revealed that an automated system can profoundly change the observer's approach to his work. This makes it difficult to evaluate the 'advantage' of an automated telescope over a conventional instrument. Some of the problems arising with automation in astronomy are discussed.
ERIC Educational Resources Information Center
Harvey, Aminifu R.; Hill, Robert B.
2004-01-01
This article examines the effects of an Africentric youth and family rites of passage program on at-risk African American youths and their parents. Data were obtained from a three-year evaluation of a youth rites of passage demonstration project using therapeutic interventions based on Africentric principles. At-risk African American boys between…
Examining How Model Youth Sport Coaches Learn to Facilitate Positive Youth Development
ERIC Educational Resources Information Center
Camiré, Martin; Trudel, Pierre; Forneris, Tanya
2014-01-01
Background: Research indicates that some youth sport coaches have specific strategies in their coaching plan to facilitate positive youth development (PYD) while others struggle in articulating how they promote the development of their athletes in actual practice. These variations can be largely attributed to the fact that coaching is a complex…
ERIC Educational Resources Information Center
Chowa, Gina A. N.; Masa, Rainier D.; Wretman, Christopher J.; Ansong, David
2013-01-01
Household assets as part of youth's family background have been found to have a significant impact on youth's academic achievement. In this study, the impact of household possessions on youth's academic achievement in the Ghana YouthSave experiment is investigated. Findings support the hypothesized positive direction of the impact of household…
Automation in Clinical Microbiology
Ledeboer, Nathan A.
2013-01-01
Historically, the trend toward automation in clinical pathology laboratories has largely bypassed the clinical microbiology laboratory. In this article, we review the historical impediments to automation in the microbiology laboratory and offer insight into the reasons why we believe that we are on the cusp of a dramatic change that will sweep a wave of automation into clinical microbiology laboratories. We review the currently available specimen-processing instruments as well as the total laboratory automation solutions. Lastly, we outline the types of studies that will need to be performed to fully assess the benefits of automation in microbiology laboratories. PMID:23515547
Casis, E; Garrido, A; Uranga, B; Vives, A; Zufiaurre, C
2001-01-01
Total laboratory automation (TLA) can be substituted in mid-size laboratories by a computer sample workflow control (virtual automation). Such a solution has been implemented in our laboratory using PSM, software developed in cooperation with Roche Diagnostics (Barcelona, Spain), to this purpose. This software is connected to the online analyzers and to the laboratory information system and is able to control and direct the samples working as an intermediate station. The only difference with TLA is the replacement of transport belts by personnel of the laboratory. The implementation of this virtual automation system has allowed us the achievement of the main advantages of TLA: workload increase (64%) with reduction in the cost per test (43%), significant reduction in the number of biochemistry primary tubes (from 8 to 2), less aliquoting (from 600 to 100 samples/day), automation of functional testing, drastic reduction of preanalytical errors (from 11.7 to 0.4% of the tubes) and better total response time for both inpatients (from up to 48 hours to up to 4 hours) and outpatients (from up to 10 days to up to 48 hours). As an additional advantage, virtual automation could be implemented without hardware investment and significant headcount reduction (15% in our lab).
Risk Factor Analysis and the Youth Question
ERIC Educational Resources Information Center
France, Alan
2008-01-01
This paper is concerned with exploring how in late modernity the "youth question" is being addressed by public policy and what impact this is having on understandings of childhood and youth. Historically the youth question has been shaped by adult anxieties over youth delinquency and their problems of social integration. In late modernity, this is…
Laboratory automation: total and subtotal.
Hawker, Charles D
2007-12-01
Worldwide, perhaps 2000 or more clinical laboratories have implemented some form of laboratory automation, either a modular automation system, such as for front-end processing, or a total laboratory automation system. This article provides descriptions and examples of these various types of automation. It also presents an outline of how a clinical laboratory that is contemplating automation should approach its decision and the steps it should follow to ensure a successful implementation. Finally, the role of standards in automation is reviewed.
28 CFR 115.14 - Youthful inmates.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Youthful inmates. 115.14 Section 115.14 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Adult Prisons and Jails Prevention Planning § 115.14 Youthful inmates. (a) A youthful inmate...
28 CFR 115.14 - Youthful inmates.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Youthful inmates. 115.14 Section 115.14 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Adult Prisons and Jails Prevention Planning § 115.14 Youthful inmates. (a) A youthful inmate...
Suicidal Ideation in Anxiety-Disordered Youth
ERIC Educational Resources Information Center
O'Neil, Kelly A.; Puleo, Connor M.; Benjamin, Courtney L.; Podell, Jennifer L.; Kendall, Philip C.
2012-01-01
Evidence is mixed regarding an independent association between anxiety and suicidality in youth. Study 1 examined suicidal ideation in treatment-referred, anxiety-disordered youth (N = 312, aged 7-17). Forty-one percent of anxiety-disordered youth endorsed suicidal ideation. Anxiety disorder severity, global impairment, and current depressive…
Saletsky, Ronald D; Trief, Paula M; Anderson, Barbara J; Rosenbaum, Paula; Weinstock, Ruth S
2014-06-01
Parenting behaviors and family conflict relate to type 1 diabetes outcomes in youth. Our purpose was to understand these relationships in parents and youth with type 2 diabetes (T2DM). The TODAY (Treatment Options for Type 2 Diabetes in Adolescents and Youth) trial enrolled youth (10-17 years) with T2DM and parent/guardian. For this ancillary study, we enrolled a sample of youth-parent pairs (N = 137) in 1 study arm (metformin plus lifestyle intervention). They completed questionnaires measuring parenting style related to normative (e.g., completing homework) and diabetes self-care (e.g., testing blood glucose) tasks, and parent-youth verbal conflict (baseline, 6, and 12 months). Parenting style was consistent across normative and diabetes tasks, with gradual increases in autonomy perceived by youth. Conversations were generally calm, with greater conflict regarding normative than diabetes tasks at baseline (youth: p < .001, parent: p = .01), 6 months (youth: p = .02, parent: p > .05), and 12 months (youth: p > .05., parent: p = .05). A permissive parenting style toward normative tasks and a less authoritarian style toward diabetes tasks, at baseline, predicted better medication adherence (8-12 months) (normative: adjusted R2 = 0.48, p < .001; diabetes: adjusted R2 = 0.47, p < .001). Parent-youth conflict did not predict medication adherence. Youth with T2DM who perceive more autonomy (less parental control) in day-to-day and diabetes tasks are more likely to adhere to medication regimens. It may be valuable to assess youth perceptions of parenting style and help parents understand youths' needs for autonomy.
Ecker, N; Smith, J
2000-04-01
Planned Parenthood of Nassau County (PPNC) employs a wide range of local programs to assist young people in developing the skills necessary to make responsible decisions and help them become good leaders in the future. The mission that underpins their work with the youth is to help them recognize the powerful positive impact they can have on their peers, friends, loved ones, and families. For the last 16 years, peer education has played an essential role in the programs and services of PPNC for teens. The Teen Advocate Project (TAP) has trained and supported dozens of local youth who have in turn participated in several outreach and education activities. The PPNC also created the Teen Info Line, a telephone peer support service operated by and for teens. Along with the TAP, PPNC operates three other successful components of its education programs targeting the youth and their families: 1) male involvement program, 2) multicultural education program, and 3) substance awareness/sexual health education program. In recognizing that its mission to help the youth must not stop at the county border, PPNC established the Global Institute for Training in 1992 to develop youth leadership programs throughout sub-Saharan Africa, the Caribbean, and Eastern Europe.
The Impact of Youth-Friendly Structures of Care on Retention Among HIV-Infected Youth
Yehia, Baligh R.; Gaur, Aditya H.; Rutstein, Richard; Gebo, Kelly; Keruly, Jeanne C.; Moore, Richard D.; Nijhawan, Ank E.; Agwu, Allison L.
2016-01-01
Abstract Limited data exist on how structures of care impact retention among youth living with HIV (YLHIV). We describe the availability of youth-friendly structures of care within HIV Research Network (HIVRN) clinics and examine their association with retention in HIV care. Data from 680 15- to 24-year-old YLHIV receiving care at 7 adult and 5 pediatric clinics in 2011 were included in the analysis. The primary outcome was retention in care, defined as completing ≥2 primary HIV care visits ≥90 days apart in a 12-month period. Sites were surveyed to assess the availability of clinic structures defined a priori as ‘youth-friendly’. Univariate and multivariable logistic regression models assessed structures associated with retention in care. Among 680 YLHIV, 85% were retained. Nearly half (48%) of the 680 YLHIV attended clinics with youth-friendly waiting areas, 36% attended clinics with evening hours, 73% attended clinics with adolescent health-trained providers, 87% could email or text message providers, and 73% could schedule a routine appointment within 2 weeks. Adjusting for demographic and clinical factors, YLHIV were more likely to be retained in care at clinics with a youth-friendly waiting area (AOR 2.47, 95% CI [1.11–5.52]), evening clinic hours (AOR 1.94; 95% CI [1.13–3.33]), and providers with adolescent health training (AOR 1.98; 95% CI [1.01–3.86]). Youth-friendly structures of care impact retention in care among YLHIV. Further investigations are needed to determine how to effectively implement youth-friendly strategies across clinical settings where YLHIV receive care. PMID:26983056
Naturalistically observed conflict and youth asthma symptoms.
Tobin, Erin T; Kane, Heidi S; Saleh, Daniel J; Naar-King, Sylvie; Poowuttikul, Pavadee; Secord, Elizabeth; Pierantoni, Wayne; Simon, Valerie A; Slatcher, Richard B
2015-06-01
To investigate the links between naturalistically observed conflict, self-reported caregiver-youth conflict, and youth asthma symptoms. Fifty-four youth with asthma (age range: 10-17 years) wore the Electronically Activated Recorder (EAR) for a 4-day period to assess interpersonal conflict and caregiver-youth conflict as they occur in daily life. Conflict also was assessed with baseline self-report questionnaires and daily diaries completed by youth participants and their caregivers. Asthma symptoms were assessed using daily diaries, baseline self-reports, and wheezing, as coded from the EAR. EAR-observed measures of conflict were strongly associated with self-reported asthma symptoms (both baseline and daily diaries) and wheezing coded from the EAR. Further, when entered together in regression analyses, youth daily reports of negative caregiver-youth interactions and EAR-observed conflict uniquely predicted asthma symptoms; only EAR-observed conflict was associated with EAR-observed wheezing. These findings demonstrate the potential impact of daily conflict on youth asthma symptoms and the importance of assessing conflict as it occurs in everyday life. More broadly, they point to the importance of formulating a clear picture of family interactions outside of the lab, which is essential for understanding how family relationships "get under the skin" to affect youth health. (c) 2015 APA, all rights reserved).
Naturalistically-Observed Conflict and Youth Asthma Symptoms
Tobin, Erin T.; Kane, Heidi S.; Saleh, Daniel J.; Naar-King, Sylvie; Poowuttikul, Pavadee; Secord, Elizabeth; Pierantoni, Wayne; Simon, Valerie; Slatcher, Richard B.
2014-01-01
Objective To investigate the links between naturalistically-observed conflict, self-reported caregiver-youth conflict, and youth asthma symptoms. Method Fifty-four youth with asthma (aged 10-17) wore the Electronically Activated Recorder (EAR) for a 4-day period to assess interpersonal conflict and caregiver-youth conflict as they occur in daily life. Conflict also was assessed with baseline self-report questionnaires and daily diaries completed by the youth participants and their caregiver. Asthma symptoms were assessed via daily diaries and baseline self-reports and wheezing as coded from the EAR. Results EAR-observed measures of conflict were strongly associated with self-reported asthma symptoms (both baseline and daily diaries) and wheezing coded from the EAR. Further, when entered together in regression analyses, youth daily reports of negative caregiver-youth interactions and EAR-observed conflict uniquely predicted asthma symptoms; only EAR-observed conflict was associated with EAR-observed wheezing. Conclusions These findings demonstrate the potential impact of daily conflict on youth asthma symptoms and the importance of assessing conflict as it occurs in everyday life. More broadly, they point to the importance of formulating a clear picture of family interactions outside of the lab, which is essential for understanding how family relationships “get under the skin” to affect youth health. PMID:25222090
Baillie, Colin P T; Galaviz, Karla I; Emiry, Kevin; Bruner, Mark W; Bruner, Brenda G; Lévesque, Lucie
2017-03-01
Physical activity (PA) programs are a promising strategy to promote positive youth development (PYD). It is not known if published reports provide sufficient information to promote the implementation of effective PYD in indigenous youth. The purpose of this study was to assess the extent to which published literature on PA programs that promote PYD in indigenous youth report on RE-AIM (reach, effectiveness, adoption, implementation, maintenance) indicators. A systematic literature search was conducted to identify articles reporting on PA programs that promote PYD in indigenous youth. The search yielded 8084 articles. A validated 21-item RE-AIM abstraction tool assessing internal and external validity factors was used to extract data from 10 articles meeting eligibility criteria. The most commonly reported dimensions were effectiveness (73 %), adoption (48 %), and maintenance (43 %). Reach (34 %) and implementation (30 %) were less often reported. Published research provides insufficient information to inform real-world implementation of PA programs to promote PYD in indigenous youth.
28 CFR 115.14 - Youthful inmates.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Standards for Adult Prisons and Jails Prevention Planning § 115.14 Youthful inmates. (a) A youthful inmate... contact with any adult inmate through use of a shared dayroom or other common space, shower area, or... sound separation between youthful inmates and adult inmates, or (2) Provide direct staff supervision...
Conceptualizing Youth Empowerment within Tobacco Control
ERIC Educational Resources Information Center
Holden, Debra J.; Messeri, Peter; Evans, W. Douglas; Crankshaw, Erik; Ben-Davies, Maureen
2004-01-01
This article presents a conceptual framework that was developed to guide a national evaluation of the American Legacy Foundation's (Legacy) Statewide Youth Movement Against Tobacco Use (SYMATU) program. This program was designed to develop youth-led, youth-directed initiatives within local communities. Two evaluation studies were designed and…
Utilizing technology for longitudinal communication with homeless youth.
Bender, Kimberly; Begun, Stephanie; DePrince, Anne; Haffejee, Badiah; Kaufmann, Sarah
2014-10-01
The current study investigated forms of technology (phone calls, texts, email and Facebook) for maintaining contact with homeless youth over baseline, 1-week, 6-week, and 3-month follow-up interviews. The study combined quantitative tracking of youths' response patterns and open-ended interviews regarding youths' preferred methods of communication. Results indicate that maintaining communication with homeless youth requires persistence, including frequent contact attempts over several days. Cell phone contacts (calls or texts) were most successful in communicating with youth, with e-mail and Facebook messaging useful when phones were lost or stolen. Youth who maintained contact were strikingly similar to youth who discontinued contact.
IMPACT Youth Crime Prevention.
ERIC Educational Resources Information Center
Warrington, Georgina; Wright, Paul
2003-01-01
Four models of crime prevention are discussed that arise from differing views of the causes of crime: criminal justice, situational, developmental, and social development models. Two activity-based youth crime prevention projects in Queensland (Australia) use developmental and social development models and expand local youth service…
LGBT Youth and Family Acceptance
Katz-Wise, Sabra L.; Rosario, Margaret; Tsappis, Michael
2016-01-01
Summary In this article, we address theories of attachment and parental acceptance and rejection, and their implications for lesbian, gay, bisexual, and transgender (LGBT) youths’ identity and health. We also provide two clinical cases to illustrate the process of family acceptance of a transgender youth and a gender nonconforming youth who was neither a sexual minority nor transgender. Clinical implications of family acceptance and rejection of LGBT youth are discussed. PMID:27865331
Youth Empowerment and High School Gay-Straight Alliances
Muraco, Anna; Subramaniam, Aarti; Laub, Carolyn
2010-01-01
In the field of positive youth development programs, “empowerment” is used interchangeably with youth activism, leadership, civic participation and self-efficacy. However, few studies have captured what empowerment means to young people in diverse contexts. This article explores how youth define and experience empowerment in youth-led organizations characterized by social justice goals: high school Gay-Straight Alliances (GSAs). Through focus group interviews, fifteen youth leaders of GSAs from different regions of California explain what they think empowerment means and how they became empowered through their involvement with the GSA. Youth describe three inter-related dimensions of empowerment: personal empowerment, relational empowerment, and strategic empowerment through having and using knowledge. When these three dimensions are experienced in combination, GSA leaders have the potential for individual and collective empowerment as agents of social change at school. By understanding these youth's perspectives on the meanings of empowerment, this article clarifies the conceptual arena for future studies of socially marginalized youth and of positive youth development. PMID:19636734
Cultural correlates of youth suicide.
Eckersley, Richard; Dear, Keith
2002-12-01
Youth suicide has risen in most developed nations over the past 50 years, especially among males, but the increase remains to be explained. Statistical analyses were used to examine associations between youth suicide rates in 11-21 mainly Western, developed nations and 32 socio-economic and cultural variables. The central hypothesis was that suicide rates would be correlated with various cultural measures of social attachment and integration, especially individualism. Socio-economic variables were included in the analysis to demonstrate the relative strength of the cultural associations. The study found a strong positive correlation between male youth suicide rates and subjective measures of health, optimism, and several indices of individualism, including personal freedom and control. Correlations between female youth suicide and individualism were smaller, attaining significance in only one instance. Male youth suicide and individualism were negatively correlated with older people's sense of parental duty. Correlations between suicide and other possibly relevant cultural variables--tolerance of suicide, belief in God and national pride--were not significant. The analysis of socio-economic variables yielded only one significant, but doubtful, correlation. The findings can be interpreted as supporting two very different hypotheses: that youth suicide represents "an island of misery in an ocean of happiness" or "the tip of an iceberg of suffering". In favouring the latter interpretation, and consistent with Durkheim's theories on suicide, it is argued that increased youth suicide reflects a failure of Western societies to provide appropriate sites or sources of social identity and attachment, and, conversely, a tendency to promote unrealistic or inappropriate expectations of individual freedom and autonomy.
First aid on field management in youth football.
Krutsch, Werner; Voss, Andreas; Gerling, Stephan; Grechenig, Stephan; Nerlich, Michael; Angele, Peter
2014-09-01
Sufficient first aid equipment is essential to treat injuries on football fields. Deficits in first aid on field are still present in youth football. Injury pattern in youth football over one season and first aid equipment in youth football were analyzed, retrospectively. PRICE and ABC procedure served as basic principles in emergency management to assess the need for first aid equipment on field. Considering financial limits and adapted on youth football injuries, sufficient first aid equipment for youth football was configured. 84% of 73 participating youth football teams had their own first aid kit, but the majority of them were insufficiently equipped. Team coaches were in 60% of all youth teams responsible for using first aid equipment. The injury evaluation presented 922 injuries to 1,778 youth players over one season. Frequently presented types of injury were contusions and sprains of the lower extremity. Based on the analyzed injury data in youth football, first aid equipment with 90 € is sufficient for 100% of all occurred youth football injuries. Current first aid equipment in youth football is insufficient. Scientific-based first aid equipment with 90 € is adequate to serve all injuries. Football coaches need education in first aid management.
Youth Risk Factors and Educational Outcomes of Mentored and Non-Mentored Youth
ERIC Educational Resources Information Center
Castellanos-Brown, Karen
2010-01-01
As mentoring is receiving increasing attention as a method to improve youth educational outcomes, it is important to continue to examine the effects of mentoring on these youth outcomes. This study uses secondary data from Waves I and III of the National Longitudinal Study of Adolescent Health (Add Health) and transcript data from the Adolescent…
Supporting youth involved in domestic minor sex trafficking: Divergent perspectives on youth agency.
Sapiro, Beth; Johnson, Laura; Postmus, Judy L; Simmel, Cassandra
2016-08-01
Domestic-minor sex trafficking (DMST) continues to affect youth in the United States; however, lack of empirical evidence for interventions and the complex sociopolitical discourses surrounding sex trafficking and the commercial sexual exploitation of children (CSEC) hamper delivery of effective services to this population. To explore perspectives on best practices with these young people, 20 in-depth interviews were conducted with key stakeholders whose work provides them with a unique vantage point on the needs and experiences of survivors of DMST in New Jersey. Notes from interviews were coded and analyzed for emergent themes. While key stakeholders generally agreed on best practices, there were several important areas of dispute that emerged regarding how best to serve youth involved in DMST, specifically with regard to youth running away from services, models of service provision, and the use of technology by these youth. Findings suggest that professionals from diverse backgrounds may disagree about the extent to which youth involved in DMST possess agency in their decision-making capacities as adolescents. This study explores these areas of dispute, and discusses the implications for the many different professionals and systems that must work together in providing services to this population. Copyright © 2016 Elsevier Ltd. All rights reserved.
Motuma, Aboma; Syre, Thomas; Egata, Gudina; Kenay, Abera
2016-07-17
Youth friendly services are designed to make health services accommodate the unique needs of youth. Nevertheless, in developing countries like Ethiopia, the level of knowledge about the use of these services is limited. The main aim of this study was to assess the extent of youth friendly service utilization and the associated factors among the youth. A community based- cross sectional quantitative study design supplemented with qualitative inquiry was used from January to February 2011. Data were collected from a random sample of 845 youth using a pretested structured questionnaire. Qualitative data were collected through interview guides. Odds ratios, along with 95 % confidence level, were estimated to measure the strength of association between the study variables using multivariable logistic regression. Level of statistical significance was declared at p-value less than 0.05. Thematic analysis was used to analyze the qualitative data. Nearly 64 % of the youth had already utilized youth friendly services at least once at the time of the survey. In multivariable logistic regression analysis, using friends [AOR = 3.65, 95 % CI (1.81,7.32)], health care providers [AOR = 3.27, 95 % CI (1.18,9.00)], and schools [AOR = 1.79, 95 % CI (1.00,3.19) as source of information, and having knowledge about the youth friendly services [AOR = 2.77,95 % CI (1.93,3.96)] were significantly associated with the utilization of youth friendly services. In contrast, being daily laborer and private worker by occupation [AOR = 0.12, 95 % CI (0.05, 0.92)], having negative perception about counseling [AOR = 0.50, 95 % CI (0.31-0.80)], about reproductive health services [AOR = 0 .13, 95 % CI (0.04-0.46)], and about youth friendly service providers [AOR-0.02, 95 % CI (0.08-0.50)] negatively influenced the outcome variable. The utilization of youth friendly services is moderate in this study. Getting youth related services information from different sources
Horsfield, Emma; Kelly, Fiona; Clark, Terryann; Sheridan, Janie
2014-01-01
The international youth population has significant unmet health needs, and there have been many calls to increase youth health care access. Community pharmacies may be able to help address these needs, but very little research has investigated this area and it is not known whether the current community pharmacy setting is acceptable or appropriate for youth. 1) To obtain information on physical factors which could affect young people's use of community pharmacies in New Zealand, including accessibility, opening times and the physical youth-friendliness of the pharmacy environment. 2) To involve and utilize young people in the research process, in order to understand their needs and interpretation of survey data. This study applied a cross sectional survey design, informed by a sequential youth participatory approach. A questionnaire was developed in consultation with a youth advisory group (YAG). Questionnaires distributed to pharmacists at 500 randomly selected pharmacies nationwide between May and September 2011 collected information on whether the pharmacy met selected youth-friendly criteria. These included physical aspects of youth-friendliness, such as opening times and the pharmacy environment. The YAG also provided a youth perspective in the interpretation of the results. Three mail shots achieved a response rate of 50.5%. Most respondents reported the pharmacy to be accessible by public transport and many had extended opening hours. Although most pharmacies met some youth-friendly criteria with regards to the pharmacy environment (e.g. having a private consultation area), more specific criteria (such as displaying youth health information) were usually not met. Interpretive feedback from the YAG highlighted areas for improvement. Pharmacies show potential as youth-friendly health care access points and most already meet some youth-friendly criteria. Areas identified for improvement will require a greater youth focus from the profession, and should be
Automation of Oklahoma School Library Media Centers: Automation at the Local Level.
ERIC Educational Resources Information Center
Oklahoma State Dept. of Education, Oklahoma City. Library and Learning Resources Section.
This document outlines a workshop for media specialists--"School Library Automation: Solving the Puzzle"--that is designed to reduce automation anxiety and give a broad overview of the concerns confronting school library media centers planning for or involved in automation. Issues are addressed under the following headings: (1) Levels of School…
ERIC Educational Resources Information Center
Perkins, Daniel F.; Borden, Lynne M.; Villarruel, Francisco A.; Carlton-Hug, Annelise; Stone, Margaret R.; Keith, Joanne G.
2007-01-01
This study examines the cultural and contextual factors that influence the decisions of underrepresented urban youth, who identify themselves as Black/African American, Latino, Arab, or Chaldean, to participate in youth programs. Although youth programs are increasingly recognized for their positive influences, little is known about the factors…
Melchior, Maria; Chastang, Jean-François; Walburg, Vera; Arseneault, Louise; Galéra, Cédric; Fombonne, Eric
2010-12-01
It is not clear whether socioeconomic inequalities with regard to depression and anxiety are present in adolescence and young adulthood. We tested the hypothesis that in the community, youths growing up in families with low income have elevated rates of such psychological difficulties. We used data from participants of the GAZEL Youth study, a French community-based cohort assessed in 1991 and 1999 (n = 941 youths, 4-18 years of age at baseline). Measures of family income and youths' symptoms of depression and anxiety (assessed using the ASEBA family of instruments) were obtained from parents and youths at study baseline and follow-up. Covariates included family characteristics (parental divorce, parental unemployment or labor force exit, parental health difficulties including psychopathology and the quality of family relations) and youths' characteristics (sex, age, stressful life events, history of internalizing and externalizing problems). Youths from families with low income during the study period had elevated odds of symptoms of depression and anxiety at follow-up (compared to youths from families with intermediate/high income, age-adjusted OR: 1.74, 95% CI 1.17-2.57; fully adjusted OR: 1.94, 95% CI: 1.27-2.97). In particular, the likelihood of psychological difficulties was elevated among youths from families that experienced decreasing and persistently low income over time (fully adjusted ORs, respectively: 2.44, 95% CI 1.24-4.81 and 1. 83, 95% 1.10-3.06). Clinicians need to be aware that youths growing up in low-income families in the community may be at risk of depression and anxiety during the period of transition to adulthood. © 2010 Wiley-Liss, Inc.
Swahn, Monica H; Bossarte, Robert M
2009-01-01
This study examined whether youth who live in an urban, disadvantaged community are significantly more likely than youth representing the nation to engage in a range of health-compromising behaviors. Analyses were based on the Youth Violence Survey conducted in 2004 and administered to students (n=4131) in a high-risk school district. Students in ninth grade (n=1114) were compared with ninth-grade students in the 2003 national Youth Risk Behavior Survey (n=3674) and the National Longitudinal Study of Adolescent Health conducted in 1995/1996 (n=3523). Analyses assessed the differences in prevalence of risk and protective factors among ninth-grade students from the three studies using Chi-square tests. The results showed that youth in this urban, disadvantaged community were significantly more likely than their peers across the country to report vandalism, theft, violence, and selling drugs. Youth in this community also reported significantly less support from their homes and schools, and less monitoring by their parents. Moreover, youth in this community were significantly less likely to binge drink or initiate alcohol use prior to age 13 than youth across the U.S. Youth who live in this urban, disadvantaged community reported significantly higher prevalence of some, but not all, risky behaviors than nationally representative U.S. youth. These findings highlight that some caution is justified when defining what might constitute high risk and that demographic and other characteristics need to be carefully considered when targeting certain high-risk behaviors.
Physical Dating Violence Victimization Among Sexual Minority Youth
Luo, Feijun; Tharp, Andra T.
2014-01-01
Objectives. We examined (1) whether sexual minority youths (SMYs) are at increased risk for physical dating violence victimization (PDVV) compared with non-SMYs, (2) whether bisexual youths have greater risk of PDVV than lesbian or gay youths, (3) whether youths who have had sexual contact with both sexes are more susceptible to PDVV than youths with same sex–only sexual contact, and (4) patterns of PDVV among SMYs across demographic groups. Methods. Using 2 measures of sexual orientation, sexual identity and sexual behavior, and compiling data from 9 urban areas that administered the Youth Risk Behavior Surveys from 2001 to 2011, we conducted logistic regression analyses to calculate odds of PDVV among SMYs across demographic sub-samples. Results. SMYs have significantly increased odds of PDVV compared with non-SMYs. Bisexual youths do not have significantly higher odds of PDVV than gay or lesbian youths, but youths who had sexual contact with both-sexes possess significantly higher odds of PDVV than youths with same sex–only sexual contact. These patterns hold for most gender, grade, and racial/ethnic subgroups. Conclusions. Overall, SMYs have greater odds of PDVV versus non-SMYs. Among SMYs, youths who had sexual contact with both sexes have greater odds of PDVV than youths with same sex–only sexual contact. Prevention programs that consider sexual orientation, support tolerance, and teach coping and conflict resolution skills could reduce PDVV among SMYs. PMID:25121813
Enhancing the educational achievement of at-risk youth.
Schinke, S P; Cole, K C; Poulin, S R
2000-03-01
This study examined a non-school program aimed at enhancing the educational performance of economically disadvantaged early adolescents who live in public housing. The educational enhancement program included discussions with adults, writing activities, leisure reading, homework, helping others, and games using cognitive skills. A three-arm research design juxtaposed program youth who received educational enhancements with comparison youth in affiliated facilities who did not receive the program and with control youth in other community programs without educational enhancements. From youths, follow-up data collected 2 1/2 years after baseline revealed uniformly positive outcomes for program youth on measures of reading, verbal skills, writing, and tutoring. Teacher reports at final follow-up favored program and comparison youth over controls on measures of reading, writing, games, overall school performance, and interest in class material. School grades were higher for program youth than for comparison and control youth for reading, spelling, history, science, and social studies. Overall grade averages were higher for program youth versus comparisons and controls, as was school attendance. Study data lend empirical support to the provision of educational enhancements in non-school settings for at-risk youths.
Ball, Oliver; Robinson, Sarah; Bure, Kim; Brindley, David A; Mccall, David
2018-04-01
Phacilitate held a Special Interest Group workshop event in Edinburgh, UK, in May 2017. The event brought together leading stakeholders in the cell therapy bioprocessing field to identify present and future challenges and propose potential solutions to automation in cell therapy bioprocessing. Here, we review and summarize discussions from the event. Deep biological understanding of a product, its mechanism of action and indication pathogenesis underpin many factors relating to bioprocessing and automation. To fully exploit the opportunities of bioprocess automation, therapeutics developers must closely consider whether an automation strategy is applicable, how to design an 'automatable' bioprocess and how to implement process modifications with minimal disruption. Major decisions around bioprocess automation strategy should involve all relevant stakeholders; communication between technical and business strategy decision-makers is of particular importance. Developers should leverage automation to implement in-process testing, in turn applicable to process optimization, quality assurance (QA)/ quality control (QC), batch failure control, adaptive manufacturing and regulatory demands, but a lack of precedent and technical opportunities can complicate such efforts. Sparse standardization across product characterization, hardware components and software platforms is perceived to complicate efforts to implement automation. The use of advanced algorithmic approaches such as machine learning may have application to bioprocess and supply chain optimization. Automation can substantially de-risk the wider supply chain, including tracking and traceability, cryopreservation and thawing and logistics. The regulatory implications of automation are currently unclear because few hardware options exist and novel solutions require case-by-case validation, but automation can present attractive regulatory incentives. Copyright © 2018 International Society for Cellular Therapy
Parental Communication and Youth Sexual Behaviour
ERIC Educational Resources Information Center
Aspy, Cheryl B.; Vesely, Sara K.; Oman, Roy F.; Rodine, Sharon; Marshall, LaDonna; McLeroy, Ken
2007-01-01
The role of parental communication and instruction concerning sexual behaviour were studied in a community-based sample of 1083 youth aged 13-17 (mean age of 15 years; 51% girls, 49% White). The Youth Asset Survey was administered along with items measuring demographics and youth risk behaviours. After controlling for demographic factors,…
Transgender Youth and Life-Threatening Behaviors
ERIC Educational Resources Information Center
Grossman, Arnold H.; D'Augelli, Anthony R.
2007-01-01
Sexual minority status is a key risk factor for suicide among lesbian, gay, and bisexual youth; however, it has not been studied among transgender youth. Fifty-five transgender youth reported on their life-threatening behaviors. Nearly half of the sample reported having seriously thought about taking their lives and one quarter reported suicide…
The Mentor-Youth Alliance: The Role of Mentoring Relationships in Promoting Youth Competence
ERIC Educational Resources Information Center
Zand, Debra H.; Thomson, Nicole; Cervantes, Richard; Espiritu, Rachele; Klagholz, Donna; LaBlanc, Laura; Taylor, Andrea
2009-01-01
Mentoring programs hold great promise for fostering competency in disadvantaged youth. Although considerable theoretical work has been conducted to explain the role of mentoring relationships in promoting positive youth outcomes, very little empirical research has directly investigated this alliance. The present study developed and validated a…
Alcohol advertising and youth: a measured approach.
Jernigan, David H; Ostroff, Joshua; Ross, Craig
2005-09-01
Where alcohol industry self-regulation is the primary protection against youth exposure to alcohol advertising, independent, systematic monitoring of youth exposure can promote public awareness of and greater accountability in the industry's practices. Using commercially available databases, the Center on Alcohol Marketing and Youth has combined occurrence and audience data to calculate youth (aged 12-20 years) and adult (above the United States legal drinking age of 21 years) exposure to alcohol advertising on television and radio, in magazines and on the Internet. This research in the United States shows that alcohol companies have placed significant amounts of advertising where youth are more likely per capita to be exposed to it than adults. Further analyses by the Center have demonstrated that much of this excess exposure of youth to alcohol advertising in the United States could be eliminated if alcohol companies would adopt a threshold of 15% (roughly the proportion of 12-20-years-old in the population 12 and above) as the maximum youth audience composition for their advertising. Although adoption of such a threshold would still leave much youth exposure to alcohol marketing in such "unmeasured" activities as sponsorships, on-premise promotions and campus marketing, it would assist alcohol companies in reaching their intended audiences more efficiently while reducing overall youth exposure to their advertising.
Smythe, M H
1997-01-01
Automation, a hot topic in the laboratory world today, can be a very expensive option. Those who are considering implementing automation can save time and money by examining the issues from the standpoint of an industrial/manufacturing engineer. The engineer not only asks what problems will be solved by automation, but what problems will be created. This article discusses questions that must be asked and answered to ensure that automation efforts will yield real and substantial payoffs.
ERIC Educational Resources Information Center
Lippold, Melissa A.; Greenberg, Mark T.; Feinberg, Mark E.
2011-01-01
Most studies that explore parental knowledge of youths' activities utilize parents' and youths' reports separately. Using a sample of 938 rural early adolescents (53% female; 84% White), we explore congruence between mothers' and youths' perceptions of maternal knowledge and its association with youth problem behaviors (delinquency, substance use,…
Youth and Caregiver Perspectives on Barriers to Gender-Affirming Health Care for Transgender Youth.
Gridley, Samantha J; Crouch, Julia M; Evans, Yolanda; Eng, Whitney; Antoon, Emily; Lyapustina, Melissa; Schimmel-Bristow, Allison; Woodward, Jake; Dundon, Kelly; Schaff, RaNette; McCarty, Carolyn; Ahrens, Kym; Breland, David J
2016-09-01
Few transgender youth eligible for gender-affirming treatments actually receive them. Multidisciplinary gender clinics improve access and care coordination but are rare. Although experts support use of pubertal blockers and cross-sex hormones for youth who meet criteria, these are uncommonly offered. This study's aim was to understand barriers that transgender youth and their caregivers face in accessing gender-affirming health care. Transgender youth (age 14-22 years) and caregivers of transgender youth were recruited from Seattle-based clinics, and readerships from a blog and support group listserv. Through individual interviews, focus groups, or an online survey, participants described their experiences accessing gender-affirming health care. We then used theoretical thematic analysis to analyze data. Sixty-five participants (15 youth, 50 caregivers) described barriers spanning six themes: (1) few accessible pediatric providers are trained in gender-affirming health care; (2) lack of consistently applied protocols; (3) inconsistent use of chosen name/pronoun; (4) uncoordinated care and gatekeeping; (5) limited/delayed access to pubertal blockers and cross-sex hormones; and (6) insurance exclusions. This is the first study aimed at understanding perceived barriers to care among transgender youth and their caregivers. Themed barriers to care led to the following recommendations: (1) mandatory training on gender-affirming health care and cultural humility for providers/staff; (2) development of protocols for the care of young transgender patients, as well as roadmaps for families; (3) asking and recording of chosen name/pronoun; (4) increased number of multidisciplinary gender clinics; (5) providing cross-sex hormones at an age that permits peer-congruent development; and (6) designating a navigator for transgender patients in clinics. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Sun, Delin; Haswell, Courtney C; Morey, Rajendra A; De Bellis, Michael D
2018-04-10
Child maltreatment is a major cause of pediatric posttraumatic stress disorder (PTSD). Previous studies have not investigated potential differences in network architecture in maltreated youth with PTSD and those resilient to PTSD. High-resolution magnetic resonance imaging brain scans at 3 T were completed in maltreated youth with PTSD (n = 31), without PTSD (n = 32), and nonmaltreated controls (n = 57). Structural covariance network architecture was derived from between-subject intraregional correlations in measures of cortical thickness in 148 cortical regions (nodes). Interregional positive partial correlations controlling for demographic variables were assessed, and those correlations that exceeded specified thresholds constituted connections in cortical brain networks. Four measures of network centrality characterized topology, and the importance of cortical regions (nodes) within the network architecture were calculated for each group. Permutation testing and principle component analysis method were employed to calculate between-group differences. Principle component analysis is a methodological improvement to methods used in previous brain structural covariance network studies. Differences in centrality were observed between groups. Larger centrality was found in maltreated youth with PTSD in the right posterior cingulate cortex; smaller centrality was detected in the right inferior frontal cortex compared to youth resilient to PTSD and controls, demonstrating network characteristics unique to pediatric maltreatment-related PTSD. Larger centrality was detected in right frontal pole in maltreated youth resilient to PTSD compared to youth with PTSD and controls, demonstrating structural covariance network differences in youth resilience to PTSD following maltreatment. Smaller centrality was found in the left posterior cingulate cortex and in the right inferior frontal cortex in maltreated youth compared to controls, demonstrating attributes of structural
Youth Conservation Corps Guidance.
ERIC Educational Resources Information Center
Fish and Wildlife Service (Dept. of Interior), Washington, DC.
This document provides guidelines for operating Youth Conservation Corps programs under both the Fish and Wildlife Service and the National Park Service. The guide contains 11 units that cover the following topics: (1) enrollees; (2) enrollee payroll; (3) enrollee problems; (4) Youth Conservation Corps staff; (5) accounting; (6) operations; (7)…
Youth Violence: Lessons from the Experts.
ERIC Educational Resources Information Center
Rinehart, P. Mann; Borowsky, I.; Stolz, A.; Latts, E.; Cart, C. U.; Brindis, C. D.
This monograph summarizes what is known about youth and violence, identifying 10 myths that confound people's understanding of the real causes of youth violence. It focuses on: what contributes to youth violence (e.g., children exposed to domestic violence are at risk of using violence, children and adolescents use guns when they are easily…
Mentoring Transition-Age Youth with Blindness
ERIC Educational Resources Information Center
Bell, Edward C.
2012-01-01
This article reports on a mentoring project designed for transition-age youth (ages 16-26) who are persons with legal blindness. Youth were matched with adult mentors who were also persons with blindness but who have achieved academic and career success. Results demonstrate that youth who participated in the project for 2 years had significant…
Saletsky, Ronald D.; Trief, Paula M.; Anderson, Barbara J.; Rosenbaum, Paula; Weinstock, Ruth S.
2014-01-01
INTRODUCTION Parenting behaviors and family conflict relate to type 1 diabetes outcomes in youth. The purpose of this study was to understand these relationships in parents and youth with type 2 diabetes (T2DM). METHODS The TODAY (Treatment Options for type 2 Diabetes in Adolescents and Youth) trial enrolled youth (10-17 years) with recent-onset T2DM and parent/guardian. For this ancillary study, we enrolled a sample of youth-parent pairs (N =137) in one TODAY study arm (metformin plus lifestyle intervention). Parents and youths completed questionnaires to assess parenting style related to normative (e.g., completing homework) and diabetes self-care (e.g., testing blood glucose) tasks, and parent-youth verbal conflict (baseline, 6 and 12 months). RESULTS Parenting style was consistent across normative and diabetes tasks, with gradual increases in autonomy perceived by youth. Conversations were generally calm, with greater conflict regarding normative tasks than diabetes tasks at baseline (youth: p<0.001, parent: p=0.01), 6 months (youth: p=0.02, parent: p >0.05) and 12 months (youth: p> 0.05., parent: p=0.05). A permissive parenting style towards normative tasks and a less authoritarian style towards diabetes tasks, at baseline, predicted better medication adherence (8-12 months) (normative: adjusted R2=0.48, p<0.001; diabetes: adjusted R2 = 0.47, p<0.001). Parent-youth conflict did not predict medication adherence. DISCUSSION Youth with T2DM who perceive more autonomy (less parental control) in day-to-day and diabetes tasks are more likely to adhere to medication regimens. It may be valuable to assess youth perceptions of parenting style at onset of medication treatment and help parents understand youths’ needs for autonomy. PMID:24548045
Growth-promoting relationships with children and youth.
Spencer, Renée; Rhodes, Jean E
2014-12-01
At the heart of afterschool programs are the relationships that form between the children and youth who participate in these programs and the adults who lead them. To be effective, adults working in afterschool settings must be able to engage youth in growth-promoting relationships. This article identifies and describes four foundational ways of interacting with youth that foster the development of such relationships-engaging in warm and emotionally supportive connections, providing developmentally appropriate structure and support, cultivating and responding to youth initiative, and scaffolding and propelling youth learning and skill development. © 2014 WILEY PERIODICALS, INC.
Saito, Rebecca N
2006-01-01
Increasing access, even increasing supply, may not be sufficient to attract young teens who do not typically participate in youth programs. Several youth mapping projects in rural and urban communities have led to these conclusions: youth do not know what is available even in their own neighborhoods, young teens have a strong voice in how they spend their discretionary time, and we need to learn how to market youth programs much more effectively. This author reviews important findings from youth community-mapping experiences and showcases a project attempting to move beyond access and supply issues to increasing young people's interest and engagement in community youth development programs.
Youth justice and mental health in perspective.
Leschied, Alan
2011-01-01
Research indentifies that a significant proportion of youth within the justice system possess some form of mental health disorder, and that the presence of an emotional disorder can provide important explanatory value regarding the causes of crime. Evidence is now overwhelming that services within the youth justice system need to account for the causes of crime in order to effectively reduce the likelihood of reoffending. Such an ethic within youth justice service delivery not only reduces symptoms and risk within the youth and their families but also is linked to increasing community safety through reductions in reoffending. This review characterizes the relevance of mental health disorder in considering the needs of anti-social youth, and how this appreciation is linked to the delivery of effective services as well as what constitutes supportive youth justice legislation.
Meredith, P
1990-12-01
Departing from the usual family planning education format in teenage counseling, the IPPF is funding youth centers providing contraception as well as education in Ethiopia, Kenya, Togo, Tunisia, and Turkey. The development concern is for a cost efficient and effective center with minimal criticism. 2 experimental Mexican models were used in the Ethiopian youth centers. Both models utilize young adult coordinators who supervise young promoters, however each operates differently. Mexican staff trained their African counterparts and a detailed project manual will be available soon. The Ethiopian youth centers utilizing NGO's and the private sector have been permitted freedom from central control. Alarming statistics include: 20.8% of pregnancies are teenaged; 20.8% of hospital reported abortions are teenaged; the contraceptive prevalence rate is 2%; population increased by 3% per year with the average children per woman of 7.5. Addis Ababa's youth project provides services to mostly zone 5 school aged adolescents who are informed and eager to purchase condoms, although they are not able to purchase them commercially. Revolutionary Ethiopian Youth Association (REYA) with its 200,000 membership, is increasing its contribution to expanding the network of promoters. Promoters are used to register those receiving free condoms, but the recommendation to cease this practice of registration is in, and replace it with the sale of 50 US cents per condom.
Fuzzy Control/Space Station automation
NASA Technical Reports Server (NTRS)
Gersh, Mark
1990-01-01
Viewgraphs on fuzzy control/space station automation are presented. Topics covered include: Space Station Freedom (SSF); SSF evolution; factors pointing to automation & robotics (A&R); astronaut office inputs concerning A&R; flight system automation and ground operations applications; transition definition program; and advanced automation software tools.
Jardine, Cynthia G.; James, Angela
2012-01-01
Objectives To examine the benefits, limitations and ethical issues associated with conducting participatory research on tobacco use using youth to research other youth. Study design Community-based participatory research. Methods Research on tobacco use was conducted with students in the K’àlemì Dene School and Kaw Tay Whee School in the Northwest Territories, Canada, using PhotoVoice. The Grade 9–12 students acted as researchers. Researcher reflections and observations were assessed using “member checking,” whereby students, teachers and community partners could agree or disagree with the researcher's interpretation. The students and teachers were further asked informally to share their own reflections and observations on this process. Results and conclusions Using youth to research other youth within a participatory research framework had many benefits for the quality of the research, the youth researchers and the community. The research was perceived by the researchers and participants to be more valid and credible. The approach was more appropriate for the students, and the youth researchers gained valuable research experience and a sense of ownership of both the research process and results. Viewing smoking through their children's eyes was seen by the community to be a powerful and effective means of creating awareness of the community environment. Limitations of the approach were residual response bias of participants, the short period of time to conduct the research and failure to fully explore student motivations to smoke or not to smoke. Ethical considerations included conducting research with minors, difficulties in obtaining written parental consent, decisions on cameras (disposable versus digital) and representation of all participants in the final research product. PMID:22584512
2005 Youth Sports National Report Card
ERIC Educational Resources Information Center
Strategies: A Journal for Physical and Sport Educators, 2006
2006-01-01
For the first time ever, Citizen Through Sports Alliance (CTSA) convened a panel of youth sports experts from across the country to evaluate youth sports in the United States and articulate its successes and failures. The panel evaluated only community-based youth sports programs, focusing on those that serve children ages 6 to 14. The panel is…
Youth Employment in the Hospitality Sector.
ERIC Educational Resources Information Center
Schiller, Bradley R.
A study used data from the National Longitudinal Surveys of Youth to analyze the long-term effects of hospitality industry employment on youth. The subsample extracted for the study included all youth who were aged 16-24 in 1980 and employed in the civilian sector for pay at any time in the year. Statistics indicated the hospitality sector was…
Prescription drug misuse among homeless youth.
Rhoades, Harmony; Winetrobe, Hailey; Rice, Eric
2014-05-01
Prescription drug misuse (PDM) is highly prevalent among youth in the U.S., and can have serious health consequences. Homeless youth are a particularly vulnerable population with high rates of substance use. However, PDM has not been studied in a sample comprised exclusively of homeless youth. A sample of 451 homeless youth recruited from drop-in centers in Los Angeles, CA, provided information on substance use, mental health, service utilization, trauma, and sexual risk behavior. Multivariable logistic regression assessed correlates of past month PDM. Nearly 50% reported lifetime PDM and 21.6% reported PDM in the past month. The most frequently used prescriptions in the past month were: opioids only (24.5%), sedatives only (23.4%), and stimulants only (10.6%); 14.9% used some combination of these three types of prescription medications. Homeless youth reported that prescriptions were most commonly obtained for free from friends or relatives (24.5%). Foster care involvement was associated with decreased PDM, while hard drug use, suicidal ideation, and unprotected sex were associated with increased PDM. Homeless youth report high rates of PDM, and access these medications most frequently from friends and family. PDM among homeless youth clusters with other risk factors, including hard drug use, unprotected sex, and suicidal ideation. Surprisingly, foster care history was associated with decreased PDM. Programs aimed at preventing PDM among homeless youth should recognize the clustering of risk behaviors, assess prescription use/access when providing mental health services, and educate the general public about proper disposal of prescriptions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
ERIC Educational Resources Information Center
Taggart, Robert
Prepared as a basic background document for an interagency task force on youth employment, this report analyzes youth employment policies and programs for the 1980s. The main body of the report consists of three sections. Section 1, entitled "Policy Perspectives on the Youth Employment Problem," contains a discussion of pathways to…
ERIC Educational Resources Information Center
Small, Kevonne; Zweig, Janine M.
2007-01-01
An estimated 7.0% to 8.1% of American youth report being sexually victimized at some point in their life time. This article presents a background to youth sexual victimization, focusing on prevalence data, challenging issues when studying this problem, risk factors, and common characteristics of perpetrators. Additionally, a type of sexual…
Nerlander, Lina M.C.; Zapata, Lauren B.; Yorick, Roman; Skipalska, Halyna; Smith, Ruben A.; Kissin, Dmitry M.; Jamieson, Denise J.; Vitek, Charles R.; Hillis, Susan D.
2017-01-01
Background Little is known about the extent to which HIV-infected street youth (living part or full time on the streets) exhibit behaviors associated with HIV transmission in their interactions with youth not living on the streets (“non–street youth”). We aimed to determine prevalences and predictors of such “bridging behaviors”: inconsistent condom use and needle sharing between HIV-positive street youth and non–street youth. Methods A total of 171 street youth in 3 Ukrainian cites were identified as HIV infected after testing of eligible participants aged 15 to 24 years after random selection of venues. Using data from these youth, we calculated prevalence estimates of bridging behaviors and assessed predictors using logistic regression. Results Overall, two-thirds of HIV-infected street youth exhibited bridging behaviors; subgroups with high prevalences of bridging included females (78.3%) and those involved in transactional sex (84.2%). In multivariable analysis, inconsistent condom use with non–street youth was associated with being female (adjusted prevalence ratio [aPR], 1.2; 95% confidence interval [CI], 1.1–1.4), working (aPR, 1.2; 95% CI, 1.03–1.4), multiple partners (aPR, 1.4; 95% CI, 1.2–1.6), and “never” (aPR, 1.4; 95% CI, 1.1–1.6) or “sometimes” (aPR, 1.3; 95% CI, 1.02–1.8) versus “always” sleeping on the street. Needle sharing with non–street youth was associated with being male (aPR, 1.4; 95% CI, 1.02–2.0), orphaned (aPR, 2.3; 95% CI, 1.8–3.0), and 2 years or less living on the streets (aPR, 1.8; 95% CI, 1.5–2.1). Conclusions Bridging behaviors between HIV-infected street youth and non–street youth are common. Addressing the comprehensive needs of street and other at-risk youth is a critical prevention strategy. PMID:26267878
ERIC Educational Resources Information Center
Daigneault, Isabelle; Dion, Jacinthe; Hebert, Martine; McDuff, Pierre; Collin-Vezina, Delphine
2013-01-01
Objective: Explore the psychometric properties of the French Canadian version of the Child and Youth Resilience Measure (CYRM-28, Resilience Research Center, 2009; Ungar et al., 2008) in youth samples. Method: Two investigations were conducted. Participants in Study 1 were 589 youth (60% female) in grades 10-12 from 2 urban public high schools.…
Health Risk Behavior in Foster Youth
Gramkowski, Bridget; Kools, Susan; Paul, Steven; Boyer, Cherrie; Monasterio, Erica; Robbins, Nancy
2010-01-01
Problem Adolescent health problems are predominantly caused by risk behavior. Foster adolescents have disproportionately poor health; therefore identification of risk behavior is critical. Method A secondary analysis of data from a larger study investigated the health risk behavior of 56 foster youth using the CHIP-AE. Findings Foster youth had some increased risk behavior. Younger adolescents and those in kinship care had less risky behavior. Youth had more risk behavior when: in group homes, parental death, histories of physical or emotional abuse, or history of attempted suicide. Conclusions These results point to areas of strength and vulnerability in foster youth. PMID:19490278
Positive Youth Development within a Family Leisure Context: Youth Perspectives of Family Outcomes
ERIC Educational Resources Information Center
Ward, Peter J.; Zabriskie, Ramon B.
2011-01-01
Family leisure involvement may provide the first and most essential context for positive youth development in today's society. Similar to the broader ecological perspective used in the youth development literature, family systems theory suggests that each individual in the family influences the whole, while the whole family also influences each…
Politics, Gender and Youth Citizenship in Senegal: Youth Policing of Dissent and Diversity
ERIC Educational Resources Information Center
Crossouard, Barbara; Dunne, Máiréad
2015-01-01
This paper reports on empirical research on youth as active citizens in Senegal with specific reference to their education and their sexual and reproductive health rights. In a context of postcoloniality which claims to have privileged secular, republican understandings of the constitution, the authors seek to illuminate how youth activists…
GSA Advisors' Self-Efficacy Related to LGBT Youth of Color and Transgender Youth
ERIC Educational Resources Information Center
Poteat, V. Paul; Scheer, Jillian R.
2016-01-01
Gay-Straight Alliances (GSAs) serve lesbian, gay, bisexual, transgender (LGBT) and heterosexual youth from diverse backgrounds. Although some attention has been given to youth members in general, little attention has been given to adult advisors. Among 47 GSA advisors from 33 high schools (39 cisgender female, 8 cisgender male), the authors…
Choi, Yoonsun; Tan, Kevin Poh Hiong; Yasui, Miwa; Pekelnicky, Dina Drankus
2014-01-01
This study examined the interplay of parental racial-ethnic socialization and youth multidimensional cultural orientations to investigate how they indirectly and directly influence youth depressive symptoms and antisocial behaviors. Using data from the Korean American Families (KAF) Project (220 youths, 272 mothers, and 164 fathers, N = 656), this study tested the relationships concurrently, longitudinally, and accounting for earlier youth outcomes. The main findings include that racial-ethnic socialization is significantly associated with mainstream and ethnic cultural orientation among youth, which in turn influences depressive symptoms (but not antisocial behaviors). More specifically, parental racial-ethnic identity and pride discourage youth mainstream orientation, whereas cultural socialization in the family, as perceived by youth, increases ethnic orientation. These findings suggest a varying impact of racial-ethnic socialization on the multidimensional cultural orientations of youth. Korean language proficiency of youth was most notably predictive of a decrease in the number of depressive symptoms concurrently, longitudinally, and after controlling for previous levels of depressive symptoms. English language proficiency was also associated with a decrease in depressive symptoms, implying a benefit of bilingualism. PMID:24611081
Vivolo, Alana M; Matjasko, Jennifer L; Massetti, Greta M
2011-09-01
Violence, including its occurrence among youth, results in considerable physical, emotional, social, and economic consequences in the US. Youth violence prevention work at the Division of Violence Prevention (DVP) at the Centers for Disease Control and Prevention (CDC) emphasizes preventing youth violence-related behaviors, injuries, and deaths by collaborating with academic and community partners and stakeholders. In 2000 and 2005, DVP funded the National Academic Centers of Excellence (ACE) for Youth Violence Prevention. Most ACE Centers focus on building community capacity and competence so that evidence-based programs for youth violence prevention can be successfully implemented through effective and supportive research-community partnerships. This commentary provides historical information about the ACE Program, including the development, goals, accomplishments of the Centers, and the utilization of a community-based participatory research approach to prevent youth violence.
Narendorf, Sarah C; Santa Maria, Diane M; Ha, Yoonsook; Cooper, Jenna; Schieszler, Christine
2016-12-01
Communities across the United States are increasing efforts to find and count homeless youth. This paper presents findings and lessons learned from a community/academic partnership to count homeless youth and conduct an in depth research survey focused on the health needs of this population. Over a 4 week recruitment period, 632 youth were counted and 420 surveyed. Methodological successes included an extended counting period, broader inclusion criteria to capture those in unstable housing, use of student volunteers in health training programs, recruiting from magnet events for high risk youth, and partnering with community agencies to disseminate findings. Strategies that did not facilitate recruitment included respondent driven sampling, street canvassing beyond known hotspots, and having community agencies lead data collection. Surveying was successful in gathering data on reasons for homelessness, history in public systems of care, mental health history and needs, sexual risk behaviors, health status, and substance use. Youth were successfully surveyed across housing types including shelters or transitional housing (n = 205), those in unstable housing such as doubled up with friends or acquaintances (n = 75), and those who were literally on the streets or living in a place not meant for human habitation (n = 140). Most youth completed the self-report survey and provided detailed information about risk behaviors. Recommendations to combine research data collection with counting are presented.
Youth Empowerment and High School Gay-Straight Alliances
ERIC Educational Resources Information Center
Russell, Stephen T.; Muraco, Anna; Subramaniam, Aarti; Laub, Carolyn
2009-01-01
In the field of positive youth development programs, "empowerment" is used interchangeably with youth activism, leadership, civic participation and self-efficacy. However, few studies have captured what empowerment means to young people in diverse contexts. This article explores how youth define and experience empowerment in youth-led…
Maternal Depression, Maternal Expressed Emotion, and Youth Psychopathology
ERIC Educational Resources Information Center
Tompson, Martha C.; Pierre, Claudette B.; Boger, Kathryn Dingman; McKowen, James W.; Chan, Priscilla T.; Freed, Rachel D.
2010-01-01
Across development, maternal depression has been found to be a risk factor for youth psychopathology generally and youth depression specifically. Maternal Expressed Emotion (EE) has been examined as a predictor of outcome among youth with depression. The present study explored the associations between youth psychopathology and two…
Youth and Evaluation: Empowered Social-Change Agents.
ERIC Educational Resources Information Center
Fetterman, David
2003-01-01
Summarizes the chapters of this theme issue on youth participatory evaluation. The overarching theme from this collection is the shift from a focus on youth as defective to a view of youth as assets in community development. (SLD)
Evaluating Youth Development Programs: Progress and Promise
Brooks-Gunn, Jeanne
2016-01-01
Advances in theories of adolescent development and positive youth development have greatly increased our understanding of how programs and practices with adolescents can impede or enhance their development. In this paper the authors reflect on the progress in research on youth development programs in the last two decades, since possibly the first review of empirical evaluations by Roth, Brooks-Gunn, Murray, and Foster (1998). The authors use the terms Version 1.0, 2.0 and 3.0 to refer to changes in youth development research and programs over time. They argue that advances in theory and descriptive accounts of youth development programs (Version 2.0) need to be coupled with progress in definitions of youth development programs, measurement of inputs and outputs that incorporate an understanding of programs as contexts for development, and stronger design and evaluation of programs (Version 3.0). The authors also advocate for an integration of prevention and promotion research, and for use of the term youth development rather than positive youth development. PMID:28077922
Igwe, S A
1992-05-01
Improved family and community support would prevent many youth in Nigeria from risk behavior including drinking alcohol, smoking, and using illicit drugs. In Rivers State, 70% of secondary students have had at least 1 alcoholic drink. Further, in Bendel State, 13% of 15-19 year olds in the coastal region drink alcohol compared with 75% of those in the hinterland. Since alcohol affects good judgment skills, this behavior is especially risky during rituals and social activities and causes accidents. Youth who drink are likely to have unplanned and unprotected sexual intercourse. Drinking during pregnancy is associated with miscarriages, low birth weight, and birth defects. Despite the problems with youth and drinking, Nigeria does not have law restricting sales of alcohol to youth. In Nigeria smoking was once predominantly a male habit but is now increasing quickly among women. Most smokers 1st begin their habit when 18 years old. Even thought he Nigerian government has restricted smoking in public places, it has not yet been effective. Smoking has numerous negative effects such as lung cancer, other cancers, shorter life spans, low birth weight, prematurity, higher perinatal mortality, and more labor complications. Moreover the tobacco and alcohol companies advertise widely using ingenious and persuasive promotions. Youth are especially vulnerable to these slick promotions. Cannabis remains the most common illegal drug. Heroin use is growing among urban adolescents in Nigeria, however. Nigeria also serves as a transhipment point for drugs to the US as well as a consumption point. Drug use results in rising numbers of patients in mental hospitals and treatment centers. A particular concern of drug use is transmission of HIV and hepatitis B via needles. Smokers and alcohol drinkers are likely to also be drug users. Families, government, and community organizations need to collaborate to prevent these risk behaviors among youth.
ERIC Educational Resources Information Center
OECD Publishing, 2014
2014-01-01
The series Investing in Youth builds on the expertise of the Organisation for Economic Cooperation and Development (OECD) on youth employment, social support and skills. It covers both OECD countries and countries in the process of accession to the OECD, as well as some emerging economies. This report provides a detailed diagnosis of the youth…
Runaway Youth Program Directory.
ERIC Educational Resources Information Center
New England Association for the Education of Young Children, Springvale, ME.
This directory provides a state-by-state listing of 212 runaway programs which exist, for the most part, outside the juvenile justice system and serve primarily the self-referred runaway and "throwaway" youth. The directory is designed to aid those persons seeking appropriate referrals for youth in need of crisis shelter as well as those…
ERIC Educational Resources Information Center
OECD Publishing, 2015
2015-01-01
The series Investing in Youth builds on the expertise of the Organisation for Economic Cooperation and Development (OECD) on youth employment, social support and skills. It covers both OECD countries and countries in the process of accession to the OECD, as well as some emerging economies. This report provides a detailed diagnosis of the youth…
Monitoring and decreasing public smoking among youth.
Jason, Leonard A; Pokorny, Steven B; Sanem, Julia R; Adams, Monica L
2006-09-01
This study examined the impact of tobacco possession laws on public smoking among youth. There were two intervention sites: a fast food restaurant and a shopping mall. Two control sites were also monitored for public smoking among youth. Preliminary findings suggest that when police issued tickets to minors for violating tobacco possession laws, the number of youth smoking in public declined in both towns, with a more dramatic decrease occurring at the fast food site. In contrast, public smoking among youth in the control sites was not affected. The significance of reducing number of youth smoking in public through tobacco possession laws is discussed.
Asleep at the automated wheel-Sleepiness and fatigue during highly automated driving.
Vogelpohl, Tobias; Kühn, Matthias; Hummel, Thomas; Vollrath, Mark
2018-03-20
Due to the lack of active involvement in the driving situation and due to monotonous driving environments drivers with automation may be prone to become fatigued faster than manual drivers (e.g. Schömig et al., 2015). However, little is known about the progression of fatigue during automated driving and its effects on the ability to take back manual control after a take-over request. In this driving simulator study with Nö=ö60 drivers we used a three factorial 2ö×ö2ö×ö12 mixed design to analyze the progression (12ö×ö5ömin; within subjects) of driver fatigue in drivers with automation compared to manual drivers (between subjects). Driver fatigue was induced as either mainly sleep related or mainly task related fatigue (between subjects). Additionally, we investigated the drivers' reactions to a take-over request in a critical driving scenario to gain insights into the ability of fatigued drivers to regain manual control and situation awareness after automated driving. Drivers in the automated driving condition exhibited facial indicators of fatigue after 15 to 35ömin of driving. Manual drivers only showed similar indicators of fatigue if they suffered from a lack of sleep and then only after a longer period of driving (approx. 40ömin). Several drivers in the automated condition closed their eyes for extended periods of time. In the driving with automation condition mean automation deactivation times after a take-over request were slower for a certain percentage (about 30%) of the drivers with a lack of sleep (Mö=ö3.2; SDö=ö2.1ös) compared to the reaction times after a long drive (Mö=ö2.4; SDö=ö0.9ös). Drivers with automation also took longer than manual drivers to first glance at the speed display after a take-over request and were more likely to stay behind a braking lead vehicle instead of overtaking it. Drivers are unable to stay alert during extended periods of automated driving without non-driving related tasks. Fatigued drivers could
... High School and Youth Trends Monitoring the Future Survey: High School and Youth Trends Email Facebook Twitter ... December 2017 This year's Monitoring the Future (MTF) survey of drug use and attitudes among 8th, 10th, ...
Vu, Mary; Leatherdale, Scott T; Ahmed, Rashid
2011-12-01
Understanding factors associated with youth cigarette access behaviours can provide insight into the development of more effective means of preventing youth from accessing cigarettes. This cross-sectional study used self-reported data collected from 41,886 students in grades 9 to 12 who participated in the 2006-07 Youth Smoking Survey to examine the student- and school-level characteristics that differentiate youth smokers who usually access cigarettes from a social source versus buying their own from retailers. Multi-level regression analyses revealed significant between-school variability in the odds of a smoking student reporting that they usually buy their own cigarettes. Important student-level characteristics associated with how youth usually access their cigarettes included binge drinking and being asked for age or photo identification when purchasing cigarettes from a retailer. Future studies should further explore the school- and student-level characteristics associated with youth cigarette access behaviour. Copyright © 2011 Elsevier Ltd. All rights reserved.
Thomée, Suzanne; Malm, Desiré; Christianson, Monica; Hurtig, Anna-Karin; Wiklund, Maria; Waenerlund, Anna-Karin; Goicolea, Isabel
2016-12-21
Youth-friendly health-care services - those that are accessible, acceptable, equitable, appropriate and effective for different youth subpopulations - are beneficial for youth health, but not easy to implement and sustain. Sweden is among the few countries where youth-friendly health-care services have been integrated within the public health system and sustained for a long time. This study explores the challenges and strategies in providing sustainable youth-friendly health-care services, from the perspective of professionals working in youth clinics in northern Sweden. Eleven semi-structured interviews with various health-care professionals working in youth clinics in northern Sweden were conducted. The interviews were transcribed verbatim, and analysed using thematic analysis in relation to the World Health Organization domains of youth friendliness. Four themes emerged from the analysis of the data: 1) 'Meeting youths on their own terms - the key to ensuring a holistic and youth-centred care' was related to the acceptability and appropriateness of the services; 2) 'Organizational challenges and strategies in keeping professionals' expertise on youth updated' referred to the domain of effectiveness; 3) 'Youth clinics are accessible for those who know and can reach them' was related to the domains of accessibility and equity, and 4) 'The challenge of combining strong directions and flexibility in diverse local realities' focused on the struggle to sustain the youth clinics organization and their goals within the broader health system. Professionals working in youth clinics are perceived as motivated, interested and knowledgeable about youth, and the clinics ensure confidentiality and a youth-centred and holistic approach. Challenges remain, especially in terms of ensuring equitable access to different youth subpopulations, improving monitoring routines and ensuring training and competence for all professionals, independently of the location and characteristics of
Elements of EAF automation processes
NASA Astrophysics Data System (ADS)
Ioana, A.; Constantin, N.; Dragna, E. C.
2017-01-01
Our article presents elements of Electric Arc Furnace (EAF) automation. So, we present and analyze detailed two automation schemes: the scheme of electrical EAF automation system; the scheme of thermic EAF automation system. The application results of these scheme of automation consists in: the sensitive reduction of specific consummation of electrical energy of Electric Arc Furnace, increasing the productivity of Electric Arc Furnace, increase the quality of the developed steel, increasing the durability of the building elements of Electric Arc Furnace.
Exploring Commitment to Youth Sports Leadership
ERIC Educational Resources Information Center
Rickabaugh, Tim
2009-01-01
With over 38 million U.S. youth (54% of children between ages 6 to 17) participating in organized sports each year, there is an ever increasing demand for entry-level youth sport leaders. To meet this leadership demand in organized youth sports, over 2.5 million adults volunteer to coach, yet less than 10% of these individuals have any formal…
Youth Media Citizenship: Beyond "Youth Voice"
ERIC Educational Resources Information Center
Soep, Elisabeth
2006-01-01
The globalization of youth culture complicates young people's relationship to democracy as traditionally conceived. More and more young people define themselves as cosmopolitan citizens, connected through popular culture, digital technologies, and migration histories to social geographies outside their own local and national contexts. Despite…
Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.
Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya
2011-11-25
Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as
Dantrolene is neuroprotective in Huntington's disease transgenic mouse model
2011-01-01
Background Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2
ERIC Educational Resources Information Center
Evaluation Technologies, Inc., Arlington, VA.
This volume serves as a source of information about the relationship of Teacher Corps Youth Advocacy Project activities to the field of secondary school reform for troubled youth. This document presents major theories about educating troubled youth, theoretically-based programs, and research and evaluation on their effectiveness. Theories are…
Sanders, Jackie; Munford, Robyn; Thimasarn-Anwar, Tewaporn; Liebenberg, Linda; Ungar, Michael
2015-04-01
Services that utilise positive youth development practices (PYD) are thought to improve the quality of the service experience leading to better outcomes for at-risk youth. This article reports on a study of 605 adolescents (aged 12-17 years) who were concurrent clients of two or more service systems (child welfare, juvenile justice, additional education, mental health). It was hypothesised that services adopting PYD approaches would be related to increases in youth resilience and better wellbeing outcomes. It was also hypothesised that risks, resilience, service experiences and wellbeing outcomes would differ by age, gender and ethnicity. Youth completed a self-report questionnaire administered individually. Path analysis was used to determine the relationship between risk, service use, resilience and a wellbeing outcome measure. MANOVA was then used to determine patterns of risk, service use, resilience and wellbeing among participants based on their demographic characteristics. Services using PYD approaches were significantly related to higher levels of youth resilience. Similarly, increased resilience was related to increased indicators of wellbeing, suggesting the mediating role of resilience between risk factors and wellbeing outcomes. When professionals adopt PYD practices and work with the positive resources around youth (their own resilience processes) interventions can make a significant contribution to wellbeing outcomes for at-risk youth. Copyright © 2015 Elsevier Ltd. All rights reserved.
Promoting CARE: including parents in youth suicide prevention.
Hooven, Carole; Walsh, Elaine; Pike, Kenneth C; Herting, Jerald R
2012-01-01
This study evaluated the effectiveness of augmenting a youth suicide-preventive intervention with a brief, home-based parent program. A total of 615 high school youth and their parents participated. Three suicide prevention protocols, a youth intervention, a parent intervention, and a combination of youth and parent intervention, were compared with an "intervention as usual" (IAU) group. All groups experienced a decline in risk factors and an increase in protective factors during the intervention period, and sustained these improvements over 15 months. Results reveal that the youth intervention and combined youth and parent intervention produced significantly greater reductions in suicide risk factors and increases in protective factors than IAU comparison group.
ERIC Educational Resources Information Center
OECD Publishing, 2016
2016-01-01
The series Investing in Youth builds on the expertise of the Organisation for Economic Cooperation and Development (OECD) on youth employment, social support and skills. It covers both OECD countries and countries in the process of accession to the OECD, as well as some emerging economies. The present report on Lithuania is the fourth of a new…
Youth Monitoring and Self-Evaluation Services. Final Report.
ERIC Educational Resources Information Center
Fenton, Calvin W.
Youth monitoring and self evaluation services were developed for fourteen youth programs in the Eastern Region, the mid-Western Region and the Western Region of the United States. The concept of youth involvement is central to these fourteen projects. Youth involvement is defined as "initial participation by project beneficiaries in the…
The Youth Writers: Developing Curriculum for Their Peers
ERIC Educational Resources Information Center
Krehbiel, Michelle; Fenton, Melissa S.; Fairchild, Patricia J.
2015-01-01
Curricula designed for youth are often lacking a young person's influence and perspective. In order to provide engaging, "fresh" materials for youth, 4-H professionals can recruit youth as curriculum writers. Youth are given an opportunity to form positive partnerships with adults, produce engaging and creative materials for their peers,…
Youth Work, Performativity and the New Youth Impact Agenda: Getting Paid for Numbers?
ERIC Educational Resources Information Center
de St Croix, Tania
2018-01-01
A growing policy emphasis on measurement and outcomes has led to cultures of performativity, which are transforming what educators do and how they feel about themselves in relation to their work. While most analysis of performativity in education has focused on schools, this article investigates parallel developments in youth work. Youth work is a…
Queer Youth in Family Therapy.
Harvey, Rebecca G; Stone Fish, Linda
2015-09-01
Trends in popular belief about same-sex relationships have undergone noteworthy change in the United States over the last decade. Yet this change has been marked by stark polarizations and has occurred at varying rates depending upon regional, community, racial, religious, and individual family context. For queer youth and their families, this cultural transformation has broadened opportunities and created a new set of risks and vulnerabilities. At the same time, youth's increasingly open and playful gender fluidity and sexual identity is complicated by unique intersections of class, race, religion, and immigration. Effective family therapy with queer youth requires practitioner's and treatment models that are sensitive to those who bear the burden of multiple oppressions and the hidden resilience embedded in their layered identities. We present case examples of our model of family therapy which addresses refuge, supports difficult dialogs, and nurtures queerness by looking for hidden resilience in the unique intersections of queer youths' lives. These intersections provide transformational potential for youth, their families and even for family therapists as we are all nurtured and challenged to think more complexly about intersectionality, sexuality, and gender. © 2015 Family Process Institute.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-14
... Program (NCAP) Test Concerning Automated Commercial Environment (ACE) Simplified Entry: Modification of... Automated Commercial Environment (ACE). The test's participant selection criteria are modified to reflect... (NCAP) test concerning Automated Commercial Environment (ACE) Simplified Entry functionality (Simplified...
ERIC Educational Resources Information Center
Spring, Kimberly; Dietz, Nathan; Grimm, Robert, Jr.
2006-01-01
This brief is the second in the Youth Helping America Series, a series of reports based on data from the Youth Volunteering and Civic Engagement Survey, a national survey of 3,178 American youth between the ages of 12 and 18 that was conducted by the Corporation for National and Community Service in 2005 in collaboration with the U.S. Census…
2016-10-01
Youth incarceration is an international public health concern among developed and developing countries. Worldwide, youth are held in incarceration, detention, and other secure settings that are inappropriate for their age and developmental stages, jeopardizing their prosocial development, and reintegration into society. Youth incarceration lacks evidence and cost-effectiveness. The well-being of youth is a key indicator of the welfare of families, communities, and society at large; therefore, the Society for Adolescent Health and Medicine (SAHM) supports a paradigm shift in the role of the justice system as it relates to treatment of youth. SAHM recommends justice systems focus greater attention and resources on identifying and reducing the antecedents of high-risk and criminal behaviors, recognizing the rights and freedom of young persons, and prioritizing the well-being of youth over punitive measures that may harm and disrupt healthy adolescent development. SAHM supports the following positions: (1) incarceration is a last option for selected offenders who have committed the most serious violent crimes and are unable to remain safely in the community; (2) youth justice policies, programs, and practices affecting youth be evidence based and trauma informed; (3) youth justice policies, programs, and practices must incorporate research and ongoing program evaluation; (4) youth justice policies shall protect the privacy and dignity of children younger than 18 years; and (5) health care professionals and media will promote positive portrayals of youth in healthy relationships within their communities and reduce representations and images of youth that are negative, violent, deviant, and threatening. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Demography of Immigrant Youth: Past, Present, and Future
ERIC Educational Resources Information Center
Passel, Jeffrey S.
2011-01-01
Jeffrey Passel surveys demographic trends and projections in the U.S. youth population, with an emphasis on trends among immigrant youth. He traces shifts in the youth population over the past hundred years, examines population projections through 2050, and offers some observations about the likely impact of the immigrant youth population on…
Minnesota 4-H Youth Program Quality Improvement Model
ERIC Educational Resources Information Center
Herman, Margo; Grant, Samantha
2015-01-01
The University of Minnesota Extension Center for Youth Development made an organizational decision in 2011 to invest in a system-wide approach to implement youth program quality into the 4-H program using the Youth Program Quality Assessment (YPQA) tool. This article describes the four key components to the Minnesota Youth Program Quality…
Youth-Led Decision Making in Community Development Grants
ERIC Educational Resources Information Center
Blanchet-Cohen, Natasha; Manolson, Sarah; Shaw, Katie
2014-01-01
This study examines youth-led decision making (YLDM) among groups of youth who are providers or recipients of community development grants. Focus groups, interviews, and participant observation with 14- to 20-year-olds and supporting adults showed youth have a preference for consensus-based decisions. Youth used due process to reach decisions…
Influence of Permissive Parenting on Youth Farm Risk Behaviors.
Jinnah, Hamida A; Stoneman, Zolinda
2016-01-01
Farm youth continue to experience high rates of injuries and premature deaths as a result of agricultural activities. Increased parental permissiveness is positively associated with many different types of high-risk behaviors in youth. This study explored whether permissive parenting (fathering and mothering) predicts youth unsafe behaviors on the farm. Data were analyzed for 67 youth and their parents. Families were recruited from a statewide farm publication, through youth organizations (i.e., FFA [Future Farmers of America]), local newspapers, farmer referrals, and through the Cooperative Extension Network. Hierarchical multiple regression was completed. Results revealed that fathers and mothers who practiced lax-inconsistent disciplining were more likely to have youth who indulged in unsafe farm behaviors. Key hypotheses confirmed that permissive parenting (lax-inconsistent disciplining) by parents continued to predict youth unsafe farm behaviors, even after youth age, youth gender, youth personality factor of risk-taking, and father's unsafe behaviors (a measure associated with modeling) were all taken into account. A key implication is that parents may play an important role in influencing youth farm safety behaviors. Parents (especially fathers) need to devote time to discuss farm safety with their youth. Farm safety interventions need to involve parents as well as address and respect the culture and values of families. Interventions need to focus not only on safe farm practices, but also promote positive parenting practices, including increased parent-youth communication about safety, consistent disciplining strategies, and increased monitoring and modeling of safe farm behaviors by parents.
Mental Illness Drives Hospitalizations for Detained California Youth
Anoshiravani, Arash; Saynina, Olga; Chamberlain, Lisa; Goldstein, Benjamin A; Huffman, Lynne C; Wang, N Ewen; Wise, Paul H
2015-01-01
Objective To describe inpatient hospitalization patterns among detained and non-detained youth in a large, total population of hospitalized adolescents in California. Methods We examined the unmasked California Office of Statewide Health Planning and Development Patient Discharge Dataset from 1997-2011. We considered hospitalized youth aged 11-18 years “detained” if admitted to California hospitals from detention, transferred from hospital to detention, or both. We compared discharge diagnoses and length of stay (LOS) between detained youth and their non-detained counterparts in the general population. Results There were 11,367 hospitalizations for detained youth. Hospitalizations differed for detained versus non-detained youth: 63% of all detained youth had a primary diagnosis of mental health disorder (compared to 19.8% of non-detained youth). Detained girls were disproportionately affected, with 74% hospitalized for a primary mental health diagnosis. Detained youth hospitalized for mental health disorder had an increased median LOS compared to non-detained inpatient youth with mental illness (≥6 days versus 5 days, respectively). This group difference was heightened in the presence of minority status, public insurance, and concurrent substance abuse. Hospitalized detained youth discharged to chemical dependency treatment facilities had the longest hospital stays (≥43 days). Conclusions Detained juvenile offenders are hospitalized for very different reasons than the general adolescent population. Mental illness, often with comorbid substance abuse, requiring long inpatient stays, represents the major cause for hospitalization. These findings underscore the urgent need for effective, well-coordinated mental health services for youth before, during, and after detention. PMID:26208862
Automation in College Libraries.
ERIC Educational Resources Information Center
Werking, Richard Hume
1991-01-01
Reports the results of a survey of the "Bowdoin List" group of liberal arts colleges. The survey obtained information about (1) automation modules in place and when they had been installed; (2) financing of automation and its impacts on the library budgets; and (3) library director's views on library automation and the nature of the…
Having "The Talk": Youth-Parent Climate Conversations
NASA Astrophysics Data System (ADS)
Anderson, R. K.; Flora, J. A.; Lertzman, R.; Saphir, M.
2017-12-01
Youth are concerned about climate change. Recent research conducted by the Alliance for Climate Education, in partnership with the Skoll Global Threats Fund, demonstrates that youth have agency within their families regarding climate relevant behaviors, particularly resulting from conversations that rely on listening. In this pilot project, we examined whether youth involved in a year-long climate action program will carry out climate related conversations with their parents, and whether youth who have engaged online with a climate education group, will carry out similar conversations with their parents when asked to do so via SMS. In study one, we used mixed methods to determine if youth participating in a training would carry out a climate conversation with their parents, adhere to guidelines such as reflective listening, and have positive experiences. Further, we investigated to what extent parents would experience the conversation as a positive and impactful event. Parents overall reported a positive experience, and were proud of their child's work. In study two, in a randomized controlled trial conducted entirely via SMS, we investigated whether youth would watch a brief instructional animated video, and have a conversation with a parent. Results showed the majority of youth reported gained confidence in conducting a climate conversation and intended to speak to relatives. Preliminary results indicate when youth can express their climate engagement to a parent using these techniques, they have positive experiences, gain confidence in future engagements and can influence family. The studies highlight the positive impact of climate conversations as well as the potential to scale climate conversations to reach more youth and families.
Automation: Decision Aid or Decision Maker?
NASA Technical Reports Server (NTRS)
Skitka, Linda J.
1998-01-01
This study clarified that automation bias is something unique to automated decision making contexts, and is not the result of a general tendency toward complacency. By comparing performance on exactly the same events on the same tasks with and without an automated decision aid, we were able to determine that at least the omission error part of automation bias is due to the unique context created by having an automated decision aid, and is not a phenomena that would occur even if people were not in an automated context. However, this study also revealed that having an automated decision aid did lead to modestly improved performance across all non-error events. Participants in the non- automated condition responded with 83.68% accuracy, whereas participants in the automated condition responded with 88.67% accuracy, across all events. Automated decision aids clearly led to better overall performance when they were accurate. People performed almost exactly at the level of reliability as the automation (which across events was 88% reliable). However, also clear, is that the presence of less than 100% accurate automated decision aids creates a context in which new kinds of errors in decision making can occur. Participants in the non-automated condition responded with 97% accuracy on the six "error" events, whereas participants in the automated condition had only a 65% accuracy rate when confronted with those same six events. In short, the presence of an AMA can lead to vigilance decrements that can lead to errors in decision making.
Tobacco Use Cessation and Youth. Issue Brief. August 1999.
ERIC Educational Resources Information Center
Wojciak, Alison
This issue brief discusses the importance of tobacco use cessation efforts for youth. Section 1 discusses the need for tobacco cessation for youth, explaining that despite increased attention to the prevention of tobacco use among youth, there has been little attention to youth who already smoke, and few programs for youth have proven successful.…
Gang Involvement and Membership among Homeless and Runaway Youth.
ERIC Educational Resources Information Center
Yoder, Kevin A.; Whitbeck, Les B.; Hoyt, Dan R.
2003-01-01
Assessed the extent of gang involvement among homeless and runaway youth, comparing gang members, gang-involved youth (not members), and non-gang youth on several dimensions. Interview data indicated that 15.4 percent of the youth were gang members and 32.2 percent were involved in gangs. These youth reported more family problems and school…
Healthy & Empowered Youth: A Positive Youth Development Program for Native Youth.
Rushing, Stephanie N Craig; Hildebrandt, Nichole L; Grimes, Carol J; Rowsell, Amanda J; Christensen, Benjamin C; Lambert, William E
2017-03-01
During 2010-2012, Oregon Health & Science University's Prevention Research Center, a Northwest Tribe, and the Northwest Portland Area Indian Health Board, collaborated to evaluate the Healthy & Empowered Youth Project, a school- and community-based positive youth development program for American Indian and Alaska Native high school students. The Native STAND (Students Together Against Negative Decisions) curriculum was enhanced with hands-on learning activities in media design to engage students in sexual and reproductive health topics covered by the curriculum. Guest speakers, field trips, and extracurricular activities were added to provide academic enrichment, engage students in cultural activities, and offer opportunities for career development. Students completed comprehensive pre- and post-surveys, and the authors conducted focus groups and key informant interviews with students and teachers. Data analysis was conducted during 2013-2014. Survey findings demonstrated improvements in student leadership and achievement, physical and mental health, and protective sexual health behaviors. The percentage of female teens reporting use of a condom the last time they had sex increased from 17% to 30%, and those who reported ever having been tested for sexually transmitted illnesses doubled from 12% to 24%. Focus group and interview findings indicated similar improvements in student self-esteem, life skills, health behavior, and engagement in community. The Healthy & Empowered Youth Project educated and empowered Native high school students on a variety of sensitive health topics. The media enhancements were central to the program's success, reinforcing and personalizing classroom lessons and generating health-related videos and posters that resonated with family and friends. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
Positional cloning of the chromosome 14 Alzheimer`s disease locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clark, R.F.; Korenblat, K.M.; Goate, A.M.
1994-09-01
Genetic linkage analysis had indicated a locus for familial early-onset Alzheimer`s disease (FAD) on chromosome 14 at q24.3. The FAD locus has been shown previously to lie between the dinucleotide markers D14S61 and D14S63, a genetic distance of approximately 13 cM. We are currently attempting to identify the gene using a positional cloning strategy. The first step towards the isolation and characterization of this locus was the construction of an overlapping YAC contig covering the entire region. Over forty YACs which map to this region have been isolated from the St. Louis and CEPH libraries by a combination of YACmore » end sequence walking and sequence tagged site mapping. Our contig fully spans the complete domain, encompassing all genetic markers non-recombinant with FAD (i.e. D14S76, D14S43, D14S71, D14S77) and the two nearest flanking FAD-recombinant markers. With restriction mapping of the domain, we can determine the exact size of the region. As a second step, the YACs in this contig are currently being inspected for expressed sequences by exon trapping, initially on those YACs known to be nonchimeric. We have currently made exon-trapped libraries from YACs that have the markers D14S76 and D14S43. Sequence analysis of these libraries indicates that a trapped exon is identified on average for each 30 kb of YAC DNA. The trapped exons are being screened to identify likely candidate genes, which will be examined for mutations in FAD families.« less
ERIC Educational Resources Information Center
Rosenberg, Mark L., Ed.; Baer, Katie, Ed.
Commissioned papers by a work group on strategies for the prevention of youth suicide are presented in this document. Included are: (1) "The Federal Role in Youth Suicide Research and Programs: The Legacy of Recent History" (Margaret Gerteis and Mark L. Rosenberg); (2) "Estimating the Effectiveness of Interventions to Prevent Youth Suicides: A…
Padon, Alisa A; Lochbuehler, Kirsten; Maloney, Erin K; Cappella, Joseph N
2017-07-05
Very little is known about how e-cigarette marketing is being perceived by youth, and the potential effect it will have on youth vaping and smoking behaviors. This limits the ability to identify youth-focused marketing efforts and to design effective policies for the regulation of e-cigarette marketing content and placement. A sample of 417 nonsmoking youth (mean age = 15, SD = 1.3) were randomly assigned to either view four e-cigarette ads with low youth appeal, four e-cigarette ads with high youth appeal or four control ads. After exposure, participants completed covert and overt measurements of e-cigarette and tobacco cigarette attitudes and susceptibility to use. Youth in an e-cigarette ad condition were more likely to select an e-cigarette item in a product choice task compared to control, and had more positive e-cigarette beliefs. Contrary to hypotheses, youth in the low youth appeal condition reported greater susceptibility to trying e-cigarettes and tobacco cigarettes compared to control. Exposure to any e-cigarette advertising may play a role in teens' decision to initiate e-cigarette and tobacco cigarette use. As the Food and Drug Administration now has regulatory authority over the marketing of e-cigarettes, regulations on e-cigarette advertising are suggested. Teens are increasingly being exposed to e-cigarette advertising, and many places are considering e-cigarette regulations, yet we know very little about how e-cigarette advertisements might influence youth tobacco use. This study utilized a novel dataset of e-cigarette ads coded for youth appeal and presented them to a sample of 417 nonsmoking teens in a randomized controlled design to test the effect of features on youth susceptibility to initiating e-cigarette and tobacco cigarette use. The findings inform evidence-based recommendations for regulating the marketing of e-cigarettes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Research on Nicotine and
Holocaust Youth and Creativity.
ERIC Educational Resources Information Center
Clark, Joanna
As Holocaust study for youth becomes integrated into the U.S. educational structure, educators throughout the country are going to need resources that combine history and humanity to convey to young people the impact of tragedy and violence that World War II and the Holocaust had on the youth of a particular time in the 20th century. This paper…
Laboratory Automation and Middleware.
Riben, Michael
2015-06-01
The practice of surgical pathology is under constant pressure to deliver the highest quality of service, reduce errors, increase throughput, and decrease turnaround time while at the same time dealing with an aging workforce, increasing financial constraints, and economic uncertainty. Although not able to implement total laboratory automation, great progress continues to be made in workstation automation in all areas of the pathology laboratory. This report highlights the benefits and challenges of pathology automation, reviews middleware and its use to facilitate automation, and reviews the progress so far in the anatomic pathology laboratory. Copyright © 2015 Elsevier Inc. All rights reserved.
Decker, Martha; Montagu, Dominic
2007-03-01
This paper evaluates the ability of social franchise programs, which use private providers to offer reproductive health services, to provide services to youth in western Kenya. Although franchise clinics have rarely targeted youth, they appear to offer a viable alternative for providing reproductive health services to this age group.
Out-of-school time activity participation among US--immigrant youth.
Yu, Stella M; Newport-Berra, McHale; Liu, Jihong
2015-05-01
Structured out-of-school time (OST) activities are associated with positive academic and psychosocial outcomes. Data came from the 2007 National Survey of Children's Health, restricted to 36,132 youth aged 12-17 years. Logistic regression models were used to examine the joint effects of race/ethnicity and immigrant family type on the participation in OST activities. Compared with US-born (USB) non-Hispanic White youth with USB parents, USB Hispanic youth with USB parents were less likely to participate in sports, whereas non-Hispanic Black youth with immigrant parents were more likely to participate in sports. White youth with at least 1 immigrant parent had higher odds of participating in after-school clubs. All Hispanic youth were less likely to participate in after-school clubs. USB Hispanic youth, USB Black youth, and White youth and "other" youth with at least 1 immigrant parent had higher odds of engaging in community services. Youth from immigrant families had lower odds of doing paid work. Hispanic youth were less likely to participate in OST activities. Non-Hispanic youth with immigrant parents did not engage in fewer OST activities compared with USB White youth with USB parents. Intervention and recruitment strategies for OST activities may need to be customized for immigrant groups. © 2015, American School Health Association.
LGBTQ Youth's Perceptions of Primary Care.
Snyder, Barbara K; Burack, Gail D; Petrova, Anna
2017-05-01
Despite published guidelines on the need to provide comprehensive care to lesbian, gay, bisexual, transgender, and questioning/queer (LGBTQ) youth, there has been limited research related to the deliverance of primary health care to this population. The goals of this study were to learn about LGBTQ youth's experiences with their primary care physicians and to identify areas for improvement. Youth attending 1 of 5 community-based programs completed a written questionnaire and participated in a focus group discussion regarding experiences at primary care visits, including topics discussed, counselling received, and physician communication. Most of the youth did not feel their health care needs were well met. The majority acknowledged poor patient-provider communication, disrespect, and lack of discussions about important topics such as sexual and emotional health. Participants cited concerns about confidentiality and inappropriate comments as barriers to care. Youth expressed a strong desire to have physicians be more aware of their needs and concerns.
Managing laboratory automation
Saboe, Thomas J.
1995-01-01
This paper discusses the process of managing automated systems through their life cycles within the quality-control (QC) laboratory environment. The focus is on the process of directing and managing the evolving automation of a laboratory; system examples are given. The author shows how both task and data systems have evolved, and how they interrelate. A BIG picture, or continuum view, is presented and some of the reasons for success or failure of the various examples cited are explored. Finally, some comments on future automation need are discussed. PMID:18925018
Managing laboratory automation.
Saboe, T J
1995-01-01
This paper discusses the process of managing automated systems through their life cycles within the quality-control (QC) laboratory environment. The focus is on the process of directing and managing the evolving automation of a laboratory; system examples are given. The author shows how both task and data systems have evolved, and how they interrelate. A BIG picture, or continuum view, is presented and some of the reasons for success or failure of the various examples cited are explored. Finally, some comments on future automation need are discussed.
Promoting culturally competent care for gay youth.
Bakker, Leslie J; Cavender, Angela
2003-04-01
Gay youth and those questioning their sexual identity have been referred to as "hidden," "invisible," "stigmatized," and "marginalized." As a result, the unique safety and health needs of this subculture have been overlooked, or worse, ignored, placing these youth at risk. Because school nurses have been identifying at-risk populations of students and developing programs to promote youth and family health for years, they should be prepared to provide health care for the subculture of gay youth. However, nurses are saying they do not have the knowledge or skills needed to identify and address the needs of this group. Providing school nursing care for gay youth requires the school nurse to be culturally competent. School nurses need to be aware of, sensitive to, and knowledgeable about the subculture. They must also possess communication skills required to relate appropriately to this group. This article presents information and nursing strategies that will promote the safety and health of gay youth while enhancing the school nurse's cultural competence.
Rural Youth in Asia. Report of the CCA Rural Youth Study Group (Sibu, Malaysia, March 14-19, 1976).
ERIC Educational Resources Information Center
1977
Historical causes of rural poverty and general recommendations for work among rural youth in India, Malaysia, Philippines, Sri Lanka, and Thailand are presented in this summary of national reports given before the Rural Youth Study Group in 1976. In addition to study papers on each country, the volume contains an introduction on rural youth and…
Serum cystatin C in youth with diabetes: The SEARCH for diabetes in youth study.
Kanakatti Shankar, Roopa; Dolan, Lawrence M; Isom, Scott; Saydah, Sharon; Maahs, David M; Dabelea, Dana; Reynolds, Kristi; Hirsch, Irl B; Rodriguez, Beatriz L; Mayer-Davis, Elizabeth J; Marcovina, Santica; D'Agostino, Ralph; Mauer, Michael; Mottl, Amy K
2017-08-01
We compared cystatin C in youth with versus without diabetes and determined factors associated with cystatin C in youth with type 1 diabetes (T1D) and type 2 diabetes (T2D). Youth (ages 12-19years) without diabetes (N=544) were ascertained from the NHANES Study 2000-2002 and those with T1D (N=977) and T2D (N=168) from the SEARCH for Diabetes in Youth Study. Adjusted means of cystatin C concentrations were compared amongst the 3 groups. Next, we performed multivariable analyses within the T1D and T2D SEARCH samples to determine the association between cystatin C and race, sex, age, diabetes duration, HbA1c, fasting glucose, and BMI. Adjusted cystatin C concentrations were statistically higher in NHANES (0.85mg/L) than in either the T1D (0.75mg/L) or T2D (0.70mg/L) SEARCH groups (P<0.0001). Fasting glucose was inversely related to cystatin C only in T1D (P<0.001) and BMI positively associated only in T2D (P<0.01) while HbA1c was inversely associated in both groups. Cystatin C concentrations are statistically higher in youth without diabetes compared to T1D or T2D, however the clinical relevance of this difference is quite small, especially in T1D. In youth with diabetes, cystatin C varies with BMI and acute and chronic glycemic control, however their effects may be different according to diabetes type. Copyright © 2017 Elsevier B.V. All rights reserved.
Handbook of Youth Prevention Science
ERIC Educational Resources Information Center
Doll, Beth, Ed.; Pfohl, William, Ed.; Yoon, Jina S., Ed.
2010-01-01
The "Handbook of Youth Prevention Science" describes current research and practice in mental health preventive interventions for youth. Traditional prevention research focused on preventing specific disorders, e.g. substance abuse, conduct disorders, or criminality. This produced "silos" of isolated knowledge about the…
The Science of Home Automation
NASA Astrophysics Data System (ADS)
Thomas, Brian Louis
Smart home technologies and the concept of home automation have become more popular in recent years. This popularity has been accompanied by social acceptance of passive sensors installed throughout the home. The subsequent increase in smart homes facilitates the creation of home automation strategies. We believe that home automation strategies can be generated intelligently by utilizing smart home sensors and activity learning. In this dissertation, we hypothesize that home automation can benefit from activity awareness. To test this, we develop our activity-aware smart automation system, CARL (CASAS Activity-aware Resource Learning). CARL learns the associations between activities and device usage from historical data and utilizes the activity-aware capabilities to control the devices. To help validate CARL we deploy and test three different versions of the automation system in a real-world smart environment. To provide a foundation of activity learning, we integrate existing activity recognition and activity forecasting into CARL home automation. We also explore two alternatives to using human-labeled data to train the activity learning models. The first unsupervised method is Activity Detection, and the second is a modified DBSCAN algorithm that utilizes Dynamic Time Warping (DTW) as a distance metric. We compare the performance of activity learning with human-defined labels and with automatically-discovered activity categories. To provide evidence in support of our hypothesis, we evaluate CARL automation in a smart home testbed. Our results indicate that home automation can be boosted through activity awareness. We also find that the resulting automation has a high degree of usability and comfort for the smart home resident.
2013-01-01
Objectives. I sought to describe current state-wide youth sports traumatic brain injury (TBI) laws and their relationship to prevailing scientific understandings of youth sports TBIs, and to facilitate further research by creating an open-source data set of current laws. Methods. I used Westlaw and LexisNexis databases to create a 50-state data set of youth sports TBI laws enacted between January 2009 and December 2012. I collected and coded the text and citations of each law and developed a protocol and codebook to facilitate future research. Results. Forty-four states and Washington, DC, passed youth sports TBI laws between 2009 and 2012. No state’s youth sports TBI law focuses on primary prevention. Instead, such laws focus on (1) increasing coaches’ and parents’ ability to identify and respond to TBIs and (2) reducing the immediate risk of multiple TBIs. Conclusions. Existing youth sports TBI laws were not designed to reduce initial TBIs. Evaluation is required to assess their effectiveness in reducing the risk and consequences of multiple TBIs. Continued research and evaluation of existing laws will be needed to develop a more comprehensive youth TBI-reduction solution. PMID:23678903
ERIC Educational Resources Information Center
Kazis, Richard
This report focuses on the potential of Workforce Investment Act Youth Councils (YCs) to become proponents of and planners for coordinated youth services and to advocate for improved outcomes for in-school and out-of-school youth, whether a person qualifies for services under the act or not. The study reviews plans and strategies of YCs in these…
Examining How Youth Take on Critical Civic Identities across Classroom and Youth Organizing Spaces
ERIC Educational Resources Information Center
Moya, Jesse
2017-01-01
This paper documents the ways that two learning spaces--a community-based youth organizing group and a high school social studies classroom--provided different opportunities for Latinx youth to take on critical civic identities characterized by a critical consciousness, a motivation for social justice, and feelings of civic agency. By examining…
VMI-VI and BG-II KOPPITZ-2 for Youth with HFASDs and Typical Youth
ERIC Educational Resources Information Center
McDonald, Christin A.; Volker, Martin A.; Lopata, Christopher; Toomey, Jennifer A.; Thomeer, Marcus L.; Lee, Gloria K.; Lipinski, Alanna M.; Dua, Elissa H.; Schiavo, Audrey M.; Bain, Fabienne; Nelson, Andrew T.
2014-01-01
The visual-motor skills of 90 youth with high-functioning autism spectrum disorders (HFASDs) and 51 typically developing (TD) youth were assessed using the Beery-Buktenica Developmental Test of Visual-Motor Integration, Sixth Edition (VMI-VI) and Koppitz Developmental Scoring System for the Bender-Gestalt Test-Second Edition (KOPPITZ-2).…
Exposure of black youths to cigarette advertising in magazines
King, C.; Siegel, M.; Pucci, L.
2000-01-01
OBJECTIVE—To estimate the potential exposure of black adolescents to brand specific advertising in magazines. DESIGN—A probit regression analysis was conducted of pooled 1990 and 1994 data on brand specific advertising in 36 popular US magazines to examine the relationship between the presence or absence of advertising in each magazine for each of 12 cigarette brands, and the proportion of each magazine's youth (ages 12-17 years) readers who were black. MAIN OUTCOME MEASURES—The presence or absence of advertising in each magazine in 1990 and 1994, for each of 12 cigarette brands. RESULTS—After controlling for total magazine readership and the percentage of young adult, Hispanic, and female readers, black youth cigarette brands (those whose market share among black youths exceeded their overall market share) were more likely than other brands to advertise in magazines with a higher percentage of black youth readers. Holding all other variables constant at their sample means, the probability of a non-black youth brand advertising in a magazine decreased over the observed range of percentage black youth readership from 0.65 (95% confidence interval (CI) 0.55 to 0.75) for magazines with 5% black youth readers to 0.33 (95% CI 0.00 to 0.69) for magazines with 91% black youth readers. In contrast, the probability of a black youth brand advertising in a magazine increased from 0.40 (95% CI 0.17 to 0.62) at 5% black youth readership to 1.00 (95% CI 0.97 to 1.00) at 91% black youth readership. CONCLUSIONS—Black youths are more likely than white youths to be exposed to magazine advertising by cigarette brands popular among black adolescents. Keywords: advertising; magazines; youths PMID:10691759
Automation in organizations: Eternal conflict
NASA Technical Reports Server (NTRS)
Dieterly, D. L.
1981-01-01
Some ideas on and insights into the problems associated with automation in organizations are presented with emphasis on the concept of automation, its relationship to the individual, and its impact on system performance. An analogy is drawn, based on an American folk hero, to emphasize the extent of the problems encountered when dealing with automation within an organization. A model is proposed to focus attention on a set of appropriate dimensions. The function allocation process becomes a prominent aspect of the model. The current state of automation research is mentioned in relation to the ideas introduced. Proposed directions for an improved understanding of automation's effect on the individual's efficiency are discussed. The importance of understanding the individual's perception of the system in terms of the degree of automation is highlighted.
McKEE, LAURA G.; PARENT, JUSTIN; FOREHAND, REX; RAKOW, AARON; WATSON, KELLY H.; DUNBAR, JENNIFER P.; REISING, MICHELLE M.; HARDCASTLE, EMILY; COMPAS, BRUCE E.
2014-01-01
This study utilized structural equation modeling to examine the associations among parental guilt induction (a form of psychological control), youth cognitive style, and youth internalizing symptoms, with parents and youth participating in a randomized controlled trial of a family-based group cognitive–behavioral preventive intervention targeting families with a history of caregiver depression. The authors present separate models utilizing parent report and youth report of internalizing symptoms. Findings suggest that families in the active condition (family-based group cognitive–behavioral group) relative to the comparison condition showed a significant decline in parent use of guilt induction at the conclusion of the intervention (6 months postbaseline). Furthermore, reductions in parental guilt induction at 6 months were associated with significantly lower levels of youth negative cognitive style at 12 months. Finally, reductions in parental use of guilt induction were associated with lower youth internalizing symptoms 1 year following the conclusion of the intervention (18 months postbaseline). PMID:24438999
Seeking and Finding Positive Youth Development Among Zulu Youth in South African Townships.
Schwartz, Kelly D; Theron, Linda C; Scales, Peter C
2017-07-01
A cross-sectional study explored the presence and power of developmental assets in a sample of youth from rural South African townships. Learners (female = 58%; M age = 17.1; N = 505) attending three township high schools completed self-report measures of developmental assets and thriving outcomes. Participants reported contextual assets (e.g., family, school, community) in the vulnerable ranges, with gender, family structure, and school type accounting for some differences. Correlation and regression analyses revealed that five asset contexts (family, school, community, personal, social) were uniquely predictive of thriving outcomes. Discussion focuses on contextual expressions of positive youth development among Zulu township youth in challenging environments. © 2017 The Authors. Child Development © 2017 Society for Research in Child Development, Inc.
Helping Youth Become More Responsible.
ERIC Educational Resources Information Center
Owens, Thomas R.
Students and teachers at a suburban high school in Oregon and employers associated with cooperative work experience (CWE) and experience-based career education (EBCE) programs were interviewed regarding youth responsibility. Specific focuses were perceptions about the meaning of responsibility, youth attitudes regarding being given adult…
Pickens County Youth Apprenticeship Initiative.
ERIC Educational Resources Information Center
Pickens County School District, Easley, SC.
This publication contains materials related to the youth apprenticeship program in computer electronics launched by Pickens Country School District, South Carolina, for students enrolled in the district's tech prep curriculum. Contents include the following: goals and objectives of the National Youth Apprenticeship Initiative; a pyramid…
Organizations Advocating for Youth: The Local Advantage
ERIC Educational Resources Information Center
Deschenes, Sarah; McLaughlin, Milbrey; Newman, Anne
2008-01-01
Youth occupy a unique place in democratic society. They must primarily rely on others to speak on their behalf as decisions are made about the allocation of resources within and across various youth-serving institutions. Advocacy organizations comprise crucial representational assets for all youth, but America's poorest children and youth…
Intermediaries Supporting Sports-Based Youth Development Programs
ERIC Educational Resources Information Center
Wicks, Anne; Beedy, Jeffrey P.; Spangler, Kathy J.; Perkins, Daniel F.
2007-01-01
The authors describe intermediary organizations whose aim is to provide technical assistance to sports organizations about infusing a youth development emphasis into their programming. Team-Up for Youth, Sports PLUS Global, and the National Recreation and Park Association are the three organizations highlighted in this article. Team-Up for Youth's…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davies, K.E.; Morrison, K.E.; Daniels, R.I.
1994-09-01
We previously reported that the 400 kb interval flanked the polymorphic loci D5S435 and D5S557 contains blocks of a chromosome 5 specific repeat. This interval also defines the SMA candidate region by genetic analysis of recombinant families. A YAC contig of 2-3 Mb encompassing this area has been constructed and a 5.5 kb conserved fragment, isolated from a YAC end clone within the above interval, was used to obtain cDNAs from both fetal and adult brain libraries. We describe the identification of cDNAs with stretches of high DNA sequence homology to exons of {beta} glucuronidase on human chromosome 7. Themore » cDNAs map both to the candidate region and to an area of 5p using FISH and deletion hybrid analysis. Hybridization to bacteriophage and cosmid clones from the YACs localizes the {beta} glucuronidase related sequences within the 400 kb region of the YAC contig. The cDNAs show a polymorphic pattern on hybridization to genomic BamH1 fragments in the size range of 10-250 kb. Further analysis using YAC fragmentation vectors is being used to determine how these {beta} glucuronidase related cDNAs are distributed within 5q13. Dinucleotide repeats within the region are being investigated to determine linkage disequilibrium with the disease locus.« less
Youth-Targeted E-cigarette Marketing in the US
Padon, Alisa A.; Maloney, Erin K.; Cappella, Joseph N.
2016-01-01
Objectives The purpose of this project was to explore the extent to which e-cigarette advertisements use youth-appealing content. Methods A sample of e-cigarette video ads (N = 154) were coded by 3 independent coders using the content appealing to youth (CAY) index, which measures over 40 youth-appealing features. To calculate a total CAY score for each ad, scores were normalized and summed such that a higher score represented the presence of more youth-appealing elements. Results All ads included some youth-appealing content, with frequent use of emotional appeals, including happiness (68%), friendship (41%), sex (24%), and success (24%). Over half featured animation. However, product appeals, known to be disliked by youth, were also prevalent. Eighty-seven percent used a direct appeal to e-cigarettes' value over tobacco cigarettes; 66% mentioned product composition; and 40% mentioned health. Conclusions Given the unregulated context in the US, e-cigarette marketing currently contains many features that may be particularly appealing to youth. PMID:28083545
Youth-Targeted E-cigarette Marketing in the US.
Padon, Alisa A; Maloney, Erin K; Cappella, Joseph N
2017-01-01
The purpose of this project was to explore the extent to which e-cigarette advertisements use youth-appealing content. A sample of e-cigarette video ads (N = 154) were coded by 3 independent coders using the content appealing to youth (CAY) index, which measures over 40 youth-appealing features. To calculate a total CAY score for each ad, scores were normalized and summed such that a higher score represented the presence of more youth-appealing elements. All ads included some youth-appealing content, with frequent use of emotional appeals, including happiness (68%), friendship (41%), sex (24%), and success (24%). Over half featured animation. However, product appeals, known to be disliked by youth, were also prevalent. Eighty-seven percent used a direct appeal to e-cigarettes' value over tobacco cigarettes; 66% mentioned product composition; and 40% mentioned health. Given the unregulated context in the US, e-cigarette marketing currently contains many features that may be particularly appealing to youth.
Youth in detention and handguns.
Callahan, C M; Rivara, F P; Farrow, J A
1993-07-01
The objective of this work was to describe the frequency and correlates of handgun ownership and firearm injury experiences among youth in a detention facility. A convenience sample of 89 males detained in the King County Youth Services Center, a short-term holding facility, voluntarily completed an anonymous survey. Results showed that 59% of the youth reported owning a handgun. Firearm experiences included carrying a gun to school (46%); firing at another person (68% of handgun owners); firearm injury to self (27%); death of a close friend or family member to firearm homicide or suicide (35%). Personal safety far exceeded recreational use of guns as motivation for self-arming (52% versus 4%). Handgun ownership was more common among youth who reported problem behaviors. Adjusting for age and controlling for covariation of the problem behaviors, gang membership [odds ratio (OR) 6.7; 95% confidence interval (CI) 1.7-26.1], committing assault and battery (OR 7.7; 95% CI 2.2-26.8) and selling drugs (OR 3.6; 95% CI 0.99-13.4) were associated with handgun ownership. Our conclusion was that firearm experiences for youth in detention pose health risks equal to or far exceeding other high-risk behaviors in this population.
Sauer, Juergen; Chavaillaz, Alain; Wastell, David
2016-06-01
This work examined the effects of operators' exposure to various types of automation failures in training. Forty-five participants were trained for 3.5 h on a simulated process control environment. During training, participants either experienced a fully reliable, automatic fault repair facility (i.e. faults detected and correctly diagnosed), a misdiagnosis-prone one (i.e. faults detected but not correctly diagnosed) or a miss-prone one (i.e. faults not detected). One week after training, participants were tested for 3 h, experiencing two types of automation failures (misdiagnosis, miss). The results showed that automation bias was very high when operators trained on miss-prone automation encountered a failure of the diagnostic system. Operator errors resulting from automation bias were much higher when automation misdiagnosed a fault than when it missed one. Differences in trust levels that were instilled by the different training experiences disappeared during the testing session. Practitioner Summary: The experience of automation failures during training has some consequences. A greater potential for operator errors may be expected when an automatic system failed to diagnose a fault than when it failed to detect one.
Oshri, Assaf; Topple, Trasie A; Carlson, Matthew W
2017-07-01
Maltreated children are a vulnerable population, yet many of these youth follow positive developmental pathways. The primary aim was to identify social skills growth trajectories among at-risk youth to understand processes underlying resilience. Nationally representative, longitudinal data from 1,179 families investigated for child maltreatment (M age = 12.75) were obtained from the National Survey of Child and Adolescent Well-Being. Four trajectories were identified-stress-resistant, emergent resilience, breakdown, and unresponsive-maladaptive. Protective resources from multiple levels of the youth ecology (individual, family, school, and social service) predicted positive growth social skills trajectories. Resilience process and attendant positive outcomes in multiple domains of functioning were evident among the stress-resistant and emergent resilience trajectories. Results underscore the saliency of social skills development for resilient outcomes in youth. © 2017 The Authors. Child Development © 2017 Society for Research in Child Development, Inc.
Tanski, S E; Prokhorov, A V; Klein, J D
2004-12-01
Youth around the world take up smoking and use tobacco products at high rates. Young people may not grasp the long-term consequences of tobacco use, although tobacco consumption and exposure has been shown to have significant negative health effects. Youth use a variety of tobacco products that are smoked, chewed, or sniffed, including machine-manufactured cigarettes, cigars, bidis, kreteks, sticks, and snuff. Prevention efforts have focused on countering those aspects that are believed to contribute to smoking uptake, such as tobacco industry advertising and promotion, and access to tobacco. There are many aspects of tobacco promotion through the media that have been more difficult to control, however, such as product placement within popular cinema movies. Once a youth has taken up tobacco, he or she is more likely than an adult to become addicted and should be offered treatment for tobacco cessation. Although there is not yet sufficient evidence to prove efficacy, the same treatments are suggested for youth as are recommended for adults, including nicotine replacement products. Given the severity of the tobacco epidemic worldwide and the devastating health effects on an individual and population basis, there are currently many efforts to curtail the tobacco problem, including the World Health Organization (WHO) sponsored Framework Convention on Tobacco Control. It is through comprehensive and collaborative efforts such as this that the global hazard of tobacco is most likely to be overcome.
ERIC Educational Resources Information Center
Richards, James M., Jr.; And Others
The New Youth Initiatives in Apprenticeship Program (YAP) was compared with the Youth Career Development Program (YCD). Data for 1979 and 1980 came from an evaluation of YAP projects by CSR, Incorporated, and an evaluation of the YCD projects by the Educational Testing Service. A multiple regression approach was used to compare student…
Youth Courts and Their Educational Value: An Examination of Youth Courts in Chester, Pennsylvania
ERIC Educational Resources Information Center
Norton, Michael H.; Gold, Eva; Peralta, Renata
2013-01-01
The Stoneleigh Foundation of Philadelphia has historically focused its strategic investments on improving outcomes for youth involved or at risk of involvement in the juvenile justice and child welfare systems. Stoneleigh began its support for youth courts by providing a fellowship award from 2009 to 2011 to public interest lawyer Gregory Volz to…
ERIC Educational Resources Information Center
Zeldin, Shepherd; Camino, Linda; Mook, Carrie
2005-01-01
Youth-adult partnerships (Y-APs) for organizational and community change represent an innovative practice in the United States. Innovations are typically a challenge to implement, so it is not surprising that youth organizations are seeking guidance on how to adopt and sustain Y-APs. This article brings contemporary scholarship to bear on the…
Youth with Depression/Anxiety. Vulnerable Youth and the Transition to Adulthood. ASPE Research Brief
ERIC Educational Resources Information Center
Macomber, Jennifer
2009-01-01
The transition to adulthood can be particularly challenging when a young adult experiences mental health problems. This fact sheet uses data from the National Longitudinal Survey of Youth 1997 to explore the young adult outcomes and adolescent risk behaviors of youth suffering from depression and anxiety as they make this transition. Depression…
Automated Engineering Design (AED); An approach to automated documentation
NASA Technical Reports Server (NTRS)
Mcclure, C. W.
1970-01-01
The automated engineering design (AED) is reviewed, consisting of a high level systems programming language, a series of modular precoded subroutines, and a set of powerful software machine tools that effectively automate the production and design of new languages. AED is used primarily for development of problem and user-oriented languages. Software production phases are diagramed, and factors which inhibit effective documentation are evaluated.
Computers and the internet: tools for youth empowerment.
Valaitis, Ruta K
2005-10-04
Youth are often disenfranchised in their communities and may feel they have little voice. Since computers are an important aspect of youth culture, they may offer solutions to increasing youth participation in communities. This qualitative case study investigated the perceptions of 19 (predominantly female) inner-city school youth about their use of computers and the Internet in a school-based community development project. Youth working with public health nurses in a school-based community development project communicated with local community members using computer-mediated communication, surveyed peers online, built websites, searched for information online, and prepared project materials using computers and the Internet. Participant observation, semistructured interviews, analysis of online messages, and online- and paper-based surveys were used to gather data about youth's and adults' perceptions and use of the technologies. Constant comparison method and between-method triangulation were used in the analysis to satisfy the existence of themes. Not all youth were interested in working with computers. Some electronic messages from adults were perceived to be critical, and writing to adults was intimidating for some youth. In addition, technical problems were experienced. Despite these barriers, most youth perceived that using computers and the Internet reduced their anxiety concerning communication with adults, increased their control when dealing with adults, raised their perception of their social status, increased participation within the community, supported reflective thought, increased efficiency, and improved their access to resources. Overall, youth perceived computers and the Internet to be empowering tools, and they should be encouraged to use such technology to support them in community initiatives.
Youth Mentoring and Resilience: Implications for Practice
ERIC Educational Resources Information Center
Rhodes, Jean; Lowe, Sarah Ryan
2008-01-01
Despite findings indicating the importance of non-parental adults in the lives of youth, there is little research on these relationships, including those that occur in the context of youth mentoring. Compounding this problem is a positive slant taken towards youth mentoring in the media, often unsubstantiated by empirical evidence. This article…
Leatherdale, S T; Smith, P; Ahmed, R
2008-04-01
Little is known about what youth think about restricting smoking in their homes or in cars. The present study characterises the frequency of youth being exposed to smoking in their homes and cars, and the beliefs that youth have about restricting people from smoking around youth in those locations. Data from the 2004 Youth Smoking Survey (YSS) were used to examine youth exposure to smoking and beliefs about smoking in the home and car among 29,243 Canadian youth in grades 5-9. Logistic regression models were conducted to examine if being exposed to smoking at home or in the car were associated with the beliefs youth have about either smoking around children at home or smoking around children in cars. In 2004, 23.1% of youth in grades 5-9 were exposed to smoking in their home on a daily or almost daily basis, 26.3% were exposed to smoking while travelling in a car at least once in the previous week. The majority of youth reported that they do not think smoking should be allowed around children at home (90.6%) or in cars (90.2%). Males were more likely than females to report that smoking should not be allowed around children at home (OR 1.38) or in cars (OR 1.39). Youth living in a house where someone smokes inside daily were more likely to report that smoking should not be allowed around children at home (OR 1.20) or in cars (OR 1.21). Youth living in a house where the rules do not prevent people from smoking inside were also more likely to report that smoking should not be allowed around children at home (OR 2.07) or in cars (OR 1.76). Youth who have ridden in a car with someone who was smoking cigarettes in the past 7 days were more likely to report that smoking should not be allowed around children in cars (OR 1.73). It is common for Canadian youth to be exposed to SHS in their homes or while in cars on a frequent basis even though the vast majority of youth do not think smoking should be allowed around children in those locations. This new evidence suggests that
Weapons and Minority Youth Violence.
ERIC Educational Resources Information Center
Northrop, Daphne; Hamrick, Kim
Weapons violence is a major public health problem that especially impacts minority youth. Interventions designed to reduce weapon use by youth are categorized as educational/behavioral change, legal, and technological/environmental. Few educational programs currently exist, but those that do largely concern firearm safety courses, public…
Youth Homelessness and Individualised Subjectivity
ERIC Educational Resources Information Center
Farrugia, David
2011-01-01
This article aims to contribute to understandings of youth homelessness and subjectivity by analysing identity construction in terms of young people's negotiation of the structural and institutional environment of youth homelessness. I suggest that while existing literature on this topic concentrates mainly on micro-social encounters, the…
Raising Responsible and Resourceful Youth.
ERIC Educational Resources Information Center
Juvenile Justice, 2000
2000-01-01
The 2000 White House Conference on Teenagers brought together parents, teenagers, educators, youth workers, researchers, policymakers, and others to examine how families and communities can teach youth sound values, promote healthy behavior, and support positive development. Presents an article by Hillary Rodham Clinton that summarizes the…
Knowledge, Interest, and Value of Youth Zoo Visitors
NASA Astrophysics Data System (ADS)
Burris, Alexandra M.
In the face of massive global extinction, the mission of zoos for conservation education has increasing importance. Zoos are in a unique position to affect the development of youth in ways that are consistent with cultivating pro-environmental behaviors. The purpose of this study was to examine three intrinsic traits of youth important to the goals of conservation education: knowledge about animals, interest in animals, and value for animals. In particular, I explored the relationship between these three traits and the utterances and behaviors of youth zoo visitors during their visit. Using an embedded correlational data transformation mixed methods design, this study examined the experiences of 37 youth attending the zoo. Data collection sources included a drawing activity meant to assess the knowledge of youth about animals, Likert-type questionnaires meant to assess the youth's interest and value, and a semi-structured interview meant to ascertain critical moments from the youth's visit. The results of these instruments were paired with extensive video data of the youth's entire zoo visit. Results of the study indicated that youth organize their knowledge about animals around ecological and morphological concepts and that this forms the basis for their value of animals. The knowledge, interest, and value of youth zoo visitors did seem to correlate with some utterances and behaviors in the zoo, but learning talk was rare. Results also indicated that certain critical moments during the youth's visit were social in nature and centered on the behaviors of animals. These moments may be the most promising for influencing the development of knowledge, interest, and value. The discussion and implications sections of the study focus on the practical use of the findings for zoo education. The study points to the importance of studying intrinsic traits of youth as well as the important influences of the social and physical context on the development of these traits during
ERIC Educational Resources Information Center
Iwasaki, Yoshitaka; Hopper, Tristan; Whelan, Patricia
2017-01-01
This short communication provides our insights into how or in what ways educators can more effectively support aspiration of at-risk/high-risk youth toward meaningful education. These are informed by the key learnings from our ongoing youth engagement research. Those insights emphasize the importance of "meaningful engagement of youth"…
ERIC Educational Resources Information Center
Naclerio, Nick
1979-01-01
Clerical personnel may be able to climb career ladders as a result of office automation and expanded job opportunities in the word processing area. Suggests opportunities in an automated office system and lists books and periodicals on word processing for counselors and teachers. (MF)
Transgender youth: current concepts
2016-01-01
In many countries throughout the world, increasing numbers of gender nonconforming/transgender youth are seeking medical services to enable the development of physical characteristics consistent with their experienced gender. Such medical services include use of agents to block endogenous puberty at Tanner stage II with subsequent use of cross-sex hormones, and are based on longitudinal studies demonstrating that those individuals who were first identified as gender dysphoric in early or middle childhood and continue to meet the mental health criteria for being transgender at early puberty are likely to be transgender as adults. This review addresses terms and definitions applicable to gender nonconforming youth, studies that shed light on the biologic determinants of gender identity, current clinical practice guidelines for transgender youth, challenges to optimal care, and priorities for research. PMID:28164070
Racial Differences in Cigarette Smoking Among Homeless Youth.
Golinelli, Daniela; Tucker, Joan S; Shadel, William G
2016-12-01
Several studies have reported pronounced racial/ethnic differences in smoking behavior among homeless youth. Better understanding the factors underlying racial/ethnic differences in daily smoking among homeless youth may help inform programs to reduce smoking in this population. Data come from a probability sample of homeless youth in Los Angeles County collected between 2008 and 2009. The sample includes 116 African American, 99 Hispanic, and 119 White youth with ages ranging from 13 to 24 years. Chi-square tests were used to test the differences in daily smoking among African American, Hispanic, and White youth. Propensity score and doubly robust methods were used to produce a less biased estimate of the association between daily smoking and race/ethnicity after having removed the effect of potential confounders. The daily smoking rate for White youth was 70.1%, more than 31 percentage points than the rates for either African American or Hispanic youth. Propensity score analysis revealed that the majority of the racial/ethnic differences in smoking rates could be explained by differences in homelessness severity, although background characteristics and comorbidity were relevant as well. As programs are developed to reduce smoking among homeless youth, results suggest that additional outreach may be needed to engage White youth in services. Also, smoking prevention programs may benefit from incorporating a social network-based approach that assists youth in fostering relationships with lower-risk peers, as well as addressing other forms of substance use. Incorporating these elements may help reduce the large racial/ethnic disparities in daily smoking among homeless youth. This report extends the small existing literature on racial/ethnic differences in smoking among homeless youth in two important respects. First, it confirms differences in daily smoking, an important indicator of dependence, across racial/ethnic groups. Second, it seeks to understand the extent
Development of measures to evaluate youth advocacy for obesity prevention.
Millstein, Rachel A; Woodruff, Susan I; Linton, Leslie S; Edwards, Christine C; Sallis, James F
2016-07-26
Youth advocacy has been successfully used in substance use prevention but is a novel strategy in obesity prevention. As a precondition for building an evidence base for youth advocacy for obesity prevention, the present study aimed to develop and evaluate measures of youth advocacy mediator, process, and outcome variables. The Youth Engagement and Action for Health (YEAH!) program (San Diego County, CA) engaged youth and adult group leaders in advocacy for school and neighborhood improvements to nutrition and physical activity environments. Based on a model of youth advocacy, scales were developed to assess mediators, intervention processes, and proximal outcomes of youth advocacy for obesity prevention. Youth (baseline n = 136) and adult group leaders (baseline n = 47) completed surveys before and after advocacy projects. With baseline data, we created youth advocacy and adult leadership subscales using confirmatory factor analysis (CFA) and described their psychometric properties. Youth came from 21 groups, were ages 9-22, and most were female. Most youth were non-White, and the largest ethnic group was Hispanic/Latino (35.6%). The proposed factor structure held for most (14/20 youth and 1/2 adult) subscales. Modifications were necessary for 6 of the originally proposed 20 youth and 1 of the 2 adult multi-item subscales, which involved splitting larger subscales into two components and dropping low-performing items. Internally consistent scales to assess mediators, intervention processes, and proximal outcomes of youth advocacy for obesity prevention were developed. The resulting scales can be used in future studies to evaluate youth advocacy programs.
Development, risk, and resilience of transgender youth.
Stieglitz, Kimberly A
2010-01-01
Transgender youth face unique and complex issues as they confront cultural expectations of gender expression and how these fit with what is natural for them. Striving for balance, learning to cope, questioning, and eventually becoming comfortable with one's gender identity and sexual orientation are of paramount importance for healthy growth and development. Ineffective management of intense challenges over time without adequate social support places youth at risk for a number of unhealthy behaviors, including risk behaviors associated with acquiring HIV. This article explores early foundations of gender identity development, challenges in the development of transgender youth, and the limited data that exist on transgender youth and HIV risks. The concept of resilience is introduced as a counterbalancing area for assessment and intervention in practice and future research with transgender youth.
Systematic review automation technologies
2014-01-01
Systematic reviews, a cornerstone of evidence-based medicine, are not produced quickly enough to support clinical practice. The cost of production, availability of the requisite expertise and timeliness are often quoted as major contributors for the delay. This detailed survey of the state of the art of information systems designed to support or automate individual tasks in the systematic review, and in particular systematic reviews of randomized controlled clinical trials, reveals trends that see the convergence of several parallel research projects. We surveyed literature describing informatics systems that support or automate the processes of systematic review or each of the tasks of the systematic review. Several projects focus on automating, simplifying and/or streamlining specific tasks of the systematic review. Some tasks are already fully automated while others are still largely manual. In this review, we describe each task and the effect that its automation would have on the entire systematic review process, summarize the existing information system support for each task, and highlight where further research is needed for realizing automation for the task. Integration of the systems that automate systematic review tasks may lead to a revised systematic review workflow. We envisage the optimized workflow will lead to system in which each systematic review is described as a computer program that automatically retrieves relevant trials, appraises them, extracts and synthesizes data, evaluates the risk of bias, performs meta-analysis calculations, and produces a report in real time. PMID:25005128
Meeting the Needs of Homeless Youth. A Report of the Homeless Youth Steering Committee.
ERIC Educational Resources Information Center
Frawley, Robert; Zafonte, Suzanne M.
This report examines the unique aspects of homelessness among youth ages 16 to 21. Section I reviews existing literature and data on the size, characteristics, and needs of homeless youth. Section II summarizes New York State's current efforts on their behalf. Section III analyzes obstacles to serving this population. Section IV outlines an action…
Corner stores: the perspective of urban youth.
Sherman, Sandra; Grode, Gabrielle; McCoy, Tara; Vander Veur, Stephanie S; Wojtanowski, Alexis; Sandoval, Brianna Almaguer; Foster, Gary D
2015-02-01
We examined the perspectives of low-income, urban youth about the corner store experience to inform the development of corner store interventions. Focus groups were conducted to understand youth perceptions regarding their early shopping experiences, the process of store selection, reasons for shopping in a corner store, parental guidance about corner stores, and what their ideal, or "dream corner store" would look like. Thematic analysis was employed to identify themes using ATLAS.ti (version 6.1, 2010, ATLAS.ti GmbH) and Excel (version 2010, Microsoft Corp). Focus groups were conducted in nine kindergarten-through-grade 8 (K-8) public schools in low-income neighborhoods with 40 fourth- to sixth-graders with a mean age of 10.9±0.8 years. Youth report going to corner stores with family members at an early age. By second and third grades, a growing number of youth reported shopping unaccompanied by an older sibling or adult. Youth reported that the products sold in stores were the key reason they choose a specific store. A small number of youth said their parents offered guidance on their corner store purchases. When youth were asked what their dream corner store would look like, they mentioned wanting a combination of healthy and less-healthy foods. These data suggest that, among low-income, urban youth, corner store shopping starts at a very young age and that product, price, and location are key factors that affect corner store selection. The data also suggest that few parents offer guidance about corner store purchases, and youth are receptive to having healthier items in corner stores. Corner store intervention efforts should target young children and their parents/caregivers and aim to increase the availability of affordable, healthier products. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.
Community Service and Social Responsibility in Youth.
ERIC Educational Resources Information Center
Youniss, James; Yates, Miranda
This book presents a theoretical rationale for youth involvement in community service. Its thesis is that youth participation in solving social problems has the potential to promote the development of personal and collective identity. Through community service, youth can acquire a sense that they can make a difference and a concern for society's…
Understanding human management of automation errors.
McBride, Sara E; Rogers, Wendy A; Fisk, Arthur D
2014-01-01
Automation has the potential to aid humans with a diverse set of tasks and support overall system performance. Automated systems are not always reliable, and when automation errs, humans must engage in error management, which is the process of detecting, understanding, and correcting errors. However, this process of error management in the context of human-automation interaction is not well understood. Therefore, we conducted a systematic review of the variables that contribute to error management. We examined relevant research in human-automation interaction and human error to identify critical automation, person, task, and emergent variables. We propose a framework for management of automation errors to incorporate and build upon previous models. Further, our analysis highlights variables that may be addressed through design and training to positively influence error management. Additional efforts to understand the error management process will contribute to automation designed and implemented to support safe and effective system performance.
ERIC Educational Resources Information Center
Kennedy, J. A.
A study of youth and the Youth Service in rural West Dorset (England) to determine what work and recreational opportunities are available, how youth view their adolescent years, and how the Youth Service is helping them adjust to adulthood, indicates that within the present system youth are afforded few considerations. Many become alienated. Many…
Mental health correlates of victimization classes among homeless youth.
Bender, Kimberly; Ferguson, Kristin; Thompson, Sanna; Langenderfer, Lisa
2014-10-01
Literature reports high rates of street victimization among homeless youth and recognizes psychiatric symptoms associated with such victimization. Few studies have investigated the existence of victimization classes that differ in type and frequency of victimization and how youth in such classes differ in psychiatric profiles. We used latent class analysis (LCA) to examine whether classes of homeless youth, based on both type and frequency of victimization experiences, differ in rates of meeting diagnostic criteria for major depressive episodes and posttraumatic stress disorder (PTSD) in a sample of homeless youth (N=601) from three regions of the United States. Results suggest youth who experience high levels of direct and indirect victimization (high-victimization class) share similarly high rates of depressive episodes and PTSD as youth who experience primarily indirect victimization only (witness class). Rates of meeting criteria for depressive episodes and PTSD were nearly two and three times greater, respectively, among the high victimization and witness classes compared to youth who never or rarely experienced victimization. Findings suggest the need for screening and intervention for homeless youth who report direct and indirect victimization and youth who report indirect victimization only, while prevention efforts may be more relevant for youth who report limited victimization experience. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Sato, Takumi C.
While many researchers have worked to address the unequal educational outcomes between White and non-White students, there are few signs of progress for people of color seeking entry into a STEM career trajectory. Starting from high school, the number of students who persist to complete a STEM bachelor's degree and obtaining a job in science or engineering continues to indicate that people of color are underrepresented. I suggest that research must consider the role of race and racism in the education of youth of color. Especially in science education, there is very little work addressing how racism may present barriers that impede progress for students along the STEM trajectory. This study is informed by critical race theory (CRT) that posits racism is endemic in society. White privilege enables the dominant group to maintain inequitable advantages that marginalizes populations of color. CRT also puts forth that counter narratives of the marginalized groups is essential to challenge the institutionalized forms of oppression. Using CRT and youth participatory action research (YPAR), this investigation re-imagines youth as capable of transforming their own social and political condition through research and action. This project asked youth of color to interrogate their own experiences as science learners, engage in research on structural inequities of STEM trajectories, plan strategic moves to challenge power structures, and take action for social justice. The youth started by exploring the concept of race and instances where racism was found in public spaces and in their personal experiences. They examined their experiences in science as a student more generally and then for racism. Then, the focus turned to conducting research with peers, observing science classrooms in another school, and using online information to compare schools. The youth planned strategic action against the racism they found in the analysis of the data that included conference presentations
Black Youths and Illegal Drugs.
ERIC Educational Resources Information Center
Joseph, Janice; Pearson, Patricia G.
2002-01-01
Examines the effect of drugs on black youths, discussing different types of drug involvement, reasons for drug involvement, extent and nature of involvement, drugs and crime, drugs and health issues, drug control strategies, and prevention. Policy implications include prioritizing drug prevention among black youths, providing alternatives to drug…
International Polar Year Youth Steering Committee
NASA Astrophysics Data System (ADS)
Baeseman, J. L.; Church, A.; Kuhn, T.; Raymond, M.; Lantuit, H.
2006-12-01
The International Youth Steering Committee is made up of youth representatives from around the world, from science, social science, aboriginal and arts backgrounds and ranging in education from new faculty to high school. The YSC serves as a voice for youth on polar issues and empower youth to get involved in issues facing the Polar Regions. YSC is working to draw the World's attention to the poles and act as a force for positive change. An International YSC website has been developed which will provide a forum where youth will be able to communicate with each other globally and get involved in IPY and YSC programs. One of these programs is the International Youth Conference on the Poles (IYCP). This conference, which will take place in May 2008, will bring together youth from around the world to focus on polar issues. Young polar researchers are being recruited to design educational materials based on their work for another YSC project, Polar Contests. YSC has partnered with Students on Ice (SOI), a non-profit organization who will be providing a series of nine SOI- IPY YSC expeditions to the Arctic and Antarctic over the course of IPY, allowing hundreds of students from around the world to experience the Polar Regions first-hand, learn from experts working in these areas and become inspired to work for their continued protection. We are also sponsoring an opportunity for youth from around the world to connect with and interview the participants of the International Geophysical Year (IGY), the results of that will ultimately be presented in book or documentary form at the close of IPY. The YSC has partnered with the science fiction educational book series, Tales of the Wonder Zone, to release Polaris; A Celebration of Polar Science, in which youth and professional authors from around the world submitted stories based on an IPY fifty years in the future. The final part of the YSC is to provide a forum and activities that will allow early career scientists to
ERIC Educational Resources Information Center
Erbstein, Nancy
2013-01-01
For youth who are the most vulnerable to challenging community conditions, more limited opportunities, and poor health, educational and economic trajectories derive especially strong benefits from engagement in community youth development efforts. Although communities can benefit in powerful ways from the knowledge and insight of these youth…
The "here and now" of youth: the meanings of smoking for sexual and gender minority youth.
Antin, Tamar M J; Hunt, Geoffrey; Sanders, Emile
2018-05-31
The mainstream tobacco field in the USA tends to situate youth as passive, particularly in terms of their susceptibility to industry manipulation and peer pressure. However, failing to acknowledge youths' agency overlooks important meanings youth ascribe to their tobacco use and how those meanings are shaped by the circumstances and structures of their everyday lives. This article is based on analysis of 58 in-depth qualitative interviews conducted with sexual and gender minority youth living in the San Francisco Bay area in California. Topics covered in interviews focused on meanings of tobacco in the lives of youth. Interviews lasted approximately 2.5 h and were transcribed verbatim and linked with ATLAS.ti, a qualitative data analysis software. Following qualitative coding, narrative segments were sorted into piles of similarity identified according to principles of pattern-level analysis to interpret to what extent meanings of smoking for young people may operate as forms of resistance, survival, and defense. Analysis of our participants' narratives highlights how smoking is connected to what Bucholtz calls the "'here-and-now' of young people's experience, the social and cultural practices through which they shape their worlds" as active agents (Bucholtz, Annu Rev Anthropol31:525-52, 2003.). Specifically, narratives illustrate how smoking signifies "control" in a multitude of ways, including taking control over an oppressor, controlling the effects of exposure to traumatic or day-to-day stress, and exerting control over the physical body in terms of protecting oneself from violence or defending one's mental health. These findings call into question the universal appropriateness of foundational elements that underlie tobacco control and prevention efforts directed at youth in the USA, specifically the focus on abstinence and future orientation. Implications of these findings for research, prevention, and policy are discussed, emphasizing the risk of furthering
Listening to youth: reflections on the effect of a youth development program.
Kalish, Robin E; Voigt, Bridget; Rahimian, Afsaneh; Dicara, Joseph; Sheehan, Karen
2010-05-01
To identify key elements that contribute to the effectiveness of a youth development program, interviews were conducted with 35 former Chicago Youth Programs (CYP) participants who remained in the program until age 18 years and went on to attend college, and 25 participants who left the program (and are currently older than age 18). Of the college participants who remained in CYP until age 18, 97% reported that the program had helped them by providing tutoring, mentoring, and financial support. In comparison, only 56% of the CYP dropouts had completed some college, and nearly 50% reported being involved in illegal activities. Many of the CYP dropouts were drawn to illegal activities for financial reasons or because they felt there was inadequate adolescent programming. All reported benefiting from their CYP participation. Incorporating financial incentives or specific adolescent programming may lead to longer youth program participation and, perhaps, more positive outcomes.
The Automation-by-Expertise-by-Training Interaction.
Strauch, Barry
2017-03-01
I introduce the automation-by-expertise-by-training interaction in automated systems and discuss its influence on operator performance. Transportation accidents that, across a 30-year interval demonstrated identical automation-related operator errors, suggest a need to reexamine traditional views of automation. I review accident investigation reports, regulator studies, and literature on human computer interaction, expertise, and training and discuss how failing to attend to the interaction of automation, expertise level, and training has enabled operators to commit identical automation-related errors. Automated systems continue to provide capabilities exceeding operators' need for effective system operation and provide interfaces that can hinder, rather than enhance, operator automation-related situation awareness. Because of limitations in time and resources, training programs do not provide operators the expertise needed to effectively operate these automated systems, requiring them to obtain the expertise ad hoc during system operations. As a result, many do not acquire necessary automation-related system expertise. Integrating automation with expected operator expertise levels, and within training programs that provide operators the necessary automation expertise, can reduce opportunities for automation-related operator errors. Research to address the automation-by-expertise-by-training interaction is needed. However, such research must meet challenges inherent to examining realistic sociotechnical system automation features with representative samples of operators, perhaps by using observational and ethnographic research. Research in this domain should improve the integration of design and training and, it is hoped, enhance operator performance.
Psychological Empowerment Among Urban Youth: Measurement Model and Associations with Youth Outcomes.
Eisman, Andria B; Zimmerman, Marc A; Kruger, Daniel; Reischl, Thomas M; Miller, Alison L; Franzen, Susan P; Morrel-Samuels, Susan
2016-12-01
Empowerment-based strategies have become widely used method to address health inequities and promote social change. Few researchers, however, have tested theoretical models of empowerment, including multidimensional, higher-order models. We test empirically a multidimensional, higher-order model of psychological empowerment (PE), guided by Zimmerman's conceptual framework including three components of PE: intrapersonal, interactional, and behavioral. We also investigate if PE is associated with positive and negative outcomes among youth. The sample included 367 middle school youth aged 11-16 (M = 12.71; SD = 0.91); 60% female, 32% (n = 117) white youth, 46% (n = 170) African-American youth, and 22% (n = 80) identifying as mixed race, Asian-American, Latino, Native American, or other ethnic/racial group; schools reported 61-75% free/reduced lunch students. Our results indicated that each of the latent factors for the three PE components demonstrate a good fit with the data. Our results also indicated that these components loaded on to a higher-order PE factor (X 2 = 32.68; df: 22; p = .07; RMSEA: 0.04; 95% CI: .00, .06; CFI: 0.99). We found that the second-order PE factor was negatively associated with aggressive behavior and positively associated with prosocial engagement. Our results suggest that empowerment-focused programs would benefit from incorporating components addressing how youth think about themselves in relation to their social contexts (intrapersonal), understanding social and material resources needed to achieve specific goals (interactional), and actions taken to influence outcomes (behavioral). Our results also suggest that integrating the three components and promoting PE may help increase likelihood of positive behaviors (e.g., prosocial involvement); we did not find an association between PE and aggressive behavior. Implications and future directions for empowerment research are discussed. © Society for Community Research and
Psychological Empowerment Among Urban Youth: Measurement Model and Associations with Youth Outcomes
Eisman, Andria B.; Zimmerman, Marc A.; Kruger, Daniel; Reischl, Thomas M.; Miller, Alison L.; Franzen, Susan P.; Morrel-Samuels, Susan
2016-01-01
Empowerment-based strategies have become widely used method to address health inequities and promote social change. Few researchers, however, have tested theoretical models of empowerment, including multidimensional, higher-order models. We test empirically a multidimensional, higher-order model of psychological empowerment (PE), guided by Zimmerman’s (1995) conceptual framework including three components of PE: intrapersonal, interactional and behavioral. We also investigate if PE is associated with positive and negative outcomes among youth. The sample included 367 middle school youth aged 11–16 (M = 12.71; SD = 0.91); 60% female, 32% (n =117) white youth, 46% (n = 170) African-American youth, and 22% (n = 80) identifying as mixed race, Asian-American, Latino, Native American or other ethnic/racial group; schools reported 61–75% free/reduced lunch students. Our results indicated that each of the latent factors for the three PE components demonstrate a good fit with the data. Our results also indicated that these components loaded on to a higher-order PE factor (X2=32.68, df: 22, p=0.07; RMSEA: 0.04, 95% CI: 0.00, 0.06; CFI: 0.99). We found that the second order PE factor was negatively associated with aggressive behavior and positively associated with prosocial engagement. Our results suggest that empowerment-focused programs would benefit from incorporating components addressing how youth think about themselves in relation to their social contexts (intrapersonal), understanding social and material resources needed to achieve specific goals (interactional) and actions taken to influence outcomes (behavioral). Our results also suggest that integrating the three components and promoting PE may help increase likelihood of positive behaviors (e.g., prosocial involvement); we did not find an association between PE and aggressive behavior. Implications and future directions for empowerment research are discussed. PMID:27709632
ERIC Educational Resources Information Center
Somers, Adele, Ed.; And Others
The conference proceedings of the First National Symposium on Youth Violence are presented in terms of the program objectives, i.e., to identify successful youth involvement programs and to develop positive strategies for decreasing violence. This monograph provides the program schedule and texts and summaries of various speeches on the topics of…
Automated Microwave Dielectric Constant Measurement
1987-03-01
IJSWC TR 86-46 AD.-A 184 182 AUTOMATED MICROWAVE DIELECTRIC CONSTANT MEASUREMENT SYTIEM BY B. C. GLANCY A. KRALL PESEARCH AND TECHNOLOGY DEPARTMENT...NO0. NO. ACCESSION NO. Silver Spring, Maryland 20903-500061152N ZROO1 ZRO131 R1AA29 11. TITLE (Include Security Classification) AUTOMATED MICROWAVE ...constants as a funct on of microwave frequency has been simplified using an automated testing apparatus. This automated procedure is based on the use of a
Harvey, Aminifu R; Hill, Robert B
2004-01-01
This article examines the effects of an Africentric youth and family rites of passage program on at-risk African American youths and their parents. Data were obtained from a three-year evaluation of a youth rites of passage demonstration project using therapeutic interventions based on Africentric principles. At-risk African American boys between ages 11.5 and 14.5 years with no history of substance abuse were referred from the criminal justice system, diversion programs, and local schools. The evaluation revealed that participating youths exhibited gains in self-esteem and accurate knowledge of the dangers of drug abuse. Although the differences were not statistically significant, parents demonstrated improvements in parenting skills, racial identity, cultural awareness, and community involvement. Evidence from interviews and focus groups suggests that the program's holistic, family-oriented, Africentric, strengths-based approach and indigenous staff contributed to its success.
Understanding human management of automation errors
McBride, Sara E.; Rogers, Wendy A.; Fisk, Arthur D.
2013-01-01
Automation has the potential to aid humans with a diverse set of tasks and support overall system performance. Automated systems are not always reliable, and when automation errs, humans must engage in error management, which is the process of detecting, understanding, and correcting errors. However, this process of error management in the context of human-automation interaction is not well understood. Therefore, we conducted a systematic review of the variables that contribute to error management. We examined relevant research in human-automation interaction and human error to identify critical automation, person, task, and emergent variables. We propose a framework for management of automation errors to incorporate and build upon previous models. Further, our analysis highlights variables that may be addressed through design and training to positively influence error management. Additional efforts to understand the error management process will contribute to automation designed and implemented to support safe and effective system performance. PMID:25383042
Youth Employability Training: Two Experiments
ERIC Educational Resources Information Center
Brown, Travor; Hillier, Tara-Lynn; Warren, Amy M.
2010-01-01
Purpose: This paper aims to assess the effectiveness of verbal self-guidance (VSG) and self-management on youth employability. It seeks to access the joint effectiveness of these interventions, grounded in social cognitive and goal setting theories, for youth job seekers. Design/methodology/approach: The studies used experimental designs involving…
Cockpit Adaptive Automation and Pilot Performance
NASA Technical Reports Server (NTRS)
Parasuraman, Raja
2001-01-01
The introduction of high-level automated systems in the aircraft cockpit has provided several benefits, e.g., new capabilities, enhanced operational efficiency, and reduced crew workload. At the same time, conventional 'static' automation has sometimes degraded human operator monitoring performance, increased workload, and reduced situation awareness. Adaptive automation represents an alternative to static automation. In this approach, task allocation between human operators and computer systems is flexible and context-dependent rather than static. Adaptive automation, or adaptive task allocation, is thought to provide for regulation of operator workload and performance, while preserving the benefits of static automation. In previous research we have reported beneficial effects of adaptive automation on the performance of both pilots and non-pilots of flight-related tasks. For adaptive systems to be viable, however, such benefits need to be examined jointly in the context of a single set of tasks. The studies carried out under this project evaluated a systematic method for combining different forms of adaptive automation. A model for effective combination of different forms of adaptive automation, based on matching adaptation to operator workload was proposed and tested. The model was evaluated in studies using IFR-rated pilots flying a general-aviation simulator. Performance, subjective, and physiological (heart rate variability, eye scan-paths) measures of workload were recorded. The studies compared workload-based adaptation to to non-adaptive control conditions and found evidence for systematic benefits of adaptive automation. The research provides an empirical basis for evaluating the effectiveness of adaptive automation in the cockpit. The results contribute to the development of design principles and guidelines for the implementation of adaptive automation in the cockpit, particularly in general aviation, and in other human-machine systems. Project goals
Mentoring Relationships and the Mental Health of Aboriginal Youth in Canada.
DeWit, David J; Wells, Samantha; Elton-Marshall, Tara; George, Julie
2017-04-01
We compared the mentoring experiences and mental health and behavioral outcomes associated with program-supported mentoring for 125 Aboriginal (AB) and 734 non-Aboriginal (non-AB) youth ages 6-17 participating in a national survey of Big Brothers Big Sisters community mentoring relationships. Parents or guardians reported on youth mental health and other outcomes at baseline (before youth were paired to a mentor) and at 18 months follow-up. We found that AB youth were significantly less likely than non-AB youth to be in a long-term continuous mentoring relationship. However, AB youth were more likely than non-AB youth to be in a long-term relationship ending in dissolution. AB youth were also more likely than non-AB youth to have been mentored by a female adult. AB youth were significantly more likely than non-AB youth to report a high quality mentoring relationship, regular weekly contact with their mentor, and monthly mentoring activities. Structural equation model results revealed that, relative to non-mentored AB youth, AB youth with mentors experienced significantly fewer emotional problems and symptoms of social anxiety. These relationships were not found for non-AB youth. Our findings suggest that mentoring programs may be an effective intervention for improving the health and well-being of AB youth.
Benn, Neil; Turlais, Fabrice; Clark, Victoria; Jones, Mike; Clulow, Stephen
2007-03-01
The authors describe a system for collecting usage metrics from widely distributed automation systems. An application that records and stores usage data centrally, calculates run times, and charts the data was developed. Data were collected over 20 months from at least 28 workstations. The application was used to plot bar charts of date versus run time for individual workstations, the automation in a specific laboratory, or automation of a specified type. The authors show that revised user training, redeployment of equipment, and running complimentary processes on one workstation can increase the average number of runs by up to 20-fold and run times by up to 450%. Active monitoring of usage leads to more effective use of automation. Usage data could be used to determine whether purchasing particular automation was a good investment.
Youth With Autism Spectrum Disorder in the Emergency Department.
Lytle, Sarah; Hunt, Andrew; Moratschek, Sonal; Hall-Mennes, Marcie; Sajatovic, Martha
2018-05-08
This comprehensive literature review summarizes reports on emergency department (ED) use by youth with autism spectrum disorder (ASD). We conducted a systematic search of the PubMed, PsycINFO, CINAHL, and EMBASE databases (1985-2016), limited to studies published in English. The following search terms were used: autism, autistic, Asperger, emergency department/room/physician/doctor/treatment/medicine, childhood developmental disorders (pervasive), and emergencies. Our search found 332 articles, of which 12 specifically addressed ED services in ASD youth. Abstracts or full text articles were reviewed for relevance. Case reports, review articles, and studies that reported on adults only or that included youth and adults but did not stratify results by age were excluded. Youth (aged 0-17 years) with ASD were up to 30 times more likely to present to the ED than youth without ASD. Individuals with ASD who visited the ED were older, more likely to have public insurance, and more likely to have nonurgent ED visits. For youth with ASD, up to 13% of visits were for behavioral or psychiatric problems, whereas for youth without ASD less than 2% were for psychiatric problems. ASD youth were more likely to present for externalizing problems or psychotic symptoms. Youth with ASD were also likely to have repeat visits to the ED and more likely to be admitted to a psychiatric unit or medical floor than youth without ASD. This review found significant gaps in the literature related to ED service use by youth with ASD. More research is needed to avoid unnecessary ED utilization and hospitalization, reduce medical costs, and improve outcome for youth with ASD. © Copyright 2018 Physicians Postgraduate Press, Inc.
ERIC Educational Resources Information Center
Lewis, Kendra M.; Vuchinich, Samuel; Ji, Peter; DuBois, David L.; Acock, Alan; Bavarian, Niloofar; Day, Joseph; Silverthorn, Naida; Flay, Brian R.
2016-01-01
This study evaluated effects of "Positive Action," a school-based social-emotional and character development intervention, on indicators of positive youth development (PYD) among a sample of low-income, ethnic minority youth attending 14 urban schools. The study used a matched-pair, cluster-randomized controlled design at the school…
Heard, Jack; Morris, Amanda; Kirouac, Nicole; Ducharme, Jennifer; Trepel, Simon; Wicklow, Brandy
2018-05-01
To describe the paediatric transgender population accessing health care through the Manitoba Gender Dysphoria Assessment and Action for Youth (GDAAY) program, and report youth's experiences accessing health care in Manitoba. Demographic, medical, surgical and mental health information was extracted from the medical records of youth referred to the GDAAY program (n=174). A 77-item online survey was conducted with a subset of those youth (n=25) to identify common health care experiences and perceptions of trans youth in Manitoba. Chart review of 122 natal females and 52 natal males, ranging in age from 4.7 to 17.8 years (mean 13.9 years), found 66 patients (46.8%) with a pre-existing or current mental health diagnosis, of which anxiety and depression were the most common (n=43, 30.5%). Qualitative self-reports revealed all patients had negative interactions with health care providers at some point, many having experienced lack of engagement with the medical system due to reported lack of knowledge by the provider on trans-related health services. Transgender youth in Manitoba seeking GDAAY services have high rates of anxiety and depression. These youth face adversity in health care settings and are distressed over long wait times for mental health services. Recommendations to improve care include increasing general health care providers' education on gender affirmative care, providing gender sensitivity training for health care providers, gathering preferred names and pronouns during triage, increasing visibility of support for LGBT+ persons in clinics, increasing resource allocation to this field and creating policies so all health care settings are safe places for trans youth.
Team-Centered Perspective for Adaptive Automation Design
NASA Technical Reports Server (NTRS)
Prinzel, Lawrence J., III
2003-01-01
Automation represents a very active area of human factors research. The journal, Human Factors, published a special issue on automation in 1985. Since then, hundreds of scientific studies have been published examining the nature of automation and its interaction with human performance. However, despite a dramatic increase in research investigating human factors issues in aviation automation, there remain areas that need further exploration. This NASA Technical Memorandum describes a new area of automation design and research, called adaptive automation. It discusses the concepts and outlines the human factors issues associated with the new method of adaptive function allocation. The primary focus is on human-centered design, and specifically on ensuring that adaptive automation is from a team-centered perspective. The document shows that adaptive automation has many human factors issues common to traditional automation design. Much like the introduction of other new technologies and paradigm shifts, adaptive automation presents an opportunity to remediate current problems but poses new ones for human-automation interaction in aerospace operations. The review here is intended to communicate the philosophical perspective and direction of adaptive automation research conducted under the Aerospace Operations Systems (AOS), Physiological and Psychological Stressors and Factors (PPSF) project.
Toward designing for trust in database automation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duez, P. P.; Jamieson, G. A.
Appropriate reliance on system automation is imperative for safe and productive work, especially in safety-critical systems. It is unsafe to rely on automation beyond its designed use; conversely, it can be both unproductive and unsafe to manually perform tasks that are better relegated to automated tools. Operator trust in automated tools mediates reliance, and trust appears to affect how operators use technology. As automated agents become more complex, the question of trust in automation is increasingly important. In order to achieve proper use of automation, we must engender an appropriate degree of trust that is sensitive to changes in operatingmore » functions and context. In this paper, we present research concerning trust in automation in the domain of automated tools for relational databases. Lee and See have provided models of trust in automation. One model developed by Lee and See identifies three key categories of information about the automation that lie along a continuum of attributional abstraction. Purpose-, process-and performance-related information serve, both individually and through inferences between them, to describe automation in such a way as to engender r properly-calibrated trust. Thus, one can look at information from different levels of attributional abstraction as a general requirements analysis for information key to appropriate trust in automation. The model of information necessary to engender appropriate trust in automation [1] is a general one. Although it describes categories of information, it does not provide insight on how to determine the specific information elements required for a given automated tool. We have applied the Abstraction Hierarchy (AH) to this problem in the domain of relational databases. The AH serves as a formal description of the automation at several levels of abstraction, ranging from a very abstract purpose-oriented description to a more concrete description of the resources involved in the automated
The Postsecondary Educational Progress of Youth from Immigrant Families
ERIC Educational Resources Information Center
Fuligni, Andrew J.; Witkow, Melissa
2004-01-01
Approximately 650 youth from a variety of ethnic and generational backgrounds participated in a longitudinal study of the postsecondary educational experiences of youth from immigrant families. Youth completed questionnaires and provided official school records in the 12th grade and participated in a phone interview 3 years later. Youth from…
Validity and Reliability of the Teamwork Scale for Youth
ERIC Educational Resources Information Center
Lower, Leeann M.; Newman, Tarkington J.; Anderson-Butcher, Dawn
2017-01-01
Purpose: This study examines the psychometric properties of the Teamwork Scale for Youth, an assessment designed to measure youths' perceptions of their teamwork competency. Methods: The Teamwork Scale for Youth was administered to a sample of 460 youths. Confirmatory factor analyses examined the factor structure and measurement invariance of the…
The 'problem' with automation - Inappropriate feedback and interaction, not 'over-automation'
NASA Technical Reports Server (NTRS)
Norman, D. A.
1990-01-01
Automation in high-risk industry is often blamed for causing harm and increasing the chance of human error when failures occur. It is proposed that the problem is not the presence of automation, but rather its inappropriate design. The problem is that the operations are performed appropriately under normal conditions, but there is inadequate feedback and interaction with the humans who must control the overall conduct of the task. The problem is that the automation is at an intermediate level of intelligence, powerful enough to take over control which used to be done by people, but not powerful enough to handle all abnormalities. Moreover, its level of intelligence is insufficient to provide the continual, appropriate feedback that occurs naturally among human operators. To solve this problem, the automation should either be made less intelligent or more so, but the current level is quite inappropriate. The overall message is that it is possible to reduce error through appropriate design considerations.
Perron, Tracy; Kartoz, Connie; Himelfarb, Chaya
2017-03-01
In order to provide holistic care, school nurses must be culturally competent by being sensitive to health disparities experienced by students in at-risk populations. Despite the growing acceptance toward gender and sexual minorities, LGBTQ youth remain an at-risk population in our communities and our schools. School nurses as well as school counselors, social workers, and psychologists can increase their cultural competence in caring for this group of students by increasing their understanding of appropriate terminology and risks associated with this vulnerable group. This article is Part 1 of a two-article series designed to increase school nurses' abilities to advocate and care for LGBTQ youth in school settings. This first article provides information regarding proper terminology and current percentages of youth who identify as LGBTQ and concludes with implications for school nurses, including resources for nurses, school staff, and families.
Discussions on Petty Bourgeois and Angry Youth
ERIC Educational Resources Information Center
Yuanshan, Zhang; Lei, Rao; Liangyu, Feng; Gui, Peng
2011-01-01
Petty bourgeois and angry youth are two large sets of contemporary Chinese youth. There is no doubt that most contemporary youth do not belong to either of these two sets. However, these two large sets are indeed very fashionable at this time, and it is easy to simply distinguish between them by means of two terms: the label "shuai dai"…
The Automation of Reserve Processing.
ERIC Educational Resources Information Center
Self, James
1985-01-01
Describes an automated reserve processing system developed locally at Clemons Library, University of Virginia. Discussion covers developments in the reserve operation at Clemons Library, automation of the processing and circulation functions of reserve collections, and changes in reserve operation performance and staffing needs due to automation.…
Artificial Intelligence-Assisted Online Social Therapy for Youth Mental Health
D'Alfonso, Simon; Santesteban-Echarri, Olga; Rice, Simon; Wadley, Greg; Lederman, Reeva; Miles, Christopher; Gleeson, John; Alvarez-Jimenez, Mario
2017-01-01
Introduction: Benefits from mental health early interventions may not be sustained over time, and longer-term intervention programs may be required to maintain early clinical gains. However, due to the high intensity of face-to-face early intervention treatments, this may not be feasible. Adjunctive internet-based interventions specifically designed for youth may provide a cost-effective and engaging alternative to prevent loss of intervention benefits. However, until now online interventions have relied on human moderators to deliver therapeutic content. More sophisticated models responsive to user data are critical to inform tailored online therapy. Thus, integration of user experience with a sophisticated and cutting-edge technology to deliver content is necessary to redefine online interventions in youth mental health. This paper discusses the development of the moderated online social therapy (MOST) web application, which provides an interactive social media-based platform for recovery in mental health. We provide an overview of the system's main features and discus our current work regarding the incorporation of advanced computational and artificial intelligence methods to enhance user engagement and improve the discovery and delivery of therapy content. Methods: Our case study is the ongoing Horyzons site (5-year randomized controlled trial for youth recovering from early psychosis), which is powered by MOST. We outline the motivation underlying the project and the web application's foundational features and interface. We discuss system innovations, including the incorporation of pertinent usage patterns as well as identifying certain limitations of the system. This leads to our current motivations and focus on using computational and artificial intelligence methods to enhance user engagement, and to further improve the system with novel mechanisms for the delivery of therapy content to users. In particular, we cover our usage of natural language analysis
Artificial Intelligence-Assisted Online Social Therapy for Youth Mental Health.
D'Alfonso, Simon; Santesteban-Echarri, Olga; Rice, Simon; Wadley, Greg; Lederman, Reeva; Miles, Christopher; Gleeson, John; Alvarez-Jimenez, Mario
2017-01-01
Introduction: Benefits from mental health early interventions may not be sustained over time, and longer-term intervention programs may be required to maintain early clinical gains. However, due to the high intensity of face-to-face early intervention treatments, this may not be feasible. Adjunctive internet-based interventions specifically designed for youth may provide a cost-effective and engaging alternative to prevent loss of intervention benefits. However, until now online interventions have relied on human moderators to deliver therapeutic content. More sophisticated models responsive to user data are critical to inform tailored online therapy. Thus, integration of user experience with a sophisticated and cutting-edge technology to deliver content is necessary to redefine online interventions in youth mental health. This paper discusses the development of the moderated online social therapy (MOST) web application, which provides an interactive social media-based platform for recovery in mental health. We provide an overview of the system's main features and discus our current work regarding the incorporation of advanced computational and artificial intelligence methods to enhance user engagement and improve the discovery and delivery of therapy content. Methods: Our case study is the ongoing Horyzons site (5-year randomized controlled trial for youth recovering from early psychosis), which is powered by MOST. We outline the motivation underlying the project and the web application's foundational features and interface. We discuss system innovations, including the incorporation of pertinent usage patterns as well as identifying certain limitations of the system. This leads to our current motivations and focus on using computational and artificial intelligence methods to enhance user engagement, and to further improve the system with novel mechanisms for the delivery of therapy content to users. In particular, we cover our usage of natural language analysis
Queer Research and Queer Youth
ERIC Educational Resources Information Center
Talburt, Susan
2006-01-01
D'Augelli and Grossman's article offers an eloquent account of a complex longitudinal, interview-based study that surely has the potential to offer nuanced insights into the lives of lesbian, gay, and bisexual (LGB) youth. The authors' copious efforts to recruit, retain, and involve youth while avoiding potential dangers to them offer future…
The Undereducation of American Youth.
ERIC Educational Resources Information Center
Cardenas, Jose A.; And Others
Trend data show that while the numbers and proportions of undereducated youth are falling, undereducation in the eighties, especially among minority youth, is considerable and persistent. This study uses a population-based definition of undereducation for which trend data are available for Whites and Blacks, beginning in 1967, and for Hispanics in…
Latino Youths at a Crossroads.
ERIC Educational Resources Information Center
Children's Defense Fund, Washington, DC.
This document provides an overview of the status of Latino youth and their families and makes recommendations for improving their educational achievement. The following key facts are reported: (1) Latino youth comprise the fastest growing group of young people in the United States; (2) young Latinos are at economic and educational risk because…
Youth Assets and Sexual Activity: Differences Based on Race/Ethnicity
ERIC Educational Resources Information Center
Tolma, Eleni L.; Vesely, Sara K.; Oman, Roy F.; Aspy, Cheryl B.; Beebe, Laura; Rodine, Sharon; Marshall, LaDonna; Fluhr, Janene
2008-01-01
Race/ethnicity has been associated with the prevalence of sexual activity among youth as well as with youth assets. Research has also shown that youth assets are associated with youth abstinence. However, very few studies have examined whether the relationship between youth assets and sexual activity might differ based on race/ethnicity. The study…
ERIC Educational Resources Information Center
Education Development Center, Inc, 2004
2004-01-01
The focus of this project was to address global climate change and, in the same context, analyze how proposed solutions could simultaneously enhance employment opportunities for youth. The outcomes of the project include: (1) greater awareness and engagement of youth in climate change issues, including the need to promote renewable energy…
Absent Audiences: Youth Identity Formation in Preparations for Performance
ERIC Educational Resources Information Center
Thompson, Carol C.
2011-01-01
This article explores the use of audiences in preparation for public presentation by an urban youth organization in Camden, New Jersey (U.S.). Camden is an impoverished city with few opportunities for youth. The organization, a hybrid of youth development, technology, business, and college preparation, prepared youth for good jobs or college.…
Conference Report on Youth Unemployment: Its Measurements and Meaning.
ERIC Educational Resources Information Center
Employment and Training Administration (DOL), Washington, DC.
Thirteen papers presented at a conference on employment statistics and youth are contained in this report. Reviewed are the problems of gathering, interpreting, and applying employment and unemployment data relating to youth. The titles of the papers are as follow: "Counting Youth: A Comparison of Youth Labor Force Statistics in the Current…
NASA Technical Reports Server (NTRS)
Ancel, Ersin; Shih, Ann T.
2014-01-01
This paper highlights the development of a model that is focused on the safety issue of increasing complexity and reliance on automation systems in transport category aircraft. Recent statistics show an increase in mishaps related to manual handling and automation errors due to pilot complacency and over-reliance on automation, loss of situational awareness, automation system failures and/or pilot deficiencies. Consequently, the aircraft can enter a state outside the flight envelope and/or air traffic safety margins which potentially can lead to loss-of-control (LOC), controlled-flight-into-terrain (CFIT), or runway excursion/confusion accidents, etc. The goal of this modeling effort is to provide NASA's Aviation Safety Program (AvSP) with a platform capable of assessing the impacts of AvSP technologies and products towards reducing the relative risk of automation related accidents and incidents. In order to do so, a generic framework, capable of mapping both latent and active causal factors leading to automation errors, is developed. Next, the framework is converted into a Bayesian Belief Network model and populated with data gathered from Subject Matter Experts (SMEs). With the insertion of technologies and products, the model provides individual and collective risk reduction acquired by technologies and methodologies developed within AvSP.
Prevalence and characteristics of youth sexting: a national study.
Mitchell, Kimberly J; Finkelhor, David; Jones, Lisa M; Wolak, Janis
2012-01-01
To obtain national estimates of youth involved in sexting in the past year (the transmission via cell phone, the Internet, and other electronic media of sexual images), as well as provide details of the youth involved and the nature of the sexual images. The study was based on a cross-sectional national telephone survey of 1560 youth Internet users, ages 10 through 17. Estimates varied considerably depending on the nature of the images or videos and the role of the youth involved. Two and one-half percent of youth had appeared in or created nude or nearly nude pictures or videos. However, this percentage is reduced to 1.0% when the definition is restricted to only include images that were sexually explicit (ie, showed naked breasts, genitals, or bottoms). Of the youth who participated in the survey, 7.1% said they had received nude or nearly nude images of others; 5.9% of youth reported receiving sexually explicit images. Few youth distributed these images. Because policy debates on youth sexting behavior focus on concerns about the production and possession of illegal child pornography, it is important to have research that collects details about the nature of the sexual images rather than using ambiguous screening questions without follow-ups. The rate of youth exposure to sexting highlights a need to provide them with information about legal consequences of sexting and advice about what to do if they receive a sexting image. However, the data suggest that appearing in, creating, or receiving sexual images is far from being a normative behavior for youth.
32 CFR 643.129 - Youth groups.
Code of Federal Regulations, 2010 CFR
2010-07-01
... facilities, without monetary consideration, to on-post youth groups such as the Boy Scouts, Girl Scouts, and... intermittent or continuing use, to off-post youth groups such as the Boy Scouts, Girl Scouts, and the Little...
76 FR 68243 - Youth Leadership Program: TechGirls
Federal Register 2010, 2011, 2012, 2013, 2014
2011-11-03
... DEPARTMENT OF STATE [Public Notice: 7671] Youth Leadership Program: TechGirls Overview Information Bureau of Educational and Cultural Affairs (ECA) Request for Grant Proposals: Youth Leadership Program... Cultural Affairs (ECA) announces an open competition for the new Youth Leadership Program ``TechGirls...
Youth Opportunity: A Private Sector Investment in Prevention.
ERIC Educational Resources Information Center
Tice, Carol H.
1989-01-01
Describes the Youth Opportunity Project, which was designed to allow youth to experience the world of work and hands-on learning in the framework of preventing substance abuse and school dropout. Six youths aged 12-14 worked on a small diversified farm. (RJC)
Violent and Nonviolent Youth Offenders: Preliminary Evidence on Group Subtypes.
Lai, Violet; Zeng, Gerald; Chu, Chi Meng
2016-07-01
Youth violence is a costly social problem. This study compared the risk and needs of nonviolent youth offenders, with those who had committed violent offenses only (violent only) and those who had committed violent and nonviolent offenses (violent plus) to determine whether violent youth were a different "type" from nonviolent youth. The case files of 3,744 youth offenders (3,327 males and 417 females, between 12 and 18 years old) were retrospectively coded, before official recidivism records were obtained. Multivariate analysis of variance (MANOVA), χ 2 , and Cox regressions were conducted. Violent-plus youth were younger; higher in their total risk and all criminogenic needs; more likely to have several noncriminogenic needs; and at higher risk of any reoffending, violent reoffending, and nonviolent reoffending than nonviolent youth. Violent-only youth had the same total risk and risk of general and violent recidivism as nonviolent offenders but presented different criminogenic and noncriminogenic needs and risk of nonviolent recidivism. Compared to violent-only youth, violent-plus youth were younger, had higher total risk and criminogenic needs on five domains, were more likely to have several noncriminogenic needs, and were at higher risk of all types of reoffending (except sexual reoffending), suggesting subtypes of violent youth offenders. The implication is that nonviolent and violent youth offenders require different dosage and types of intervention.
Trust in automation: designing for appropriate reliance.
Lee, John D; See, Katrina A
2004-01-01
Automation is often problematic because people fail to rely upon it appropriately. Because people respond to technology socially, trust influences reliance on automation. In particular, trust guides reliance when complexity and unanticipated situations make a complete understanding of the automation impractical. This review considers trust from the organizational, sociological, interpersonal, psychological, and neurological perspectives. It considers how the context, automation characteristics, and cognitive processes affect the appropriateness of trust. The context in which the automation is used influences automation performance and provides a goal-oriented perspective to assess automation characteristics along a dimension of attributional abstraction. These characteristics can influence trust through analytic, analogical, and affective processes. The challenges of extrapolating the concept of trust in people to trust in automation are discussed. A conceptual model integrates research regarding trust in automation and describes the dynamics of trust, the role of context, and the influence of display characteristics. Actual or potential applications of this research include improved designs of systems that require people to manage imperfect automation.
DISASTER AND YOUTH VIOLENCE: THE EXPERIENCE OF SCHOOL ATTENDING YOUTH IN NEW ORLEANS
Madkour, Aubrey S.; Johnson, Carolyn C.; Clum, Gretchen A.; Brown, Lisanne
2013-01-01
Purpose Although disaster exposure is linked with increased child aggression, population-level trends are unknown. Pre- to post-Katrina changes in violence-related behaviors among New Orleans high school youth (ages 12-18) were assessed. Methods Data from the 2003 (pre-Katrina), 2005 (pre-Katrina) and 2007 (post-Katrina) New Orleans Youth Risk Behavior Survey (n=5,267) were utilized. Crude comparisons across years of population characteristics and violence behavior prevalence were made with chi-square analyses. Changes in violence-related behaviors over time were assessed with logistic regression models including indicators for survey years and controls for compositional changes. Results Age, gender and race/ethnicity of school-attending youth were stable across years. In models controlling for demographics, most behaviors were stable over time. Some changes were observed for all groups: dating violence and forced sex increased prior to the storm; weapon carrying and missing school due to feeling unsafe decreased after the storm. Among African American adolescents only, being threatened at school increased before Katrina. Conclusions Results do not support significant population-level increases in violent behavior among New Orleans school-attending youths post-Katrina. Factors that buffered New Orleans students from post-Katrina violence increases, such as population composition changes or increased supportive services, may explain these findings. PMID:21783056
Organic Activists: Undocumented Youth Creating Spaces of Acompañamiento
ERIC Educational Resources Information Center
Nuñez-Janes, Mariela; Ovalle, Mario
2016-01-01
Our research brings attention to undocumented youth activism as a space controlled by marginalized youth. We discuss the case study of a youth-led grassroots group in Texas to explore how undocumented youth engage a pedagogy of acompañamiento through activism. We worked with undocumented youth activists as allies over the past seven years and…
Is Heading in Youth Soccer Dangerous Play?
O'Kane, John W
2016-01-01
Soccer is among the most popular youth sports with over 3 million youth players registered in the U.S. Soccer is unique in that players intentionally use their head to strike the ball, leading to concerns that heading could cause acute or chronic brain injury, especially in the immature brains of children. Pub Med search without date restriction was conducted in November 2014 and August 2015 using the terms soccer and concussion, heading and concussion, and youth soccer and concussion. 310 articles were identified and reviewed for applicable content specifically relating to youth athletes, heading, and/or acute or chronic brain injury from soccer. Soccer is a low-risk sport for catastrophic head injury, but concussions are relatively common and heading often plays a role. At all levels of play, concussions are more likely to occur in the act of heading than with other facets of the game. While concussion from heading the ball without other contact to the head appears rare in adult players, some data suggests children are more susceptible to concussion from heading primarily in game situations. Contributing factors include biomechanical forces, less developed technique, and the immature brain's susceptibility to injury. There is no evidence that heading in youth soccer causes any permanent brain injury and there is limited evidence that heading in youth soccer can cause concussion. A reasonable approach based on U.S. Youth Soccer recommendations is to teach heading after age 10 in controlled settings, and heading in games should be delayed until skill acquisition and physical maturity allow the youth player to head correctly with confidence.
ERIC Educational Resources Information Center
Furuta, Kenneth; And Others
1990-01-01
These three articles address issues in library cataloging that are affected by automation: (1) the impact of automation and bibliographic utilities on professional catalogers; (2) the effect of the LASS microcomputer software on the cost of authority work in cataloging at the University of Arizona; and (3) online subject heading and classification…
ERIC Educational Resources Information Center
Arshad-Ayaz, Adeela; Andreotti, Vanessa; Sutherland, Ali
2017-01-01
In the recent "National Youth White Paper on Global Citizenship" (2015), a selection of Canadian youth identified their vision for global citizenship education (GCE). The document articulates the Canadian youths' vision for global citizenship and outlines changes that need to be implemented in order for that vision to be achieved.…
Therapy for Specific Problems: Youth Tobacco Cessation
Curry, Susan J.; Mermelstein, Robin J.; Sporer, Amy K.
2010-01-01
Cigarette smoking is the leading cause of premature morbidity and mortality in the United States. The majority of children smoke their first cigarette in early adolescence, and many older teens have well-established dependence on nicotine. Efforts to promote and support smoking cessation among these youth smokers are critical. The available experimental studies of youth cessation interventions find that behavioral interventions increase the chances of youth smokers achieving successful cessation. Currently there is insufficient evidence for the effectiveness of pharmacological treatments with youth smokers. Many innovative studies have been compromised by challenges in recruiting sufficient numbers of youth, obtaining approval for waivers of parental consent, and high attrition in longitudinal studies. Key areas for future work include bridging the fields of adolescent development and treatment design, matching treatments to developmental trajectories of smoking behavior, better understanding treatment processes and treatment moderators, and building demand for evidence-based cessation treatments. PMID:19035825
Crime Prevention Services for Youth.
ERIC Educational Resources Information Center
Wright, Harold A.
The purpose of this guide is to identify the various opportunities available in most communities for delivering crime prevention services to youth so that they will be better prepared to reduce their vulnerability to crime, while enhancing their involvement in prevention efforts. It also serves to outline the benefits of programming with youth;…
Attitude Consistency Among American Youth.
ERIC Educational Resources Information Center
Mott, Frank L.; Mott, Susan H.
Attitudes of youth (ages 14-21) toward fertility expectations and women's roles are examined for consistency (e.g., whether high career expectations are correlated with a desire for fewer children). Approximately 12,000 White, Black, and Hispanic youth rated their attitudes toward statements that a woman's place is in the home, employment of wives…
Youth Homelessness and Social Stigma
ERIC Educational Resources Information Center
Kidd, Sean A.
2007-01-01
Building upon previous exploratory qualitative research (Kidd S.A. (2003) "Child Adol. Social Work J." 20(4):235-261), this paper examines the mental health implications of social stigma as it is experienced by homeless youth. Surveys conducted with 208 youths on the streets and in agencies in New York City and Toronto revealed…
Developing Culturally Responsive Youth Workers
ERIC Educational Resources Information Center
Walter, Ann; Grant, Samantha
2011-01-01
Culturally Responsive Youth Work: The Journey Matters is based on the theory that when knowledge and skills are found within the lived experiences and cultural contexts of youth, they are more meaningful and more engaging and are learned more easily (Gay, 2000). The program was evaluated using a retrospective pre-then-post test evaluation and…
Health Literacy among Youth in Guatemala City.
Hoffman, Steven; Marsiglia, Flavio F; Nevarez, Lucinda; Porta, Maria
2017-01-02
Health literacy (HL) is recognized as an important health construct that is correlated with various health-related outcomes, but outside of the United States there is limited HL research available, particularly among youth. This study looked at the HL and harmful health behavior (i.e., substance use) of 210 youth across 10 schools in Guatemala City. Based on results from the Newest Vital Sign (NVS) HL assessment, fewer than one third of youth sampled had adequate HL. Training/education to improve adolescent HL is needed in Guatemala City, and the unique skillset of social workers could be an idea method of reaching at-risk youth.
Human-centered aircraft automation: A concept and guidelines
NASA Technical Reports Server (NTRS)
Billings, Charles E.
1991-01-01
Aircraft automation is examined and its effects on flight crews. Generic guidelines are proposed for the design and use of automation in transport aircraft, in the hope of stimulating increased and more effective dialogue among designers of automated cockpits, purchasers of automated aircraft, and the pilots who must fly those aircraft in line operations. The goal is to explore the means whereby automation may be a maximally effective tool or resource for pilots without compromising human authority and with an increase in system safety. After definition of the domain of the aircraft pilot and brief discussion of the history of aircraft automation, a concept of human centered automation is presented and discussed. Automated devices are categorized as a control automation, information automation, and management automation. The environment and context of aircraft automation are then considered, followed by thoughts on the likely future of automation of that category.
ERIC Educational Resources Information Center
Dolan, Tom; Christens, Brian D.; Lin, Cynthia
2015-01-01
Community organizing efforts employ different types of research as they seek to address community issues. This chapter details the evolving use of research in a youth organizing effort in San Bernardino, CA that has addressed issues in schools, the educational system, and the broader community. We examine the youth organizers' use of organizing…
Ties That Bond: Youth Sport as a Vehicle for Social Identity and Positive Youth Development
ERIC Educational Resources Information Center
Bruner, Mark W.; Balish, Shea M.; Forrest, Christopher; Brown, Sarah; Webber, Kristine; Gray, Emily; McGuckin, Matthew; Keats, Melanie R.; Rehman, Laurene; Shields, Christopher A.
2017-01-01
An emerging area of research has focused on understanding how the group dynamics of a sport team influence positive youth development (PYD). The identities that youth form through their membership in sport teams (i.e., social identities) have been found to influence teammate behavior and team performance. Yet, minimal work exists on social…
Classification of Automated Search Traffic
NASA Astrophysics Data System (ADS)
Buehrer, Greg; Stokes, Jack W.; Chellapilla, Kumar; Platt, John C.
As web search providers seek to improve both relevance and response times, they are challenged by the ever-increasing tax of automated search query traffic. Third party systems interact with search engines for a variety of reasons, such as monitoring a web site’s rank, augmenting online games, or possibly to maliciously alter click-through rates. In this paper, we investigate automated traffic (sometimes referred to as bot traffic) in the query stream of a large search engine provider. We define automated traffic as any search query not generated by a human in real time. We first provide examples of different categories of query logs generated by automated means. We then develop many different features that distinguish between queries generated by people searching for information, and those generated by automated processes. We categorize these features into two classes, either an interpretation of the physical model of human interactions, or as behavioral patterns of automated interactions. Using the these detection features, we next classify the query stream using multiple binary classifiers. In addition, a multiclass classifier is then developed to identify subclasses of both normal and automated traffic. An active learning algorithm is used to suggest which user sessions to label to improve the accuracy of the multiclass classifier, while also seeking to discover new classes of automated traffic. Performance analysis are then provided. Finally, the multiclass classifier is used to predict the subclass distribution for the search query stream.
Youth Attitudes Toward the Military: Poll One
2002-04-01
recruiting advertising recognition, and media habits. The primary focus of YATS was to measure enlistment propensity—the percent of youth saying they...overall impression of the military, roughly half of all youth indicated that they had a positive impression of the military, with 18 percent...Books Youth Poll 1 13 teamwork statements tended to more often explicitly state benefits (i.e., Working in groups is helpful
Youth Internet use: risks and opportunities.
Guan, Shu-Sha Angie; Subrahmanyam, Kaveri
2009-07-01
The Internet has become all pervasive in the lives of young people and this paper will review studies that examine the risks and opportunities that it affords. We will examine research that investigates the more negative aspects of youth online behavior such as addiction as well as online risks such as harassment/cyber bullying and sexual solicitation. In addition, positive aspects of Internet use such as its potential for learning and enhancing social relations as well as delivering health interventions will be examined. The results show that online risks such as addiction, cyber bullying, and sexual solicitation are associated with negative consequences for youth. It is important to note that not all children are equally susceptible and more research is necessary to identify the youth most at risk as well as to develop effective interventions. The Internet can also provide benefits in the areas of cognitive, social, and physical development, and can also be used to deliver treatment interventions. The Internet represents both risks and opportunities for young people. To protect youth who are at risk for online addiction, bullying, and solicitation, we need more research to understand which youth may be most susceptible and to develop targeted interventions to protect them. The Internet also has many positive aspects and can be used to enhance youth learning and empowerment; although it is a tremendous health resource and can be used to cheaply deliver interventions, we need to understand how to better implement them to enhance their effectiveness.
Youth-Initiated HIV Risk and Substance Use Prevention Program.
ERIC Educational Resources Information Center
Goggin, K.; Metcalf, K.; Wise, D.; Kennedy, S.; Murray, T.; Burgess, D.; Reese-Smith, J.; Terhune, N.; Broadus, K.; Downes, A.; Buckendahl, H.
This study evaluates the first year of a novel HIV and substance use prevention program for inner city youth (Offering New Youth eXperiences--ONYX). Baseline and follow-up measures of knowledge, attitudes, and risk behaviors were administered seven months apart to 441 youth participating in the ONYX program. Youth (n=71) who provided data at both…
Income Tax and the FAFSA for Unaccompanied Homeless Youth
ERIC Educational Resources Information Center
National Association for the Education of Homeless Children and Youth, 2009
2009-01-01
This two-page brief answers various questions about the relationship between the filing of tax returns and a youth's completion of the FAFSA. Questions answered include: How does a youth's decision to file a tax return affect the FAFSA?; Are youth required to file tax returns?; and What should an unaccompanied youth do if his/her parents claim…
The Impact of World Youth Day on Religious Practice
ERIC Educational Resources Information Center
Singleton, Andrew
2011-01-01
World Youth Day, a youth-focused Catholic celebration, is the largest recurring youth event in the world. The 10th International World Youth Day (WYD) was held from 15-20 July 2008, in Sydney, Australia and attenders participated in a week-long series of religious events and activities. Little research in English has been conducted on WYD…
ERIC Educational Resources Information Center
Gaetz, Stephen
1992-01-01
A weakness in the approach to community-based youth services in Cork (Ireland) involves viewing the terms "youth" and "community" as though they represented homogeneous categories. Ethnographic data highlight the difficulties of monolithic classification by describing the experiences of three distinct categories of young…
Laboratory automation: trajectory, technology, and tactics.
Markin, R S; Whalen, S A
2000-05-01
Laboratory automation is in its infancy, following a path parallel to the development of laboratory information systems in the late 1970s and early 1980s. Changes on the horizon in healthcare and clinical laboratory service that affect the delivery of laboratory results include the increasing age of the population in North America, the implementation of the Balanced Budget Act (1997), and the creation of disease management companies. Major technology drivers include outcomes optimization and phenotypically targeted drugs. Constant cost pressures in the clinical laboratory have forced diagnostic manufacturers into less than optimal profitability states. Laboratory automation can be a tool for the improvement of laboratory services and may decrease costs. The key to improvement of laboratory services is implementation of the correct automation technology. The design of this technology should be driven by required functionality. Automation design issues should be centered on the understanding of the laboratory and its relationship to healthcare delivery and the business and operational processes in the clinical laboratory. Automation design philosophy has evolved from a hardware-based approach to a software-based approach. Process control software to support repeat testing, reflex testing, and transportation management, and overall computer-integrated manufacturing approaches to laboratory automation implementation are rapidly expanding areas. It is clear that hardware and software are functionally interdependent and that the interface between the laboratory automation system and the laboratory information system is a key component. The cost-effectiveness of automation solutions suggested by vendors, however, has been difficult to evaluate because the number of automation installations are few and the precision with which operational data have been collected to determine payback is suboptimal. The trend in automation has moved from total laboratory automation to a
Transitioning HIV-infected youth into adult health care.
2013-07-01
With advances in antiretroviral therapy, most HIV-infected children survive into adulthood. Optimal health care for these youth includes a formal plan for the transition of care from primary and/or subspecialty pediatric/adolescent/family medicine health care providers (medical home) to adult health care provider(s). Successful transition involves the early engagement and participation of the youth and his or her family with the pediatric medical home and adult health care teams in developing a formal plan. Referring providers should have a written policy for the transfer of HIV-infected youth to adult care, which will guide in the development of an individualized plan for each youth. The plan should be introduced to the youth in early adolescence and modified as the youth approaches transition. Assessment of developmental milestones is important to define the readiness of the youth in assuming responsibility for his or her own care before initiating the transfer. Communication among all providers is essential and should include both personal contact and a written medical summary. Progress toward the transition should be tracked and,once completed, should be documented and assessed.
Risk and Criminogenic Needs of Youth Who Sexually Offended in Singapore
Zeng, Gerald; Chu, Chi Meng; Koh, Li Lian; Teoh, Jennifer
2015-01-01
An increasing amount of research has been carried out to understand the characteristics of subgroups of adult sex offenders, but there is limited research into the risk factors and criminogenic needs of subgroups of youth who sexually offended. The current study investigated if there were differences in the risk and criminogenic needs of 167 Singaporean youth who sexually offended based on two typologies - youth who offended both sexually and nonsexually versus youth who offended only sexually, and youth who offended against child victims versus youth who offended against nonchild victims. Results show that youth who offended both sexually and nonsexually were found to have higher risk and criminogenic needs as compared to youth who only sexually offended. In addition, youth who offended against child victims were found to have higher numbers of previous sexual assaults as compared to youth who offended against nonchild victims. These differences have implications for the management and intervention of youth who sexually offended. PMID:24503949
An Ecological Perspective on the Media and Youth Development.
McHale, Susan M; Dotterer, Aryn; Kim, Ji-Yeon
2009-04-01
From an ecological perspective, daily activities are both a cause and a consequence of youth development. Research on youth activities directs attention to the processes through which daily activities may have an impact on youth, including: (a) providing chances to learn and practice skills; (b) serving as a forum for identity development; (c) affording opportunities to build social ties; (d) connecting youth to social institutions; and (e) keeping youth from engaging in other kinds of activities. Youth's daily activities, in turn, both influence and are influenced by the multi-layered ecology within which their lives are embedded, an ecology that ranges from the proximal contexts of everyday life (e.g., family, peer group) to the larger political, economic, legal and cultural contexts of the larger society. The paper concludes with consideration of methodological issues and directions for research on the media and youth development.
Compliance with youth access regulations for indoor UV tanning.
Hester, Eric J; Heilig, Lauren F; D'Ambrosia, Renee; Drake, Amanda L; Schilling, Lisa M; Dellavalle, Robert P
2005-08-01
To describe youth access to indoor UV tanning and youth discount pricing incentives in 4 states with different age restrictions: Colorado (no age restrictions), Texas (age 13 years), Illinois (age 14 years), and Wisconsin (age 16 years). Cross-sectional telephone survey conducted in October 2003 using a standardized script to assess the practices of randomly selected UV tanning operators. Randomly selected licensed indoor UV tanning facility operators in Colorado, Texas, Illinois, and Wisconsin. Number of facilities (1) complying with indoor UV tanning minimum age regulations for a 12-year-old potential patron and a 15-year-old potential patron and (2) offering youth discounts. For a 12-year-old potential patron, 62% of facilities in states with minimum age restrictions prohibiting 12-year-olds had an operator report that they would not permit indoor tanning (Texas, 23%; Illinois, 74%; and Wisconsin, 89%) compared with 18% in Colorado, a state without youth access regulations. For a 15-year-old patron, most facilities in Wisconsin, the only state with a minimum age restriction for 15-year-olds, prohibited access (77%). Overall, 15% of operators offered youth discounts: Texas, 23%; Illinois, 14%; Wisconsin, 11%; and Colorado, 11%. Tanning facilities in 4 states offered price incentives directed at youths. State youth access regulations were associated with decreased youth access to indoor tanning. High compliance levels in states with long-standing youth access regulations (Illinois and Wisconsin) demonstrate the potential for successful tanning industry youth access regulation.
Villa-Torres, Laura; Svanemyr, Joar
2015-01-01
The purpose of this article was to reflect on the concepts of adolescence and youth, summarize models and frameworks developed to conceptualize youth participation, and assess research that has attempted to evaluate the implementation and impact of youth participation in the field of sexual and reproductive health and rights (SRHR). We searched and critically reviewed relevant published reports and "gray literature" from the period 2000-2013. "Young people" are commonly defined as those between the ages of 10 and 24 years, but what it means to be a young person varies largely across cultures and depends on a range of socioeconomic factors. Several conceptual frameworks have been developed to better understand youth participation, and some frameworks are designed to monitor youth development programs that have youth participation as a key component. Although none of them are SRHR specific, they have the potential to be adapted and applied also for adolescents' SRHR programs. The most monitored and evaluated intervention type is peer education programs, but the effectiveness of the approach is questioned. There are few attempts to systematically evaluate youth participation, and clear indicators and better methodologies still need to be developed. More research and documentation as well as the adoption of innovative practices for involving youth in sexual and reproductive health programs are needed. Participation is a right and should not only be evaluated in terms of effectiveness and impact. Youth participation in program and policy development should still be a priority. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
1983-01-01
An important concept of the Action Information Management System (AIMS) approach is to evaluate office automation technology in the context of hands on use by technical program managers in the conduct of human acceptance difficulties which may accompany the transition to a significantly changing work environment. The improved productivity and communications which result from application of office automation technology are already well established for general office environments, but benefits unique to NASA are anticipated and these will be explored in detail.
Gatekeeper Training for Youth Workers
ERIC Educational Resources Information Center
Cartmill, Tania; Deane, Frank; Wilson, Coralie
2009-01-01
Adults who act as gatekeepers for young people may have the same barriers to help-seeking for mental health issues as young people. This study investigated the personal help-seeking practices of 47 Australian youth workers prior to and after a training workshop on youth mental health issues. Pre-post workshop evaluation revealed some increases in…
ERIC Educational Resources Information Center
Young, Morghan Velez; Phillips, Rachel Sophia; Nasir, Na'ilah Suad
2010-01-01
This paper examines schooling inside a youth prison. We draw on interview and observation data from a study of a youth prison school to understand the practices and tensions of schooling in a juvenile incarceration facility. We describe the processes of schooling in the facility with an eye towards understanding both the conditions of learning and…
Youth and Environment Training Project: Mid-Project Review.
ERIC Educational Resources Information Center
Edbrooke, Jill
The aims of the Youth and Environment Training Project were to: increase youth workers' awareness and understanding of conservation and environmental issues and their relevance to young people; create links between environmental education and youth work practice; develop strategies for implementing conservation and environmental activities within…
Selecting automation for the clinical chemistry laboratory.
Melanson, Stacy E F; Lindeman, Neal I; Jarolim, Petr
2007-07-01
Laboratory automation proposes to improve the quality and efficiency of laboratory operations, and may provide a solution to the quality demands and staff shortages faced by today's clinical laboratories. Several vendors offer automation systems in the United States, with both subtle and obvious differences. Arriving at a decision to automate, and the ensuing evaluation of available products, can be time-consuming and challenging. Although considerable discussion concerning the decision to automate has been published, relatively little attention has been paid to the process of evaluating and selecting automation systems. To outline a process for evaluating and selecting automation systems as a reference for laboratories contemplating laboratory automation. Our Clinical Chemistry Laboratory staff recently evaluated all major laboratory automation systems in the United States, with their respective chemistry and immunochemistry analyzers. Our experience is described and organized according to the selection process, the important considerations in clinical chemistry automation, decisions and implementation, and we give conclusions pertaining to this experience. Including the formation of a committee, workflow analysis, submitting a request for proposal, site visits, and making a final decision, the process of selecting chemistry automation took approximately 14 months. We outline important considerations in automation design, preanalytical processing, analyzer selection, postanalytical storage, and data management. Selecting clinical chemistry laboratory automation is a complex, time-consuming process. Laboratories considering laboratory automation may benefit from the concise overview and narrative and tabular suggestions provided.
ERIC Educational Resources Information Center
Partee, Glenda L.
2003-01-01
At the international Youth Employment Summit, September 7-11, 2002, representatives from over 140 countries gathered in Alexandria, Egypt to share knowledge and experience and to advance the cause of better preparation of youth for entry into, and success in, their respective national economies. At the Summit, for the benefit of those with little…
Youth-Reaching-Youth Implementation Guide: A Peer Program for Alcohol and Other Drug Use Prevention.
ERIC Educational Resources Information Center
Dietz, Patricia M.; And Others
This guide was designed to encourage and assist groups to incorporate youth into their alcohol and other drug prevention and education programs. It provides a step-by-step approach to planning and implementing a program in which young people make a significant contribution to reducing or preventing alcohol and other drug use among youth in…
Public Opinion on Youth, Crime and Race: A Guide for Advocates. Building Blocks for Youth.
ERIC Educational Resources Information Center
Soler, Mark
This guide summarizes public opinion research on youth and juvenile justice issues from the Building Blocks for Youth focus groups and various national polls. Overall, the public is less fearful about crime than in the past but believes juvenile crime is increasing. There is serious public concern about the effectiveness of the juvenile justice…
A Social Semiotic Mapping of Voice in Youth Media: The Pitch in Youth Video Production
ERIC Educational Resources Information Center
Pyles, Damiana Gibbons
2017-01-01
An ethics of youth media production is the interplay of identities, media literacy, and modality that shape the environment within which young people produce media, yet how "voice" is fostered and/or constrained in these environments could still be explored more fully. This paper stems from a larger qualitative study of how youth created…
Employment and Other Income Sources Among Homeless Youth.
Slesnick, Natasha; Zhang, Jing; Yilmazer, Tansel
2018-05-12
Homeless youth report high rates of unemployment. While homeless serving agencies usually offer employment services, most homeless youth are disengaged from homeless service agencies, and a limited number of studies have examined employment and other income sources among service disconnected youth. Our study examined income sources and change in income among service disconnected youth, all of whom received Strengths-Based Outreach and Advocacy (SBOA, N = 79). Findings revealed that over time employment and legal income from non-survival behaviors increased (e.g., governmental assistance and receiving income from friends and relatives), while income from survival behaviors decreased (e.g., prostitution, stealing, selling possessions, selling blood or plasma). Although unemployment among these youth remained high (62%), income from survival behaviors reduced most drastically. Findings also suggest that employment is linked to housing stability and mental health, as is substance use and income, which suggests that mental health, housing, and substance use treatment services are important components in income stabilization for homeless youth.
Caregiver Life Satisfaction: Relationship to Youth Symptom Severity through Treatment
Athay, M. Michele
2013-01-01
Objective This study utilized the Satisfaction with Life Scale (SWLS) to investigate the life satisfaction of caregivers for youth receiving mental health services (N = 383), specifically how it relates to youth symptom severity throughout treatment. Method Hierarchical linear modeling (HLM) with a time-varying covariate was used to estimate the linear trajectory of caregiver life satisfaction and how it relates to youth symptom severity as rated by caregivers, youth, and clinicians. Results Initial caregiver life satisfaction was inversely related to caregiver and clinician rated youth symptom severity. Additionally, subsequent caregiver life satisfaction demonstrated a small but significant relationship to changes in youth symptom severity during treatment where a decrease in youth symptoms corresponded to an increase in caregiver life satisfaction, and vice versa. Caregiver background characteristics related to higher life satisfaction include being: married, a birth-parent, under 40 years old and having the absence of previous diagnoses of an emotional, behavioral or substance use disorder. Conclusion Caregivers of clinically-referred youth report low levels of life satisfaction throughout youth treatment. Given the bi-directional influences on one another, tending to the well-being of caregivers may positively influence both caregivers and youths. PMID:22571285
Cultural orientations, daily activities, and adjustment in Mexican American youth.
McHale, Susan M; Updegraff, Kimberly A; Kim, Ji-Yeon; Cansler, Emily
2009-05-01
The links between youth's daily activities and adjustment and the role of cultural practices and values in these links were studied in 469 youth from 237 Mexican American families. In home interviews, data on mothers', fathers', and two adolescent-age siblings' cultural practices (language use, social contacts) and values (for familism, for education achievement) were collected, along with data on youth risky behavior and depressive symptoms. In 7 nightly phone calls, youth reported on their day's free time activities (i.e., sports, academics, religious activities, television viewing, and hanging out). Analyses revealed that youth who spent more time in unsupervised hanging out reported more depressive symptoms and risky behavior, and those who spent more time in academic activities reported less risky behavior. Results also indicated that more Anglo-oriented youth spent more time in sports, that more Mexican-oriented youth spent more time watching television, that fathers' familism values were related to youth's time in religious activities, and that parents' educational values were linked to youth's time in academic activities. Some evidence indicated that parents' cultural practices and values, particularly fathers', moderated the links between daily activities and youth adjustment.
21 CFR 864.5200 - Automated cell counter.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Automated cell counter. 864.5200 Section 864.5200....5200 Automated cell counter. (a) Identification. An automated cell counter is a fully-automated or semi-automated device used to count red blood cells, white blood cells, or blood platelets using a sample of the...
Youth Prostitution: A Balance of Power.
ERIC Educational Resources Information Center
McMullen, Richie J.
1987-01-01
Discusses the issues of child and adolescent prostitution, focusing on the youth prostitution situation in London, England. Briefly describes "Streetwise," a support and counseling program developed to aid London youth who have been involved in any form of prostitution. (NB)
Progress on youth reproductive health.
1998-06-01
The first round table meeting to review progress in implementing the Programme of Action of the 1994 International Conference on Population and Development was convened in April 1998 to consider progress on adolescent reproductive health and rights. The 30 participants from 24 countries concluded that while many countries have made progress, attitudes still need to be changed among those who continue to believe that provision of reproductive health services to adolescents leads to promiscuity. The topics considered during the meeting included: 1) improving accessibility and quality of information and services; 2) creating an "enabling environment" for adolescent reproductive health; 3) enhancing the role of parents and schools in providing sex education; 4) using national laws and policies to protect youth health and rights; and 5) mobilizing private sector and private foundation resources. The round table recommended that adolescent reproductive health programs 1) involve diverse groups of young people in the development of programs, services, and materials; 2) cooperate with a wide variety of other agencies; 3) encourage open discussions of sexuality; 4) train youth as peer counselors; 5) hire youth as paid staff; 6) use a range of quality communication resources; 7) train health care professionals who deal with adolescents; 8) develop evaluation indicators for social and emotional well-being; 9) increase youth access to the formal health sector; and 10) use the visibility of women's groups to promote young women's interests. The round table also asked UN agencies to strengthen their support for youth programs.
One chip at a time: using technology to enhance youth development.
Cohall, Alwyn; Nshom, Montsine; Nye, Andrea
2007-08-01
Youth development programs have the potential to positively impact psychosocial growth and maturation in young adults. Several youth development programs are capitalizing on youths' natural gravitation toward technology as well. Research has shown that youth view technology and technologic literacy as positive and empowering, and that youth who master technology have increased self-esteem and better socioeconomic prospects than their counterparts. Technology-centered youth development programs offer a unique opportunity to engage youth, thereby extending their social networks, enhancing their access to information, building their self-esteem, and improving their self-efficacy. This article provides an overview of the intersection between youth development and technology and illustrates the ways technology can be used as a cutting-edge tool for youth development.
Social Meanings of Marijuana Use for Southeast Asian Youth
Lee, Juliet P.; Kirkpatrick, Sean
2011-01-01
The paper describes findings from a pilot study of drug use and environment for Southeast Asian youths in the San Francisco Bay Area. From interviews with 31 drug-involved youths living in two low-income predominantly ethnic minority neighborhoods, smoking marijuana emerged as pervasive and highly normative. Smoking marijuana provided a means for coping with the stresses of home and community life, and located youths, moreover, within an alternative ghetto lifestyle of rap music, marijuana smoking and youth crime, as modeled by co-resident ethnic minority peers, with which many Southeast Asian youths identified. The findings indicate the importance of the social environment as well as social status in the substance use of this group of second-generation youth. PMID:16537331
Learning in non-formal education: Is it "youthful" for youth in action?
NASA Astrophysics Data System (ADS)
Norqvist, Lars; Leffler, Eva
2017-04-01
This article offers insights into the practices of a non-formal education programme for youth provided by the European Union (EU). It takes a qualitative approach and is based on a case study of the European Voluntary Service (EVS). Data were collected during individual and focus group interviews with learners (the EVS volunteers), decision takers and trainers, with the aim of deriving an understanding of learning in non-formal education. The research questions concerned learning, the recognition of learning and perspectives of usefulness. The study also examined the Youthpass documentation tool as a key to understanding the recognition of learning and to determine whether the learning was useful for learners (the volunteers). The findings and analysis offer several interpretations of learning, and the recognition of learning, which take place in non-formal education. The findings also revealed that it is complicated to divide learning into formal and non- formal categories; instead, non-formal education is useful for individual learners when both formal and non-formal educational contexts are integrated. As a consequence, the division of formal and non-formal (and possibly even informal) learning creates a gap which works against the development of flexible and interconnected education with ubiquitous learning and mobility within and across formal and non-formal education. This development is not in the best interests of learners, especially when seeking useful learning and education for youth (what the authors term "youthful" for youth in action).
Measles and Rubella Seroprevalence Among HIV-infected and Uninfected Zambian Youth.
Sutcliffe, Catherine G; Searle, Kelly; Matakala, Hellen K; Greenman, Michelle P; Rainwater-Lovett, Kaitlin; Thuma, Philip E; Moss, William J
2017-03-01
Measles and congenital rubella syndrome remain significant causes of morbidity and mortality despite available vaccines. HIV-infected youth may be at increased risk of measles because of greater waning immunity after vaccination. At a population level, they constitute a potentially large pool of susceptibles to measles and rubella. More data among HIV-infected youth in sub-Saharan Africa are needed to guide vaccination policy and control strategies. This cross-sectional study was nested within 2 ongoing studies of malaria and HIV in Zambia. Dried blood spot cards from youth (5-15 years) in these studies from 2009 to 2013 were tested for IgG antibodies to measles and rubella viruses. HIV-uninfected youth, HIV-infected treatment-naive youth and HIV-infected youth receiving antiretroviral therapy (ART) were compared. A total of 617 HIV-uninfected, 144 HIV-infected treatment-naive and 128 HIV-infected youth receiving ART were included in this study. The proportion seropositive for measles virus was significantly higher among HIV-uninfected youth (92.5%) compared with HIV-infected treatment-naive youth (74.1%) and HIV-infected youth receiving ART (71.9%). No differences by age were observed. The proportion seropositive for rubella virus was significantly higher among HIV-uninfected youth (54.7%) compared with HIV-infected treatment-naive youth (41.7%) and HIV-infected youth receiving ART (49.6%), with increases observed by age for all groups. Measles seroprevalence was lower among HIV-infected than uninfected youth, consistent with waning immunity after measles vaccination. HIV-infected youth would benefit from revaccination. Half of all youth in rural Zambia were susceptible to rubella and may need targeting for catch-up rubella campaigns when measles-rubella vaccine is introduced.
Mortality of Youth Offenders Along a Continuum of Justice System Involvement.
Aalsma, Matthew C; Lau, Katherine S L; Perkins, Anthony J; Schwartz, Katherine; Tu, Wanzhu; Wiehe, Sarah E; Monahan, Patrick; Rosenman, Marc B
2016-03-01
Black male youth are at high risk of homicide and criminal justice involvement. This study aimed to determine how early mortality among youth offenders varies based on race; gender; and the continuum of justice system involvement: arrest, detention, incarceration, and transfer to adult courts. Criminal and death records of 49,479 youth offenders (ages 10-18 years at first arrest) in Marion County, Indiana, from January 1, 1999, to December 31, 2011, were examined. Statistical analyses were completed in November 2014. From 1999 to 2011 (aggregate exposure, 386,709 person-years), 518 youth offender deaths occurred. The most common cause of death was homicide (48.2%). The mortality rate of youth offenders was nearly 1.5 times greater than that among community youth (standardized mortality ratio, 1.48). The youth offender mortality rate varied depending on the severity of justice system involvement. Arrested youth had the lowest rate of mortality (90/100,000), followed by detained youth (165/100,000); incarcerated youth (216/100,000); and youth transferred to adult court (313/100,000). A proportional hazards model demonstrated that older age, male gender, and more severe justice system involvement 5 years post-arrest predicted shorter time to mortality. Youth offenders face greater risk for early death than community youth. Among these, black male youth face higher risk of early mortality than their white male counterparts. However, regardless of race/ethnicity, mortality rates for youth offenders increase as youth involvement in the justice system becomes more protracted and severe. Thus, justice system involvement is a significant factor to target for intervention. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
Computers and the Internet: Tools for Youth Empowerment
2005-01-01
Background Youth are often disenfranchised in their communities and may feel they have little voice. Since computers are an important aspect of youth culture, they may offer solutions to increasing youth participation in communities. Objective This qualitative case study investigated the perceptions of 19 (predominantly female) inner-city school youth about their use of computers and the Internet in a school-based community development project. Methods Youth working with public health nurses in a school-based community development project communicated with local community members using computer-mediated communication, surveyed peers online, built websites, searched for information online, and prepared project materials using computers and the Internet. Participant observation, semistructured interviews, analysis of online messages, and online- and paper-based surveys were used to gather data about youth’s and adults’ perceptions and use of the technologies. Constant comparison method and between-method triangulation were used in the analysis to satisfy the existence of themes. Results Not all youth were interested in working with computers. Some electronic messages from adults were perceived to be critical, and writing to adults was intimidating for some youth. In addition, technical problems were experienced. Despite these barriers, most youth perceived that using computers and the Internet reduced their anxiety concerning communication with adults, increased their control when dealing with adults, raised their perception of their social status, increased participation within the community, supported reflective thought, increased efficiency, and improved their access to resources. Conclusions Overall, youth perceived computers and the Internet to be empowering tools, and they should be encouraged to use such technology to support them in community initiatives. PMID:16403715
ERIC Educational Resources Information Center
Livingstone, Anne-Marie; Celemencki, Jacqueline; Calixte, Melissa
2014-01-01
The article discusses the implementation and results of a youth participatory action research (YPAR) project carried out with black high school students in 2009 and 2010 in Montreal, QC. The aim of the project was to involve black youth in studying the factors that either enhance or impede their success in school and thereby have them identify…
ERIC Educational Resources Information Center
Perry, George S., Jr.
Taking the position that Youth for Justice Youth Summits were highly successful in their inaugural year of 1995, this report explains the purpose and goals of the summits. The report also summarizes the activities undertaken in the 47 states (plus the District of Columbia and Puerto Rico) where the summits were held on a state-by-state basis. The…
Health care of youth aging out of foster care.
2012-12-01
Youth transitioning out of foster care face significant medical and mental health care needs. Unfortunately, these youth rarely receive the services they need because of lack of health insurance. Through many policies and programs, the federal government has taken steps to support older youth in foster care and those aging out. The Fostering Connections to Success and Increasing Adoptions Act of 2008 (Pub L No. 110-354) requires states to work with youth to develop a transition plan that addresses issues such as health insurance. In addition, beginning in 2014, the Patient Protection and Affordable Care Act of 2010 (Pub L No. 111-148) makes youth aging out of foster care eligible for Medicaid coverage until age 26 years, regardless of income. Pediatricians can support youth aging out of foster care by working collaboratively with the child welfare agency in their state to ensure that the ongoing health needs of transitioning youth are met.
Flight-deck automation - Promises and problems
NASA Technical Reports Server (NTRS)
Wiener, E. L.; Curry, R. E.
1980-01-01
The paper analyzes the role of human factors in flight-deck automation, identifies problem areas, and suggests design guidelines. Flight-deck automation using microprocessor technology and display systems improves performance and safety while leading to a decrease in size, cost, and power consumption. On the other hand negative factors such as failure of automatic equipment, automation-induced error compounded by crew error, crew error in equipment set-up, failure to heed automatic alarms, and loss of proficiency must also be taken into account. Among the problem areas discussed are automation of control tasks, monitoring of complex systems, psychosocial aspects of automation, and alerting and warning systems. Guidelines are suggested for designing, utilising, and improving control and monitoring systems. Investigation into flight-deck automation systems is important as the knowledge gained can be applied to other systems such as air traffic control and nuclear power generation, but the many problems encountered with automated systems need to be analyzed and overcome in future research.
Modular workcells: modern methods for laboratory automation.
Felder, R A
1998-12-01
Laboratory automation is beginning to become an indispensable survival tool for laboratories facing difficult market competition. However, estimates suggest that only 8% of laboratories will be able to afford total laboratory automation systems. Therefore, automation vendors have developed alternative hardware configurations called 'modular automation', to fit the smaller laboratory. Modular automation consists of consolidated analyzers, integrated analyzers, modular workcells, and pre- and post-analytical automation. These terms will be defined in this paper. Using a modular automation model, the automated core laboratory will become a site where laboratory data is evaluated by trained professionals to provide diagnostic information to practising physicians. Modem software information management and process control tools will complement modular hardware. Proper standardization that will allow vendor-independent modular configurations will assure success of this revolutionary new technology.