Sample records for yttrium-90 labeled anti-cd20

  1. Biodistribution of Yttrium-90-Labeled Anti-CD45 Antibody in a Nonhuman Primate Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemecek, Eneida; Hamlin, Donald K.; Fisher, Darrell R.

    2005-01-15

    Radioimmunotherapy may improve the outcome of hematopoietic cell transplantation for hematologic malignancies by delivering targeted radiation to hematopoietic organs while relatively sparing nontarget organs. We evaluated the organ localization of yttrium-90-labeled anti-CD45 (90Y-anti-CD45) antibody in macaques, a model that had previously predicted iodine-131-labeled anti-CD-45 (131I-anti-CD45) antibody biodistribution in humans. Experimental Design: Twelve Macaca nemestrina primates received anti-CD45 antibody labeled with 1 to 2 mCi of 90Y followed by serial blood sampling and marrow and lymph node biopsies, and necropsy. The content of 90Y per gram of tissue was determined by liquid scintillation spectrometry. Time-activity curves were constructed using average isotopemore » concentrations in each tissue at measured time points to yield the fractional residence time and estimate radiation absorbed doses for each organ per unit of administered activity. The biodistribution of 90Y-anti-CD45 antibody was then compared with that previously obtained with 131I-anti-CD45 antibody in macaques. Results: The spleen received 2,120, marrow 1,060, and lymph nodes 315 cGy/mCi of 90Y injected. The liver and lungs were the nontarget organs receiving the highest radiation absorbed doses (440 and 285 cGy/mCi, respectively). Ytrrium-90-labeled anti-CD45 antibody delivered 2.5- and 3.7-fold more radiation to marrow than to liver and lungs, respectively. The ratios previously observed with 131I-antiCD45 antibody were 2.5-and 2.2-fold more radiation to marrow than to liver and lungs, respectively. Conclusions: This study shows that 90Y-anti-CD45 antibody can deliver relatively selective radiation to hematopoietic tissues, with similar ratios of radiation delivered to target versus nontarget organs, as compared with the 131I immunoconjugate in the same animal model.« less

  2. Yttrium 90 ibritumomab tiuxetan radioimmunotherapy for relapsed or refractory low-grade non-Hodgkin's lymphoma.

    PubMed

    Gordon, Leo I; Witzig, Thomas E; Wiseman, Greg A; Flinn, Ian W; Spies, Stewart S; Silverman, Daniel H; Emmanuolides, Christos; Cripe, Larry; Saleh, Mansoor; Czuczman, Myron S; Olejnik, Teresa; White, Christine A; Grillo-López, Antonio J

    2002-02-01

    The treatment of malignant lymphoma has improved over the past 20 years, but the majority of patients are not cured. New modalities using targeted therapy based on new information in molecular biology and immunology hold promise for better outcomes with less toxicity. We review data on the use of radiolabeled monoclonal antibodies directed against the CD20 antigen on malignant B cells. We discuss the major radionuclides available, iodine 131 ( 131 I), tositumomab, and yttrium 90 ( 90 Y) ibritumomab tiuxetan (Zevalin; IDEC Pharmaceuticals, San Diego, CA) and present data on new approaches in labeling antibodies that have facilitated their use. Clinical trial data with the yttrium-labeled antibodies are discussed. The use of dosimetry as a means for predicting toxicity is discussed, and the questions of long-term toxicity (late effects) are addressed. These targeted approaches to the treatment of malignancy, and lymphoma in particular, hold great promise. Semin Oncol 29 (suppl 2):87-92. Copyright © 2002 by W.B. Saunders Company. Copyright © 2002 W.B. Saunders Company. All rights reserved.

  3. Comparative efficacy of 177Lu and 90Y for Anti-CD20 Pretargeted Radioimmunotherapy in Murine Lymphoma Xenograft Models

    DOE PAGES

    Frost, Sofia H. L.; Frayo, Shani L.; Miller, Brian W.; ...

    2015-03-18

    Purpose Pretargeted radioimmunotherapy (PRIT) is a multi-step method of selectively delivering high doses of radiotherapy to tumor cells while minimizing exposure to surrounding tissues. Yttrium-90 ( 90Y) and lutetium-177 ( 177Lu) are two of the most promising beta-particle emitting radionuclides used for radioimmunotherapy, which despite having similar chemistries differ distinctly in terms of radiophysical features. These differences may have important consequences for the absorbed dose to tumors and normal organs. Whereas 90Y has been successfully applied in a number of preclinical and clinical radioimmunotherapy settings, there have been few published pretargeting studies with 177Lu. We therefore compared the therapeutic potentialmore » of targeting either 90Y or 177Lu to human B-cell lymphoma xenografts in mice. Methods Parallel experiments evaluating the biodistribution, imaging, dosimetry, therapeutic efficacy, and toxicity were performed in female athymic nude mice bearing either Ramos (Burkitt lymphoma) or Granta (mantle cell lymphoma) xenografts, utilizing an anti-CD20 antibodystreptavidin conjugate (1F5-SA) and an 90Y- or 177Lu-labeled 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA)-biotin second step reagent. Results The two radionuclides displayed comparable biodistributions in tumors and normal organs; however, the absorbed radiation dose delivered to tumor was more than twice as high for 90Y (1.3 Gy/MBq) as for 177Lu (0.6 Gy/MBq). More importantly, therapy with 90Y-DOTAbiotin was dramatically more effective than with 177Lu-DOTA-biotin, with 100% of Ramos xenograft-bearing mice cured with 37 MBq 90Y, whereas 0% were cured using identical amounts of 177Lu-DOTA-biotin. Similar results were observed in mice bearing Granta xenografts, with 80% of the mice cured with 90Y-PRIT and 0% cured with 177Lu-PRIT. Toxicities were comparable with both isotopes. Conclusion 90Y was therapeutically superior to 177Lu for streptavidin-biotin PRIT

  4. Comparative efficacy of 177Lu and 90Y for Anti-CD20 Pretargeted Radioimmunotherapy in Murine Lymphoma Xenograft Models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frost, Sofia H. L.; Frayo, Shani L.; Miller, Brian W.

    Purpose Pretargeted radioimmunotherapy (PRIT) is a multi-step method of selectively delivering high doses of radiotherapy to tumor cells while minimizing exposure to surrounding tissues. Yttrium-90 ( 90Y) and lutetium-177 ( 177Lu) are two of the most promising beta-particle emitting radionuclides used for radioimmunotherapy, which despite having similar chemistries differ distinctly in terms of radiophysical features. These differences may have important consequences for the absorbed dose to tumors and normal organs. Whereas 90Y has been successfully applied in a number of preclinical and clinical radioimmunotherapy settings, there have been few published pretargeting studies with 177Lu. We therefore compared the therapeutic potentialmore » of targeting either 90Y or 177Lu to human B-cell lymphoma xenografts in mice. Methods Parallel experiments evaluating the biodistribution, imaging, dosimetry, therapeutic efficacy, and toxicity were performed in female athymic nude mice bearing either Ramos (Burkitt lymphoma) or Granta (mantle cell lymphoma) xenografts, utilizing an anti-CD20 antibodystreptavidin conjugate (1F5-SA) and an 90Y- or 177Lu-labeled 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA)-biotin second step reagent. Results The two radionuclides displayed comparable biodistributions in tumors and normal organs; however, the absorbed radiation dose delivered to tumor was more than twice as high for 90Y (1.3 Gy/MBq) as for 177Lu (0.6 Gy/MBq). More importantly, therapy with 90Y-DOTAbiotin was dramatically more effective than with 177Lu-DOTA-biotin, with 100% of Ramos xenograft-bearing mice cured with 37 MBq 90Y, whereas 0% were cured using identical amounts of 177Lu-DOTA-biotin. Similar results were observed in mice bearing Granta xenografts, with 80% of the mice cured with 90Y-PRIT and 0% cured with 177Lu-PRIT. Toxicities were comparable with both isotopes. Conclusion 90Y was therapeutically superior to 177Lu for streptavidin-biotin PRIT

  5. BCR-ABL1 molecular remission after 90Y-epratuzumab tetraxetan radioimmunotherapy in CD22+ Ph+ B-ALL: proof of principle.

    PubMed

    Chevallier, Patrice; Bodet-Milin, Caroline; Robillard, Nelly; Eugene, Thomas; Menard, Audrey; Le Houerou, Claire; Guillaume, Thierry; Delaunay, Jacques; Escoffre-Barbe, Martine; Wegener, William A; Goldenberg, David M; Kraeber-Bodéré, Francoise

    2013-12-01

    Although targeted therapies are used increasingly in hematologic malignancies, we are unaware of any prior studies of radioimmunotherapy (RAIT) in B-acute lymphoblastic leukemia (ALL), even though this radiosensitive tumor expresses CD22, potentially a good target for this approach. Here, we report a patient with Philadelphia chromosome-positive B-ALL in third relapse who received RAIT with (90) yttrium ((90) Y)-labeled anti-CD22 epratuzumab tetraxetan. Seven weeks after initiating therapy, the patient achieved a BCR-ABL1 molecular remission documented by RT-qPCR, which is now continuing at 6 months while awaiting an allogeneic hematopoietic stem cell transplant. (90) Y-Epratuzumab tetraxetan may be a promising therapeutic option for CD22(+) B-ALL patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. (90)Y-labelled anti-CD22 epratuzumab tetraxetan in adults with refractory or relapsed CD22-positive B-cell acute lymphoblastic leukaemia: a phase 1 dose-escalation study.

    PubMed

    Chevallier, Patrice; Eugene, Thomas; Robillard, Nelly; Isnard, Françoise; Nicolini, Franck; Escoffre-Barbe, Martine; Huguet, Françoise; Hunault, Mathilde; Marcais, Antoine; Gaschet, Joelle; Cherel, Michel; Guillaume, Thierry; Delaunay, Jacques; Peterlin, Pierre; Eveillard, Marion; Thomas, Xavier; Ifrah, Norbert; Lapusan, Simona; Bodet-Milin, Caroline; Barbet, Jacques; Faivre-Chauvet, Alain; Ferrer, Ludovic; Bene, Marie C; Le Houerou, Claire; Goldenberg, David M; Wegener, William A; Kraeber-Bodéré, Françoise

    2015-03-01

    Prognosis of patients with relapsed or refractory acute lymphoblastic leukaemia is poor and new treatments are needed. We aimed to assess the feasibility, tolerability, dosimetry, and efficacy of yttrium-90-labelled anti-CD22 epratuzumab tetraxetan ((90)Y-DOTA-epratuzumab) radioimmunotherapy in refractory or relapsed CD22-positive B-cell acute lymphoblastic leukaemia in a standard 3 + 3 phase 1 study. Adults (≥18 years) with relapsed or refractory B-cell acute lymphoblastic leukaemia (with CD22 expression on at least 70% of blast cells) were enrolled at six centres in France. Patients received one cycle of (90)Y-DOTA-epratuzumab on days 1 and 8 (give or take 2 days) successively at one of four dose levels: 2·5 mCi/m(2) (92·5 MBq/m(2); level 1), 5·0 mCi/m(2) (185 MBq/m(2); level 2), 7·5 mCi/m(2) (277·5 MBq/m(2); level 3), and 10·0 mCi/m(2) (370 MBq/m(2); level 4). The primary objective was to identify the maximum tolerated dose of (90)Y-DOTA-epratuzumab. We assessed safety during infusions and regularly after radioimmunotherapy over a 6-month period. Analyses included only patients who received radioimmunotherapy. The trial is closed to inclusion and is registered at ClinicalTrials.gov, NCT01354457. Between Aug 25, 2011, and June 11, 2014, 17 patients (median age 62 years; range 27-77) were treated (five at level 1, three at level 2, three at level 3, and six at level 4). Radioimmunotherapy infusion was overall well tolerated. One dose-limiting toxic effect (aplasia lasting 8 weeks) occurred at level 4, but the maximum tolerated dose was not reached. The most common grade 3-4 adverse events were pancytopenia (one patient at level 2, one at level 3, and six at level 4) and infections (three at level 1, one at level 2, and five at level 4). (90)Y-DOTA-epratuzumab radioimmunotherapy is well tolerated. We recommend the dose of 2 × 10·0 mCi/m(2) 1 week apart per cycle for phase 2 studies. Immunomedics and Direction de la Recherche Clinique of Nantes

  7. Improved Therapy by Pretargeted Radioimmunotherapy of Non-Hodgkin Lymphoma with a New Recombinant, Trivalent, Anti-CD20, Bispecific Antibody

    PubMed Central

    Sharkey, Robert M.; Karacay, Habibe; Litwin, Samuel; Rossi, Edmund A.; McBride, William J.; Chang, Chein-Hsing; Goldenberg, David M.

    2008-01-01

    We examined whether a pretargeting method using a new, recombinant anti-CD20 bispecific antibody (bsMAb) followed by 90Y-DOTA-peptide could reduce hematological toxicity yet improve therapeutic responses, compared to conventional 90Y-anti-CD20 IgG and a chemically-conjugated bsMAb. TF4, a humanized, tri-Fab, bsMAb with 2 Fabs binding CD20 and 1 Fab binding HSG (histamine-succinyl-glycine), developed by the Dock-and-Lock (DNL) method, was tested in nude mice with Ramos B-cell lymphomas. Optimal pretargeting required a 29-h interval between TF4 and 90Y-DOTA-HSG, and 20-fold more moles of TF4. TF4 cleared more rapidly from the blood than anti-CD20 IgG, with early processing in the liver, spleen and kidneys. At 24 h, TF4 improved tumor uptake of 111In-HSG-peptide 2.6-fold (13% vs 5% injected-dose/g) and enhanced tumor/blood ratios more than 45-fold (770 vs 17), compared to an anti-CD20 Fab x anti-HSG Fab chemical conjugate, and by 1.6-fold (9.0% vs 5.6% injected-dose/g) and 1600-fold (522 vs 0.32), respectively, compared to radiolabeled anti-CD20 IgG. A severe (≥90%) and prolonged reduction of white blood cells was observed at the maximum dose of 90Y-anti-CD20 IgG, whereas pretargeting resulted in a ≤60% transient drop. TF4-pretargeting resulted in highly significant improvement in survival, curing 33-90% of the animals, even at relatively low doses, while most tumors progressed quickly without cures with 90Y-anti-CD20 IgG. These results indicate an improved therapeutic index with pretargeting radioimmunotherapy using a DNL-constructed tri-Fab, bsMAb, as compared to conventional therapy with directly-radiolabeled antibody or with a chemically-conjugated bsMAb. These encouraging results prompt testing of these constructs for pretargeting radioimmunotherapy in patients. PMID:18593929

  8. Anti-CD20 antibody therapy and susceptibility to Pneumocystis pneumonia.

    PubMed

    Elsegeiny, Waleed; Eddens, Taylor; Chen, Kong; Kolls, Jay K

    2015-05-01

    Anti-CD20 antibody therapy has been a useful medication for managing non-Hodgkin's lymphoma as well as autoimmune diseases characterized by autoantibody generation. CD20 is expressed during most developmental stages of B lymphocytes; thus, CD20 depletion leads to B-lymphocyte deficiency. As the drug has become more widely used, there has been an increase in the number of case reports of patients developing Pneumocystis pneumonia. The role of anti-CD20 in Pneumocystis jirovecii infection is under debate due to the fact that most patients receiving it are on a regimen of multiple immunosuppressive medications. To address the specific role of CD20 depletion in host immunity against Pneumocystis, we examined a murine anti-CD20 depleting antibody. We demonstrated that anti-CD20 alone is permissive for Pneumocystis infection and that anti-CD20 impairs components of type II immunity, such as production of interleukin-4 (IL-4), IL-5, and IL-13 by whole-lung cells, in response to Pneumocystis murina. We also demonstrated that CD4(+) T cells from mice treated with anti-CD20 during Pneumocystis infection are incapable of mounting a protective immune response when transferred into Rag1(-/-) mice. Thus, CD20(+) cells are critical for generating protective CD4(+) T-cell immune responses against this organism. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Anti-CD20 Antibody Therapy and Susceptibility to Pneumocystis Pneumonia

    PubMed Central

    Elsegeiny, Waleed; Eddens, Taylor; Chen, Kong

    2015-01-01

    Anti-CD20 antibody therapy has been a useful medication for managing non-Hodgkin's lymphoma as well as autoimmune diseases characterized by autoantibody generation. CD20 is expressed during most developmental stages of B lymphocytes; thus, CD20 depletion leads to B-lymphocyte deficiency. As the drug has become more widely used, there has been an increase in the number of case reports of patients developing Pneumocystis pneumonia. The role of anti-CD20 in Pneumocystis jirovecii infection is under debate due to the fact that most patients receiving it are on a regimen of multiple immunosuppressive medications. To address the specific role of CD20 depletion in host immunity against Pneumocystis, we examined a murine anti-CD20 depleting antibody. We demonstrated that anti-CD20 alone is permissive for Pneumocystis infection and that anti-CD20 impairs components of type II immunity, such as production of interleukin-4 (IL-4), IL-5, and IL-13 by whole-lung cells, in response to Pneumocystis murina. We also demonstrated that CD4+ T cells from mice treated with anti-CD20 during Pneumocystis infection are incapable of mounting a protective immune response when transferred into Rag1−/− mice. Thus, CD20+ cells are critical for generating protective CD4+ T-cell immune responses against this organism. PMID:25733518

  10. Optimized conditions for chelation of yttrium-90-DOTA immunoconjugates.

    PubMed

    Kukis, D L; DeNardo, S J; DeNardo, G L; O'Donnell, R T; Meares, C F

    1998-12-01

    Radioimmunotherapy (RIT) with 90Y-labeled immunoconjugates has shown promise in clinical trials. The macrocyclic chelating agent 1,4,7,10-tetraazacyclododecane-N,N',N",N"'-tetraacetic acid (DOTA) binds 90Y with extraordinary stability, minimizing the toxicity of 90Y-DOTA immunoconjugates arising from loss of 90Y to bone. However, reported 90Y-DOTA immunoconjugate product yields have been typically only < or =50%. Improved yields are needed for RIT with 90Y-DOTA immunoconjugates to be practical. (S) 2-[p-(bromoacetamido)benzyl]-DOTA (BAD) was conjugated to the monoclonal antibody Lym-1 via 2-iminothiolane (2IT). The immunoconjugate product, 2IT-BAD-Lym-1, was labeled in excess yttrium in various buffers over a range of concentrations and pH. Kinetic studies were performed in selected buffers to estimate radiolabeling reaction times under prospective radiopharmacy labeling conditions. The effect of temperature on reaction kinetics was examined. Optimal radiolabeling conditions were identified and used in eight radiolabeling experiments with 2IT-BAD-Lym-1 and a second immunoconjugate, DOTA-peptide-chimeric L6, with 248-492 MBq (6.7-13.3 mCi) of 90Y. Ammonium acetate buffer (0.5 M) was associated with the highest uptake of yttrium. On the basis of kinetic data, the time required to chelate 94% of 90Y (four half-times) under prospective radiopharmacy labeling conditions in 0.5 M ammonium acetate was 17-148 min at pH 6.5, but it was only 1-10 min at pH 7.5. Raising the reaction temperature from 25 degrees C to 37 degrees C markedly increased the chelation rate. Optimal radiolabeling conditions were identified as: 30-min reaction time, 0.5 M ammonium acetate buffer, pH 7-7.5 and 37 degrees C. In eight labeling experiments under optimal conditions, a mean product yield (+/- s.d.) of 91%+/-8% was achieved, comparable to iodination yields. The specific activity of final products was 74-130 MBq (2.0-3.5 mCi) of 90Y per mg of monoclonal antibody. The immunoreactivity of 90Y-labeled

  11. Pretargeted Radioimmunotherapy Using Anti-CD45 Monoclonal Antibodies to Deliver Radiation to Murine Hematolymphoid Tissues and Human Myeloid Leukemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pagel, John M.; Matthews, Dana C.; Kenoyer, Aimee L.

    2009-01-01

    The efficacy of radioimmunotherapy (RIT) for treatment of patients with hematological malignancies frequently fails because of disease recurrence. We therefore conducted pretargeted RIT studies to augment the efficacy in mice of therapy using a pretargeted anti-human (h)CD45 antibody (Ab)-streptavidin (SA) conjugate followed by delivery of a biotinylated clearing agent and radiolabeled-DOTA-biotin. Tumor-to-blood ratios at 24 hours were 20:1 using pretargeted anti-hCD45 RIT and <1:1 with conventional RIT. In vivo imaging studies confirmed that the pretargeted RIT approach provided high-contrast tumor images with minimal blood-pool activity, whereas directly-labeled anti-hCD45 Ab produced distinct tumor images but the blood pool retained a largemore » amount of labeled antibody for a prolonged time. Therapy experiments demonstrated that 90Y-DOTA-biotin significantly prolonged survival of mice treated pretargeted with anti-hCD45 Ab-SA compared to mice treated with conventional RIT using 90Y-labeled anti-hCD45 Ab at the maximally tolerated dose (400 µCi). Since human CD45 antigens are confined to xenograft tumor cells in this model, and all murine tissues are devoid of hCD45 and will not bind anti-hCD45 Ab, we also compared one-step and pretargeted RIT using an anti-murine (m)CD45 Ab (A20 ) in a model where the target antigen is present on normal hematopoietic tissues. After 24 hours, 27.3 ± 2.8% of the injected dose of radionuclide was delivered per gram (% ID/g) of lymph node using 131I-A20-Ab compared with 40.0 ± 5.4% ID/g for pretargeted 111In-DOTA-biotin (p value). These data suggest that multi-step pretargeted methods for delivering RIT are superior to conventional RIT when targeting CD45 for the treatment of leukemia and may allow for the intensification of therapy, while minimizing toxicities.« less

  12. Shape-Controlled Synthesis of Isotopic Yttrium-90-Labeled Rare Earth Fluoride Nanocrystals for Multimodal Imaging.

    PubMed

    Paik, Taejong; Chacko, Ann-Marie; Mikitsh, John L; Friedberg, Joseph S; Pryma, Daniel A; Murray, Christopher B

    2015-09-22

    Isotopically labeled nanomaterials have recently attracted much attention in biomedical research, environmental health studies, and clinical medicine because radioactive probes allow the elucidation of in vitro and in vivo cellular transport mechanisms, as well as the unambiguous distribution and localization of nanomaterials in vivo. In addition, nanocrystal-based inorganic materials have a unique capability of customizing size, shape, and composition; with the potential to be designed as multimodal imaging probes. Size and shape of nanocrystals can directly influence interactions with biological systems, hence it is important to develop synthetic methods to design radiolabeled nanocrystals with precise control of size and shape. Here, we report size- and shape-controlled synthesis of rare earth fluoride nanocrystals doped with the β-emitting radioisotope yttrium-90 ((90)Y). Size and shape of nanocrystals are tailored via tight control of reaction parameters and the type of rare earth hosts (e.g., Gd or Y) employed. Radiolabeled nanocrystals are synthesized in high radiochemical yield and purity as well as excellent radiolabel stability in the face of surface modification with different polymeric ligands. We demonstrate the Cerenkov radioluminescence imaging and magnetic resonance imaging capabilities of (90)Y-doped GdF3 nanoplates, which offer unique opportunities as a promising platform for multimodal imaging and targeted therapy.

  13. Anti-CD22/CD20 Bispecific antibody with enhanced trogocytosis for treatment of Lupus.

    PubMed

    Rossi, Edmund A; Chang, Chien-Hsing; Goldenberg, David M

    2014-01-01

    The humanized anti-CD22 antibody, epratuzumab, has demonstrated therapeutic activity in clinical trials of lymphoma, leukemia and autoimmune diseases, treating currently over 1500 cases of non-Hodgkin lymphoma, acute lymphoblastic leukemias, Waldenström's macroglobulinemia, Sjögren's syndrome, and systemic lupus erythematosus. Because epratuzumab reduces on average only 35% of circulating B cells in patients, and has minimal antibody-dependent cellular cytotoxicity and negligible complement-dependent cytotoxicity when evaluated in vitro, its therapeutic activity may not result completely from B-cell depletion. We reported recently that epratuzumab mediates Fc/FcR-dependent membrane transfer from B cells to effector cells via trogocytosis, resulting in a substantial reduction of multiple BCR modulators, including CD22, CD19, CD21, and CD79b, as well as key cell adhesion molecules, including CD44, CD62L, and β7 integrin, on the surface of B cells in peripheral blood mononuclear cells obtained from normal donors or SLE patients. Rituximab has clinical activity in lupus, but failed to achieve primary endpoints in a Phase III trial. This is the first study of trogocytosis mediated by bispecific antibodies targeting neighboring cell-surface proteins, CD22, CD20, and CD19, as demonstrated by flow cytometry and immunofluorescence microscopy. We show that, compared to epratuzumab, a bispecific hexavalent antibody comprising epratuzumab and veltuzumab (humanized anti-CD20 mAb) exhibits enhanced trogocytosis resulting in major reductions in B-cell surface levels of CD19, CD20, CD21, CD22, CD79b, CD44, CD62L and β7-integrin, and with considerably less immunocompromising B-cell depletion that would result with anti-CD20 mAbs such as veltuzumab or rituximab, given either alone or in combination with epratuzumab. A CD22/CD19 bispecific hexavalent antibody, which exhibited enhanced trogocytosis of some antigens and minimal B-cell depletion, may also be therapeutically useful

  14. Intraprocedural yttrium-90 positron emission tomography/CT for treatment optimization of yttrium-90 radioembolization.

    PubMed

    Bourgeois, Austin C; Chang, Ted T; Bradley, Yong C; Acuff, Shelley N; Pasciak, Alexander S

    2014-02-01

    Radioembolization with yttrium-90 ((90)Y) microspheres relies on delivery of appropriate treatment activity to ensure patient safety and optimize treatment efficacy. We report a case in which (90)Y positron emission tomography (PET)/computed tomography (CT) was performed to optimize treatment planning during a same-day, three-part treatment session. This treatment consisted of (i) an initial (90)Y infusion with a dosage determined using an empiric treatment planning model, (ii) quantitative (90)Y PET/CT imaging, and (iii) a secondary infusion with treatment planning based on quantitative imaging data with the goal of delivering a specific total tumor absorbed dose. © 2014 SIR Published by SIR All rights reserved.

  15. Y-90-DOTA-hLL2: An Agent for Radioimmunotherapy of Non-Hodgkin's Lymphoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Griffiths, Gary L.; Govindan, Serengulam V.; Sharkey, Robert M.

    2003-01-01

    The goal of this work was to determine an optimal radioimmunotherapy agent for non-Hodgkin's lymphoma. We established the stability profile of yttrium-90-labeled humanized LL2 (hLL2) monoclonal antibody prepared with different chelating agents, and from these data estimated the improvement using the most stable yttrium-90 chelate-hLL2 complex. Methods: The complementary-determining region- (cdr)-grafted (humanized) anti-CD22 mAb, hLL2 (epratuzumab), was conjugated to derivatives of DTPA and 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid (DOTA). The conjugates were labeled with Y-90 and tested against a 10,000-fold molar excess of free DTPA and against human serum. The conjugates were also labeled with Y-88 and compared for biodistribution in normal andmore » lymphoma xenograft-bearing athymic mice. In vivo data were analyzed for uptake of yttrium in bone and washed bone when either the DOTA or the Mx-DTPA chelates were used, and dosimetry calculations were made for each. Results: Y-90-DOTA -mAb were stable to either DTPA or serum challenge. DTPA complexes of hLL2 lost 3-4% of Y-90 (days 1-4) and 10-15% thereafter. In vivo, stability differences showed lower Y-90 uptake in bone using DOTA. Absorbed doses per 37 MBq (1 mCi) Y-90-mAb were 3555 and 5405 cGy for bone, and 2664 and 4524 cGy for washed-bone for 90Y-DOTA-hLL2 and 90Y-MxDTPA-hLL2, respectively, amounting to 52% and 69.8% increases in absorbed radiation doses for bone and washed-bone when switching from a DOTA to a Mx-DTPA chelate. Conclusion: Y-90-hLL2 prepared with the DOTA chelate represents a preferred agent for RAIT of non-Hodgkin's lymphoma, with an in vivo model demonstrating a large reduction in bone-deposited yttrium, as compared to yttrium-90-hLL2 agents prepared with open-chain DTPA-type chelating agents. Dosimetry suggests that this will result in a substantial toxicological advantage for a DOTA-based hLL2 conjugate.« less

  16. Effects of radiolysis on yttrium-90-labeled Lym-1 antibody preparations.

    PubMed

    Salako, Q A; O'Donnell, R T; DeNardo, S J

    1998-04-01

    The physical half-life of 2.6 days and 2.2 MeV beta emissions of 90Y provide excellent properties for radioimmunotherapy applications. However, the clinically useful beta particles may be a source of radiation-induced damage of 90Y-labeled immunoconjugate radiopharmaceuticals during preparation or short-term storage. The stability of 90Y-labeled Lym-1 antibody was studied in standard radiopharmacy conditions to establish a formulation at which radiolysis is not a problem. Lym-1-21T-BAD immunoconjugate intermediate was prepared according to our standard procedure, then labeled with 90Y at 1, 2, 4 and 9.4 mCi/mg Lym-1 using 0.5 M tetramethylammonium acetate, pH 7, labeling buffer. Each mixture was challenged in diethylenetriaminepentaacetic acid to remove nonspecifically bound 90Y. The 90Y-21T-BAD-Lym-1 products were purified by centrifuged molecular sieving column chromatography. The radiochemical purity and immunoreactivity of each preparation was monitored daily by high-performance liquid chromatography (HPLC) and solid-phase radioimmunoassay, respectively, for 3 days. The preparation at 2 mCi/mg was also formulated in 4% (wt/vol) human serum albumin (HSA) overall and at 9.4 mCi/mg in five-fold water, 4 and 10% (wt/vol) HSA overall; all were monitored as above. The monomeric quality and purity profile of products at 1 and 2 mCi/mg were retained (> or = 80%) as was their immunoreactivity (> or = 75%) over 3 days. The radiochemical purity and immunoreactivity of the product at 4 mCi/mg declined to 65% and 28%, respectively, by 3 days after preparation and in just 48 hr, the product at 9.4 mCi/mg had degraded to 21% in radiochemical purity with only 3% immunoreactivity. The current HPLC data and earlier published chromatographic evidence did not support a compromised radiochemical integrity of 90Y-DOTA complexes by loss of 90Y from the DOTA chelate. Radiolysis of 90Y-labeled antibody preparations did not appear to be a problem at 90Y-21T-BAD-Lym-1 products < or = 2 m

  17. Yttrium-90 -- current status, expected availability and applications of a high beta energy emitter.

    PubMed

    Montaña, R Leyva; González, I Hernández; Ramirez, A Alberti; Garaboldi, L; Chinol, M

    2012-07-01

    Yttrium-90 ((90)Y, T(1/2) 64.14 h) is a key example of a high beta energy-emitting radionuclide which is available from the strontium-90 ((90)Sr)/(90)Y radionuclide generator system. Clinical uses of (90)Y-labeled radiopharmaceutical agents have been pursued for many years and many applications have proven to be clinical effective. These most notably include the application of 90Y-labeled antibodies for a variety of applications such as for effective treatment of non-Hodgkin's lymphoma. One of the major advantages for use of (90)Y is ready availability from the very long-lived (90)Sr parent (T(1/2) 28.78 y). Because of the importance of maintaining generator performance and minimizing parent breakthrough, this paper describes development, use and quality control of both high capacity cation adsorption-type and electrochemical generator systems. In addition, the preparation and targeting to tumors in mice of DOTA-conjugated Nimotuzamab (h-R3) antibody which recognizes the external domain of the EPFR antibody radiolabeled with (90)Y obtained from the electrochemical generator is also described. As a key example for clinical applications of (90)Y, the use of (90)Y-labeled biotin for intra-operative pre-targeting for radionuclide therapy (IART®) of breast cancer is also described.

  18. Antigenic modulation limits the efficacy of anti-CD20 antibodies: implications for antibody selection.

    PubMed

    Beers, Stephen A; French, Ruth R; Chan, H T Claude; Lim, Sean H; Jarrett, Timothy C; Vidal, Regina Mora; Wijayaweera, Sahan S; Dixon, Sandra V; Kim, Hyungjin; Cox, Kerry L; Kerr, Jonathan P; Johnston, David A; Johnson, Peter W M; Verbeek, J Sjef; Glennie, Martin J; Cragg, Mark S

    2010-06-24

    Rituximab, a monoclonal antibody that targets CD20 on B cells, is now central to the treatment of a variety of malignant and autoimmune disorders. Despite this success, a substantial proportion of B-cell lymphomas are unresponsive or develop resistance, hence more potent anti-CD20 monoclonal antibodies (mAbs) are continuously being sought. Here we demonstrate that type II (tositumomab-like) anti-CD20 mAbs are 5 times more potent than type I (rituximab-like) reagents in depleting human CD20 Tg B cells, despite both operating exclusively via activatory Fcgamma receptor-expressing macrophages. Much of this disparity in performance is attributable to type I mAb-mediated internalization of CD20 by B cells, leading to reduced macrophage recruitment and the degradation of CD20/mAb complexes, shortening mAb half-life. Importantly, human B cells from healthy donors and most cases of chronic lymphatic leukemia and mantle cell lymphoma, showed rapid CD20 internalization that paralleled that seen in the Tg mouse B cells, whereas most follicular lymphoma and diffuse large B-cell lymphoma cells were far more resistant to CD20 loss. We postulate that differences in CD20 modulation may play a central role in determining the relative efficacy of rituximab in treating these diseases and strengthen the case for focusing on type II anti-CD20 mAb in the clinic.

  19. Tetravalent anti-CD20/CD3 bispecific antibody for the treatment of B cell lymphoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Chia-Yen; Chen, Gregory J.; Tai, Pei-Han

    Bispecific antibodies (bsAbs) are second generation antibodies for therapeutic application in immunotherapy. One of the major strategies of the bsAb platform is the recruitment of immune effector T cells by incorporating an anti-CD3 domain. A bispecific T-cell engager (BiTE), with one end having an affinity for CD3 and the other end with affinity for CD19, has been approved in the US and Europe for the treatment of acute lymphoblastic leukemia. However, due to their small size and lack of Fc region, these single-chain variable fragment (scFv) bsAbs have short half-lives in vivo. Additionally, poor solubility, structural instability, and low production yieldsmore » have also become major challenges in the bulk production process. To overcome these challenges, we have engineered a tetravalent bsAb with bivalent binding specificity for the CD20 and CD3 antigen in an immunoglobulin G (IgG) format. The fusion of the anti-CD3 scFvs to the CD20 antibody via a linker-hinge domain (LHD) results in improved antibody stabilization and properties. Here we demonstrate this antibody's highly efficient cancer cell elimination in a dose-dependent manner in a CD20-expressing B lymphoblastoid cell line in vitro. Our data suggest the potential clinical application of this bsAb for the treatment of CD20-expressing B cell malignancies. - Highlights: • A bispecific antibody (bsAb) can increase immunotherapeutic efficacy. • A tetravalent bsAb with binding specificity for the CD20 and CD3 antigens is proposed. • A linker-hinge domain (LHD) within the bsAb results in improved antibody properties.« less

  20. Determination of strontium-90 from direct separation of yttrium-90 by solid phase extraction using DGA Resin for seawater monitoring.

    PubMed

    Tazoe, Hirofumi; Obata, Hajime; Yamagata, Takeyasu; Karube, Zin'ichi; Nagai, Hisao; Yamada, Masatoshi

    2016-05-15

    It is important for public safety to monitor strontium-90 in aquatic environments in the vicinity of nuclear related facilities. Strontium-90 concentrations in seawater exceeding the background level have been observed in accidents of nuclear facilities. However, the analytical procedure for measuring strontium-90 in seawater is highly demanding. Here we show a simple and high throughput analytical technique for the determination of strontium-90 in seawater samples using a direct yttrium-90 separation. The DGA Resin is used to determine the abundance of strontium-90 by detecting yttrium-90 decay (beta-emission) in secular equilibrium. The DGA Resin can selectively collect yttrium-90 and remove naturally occurring radionuclides such as (40)K, (210)Pb, (214)Bi, (238)U, and (232)Th and anthropogenic radionuclides such as (140)Ba, and (140)La. Through a sample separation procedure, a high chemical yield of yttrium-90 was achieved at 95.5±2.3%. The result of IAEA-443 certified seawater analysis (107.7±3.4 mBq kg(-1)) was in good agreement with the certified value (110±5 mBq kg(-1)). By developed method, we can finish analyzing 8 samples per day after achieving secular equilibrium, which is a reasonably fast throughput in actual seawater monitoring. By processing 3 L of seawater sample and applying a counting time of 20 h, minimum detectable activity can be as low as 1.5 mBq kg(-1), which could be applied to monitoring for the contaminated marine environment. Reproducibility was found to be 3.4% according to 10 independent analyses of natural seawater samples from the vicinity of the Fukushima Daiichi Nuclear Power Plant in September 2013. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Photoluminescence of patterned CdSe quantum dot for anti-counterfeiting label on paper

    NASA Astrophysics Data System (ADS)

    Isnaeni, Yulianto, Nursidik; Suliyanti, Maria Margaretha

    2016-03-01

    We successfully developed a method utilizing colloidal CdSe nanocrystalline quantum dot for anti-counterfeiting label on a piece of glossy paper. We deposited numbers and lines patterns of toluene soluble CdSe quantum dot using rubber stamper on a glossy paper. The width of line pattern was about 1-2 mm with 1-2 mm separation between lines. It required less than one minute for deposited CdSe quantum dot on glossy paper to dry and become invisible by naked eyes. However, patterned quantum dot become visible using long-pass filter glasses upon excitation of UV lamp or blue laser. We characterized photoluminescence of line patterns of quantum dot, and we found that emission boundaries of line patterns were clearly observed. The error of line size and shape were mainly due to defect of the original stamper. The emission peak wavelength of CdSe quantum dot was 629 nm. The emission spectrum of deposited quantum dot has full width at half maximum (FWHM) of 30-40 nm. The spectra similarity between deposited quantum dot and the original quantum dot in solution proved that our stamping method can be simply applied on glossy paper without changing basic optical property of the quantum dot. Further development of this technique is potential for anti-counterfeiting label on very important documents or objects.

  2. Photoluminescence of patterned CdSe quantum dot for anti-counterfeiting label on paper

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isnaeni,, E-mail: isnaeni@lipi.go.id; Yulianto, Nursidik; Suliyanti, Maria Margaretha

    We successfully developed a method utilizing colloidal CdSe nanocrystalline quantum dot for anti-counterfeiting label on a piece of glossy paper. We deposited numbers and lines patterns of toluene soluble CdSe quantum dot using rubber stamper on a glossy paper. The width of line pattern was about 1-2 mm with 1-2 mm separation between lines. It required less than one minute for deposited CdSe quantum dot on glossy paper to dry and become invisible by naked eyes. However, patterned quantum dot become visible using long-pass filter glasses upon excitation of UV lamp or blue laser. We characterized photoluminescence of line patterns of quantummore » dot, and we found that emission boundaries of line patterns were clearly observed. The error of line size and shape were mainly due to defect of the original stamper. The emission peak wavelength of CdSe quantum dot was 629 nm. The emission spectrum of deposited quantum dot has full width at half maximum (FWHM) of 30-40 nm. The spectra similarity between deposited quantum dot and the original quantum dot in solution proved that our stamping method can be simply applied on glossy paper without changing basic optical property of the quantum dot. Further development of this technique is potential for anti-counterfeiting label on very important documents or objects.« less

  3. Biodistributions, Myelosuppression, and Toxicities in Mice Treated with an Anti-CD45 Antibody Labeled with the alpha-Emitting Radionuclides Bismuth-213 or Astatine-211

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamae, Hirohisa; Wilbur, D. Scott; Hamlin, Donald K.

    2009-03-15

    We previously investigated 213Bi-labeled anti-CD45 antibody to replace total body irradiation as conditioning for hematopoietic cell transplantation in a canine model. While this allowed sustained engraftment of marrow, limited availability and high cost of 213Bi led to a preliminary investigation in mice of 211At-labeled antibody for the same application. To gain an understanding of the differences between the two radionuclides, biodistribution and myelosuppression/toxicity studies were conducted with 213Bi- and 211At-labeled rat anti-murine CD45 antibody, 30F11, conjugates. After injecting mice with 2-50 μCi on 10 μg 30F11 conjugate or 20 μCi on 2 or 40 μg conjugate, biodistributions, myelosuppression and non-hematologicalmore » toxicities were evaluated. Biodistribution studies showed that the spleen had the highest concentration of radioactivity, ranging from167-417 % injected dose/gram (%ID/g) at 24 h after injection in the 211At studies and 45-166 %ID/g at 3 h after injection in the 213Bi studies. The higher concentrations observed for 211At-labeled 30F11 was likely due to its longer half-life which, permitted more localization of antibody to the spleen before decay. 211At was more effective at myelosuppression for the same (mCi) quantity of injected radioactivity. Injection of only 20 or 50 μCi 211At resulted in lethal myeloablation. There was severe reversible acute hepatic toxicity with 50 μCi 213Bi, but not with lower doses or any dose of 211At. No significant renal toxicity occurred with either radionuclide. The data suggested that considerably lower quantities of 211At-labeled anti-CD45 antibody than 213Bi-labeled antibody might be effective for myelosuppression.« less

  4. Immune activation underlies a sustained clinical response to Yttrium-90 radioembolisation in hepatocellular carcinoma.

    PubMed

    Chew, Valerie; Lee, Yun Hua; Pan, Lu; Nasir, Nurul J M; Lim, Chun Jye; Chua, Camillus; Lai, Liyun; Hazirah, Sharifah Nur; Lim, Tony Kiat Hon; Goh, Brian K P; Chung, Alexander; Lo, Richard H G; Ng, David; Filarca, Rene L F; Albani, Salvatore; Chow, Pierce K H

    2018-02-13

    Yttrium-90 (Y90)-radioembolisation (RE) significantly regresses locally advanced hepatocellular carcinoma and delays disease progression. The current study is designed to deeply interrogate the immunological impact of Y90-RE, which elicits a sustained therapeutic response. Time-of-flight mass cytometry and next-generation sequencing (NGS) were used to analyse the immune landscapes of tumour-infiltrating leucocytes (TILs), tumour tissues and peripheral blood mononuclear cells (PBMCs) at different time points before and after Y90-RE. TILs isolated after Y90-RE exhibited signs of local immune activation: higher expression of granzyme B (GB) and infiltration of CD8 + T cells, CD56 + NK cells and CD8 + CD56 + NKT cells. NGS confirmed the upregulation of genes involved in innate and adaptive immune activation in Y90-RE-treated tumours. Chemotactic pathways involving CCL5 and CXCL16 correlated with the recruitment of activated GB + CD8 + T cells to the Y90-RE-treated tumours. When comparing PBMCs before and after Y90-RE, we observed an increase in tumour necrosis factor-α on both the CD8 + and CD4 + T cells as well as an increase in percentage of antigen-presenting cells after Y90-RE, implying a systemic immune activation. Interestingly, a high percentage of PD-1 + /Tim-3 + CD8 + T cells coexpressing the homing receptors CCR5 and CXCR6 denoted Y90-RE responders. A prediction model was also built to identify sustained responders to Y90-RE based on the immune profiles from pretreatment PBMCs. High-dimensional analysis of tumour and systemic immune landscapes identified local and systemic immune activation that corresponded to the sustained response to Y90-RE. Potential biomarkers associated with a positive clinical response were identified and a prediction model was built to identify sustained responders prior to treatment. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is

  5. Evaluation of dry blood spot technique for quantification of an Anti-CD20 monoclonal antibody drug in human blood samples.

    PubMed

    Lin, Yong-Qing; Zhang, Yilu; Li, Connie; Li, Louis; Zhang, Kelley; Li, Shawn

    2012-01-01

    To evaluate the dried blood spot (DBS) technique in ELISA quantification of larger biomolecular drugs, an anti-CD20 monoclonal antibody drug was used as an example. A method for the quantification of the anti-CD20 drug in human DBS was developed and validated. The drug standard and quality control samples prepared in fresh human blood were spotted on DBS cards and then extracted. A luminescent ELISA was used for quantification of the drug from DBS samples. The assay range of the anti-CD20 drug standards in DBS was 100-2500ng/mL. The intra-assay precision (%CV) ranged from 0.4% to 10.1%, and the accuracy (%Recovery) ranged from 77.9% to 113.9%. The inter assay precision (%CV) ranged from 5.9% to 17.4%, and the accuracy ranged from 81.5% to 110.5%. The DBS samples diluted 500 and 50-fold yielded recovery of 88.7% and 90.7%, respectively. The preparation of DBS in higher and lower hematocrit (53% and 35%) conditions did not affect the recovery of the drug. Furthermore, the storage stability of the anti-CD20 drug on DBS cards was tested at various conditions. It was found that the anti-CD20 drug was stable for one week in DBS stored at room temperature. However, it was determined that the stability was compro]mised in DBS stored at high humidity, high temperature (55°C), and exposed to direct daylight for a week, as well as for samples stored at room temperature and high humidity conditions for a month. Stability did not change significantly in samples that underwent 3 freeze/thaw cycles. Our results demonstrated a successful use of DBS technique in ELISA quantification of an anti-CD20 monoclonal antibody drug in human blood. The stability data provides information regarding sample storage and shipping for future clinical studies. It is, therefore, concluded that the DBS technique is applicable in the quantification of other large biomolecule drugs or biomarkers. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Interactions between ibrutinib and anti-CD20 antibodies; competing effects on the outcome of combination therapy

    PubMed Central

    Skarzynski, Martin; Niemann, Carsten U; Lee, Yuh Shan; Martyr, Sabrina; Maric, Irina; Salem, Dalia; Stetler-Stevenson, Maryalice; Marti, Gerald E; Calvo, Katherine R; Yuan, Constance; Valdez, Janet; Soto, Susan; Farooqui, Mohammed Z.H.; Herman, Sarah E.M.; Wiestner, Adrian

    2015-01-01

    Purpose Clinical trials of ibrutinib combined with anti-CD20 monoclonal antibodies (mAbs) for chronic lymphocytic leukemia (CLL) report encouraging results. Paradoxically, in pre-clinical studies in vitro ibrutinib was reported to decrease CD20 expression and inhibits cellular effector mechanisms. We therefore set out to investigate effects of in vivo ibrutinib treatment that could explain this paradox. Experimental Design Patients received single agent ibrutinib (420mg daily) on an investigator-initiated phase 2 trial. Serial blood samples were collected pre-treatment and during treatment for ex vivo functional assays to examine the effects on CLL cell susceptibility to anti-CD20 mAbs. Results We demonstrate that CD20 expression on ibrutinib was rapidly and persistently down-regulated (median reduction 74%, day 28, P<0.001) compared to baseline. Concomitantly, CD20 mRNA was decreased concurrent with reduced NF-κB signaling. An NF-κB binding site in the promoter of MS4A1 (encoding CD20) and down-regulation of CD20 by NF-κB inhibitors support a direct transcriptional effect. Ex vivo, tumor cells from patients on ibrutinib were less susceptible to anti-CD20 mAb-mediated complement-dependent cytotoxicity than pre-treatment cells (median reduction 75%, P<0.001); however, opsonization by the complement protein C3d, which targets cells for phagocytosis, was relatively maintained. Expression of decay accelerating factor (CD55) decreased on ibrutinib, providing a likely mechanism for the preserved C3d opsonization. Additionally, ibrutinib significantly inhibited trogocytosis, a major contributor to antigen loss and tumor escape during mAb therapy. Conclusions Our data indicate that ibrutinib promotes both positive and negative interactions with anti-CD20 mAbs, suggesting that successfully harnessing maximal anti-tumor effects of such combinations requires further investigation. PMID:26283682

  7. Availability of yttrium-90 from strontium-90: a nuclear medicine perspective.

    PubMed

    Chakravarty, Rubel; Dash, Ashutosh; Pillai, M R A

    2012-12-01

    Yttrium-90 (T(½) 64.1 hours, E(βmax)=2.28 MeV) is a pure β⁻ particle emitting radionuclide with well-established applications in targeted therapy. There are several advantages of ⁹⁰Y as a therapeutic radionuclide. It has a suitable physical half-life (∼64 hours) and decays to a stable daughter product ⁹⁰Zr by emission of high-energy β⁻ particles. Yttrium has a relatively simple chemistry and its suitability for forming complexes with a variety of chelating agents is well established. The ⁹⁰Sr/⁹⁰Y generator is an ideal source for the long-term continuous availability of no-carrier-added ⁹⁰Y suitable for the preparation of radiopharmaceuticals for radionuclide therapy. The parent radionuclide ⁹⁰Sr, which is a long-lived fission product, is available in large quantities from spent fuel. Several useful technologies have been developed for the preparation of ⁹⁰Sr/⁹⁰Y generators. There are several well-established radiopharmaceuticals based on monoclonal antibodies, peptides, and particulates labeled with ⁹⁰Y, that are in regular use for the treatment of some forms of primary cancers and arthritis. At present, there are no generators for the elution of ⁹⁰Y that can be set up in a hospital radiopharmacy. The radionuclide is procured from manufacturers and the radiopharmaceuticals are formulated on site. This article reviews the development of ⁹⁰Sr/⁹⁰Y generator and the development of ⁹⁰Y radiopharmaceuticals.

  8. SPIO-labeled Yttrium Microspheres for MR Imaging Quantification of Transcatheter Intrahepatic Delivery in a Rodent Model

    PubMed Central

    Li, Weiguo; Zhang, Zhuoli; Gordon, Andrew C.; Chen, Jeane; Nicolai, Jodi; Lewandowski, Robert J.; Omary, Reed A.

    2016-01-01

    Purpose To investigate the qualitative and quantitative impacts of labeling yttrium microspheres with increasing amounts of superparamagnetic iron oxide (SPIO) material for magnetic resonance (MR) imaging in phantom and rodent models. Materials and Methods Animal model studies were approved by the institutional Animal Care and Use Committee. The r2* relaxivity for each of four microsphere SPIO compositions was determined from 32 phantoms constructed with agarose gel and in eight concentrations from each of the four compositions. Intrahepatic transcatheter infusion procedures were performed in rats by using each of the four compositions before MR imaging to visualize distributions within the liver. For quantitative studies, doses of 5, 10, 15, or 20 mg 2% SPIO-labeled yttrium microspheres were infused into 24 rats (six rats per group). MR imaging R2* measurements were used to quantify the dose delivered to each liver. Pearson correlation, analysis of variance, and intraclass correlation analyses were performed to compare MR imaging measurements in phantoms and animal models. Results Increased r2* relaxivity was observed with incremental increases of SPIO microsphere content. R2* measurements of the 2% SPIO–labeled yttrium microsphere concentration were well correlated with known phantom concentrations (R2 = 1.00, P < .001) over a broader linear range than observed for the other three compositions. Microspheres were heterogeneously distributed within each liver; increasing microsphere SPIO content produced marked signal voids. R2*-based measurements of 2% SPIO–labeled yttrium microsphere delivery were well correlated with infused dose (intraclass correlation coefficient, 0.98; P < .001). Conclusion MR imaging R2* measurements of yttrium microspheres labeled with 2% SPIO can quantitatively depict in vivo intrahepatic biodistribution in a rat model. © RSNA, 2015 Online supplemental material is available for this article. PMID:26313619

  9. Interactions between Ibrutinib and Anti-CD20 Antibodies: Competing Effects on the Outcome of Combination Therapy.

    PubMed

    Skarzynski, Martin; Niemann, Carsten U; Lee, Yuh Shan; Martyr, Sabrina; Maric, Irina; Salem, Dalia; Stetler-Stevenson, Maryalice; Marti, Gerald E; Calvo, Katherine R; Yuan, Constance; Valdez, Janet; Soto, Susan; Farooqui, Mohammed Z H; Herman, Sarah E M; Wiestner, Adrian

    2016-01-01

    Clinical trials of ibrutinib combined with anti-CD20 monoclonal antibodies (mAb) for chronic lymphocytic leukemia (CLL) report encouraging results. Paradoxically, in preclinical studies, in vitro ibrutinib was reported to decrease CD20 expression and inhibit cellular effector mechanisms. We therefore set out to investigate effects of in vivo ibrutinib treatment that could explain this paradox. Patients received single-agent ibrutinib (420 mg daily) on an investigator-initiated phase II trial. Serial blood samples were collected pretreatment and during treatment for ex vivo functional assays to examine the effects on CLL cell susceptibility to anti-CD20 mAbs. We demonstrate that CD20 expression on ibrutinib was rapidly and persistently downregulated (median reduction 74%, day 28, P < 0.001) compared with baseline. Concomitantly, CD20 mRNA was decreased concurrent with reduced NF-κB signaling. An NF-κB binding site in the promoter of MS4A1 (encoding CD20) and downregulation of CD20 by NF-κB inhibitors support a direct transcriptional effect. Ex vivo, tumor cells from patients on ibrutinib were less susceptible to anti-CD20 mAb-mediated complement-dependent cytotoxicity than pretreatment cells (median reduction 75%, P < 0.001); however, opsonization by the complement protein C3d, which targets cells for phagocytosis, was relatively maintained. Expression of decay-accelerating factor (CD55) decreased on ibrutinib, providing a likely mechanism for the preserved C3d opsonization. In addition, ibrutinib significantly inhibited trogocytosis, a major contributor to antigen loss and tumor escape during mAb therapy. Our data indicate that ibrutinib promotes both positive and negative interactions with anti-CD20 mAbs, suggesting that successfully harnessing maximal antitumor effects of such combinations requires further investigation. ©2015 American Association for Cancer Research.

  10. Inflammation Causes Resistance to Anti-CD20-Mediated B Cell Depletion.

    PubMed

    Laws, L H; Parker, C E; Cherala, G; Koguchi, Y; Waisman, A; Slifka, M K; Oberbarnscheidt, M H; Obhrai, J S; Yeung, M Y; Riella, L V

    2016-11-01

    B cells play a central role in antibody-mediated rejection and certain autoimmune diseases. However, B cell-targeted therapy such as anti-CD20 B cell-depleting antibody (aCD20) has yielded mixed results in improving outcomes. In this study, we investigated whether an accelerated B cell reconstitution leading to aCD20 depletion resistance could account for these discrepancies. Using a transplantation model, we found that antigen-independent inflammation, likely through toll-like receptor (TLR) signaling, was sufficient to mitigate B cell depletion. Secondary lymphoid organs had a quicker recovery of B cells when compared to peripheral blood. Inflammation altered the pharmacokinetics (PK) and pharmacodynamics (PD) of aCD20 therapy by shortening drug half-life and accelerating the reconstitution of the peripheral B cell pool by bone marrow-derived B cell precursors. IVIG (intravenous immunoglobulin) coadministration also shortened aCD20 drug half-life and led to accelerated B cell recovery. Repeated aCD20 dosing restored B cell depletion and delayed allograft rejection, especially B cell-dependent, antibody-independent allograft rejection. These data demonstrate the importance of further clinical studies of the PK/PD of monoclonal antibody treatment in inflammatory conditions. The data also highlight the disconnect between B cell depletion on peripheral blood compared to secondary lymphoid organs, the deleterious effect of IVIG when given with aCD20 and the relevance of redosing of aCD20 for effective B cell depletion in alloimmunity. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  11. Hanford isotope project strategic business analysis yttrium-90 (Y-90)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-10-01

    The purpose of this analysis is to address the short-term direction for the Hanford yttrium-90 (Y-90) project. Hanford is the sole DOE producer of Y-90, and is the largest repository for its source in this country. The production of Y-90 is part of the DOE Isotope Production and Distribution (IP and D) mission. The Y-90 is ``milked`` from strontium-90 (Sr-90), a byproduct of the previous Hanford missions. The use of Sr-90 to produce Y-90 could help reduce the amount of waste material processed and the related costs incurred by the clean-up mission, while providing medical and economic benefits. The costmore » of producing Y-90 is being subsidized by DOE-IP and D due to its use for research, and resultant low production level. It is possible that the sales of Y-90 could produce full cost recovery within two to three years, at two curies per week. Preliminary projections place the demand at between 20,000 and 50,000 curies per year within the next ten years, assuming FDA approval of one or more of the current therapies now in clinical trials. This level of production would incentivize private firms to commercialize the operation, and allow the government to recover some of its sunk costs. There are a number of potential barriers to the success of the Y-90 project, outside the control of the Hanford Site. The key issues include: efficacy, Food and Drug Administration (FDA) approval and medical community acceptance. There are at least three other sources for Y-90 available to the US users, but they appear to have limited resources to produce the isotope. Several companies have communicated interest in entering into agreements with Hanford for the processing and distribution of Y-90, including some of the major pharmaceutical firms in this country.« less

  12. Quantitative and Qualitative Assessment of Yttrium-90 PET/CT Imaging

    PubMed Central

    Büsing, Karen-Anett; Schönberg, Stefan O.; Bailey, Dale L.; Willowson, Kathy; Glatting, Gerhard

    2014-01-01

    Yttrium-90 is known to have a low positron emission decay of 32 ppm that may allow for personalized dosimetry of liver cancer therapy with 90Y labeled microspheres. The aim of this work was to image and quantify 90Y so that accurate predictions of the absorbed dose can be made. The measurements were performed within the QUEST study (University of Sydney, and Sirtex Medical, Australia). A NEMA IEC body phantom containing 6 fillable spheres (10–37 mm ∅) was used to measure the 90Y distribution with a Biograph mCT PET/CT (Siemens, Erlangen, Germany) with time-of-flight (TOF) acquisition. A sphere to background ratio of 8∶1, with a total 90Y activity of 3 GBq was used. Measurements were performed for one week (0, 3, 5 and 7 d). he acquisition protocol consisted of 30 min-2 bed positions and 120 min-single bed position. mages were reconstructed with 3D ordered subset expectation maximization (OSEM) and point spread function (PSF) for iteration numbers of 1–12 with 21 (TOF) and 24 (non-TOF) subsets and CT based attenuation and scatter correction. Convergence of algorithms and activity recovery was assessed based on regions-of-interest (ROI) analysis of the background (100 voxels), spheres (4 voxels) and the central low density insert (25 voxels). For the largest sphere, the recovery coefficient (RC) values for the 30 min –2-bed position, 30 min-single bed and 120 min-single bed were 1.12±0.20, 1.14±0.13, 0.97±0.07 respectively. For the smaller diameter spheres, the PSF algorithm with TOF and single bed acquisition provided a comparatively better activity recovery. Quantification of Y-90 using Biograph mCT PET/CT is possible with a reasonable accuracy, the limitations being the size of the lesion and the activity concentration present. At this stage, based on our study, it seems advantageous to use different protocols depending on the size of the lesion. PMID:25369020

  13. Ibrutinib interferes with the cell-mediated anti-tumor activities of therapeutic CD20 antibodies: implications for combination therapy

    PubMed Central

    Roit, Fabio Da; Engelberts, Patrick J.; Taylor, Ronald P.; Breij, Esther C.W.; Gritti, Giuseppe; Rambaldi, Alessandro; Introna, Martino; Parren, Paul W.H.I.; Beurskens, Frank J.; Golay, Josée

    2015-01-01

    The novel Bruton tyrosine kinase inhibitor ibrutinib and phosphatidyl-4-5-biphosphate 3-kinase-δ inhibitor idelalisib are promising drugs for the treatment of chronic lymphocytic leukemia and B-cell non-Hodgkin lymphoma, either alone or in combination with anti-CD20 antibodies. We investigated the possible positive or negative impact of these drugs on all known mechanisms of action of both type I and type II anti-CD20 antibodies. Pretreatment with ibrutinib for 1 hour did not increase direct cell death of cell lines or chronic lymphocytic leukemia samples mediated by anti-CD20 antibodies. Pre-treatment with ibrutinib did not inhibit complement activation or complement-mediated lysis. In contrast, ibrutinib strongly inhibited all cell-mediated mechanisms induced by anti-CD20 antibodies rituximab, ofatumumab or obinutuzumab, either in purified systems or whole blood assays. Activation of natural killer cells, and antibody-dependent cellular cytotoxicity by these cells, as well as phagocytosis by macrophages or neutrophils were inhibited by ibrutinib with a half maximal effective concentration of 0.3–3 μM. Analysis of anti-CD20 mediated activation of natural killer cells isolated from patients on continued oral ibrutinib treatment suggested that repeated drug dosing inhibits these cells in vivo. Finally we show that the phosphatidyl-4-5-biphosphate 3-kinase-δ inhibitor idelalisib similarly inhibited the immune cell-mediated mechanisms induced by anti-CD20 antibodies, although the effects of this drug at 10 μM were weaker than those observed with ibrutinib at the same concentration. We conclude that the design of combined treatment schedules of anti-CD20 antibodies with these kinase inhibitors should consider the multiple negative interactions between these two classes of drugs. PMID:25344523

  14. Bismuth 213-labeled anti-CD45 radioimmunoconjugate to condition dogs for nonmyeloablative allogeneic marrow grafts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sandmaier, B M.; Bethge, W A.; Wilbur, D. Scott

    To lower treatment-related mortality and toxicity of conventional marrow transplantation, a nonmyeloablative regimen using 200 cGy total-body irradiation (TBI) and mycophenolate mofetil (MMF) combined with cyclosporine (CSP) for postgrafting immunosuppression was developed. To circumvent possible toxic effects of external- beam gamma irradiation, strategies for targeted radiation therapy were investigated. We tested whether the short-lived (46 minutes) alpha-emitter Bi-213 conjugated to an anti-CD45 monoclonal antibody (mAb) could replace 200 cGy TBI and selectively target hematopoietic tissues in a canine model of nonmyeloablative DLA-identical marrow transplantation. Biodistribution studies using iodine 123-labeled anti-CD45 mAb showed uptake in blood, marrow, lymph nodes, spleen, andmore » liver. In a dose-escalation study, 7 dogs treated with the Bi-213-anti-CD45 conjugate (Bi-213 dose, 0.1-5.9 mCi/kg[3.7-218 MBq/kg]) without marrow grafts had no toxic effects other than a mild, reversible suppression of blood counts. On the basis of these studies, 3 dogs were treated with 0.5 mg/kg Bi-213-labeled anti-CD45 mAb (Bi-213 doses, 3.6, 4.6, and 8.8 mCi/kg[133, 170, and 326 MBq/kg]) given in 6 injections 3 and 2 days before grafting of marrow from DLA-identical littermates. The dogs also received MMF (10 mg/kg subcutaneously twice daily the day of transplantation until day 27 afterward) and CSP (15 mg/kg orally twice daily the day before transplantation until 35 days afterward). Therapy was well tolerated except for transient elevations in levels of transaminases in 3 dogs, followed by, in one dog, ascites. All dogs achieved prompt engraftment and stable mixed hematopoietic chimerism, with donor contributions ranging from 30% to 70% after more than 27 weeks of follow-up. These results form the basis for additional studies in animals and the design of clinical trials using Bi-213 as a nonmyeloablative conditioning regimen with minimal toxicity.« less

  15. Radioimmunotherapy of pancreatic cancer xenografts in nude mice using 90Y-labeled anti-α6β4 integrin antibody

    PubMed Central

    Aung, Winn; Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Ukai, Yoshinori; Kouda, Katsushi; Kurosawa, Yoshikazu; Furukawa, Takako; Saga, Tsuneo

    2016-01-01

    The contribution of integrin α6β4 (α6β4) overexpression to the pancreatic cancer invasion and metastasis has been previously shown. We have reported immunotargeting of α6β4 for radionuclide-based and near-infrared fluorescence imaging in a pancreatic cancer model. In this study, we prepared yttrium-90 labeled anti-α6β4 antibody (90Y-ITGA6B4) and evaluated its radioimmunotherapeutic efficacy against pancreatic cancer xenografts in nude mice. Mice bearing xenograft tumors were randomly divided into 5 groups: (1) single administration of 90Y-ITGA6B4 (3.7MBq), (2) double administrations of 90Y-ITGA6B4 with once-weekly schedule (3.7MBq × 2), (3) single administration of unlabeled ITGA6B4, (4) double administrations of unlabeled ITGA6B4 with once-weekly schedule and (5) the untreated control. Biweekly tumor volume measurements and immunohistochemical analyses of tumors at 2 days post-administration were performed to monitor the response to treatments. To assess the toxicity, body weight was measured biweekly. Additionally, at 27 days post-administration, blood samples were collected through cardiac puncture, and hematological parameters, hepatic and renal functions were analyzed. Both 90Y-ITGA6B4 treatment groups showed reduction in tumor volumes (P < 0.04), decreased cell proliferation marker Ki-67-positive cells and increased DNA damage marker p-H2AX-positive cells, compared with the other groups. Mice treated with double administrations of 90Y-ITGA6B4, exhibited myelosuppression. There were no significant differences in hepatic and renal functions between the 2 treatment groups and the other groups. Our results suggest that 90Y-ITGA6B4 is a promising radioimmunotherapeutic agent against α6β4 overexpressing tumors. In the future studies, dose adjustment for fractionated RIT should be considered carefully in order to get the optimal effect while avoiding myelotoxicity. PMID:27246980

  16. Abscopal Effects and Yttrium-90 Radioembolization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghodadra, Anish; Bhatt, Sumantha; Camacho, Juan C.

    2016-07-15

    We present the case of an 80-year-old male with squamous cell carcinoma with bilobar hepatic metastases who underwent targeted Yttrium-90 radioembolization of the right hepatic lobe lesion. Subsequently, there was complete regression of the nontargeted, left hepatic lobe lesion. This may represent the first ever reported abscopal effect in radioembolization. The abscopal effect refers to the phenomenon of tumor response in nontargeted sites after targeted radiotherapy. In this article, we briefly review the immune-mediated mechanisms responsible for the abscopal effect.

  17. Yttrium-90 microspheres for the treatment of hepatocellular carcinoma: A review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Salem, Riad; Hunter, Russell D.

    2006-10-01

    To present a critical review of yttrium-90 (TheraSphere) for the treatment of hepatocellular carcinoma (HCC). Medical literature databases (Medline, Cochrane Library, and CANCERLIT) were searched for available literature concerning the treatment of HCC with TheraSphere. These publications were reviewed for scientific and clinical validity. Studies pertaining to the use of yttrium-90 for HCC date back to the 1960s. The results from the early animal safety studies established a radiation exposure range of 50-100 Gy to be used in human studies. Phase I dose escalation studies followed, which were instrumental in delineating radiation dosimetry and safety parameters in humans. These earlymore » studies emphasized the importance of differential arteriolar density between hypervascular HCC and surrounding liver parenchyma. Current trends in research have focused on advancing techniques to safely implement this technology as an alternative to traditional methods of treating unresectable HCC, such as external beam radiotherapy, conformal beam radiotherapy, ethanol ablation, trans-arterial chemoembolization, and radiofrequency ablation. Yttrium-90 (TheraSphere) is an outpatient treatment option for HCC. Current and future research should focus on implementing multicenter phase II and III trials comparing TheraSphere with other therapies for HCC.« less

  18. Durable donor engraftment after radioimmunotherapy using α-emitter astatine-211–labeled anti-CD45 antibody for conditioning in allogeneic hematopoietic cell transplantation

    PubMed Central

    Chen, Yun; Kornblit, Brian; Hamlin, Donald K.; Sale, George E.; Santos, Erlinda B.; Wilbur, D. Scott; Storer, Barry E.; Storb, Rainer

    2012-01-01

    To reduce toxicity associated with external γ-beam radiation, we investigated radioimmunotherapy with an anti-CD45 mAb labeled with the α-emitter, astatine-211 (211At), as a conditioning regimen in dog leukocyte antigen-identical hematopoietic cell transplantation (HCT). Dose-finding studies in 6 dogs treated with 100 to 618 μCi/kg 211At-labeled anti-CD45 mAb (0.5 mg/kg) without HCT rescue demonstrated dose-dependent myelosuppression with subsequent autologous recovery, and transient liver toxicity in dogs treated with 211At doses less than or equal to 405 μCi/kg. Higher doses of 211At induced clinical liver failure. Subsequently, 8 dogs were conditioned with 155 to 625 μCi/kg 211At-labeled anti-CD45 mAb (0.5 mg/kg) before HCT with dog leukocyte antigen-identical bone marrow followed by a short course of cyclosporine and mycophenolate mofetil immunosuppression. Neutropenia (1-146 cells/μL), lymphopenia (0-270 cells/μL), and thrombocytopenia (1500-6560 platelets/μL) with prompt recovery was observed. Seven dogs had long-term donor mononuclear cell chimerism (19%-58%), whereas 1 dog treated with the lowest 211At dose (155 μCi/kg) had low donor mononuclear cell chimerism (5%). At the end of follow-up (18-53 weeks), only transient liver toxicity and no renal toxicity had been observed. In conclusion, conditioning with 211At-labeled anti-CD45 mAb is safe and efficacious and provides a platform for future clinical trials of nonmyeloablative transplantation with radioimmunotherapy-based conditioning. PMID:22134165

  19. Safety and immunogenicity of inactivated varicella-zoster virus vaccine in adults with hematologic malignancies receiving treatment with anti-CD20 monoclonal antibodies.

    PubMed

    Parrino, Janie; McNeil, Shelly A; Lawrence, Steven J; Kimby, Eva; Pagnoni, Marco F; Stek, Jon E; Zhao, Yanli; Chan, Ivan S F; Kaplan, Susan S

    2017-03-27

    Immunocompromised patients can experience significant morbidity and occasional mortality from complications associated with herpes zoster (HZ), but live attenuated HZ vaccine is contraindicated for these patients. Inactivated zoster vaccine (ZV IN ) is in development for prevention of HZ in immunocompromised patients. However, there are limited data in the literature regarding the effect of anti-CD20 monoclonal antibodies on vaccine-related cell-mediated immune response. This study evaluated safety and immunogenicity of ZV IN in patients with hematologic malignancies (HM) receiving anti-CD20 monoclonal antibodies (alone or in combination chemotherapy regimens) and not likely to undergo hematopoietic cell transplant (HCT) (n=80). This was an open-label, single-arm, multicenter Phase I study (NCT01460719) of a 4-dose ZV IN regimen (∼30days between doses) in patients ⩾18years old. Blood samples were collected prior to dose 1 and 28days Postdose 4 to measure varicella zoster virus (VZV)-specific T-cell responses using interferon-γ enzyme-linked immunospot (IFN-γ ELISPOT). The primary hypothesis was that ZV IN would elicit significant VZV-specific immune responses at ∼28days Postdose 4, with a geometric fold rise (GMFR) >1.0. All vaccinated patients were evaluated for adverse events (AE) through 28days Postdose 4. ZV IN elicited a statistically significant VZV-specific immune response measured by IFN-γ ELISPOT at 28days Postdose 4 (GMFR=4.34 [90% CI:3.01, 6.24], p-value<0.001), meeting the pre-specified success criterion. Overall, 85% (68/80) of patients reported ⩾1 AE, 44% (35/80) reported ⩾1 injection-site AE, and 74% (59/80) reported ⩾1 systemic AE. The majority of systemic AEs were non-serious and considered unrelated to vaccination by the investigator. Frequencies of AEs did not increase with subsequent doses of vaccine. No recipient of ZV IN had rash polymerase chain reaction (PCR) positive for VZV vaccine strain. In adults with HM receiving anti-CD

  20. Treatment of unresectable intrahepatic cholangiocarcinoma with yttrium-90 radioembolization: a systematic review and pooled analysis.

    PubMed

    Al-Adra, D P; Gill, R S; Axford, S J; Shi, X; Kneteman, N; Liau, S-S

    2015-01-01

    Radioembolization with yttrium-90 microspheres offers an alternative treatment option for patients with unresectable intrahepatic cholangiocarcinoma (ICC). However, the rarity and heterogeneity of ICC makes it difficult to draw firm conclusions about treatment efficacy. Therefore, the goal of the current study is to systematically review the existing literature surrounding treatment of unresectable ICCs with yttrium-90 microspheres and provide a comprehensive review of the current experience and clinical outcome of this treatment modality. We performed a comprehensive search of electronic databases for ICC treatment and identified 12 studies with relevant data regarding radioembolization therapy with yttrium-90 microspheres. Based on pooled analysis, the overall weighted median survival was 15.5 months. Tumour response based on radiological studies demonstrated a partial response in 28% and stable disease in 54% of patients at three months. Seven patients were able to be downstaged to surgical resection. The complication profile of radioembolization is similar to that of other intra-arterial treatment modalities. Overall survival of patients with ICC after treatment with yttrium-90 microspheres is higher than historical survival rates and shows similar survival to those patients treated with systemic chemotherapy and/or trans-arterial chemoembolization therapy. Therefore, the use of yttrium-90 microspheres should be considered in the list of available treatment options for ICC. However, future randomized trials comparing systemic chemotherapy, TACE and local radiation will be required to identify the optimal treatment modality for unresectable ICC. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  1. Radiosynovectomy in haemophilic synovitis of elbows and ankles: Is the effectiveness of yttrium-90 and rhenium-186 different?

    PubMed

    Rodriguez-Merchan, E C; De La Corte-Rodriguez, H

    2016-04-01

    Radiosynovectomy (RS) reduces the number of haemarthroses and the synovial size in chronic haemophilic synovitis. The purpose of this study was to quantitatively compare the effectiveness of two types of RS (yttrium-90 vs. rhenium-186) in terms of the objective improvement of haemarthroses and synovial size. Seventy RSs were performed in 70 joints (44 elbows, 26 ankles) of 70 haemophiliacs diagnosed with chronic synovitis. Yttrium-90 was used in 21 joints and rhenium-186 was used in 49 joints. The mean patient age was 20.61 years. RS resulted in significant improvement in the three variables studied (six months before RS vs. six months after RS), namely in the number of episodes of haemarthrosis (67.8% improvement); the size of the synovium as measured by means of a clinical scale (43.8% improvement) and imaging techniques in millimetres (26.7% improvement). We did not find significant statistical differences between yttrium-90 and rhenium-186 regarding their efficacy. No correlation was found between the results and other variables: age, joint (ankle or elbow), presence or absence of radiological involvement, type of haemophilia (A or B), grade of haemophilia (mild, moderate or severe), previous haematological treatment (on demand or prophylaxis), and the presence or absence of inhibitor Yttrium-90 RS and rhenium-186 RS were equally effective in reducing the number of haemarthroses and the size of the synovium in ankles and elbows in the short-term (6 months). No correlation was found between the results and other patients' characteristics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. The different clinical effects of anti-BLyS, anti-APRIL and anti-CD20 antibodies point at a critical pathogenic role of γ-herpesvirus infected B cells in the marmoset EAE model.

    PubMed

    Anwar Jagessar, S; Fagrouch, Zahra; Heijmans, Nicole; Bauer, Jan; Laman, Jon D; Oh, Luke; Migone, Thi; Verschoor, Ernst J; 't Hart, Bert A

    2013-06-01

    The robust and rapid clinical effect of depleting anti-CD20 monoclonal antibodies (mAb) in multiple sclerosis (MS) demonstrates a critical pathogenic contribution of B cells. The clinical effect of anti-CD20 mAb has been replicated in a relevant preclinical MS model, experimental autoimmune encephalomyelitis (EAE) in marmoset monkeys (Callithrix jacchus). By contrast, treatment with mAbs against two essential cytokines in B cell activation growth and survival, i.e. BlyS/BAFF and APRIL, was only partially effective. All three mAbs induced depletion of CD20+ B cells from the circulation, albeit with different kinetics and based on distinct mechanisms of action. In the current study we analyzed whether the different clinical effect of anti-CD20 mAb or the anti-BLyS and anti-APRIL mAbs is due to different depletion of B cells infected with the EBV of marmosets, CalHV3. Employing a novel PCR-based assay, half of the colony of group-housed marmosets was tested positive for CalHV3 DNA in secondary lymphoid organs. The same prevalence was observed in placebo-treated monkeys. In marmosets treated with anti-CD20 mAb the load of CalHV3 DNA in lymphoid organs was substantially reduced, while this was not observed in the monkeys treated with anti-BLyS or anti-APRIL mAbs. To examine the pathogenic role of virus-transformed B cells, we infused EBV-transformed B lymphoblastic cell (BLC) lines presenting the immunodominant MOG34-56 peptide. We observed in the recipients of MOG34-56 pulsed BLC, but not in their fraternal siblings infused with non-pulsed BLC, activation of anti-MOG34-56 T cells and meningeal inflammation. Collectively, the data show that among CD20+ B cells, the herpesvirus-transformed subset has a particularly important pathogenic role in the marmoset EAE model.

  3. Anti-huCD20 Antibody Therapy for Antibody-Mediated Rejection of Renal Allografts in a Mouse Model

    PubMed Central

    Abe, Toyofumi; Ishii, Daisuke; Gorbacheva, Victoria; Kohei, Naoki; Tsuda, Hidetoshi; Tanaka, Toshiaki; Dvorina, Nina; Nonomura, Norio; Takahara, Shiro; Valujskikh, Anna; Baldwin, William M.; Fairchild, Robert L.

    2016-01-01

    We have reported that B6.CCR5−/− mice reject renal allografts with high serum donor-specific antibody (DSA) titers and marked C4d deposition in grafts, features consistent with AMR. B6.huCD20/CCR5−/− mice, where human CD20 expression is restricted to B cells, rejected A/J renal allografts by day 26 post-transplant with DSA first detected in serum on day 5 post-transplant and increased thereafter. Recipient treatment with anti-huCD20 mAb prior to the transplant and weekly up to 7 weeks post-transplant promoted long-term allograft survival (> 100 days) with low DSA titers. To investigate the effect of B cell depletion at the time serum DSA was first detected, recipients were treated with anti-huCD20 mAb on days 5, 8 and 12 post-transplant. This regimen significantly reduced DSA titers and graft inflammation on day 15 post-transplant and prolonged allograft survival > 60 days. However, DSA returned to the titers observed in control treated recipients by day 30 post-transplant and histological analyses on day 60 post-transplant indicated severe interstitial fibrosis. These results indicate that anti-huCD20 mAb had the greatest effect as a prophylactic treatment and that the distinct kinetics of DSA responses accounts for acute renal allograft failure versus the development of fibrosis. PMID:25731734

  4. Anti-CD45 Pretargeted Radioimmunotherapy using Bismuth-213: High Rates of Complete Remission and Long-Term Survival in a Mouse Myeloid Leukemia Xenograft Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pagel, John M; Kenoyer, Aimee L; Back, Tom

    2011-07-21

    Pretargeted radioimmunotherapy (PRIT) using an anti-CD45 antibody (Ab)-streptavidin (SA) conjugate and DOTA-biotin labeled with β-emitting radionuclides has been explored as a strategy to decrease relapse and toxicity. α-emitting radionuclides exhibit high cytotoxicity coupled with a short path-length, potentially increasing the therapeutic index and making them an attractive alternative to β-emitting radionuclides for patients with Acute Myeloid Leukemia (AML). Accordingly, we have used 213Bi in mice with human leukemia xenografts. Results demonstrated excellent localization of 213Bi-DOTA-biotin to tumors with minimal uptake into normal organs. After 10 minutes, 4.5 ± 1.1% of the injected dose of 213Bi was delivered per gram ofmore » tumor. α imaging demonstrated uniform radionuclide distribution within tumor tissue 45 minutes after 213Bi-DOTA-biotin injection. Radiation absorbed doses were similar to those observed using a β-emitting radionuclide (90Y) in the same model. We conducted therapy experiments in a xenograft model using a single-dose of 213Bi-DOTA-biotin given 24 hours after anti-CD45 Ab-SA conjugate. Among mice treated with anti-CD45 Ab-SA conjugate followed by 800 μCi of 213Bi- or 90Y-DOTA-biotin, 80% and 20%, respectively, survived leukemia-free for >100 days with minimal toxicity. These data suggest that anti-CD45 PRIT using an α-emitting radionuclide may be highly effective and minimally toxic for treatment of AML.« less

  5. Characterization of anti-CD20 monoclonal antibody produced by transgenic silkworms (Bombyx mori).

    PubMed

    Tada, Minoru; Tatematsu, Ken-ichiro; Ishii-Watabe, Akiko; Harazono, Akira; Takakura, Daisuke; Hashii, Noritaka; Sezutsu, Hideki; Kawasaki, Nana

    2015-01-01

    In response to the successful use of monoclonal antibodies (mAbs) in the treatment of various diseases, systems for expressing recombinant mAbs using transgenic animals or plants have been widely developed. The silkworm (Bombyx mori) is a highly domesticated insect that has recently been used for the production of recombinant proteins. Because of their cost-effective breeding and relatively easy production scale-up, transgenic silkworms show great promise as a novel production system for mAbs. In this study, we established a transgenic silkworm stably expressing a human-mouse chimeric anti-CD20 mAb having the same amino acid sequence as rituximab, and compared its characteristics with rituximab produced by Chinese hamster ovary (CHO) cells (MabThera®). The anti-CD20 mAb produced in the transgenic silkworm showed a similar antigen-binding property, but stronger antibody-dependent cell-mediated cytotoxicity (ADCC) and weaker complement-dependent cytotoxicity (CDC) compared to MabThera. Post-translational modification analysis was performed by peptide mapping using liquid chromatography/mass spectrometry. There was a significant difference in the N-glycosylation profile between the CHO- and the silkworm-derived mAbs, but not in other post-translational modifications including oxidation and deamidation. The mass spectra of the N-glycosylated peptide revealed that the observed biological properties were attributable to the characteristic N-glycan structures of the anti-CD20 mAbs produced in the transgenic silkworms, i.e., the lack of the core-fucose and galactose at the non-reducing terminal. These results suggest that the transgenic silkworm may be a promising expression system for the tumor-targeting mAbs with higher ADCC activity.

  6. [Intracoronary brachytherapy with strontium/yttrium-90. Initial experiences in Germany].

    PubMed

    Silber, S; von Rottkay, P; Gielow, A; Schneider, A; Bauer, A; Schöfer, H

    1998-09-01

    Restenosis after PTCA is still an unresolved problem and occurs in approximately 30% of our patients despite a stent implantation rate of up to 63%. Intracoronary brachytherapy has the potential to counteract the proliferative component of restenosis as well as to prevent shrinking of the coronary artery. Two years ago, we applied for the license to use the Novoste Beta-Cath system. This is the first report of its use in Germany. Attaining the license was complicated by the facts that this device did not yet have CE-certification (MPG section 17), that brachytherapy is not yet an approved method of treatment (StrSchV section 41), the report of the BfS and the approval by an accredited ethical committee. The application becomes even more complicated by the amount demanded by the LfU for insurance: 1 Million DM for each individual patient (AtDeckV section 15). The final local inspection needs to be performed by an expert from the LfAS (StrSchV section 76). Strontium-90 decays into Yttrium-90 with a half-life time of approximately 28 years. Yttrium-90, too, is a pure beta-emitter with a shorter half-life time of approximately 64 hours and a considerably higher electron energy of maximum 2.27 MeV. Yttrium-90 is the therapeutic agent. The radiation source of the Beta-Cath system consists of 12 single, separate cylinders (pellets, seeds) with a total length of 3 cm. The activity of the total train is approximately 1.3 to 1.5 GBq (35 to 40 mCi). For verification of the dose rate provided by the manufacturer, we performed a check using the GafChromic film. The test dose (exactly 2 mm from the center of the long axis of the activity train) was 150 Gy. We obtained the following results for the optical density: reference source: 0.29 +/- 0.01, source C: 0.318 +/- 0.013 and source D: 0.317 +/- 0.028. For a dose rate of e.g. 0.083 Gy/s, the radiation times are 169 s for a dose of 14 Gy (vessel diameter 2.7 to 3.35 mm) or 217 s for 18 Gy (vessel diameter 3.36 to 4.0 mm

  7. Extracorporeal adsorption therapy: A Method to improve targeted radiation delivered by radiometal-labeled monoclonal antibodies.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemecek, Eneida R.; Green, Damian J.; Fisher, Darrell R.

    2008-04-01

    anti-CD20 antibody labeled with indium-111 (111In), seven patients received RIT with anti-CD20 antibody labeled with indium-111 for biokinetics and dosimetry, and therapeutic doses of antibody labeled with yttrium-90 (90Y). Performing the ECAT procedure at a rate that such that one blood volume per hour were circulated for 3 hours, resulted in mean radioactivity depletion of 96% in whole blood, 49% in whole body 49%, 62% in the lungs and 40% in liver and kidneys. There was no sufficient data to determine whether there was an improvement in the relative delivery of radiation to the tumor compared to normal organs by performing ECAT, but pharmacokinetic modeling studies suggested a potential therapeutic advantage using this approach. [refs] To evaluate the potential therapeutic advantages of ECAT, we performed biodistribution studies in nonhuman primates comparing the therapeutic ratios of radiation delivered using this approach to those delivered by conventional RIT alone. In addition, we evaluated lutetium-177 (177Lu) as an alternative isotope to optimize the delivery of RIT by improving the therapeutic index (target to non-target ratio)« less

  8. Construction and characterization of an anti-CD20 mAb nanocomb with exceptionally excellent lymphoma-suppressing activity.

    PubMed

    Li, Hua-Fei; Wu, Cong; Chen, Ting; Zhang, Ge; Zhao, He; Ke, Chang-Hong; Xu, Zheng

    2015-01-01

    The CD20-directed monoclonal antibody rituximab (RTX) established a new era in the treatment of non-Hodgkin lymphoma (NHL); however, suboptimal response and/or resistance to RTX still limit its clinical merits. Although four effector mechanisms are validated to participate in CD20-based immunotherapy, including complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, caspase-dependent apoptosis, and lysosome-mediated programmed cell death (PCD), they could hardly be synchronously activated by any anti-CD20 mAb or mAb derivative until now. Herein, a novel mAb nanocomb (polyethylenimine polymer-RTX-tositumomab [PPRT nanocomb]) was firstly constructed through mass arming two different anti-CD20 mAbs (RTX and tositumomab) to one polymer by nanotechnology. Comparing with free mAbs, PPRT nanocomb possesses a comparable binding ability and reduced "off-rate" to surface CD20 of NHL cells. When treated by PPRT nanocomb, the caspase-dependent apoptosis was remarkably enhanced except for concurrently eliciting complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, and lysosome-mediated PCD. Besides, "cross-cell link"-assisted homotypic adhesion by PPRT nanocomb further enhanced the susceptibility to PCD of lymphoma cells. Pharmacokinetic assays revealed that PPRT nanocomb experienced a relatively reduced clearance from peripheral blood compared with free antibodies. With the cooperation of all the abovementioned superiorities, PPRT nanocomb exhibits exceptionally excellent in vivo antitumor activities in both disseminated and localized human NHL xenotransplant models.

  9. Transient B-Cell Depletion with Anti-CD20 in Combination with Proinsulin DNA Vaccine or Oral Insulin: Immunologic Effects and Efficacy in NOD Mice

    PubMed Central

    Sarikonda, Ghanashyam; Sachithanantham, Sowbarnika; Manenkova, Yulia; Kupfer, Tinalyn; Posgai, Amanda; Wasserfall, Clive; Bernstein, Philip; Straub, Laura; Pagni, Philippe P.; Schneider, Darius; Calvo, Teresa Rodriguez; Coulombe, Marilyne; Herold, Kevan; Gill, Ronald G.; Atkinson, Mark; Nepom, Gerald; Ehlers, Mario; Staeva, Teodora; Garren, Hideki; Steinman, Lawrence; Chan, Andrew C.; von Herrath, Matthias

    2013-01-01

    A recent type 1 diabetes (T1D) clinical trial of rituximab (a B cell-depleting anti-CD20 antibody) achieved some therapeutic benefit in preserving C-peptide for a period of approximately nine months in patients with recently diagnosed diabetes. Our previous data in the NOD mouse demonstrated that co-administration of antigen (insulin) with anti-CD3 antibody (a T cell-directed immunomodulator) offers better protection than either entity alone, indicating that novel combination therapies that include a T1D-related autoantigen are possible. To accelerate the identification and development of novel combination therapies that can be advanced into the clinic, we have evaluated the combination of a mouse anti-CD20 antibody with either oral insulin or a proinsulin-expressing DNA vaccine. Anti-CD20 alone, given once or on 4 consecutive days, produced transient B cell depletion but did not prevent or reverse T1D in the NOD mouse. Oral insulin alone (twice weekly for 6 weeks) was also ineffective, while proinsulin DNA (weekly for up to 12 weeks) showed a trend toward modest efficacy. Combination of anti-CD20 with oral insulin was ineffective in reversing diabetes in NOD mice whose glycemia was controlled with SC insulin pellets; these experiments were performed in three independent labs. Combination of anti-CD20 with proinsulin DNA was also ineffective in diabetes reversal, but did show modest efficacy in diabetes prevention (p = 0.04). In the prevention studies, anti-CD20 plus proinsulin resulted in modest increases in Tregs in pancreatic lymph nodes and elevated levels of proinsulin-specific CD4+ T-cells that produced IL-4. Thus, combination therapy with anti-CD20 and either oral insulin or proinsulin does not protect hyperglycemic NOD mice, but the combination with proinsulin offers limited efficacy in T1D prevention, potentially by augmentation of proinsulin-specific IL-4 production. PMID:23405091

  10. Hepatic Abscess After Yttrium-90 Radioembolization for Islet-Cell Tumor Hepatic Metastasis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mascarenhas, Neil B., E-mail: neilmascarenhas1@gmail.co; Mulcahy, Mary F.; Lewandowski, Robert J.

    2010-06-15

    Infectious complications after yttrium-90 (y-90) radioembolization of hepatic tumors are rare. Most reports describe hepatic abscesses as complications of other locoregional therapies, such as transcatheter arterial embolization or chemoembolization. These usually occur in patients with a history of biliary intervention and present several weeks after treatment. We report a case of hepatic abscess formed immediately after y-90 radioembolization of a hepatic metastasis in a patient who had no history of previous biliary instrumentation.

  11. Process for the separation and purification of yttrium-90 for medical applications

    DOEpatents

    Horwitz, P.E.; Dietz, M.L.

    1994-11-29

    An extraction chromatographic method for the preparation of [sup 90]Y of high chemical and radiochemical purity is disclosed. After an initial purification of a [sup 90]Sr stock solution and a suitable period of [sup 90]Y ingrowth, the solution is passed through a series of strontium-selective chromatographic columns, each of which lowers the [sup 90]Sr content of the mixture by a factor of about 10[sup 3]. The [sup 90]Y remaining is freed from any residual [sup 90]Sr, from its [sup 90]Zr daughter, and from any remaining impurities by passing the sample through a final column designed to selectively retain yttrium. 5 figures.

  12. Process for the separation and purification of yttrium-90 for medical applications

    DOEpatents

    Horwitz, Philip E.; Dietz, Mark L.

    1994-01-01

    An extraction chromatographic method for the preparation of .sup.90 Y of high chemical and radiochemical purity is disclosed. After an initial purification of a .sup.90 Sr stock solution and a suitable period of .sup.90 Y ingrowth, the solution is passed through a series of strontium-selective chromatographic columns, each of which lowers the .sup.90 Sr content of the mixture by a factor of about 10.sup.3. The .sup.90 Y remaining is freed from any residual .sup.90 Sr, from its .sup.90 Zr daughter, and from any remaining impurities by passing the sample through a final column designed to selectively retain yttrium.

  13. Construction and characterization of an anti-CD20 mAb nanocomb with exceptionally excellent lymphoma-suppressing activity

    PubMed Central

    Li, Hua-Fei; Wu, Cong; Chen, Ting; Zhang, Ge; Zhao, He; Ke, Chang-Hong; Xu, Zheng

    2015-01-01

    The CD20-directed monoclonal antibody rituximab (RTX) established a new era in the treatment of non-Hodgkin lymphoma (NHL); however, suboptimal response and/or resistance to RTX still limit its clinical merits. Although four effector mechanisms are validated to participate in CD20-based immunotherapy, including complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, caspase-dependent apoptosis, and lysosome-mediated programmed cell death (PCD), they could hardly be synchronously activated by any anti-CD20 mAb or mAb derivative until now. Herein, a novel mAb nanocomb (polyethylenimine polymer–RTX–tositumomab [PPRT nanocomb]) was firstly constructed through mass arming two different anti-CD20 mAbs (RTX and tositumomab) to one polymer by nanotechnology. Comparing with free mAbs, PPRT nanocomb possesses a comparable binding ability and reduced “off-rate” to surface CD20 of NHL cells. When treated by PPRT nanocomb, the caspase-dependent apoptosis was remarkably enhanced except for concurrently eliciting complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, and lysosome-mediated PCD. Besides, “cross-cell link”-assisted homotypic adhesion by PPRT nanocomb further enhanced the susceptibility to PCD of lymphoma cells. Pharmacokinetic assays revealed that PPRT nanocomb experienced a relatively reduced clearance from peripheral blood compared with free antibodies. With the cooperation of all the abovementioned superiorities, PPRT nanocomb exhibits exceptionally excellent in vivo antitumor activities in both disseminated and localized human NHL xenotransplant models. PMID:26257518

  14. Effective elimination of liver cancer stem-like cells by CD90 antibody targeted thermosensitive magnetoliposomes

    PubMed Central

    Yang, Rui; An, Li Y.; Miao, Qin F.; Li, Feng M.; Han, Yong; Wang, Hui X.; Liu, Dang P.; Chen, Rong; Tang, Sha Q.

    2016-01-01

    Aim To investigate the use of thermosensitive magnetoliposomes (TMs) loaded with magnetic iron oxide (Fe3O4) and the anti-cancer stem cell marker CD90 (CD90@TMs) to target and kill CD90+ liver cancer stem cells (LCSCs). Methods The hepatocellular carcinoma cell line Huh7 was used to separate CD90+ LCSCs by magnetic-activated cell sorting. CD90@TMs was characterized and their ability to target CD90+ LCSCs was determined. Experiments were used to investigate whether CD90@TMs combined with magnetic hyperthermia could effectively eliminate CD90+ LCSCs. Results The present study demonstrated that CD90+ LCSCs with stem cells properties were successfully isolated. We also successfully prepared CD90@TMs that was almost spherical and uniform with an average diameter of 130±4.6 nm and determined that magnetic iron oxide could be incorporated and retained a superparamagnetic response. CD90@TMs showed good targeting and increased inhibition of CD90+ LCSCs in vitro and in vivo compared to TMs. Conclusion CD90@TMs can be used for controlled and targeted delivery of anticancer drugs, which may offer a promising alternative for HCC therapy. PMID:27145285

  15. Two Saporin-Containing Immunotoxins Specific for CD20 and CD22 Show Different Behavior in Killing Lymphoma Cells

    PubMed Central

    Polito, Letizia; Mercatelli, Daniele; Bortolotti, Massimo; Maiello, Stefania; Djemil, Alice; Battelli, Maria Giulia; Bolognesi, Andrea

    2017-01-01

    Immunotoxins (ITs) are hybrid proteins combining the binding specificity of antibodies with the cytocidal properties of toxins. They represent a promising approach to lymphoma therapy. The cytotoxicity of two immunotoxins obtained by chemical conjugation of the plant toxin saporin-S6 with the anti-CD20 chimeric antibody rituximab and the anti-CD22 murine antibody OM124 were evaluated on the CD20-/CD22-positive cell line Raji. Both ITs showed strong cytotoxicity for Raji cells, but the anti-CD22 IT was two logs more efficient in killing, probably because of its faster internalization. The anti-CD22 IT gave slower but greater caspase activation than the anti-CD20 IT. The cytotoxic effect of both immunotoxins can be partially prevented by either the pan-caspase inhibitor Z-VAD or the necroptosis inhibitor necrostatin-1. Oxidative stress seems to be involved in the cell killing activity of anti-CD20 IT, as demonstrated by the protective role of the H2O2 scavenger catalase, but not in that of anti-CD22 IT. Moreover, the IT toxicity can be augmented by the contemporary administration of other chemotherapeutic drugs, such as PS-341, MG-132, and fludarabine. These results contribute to the understanding of the immunotoxin mechanism of action that is required for their clinical use, either alone or in combination with other drugs. PMID:28556822

  16. Two Saporin-Containing Immunotoxins Specific for CD20 and CD22 Show Different Behavior in Killing Lymphoma Cells.

    PubMed

    Polito, Letizia; Mercatelli, Daniele; Bortolotti, Massimo; Maiello, Stefania; Djemil, Alice; Battelli, Maria Giulia; Bolognesi, Andrea

    2017-05-30

    Immunotoxins (ITs) are hybrid proteins combining the binding specificity of antibodies with the cytocidal properties of toxins. They represent a promising approach to lymphoma therapy. The cytotoxicity of two immunotoxins obtained by chemical conjugation of the plant toxin saporin-S6 with the anti-CD20 chimeric antibody rituximab and the anti-CD22 murine antibody OM124 were evaluated on the CD20-/CD22-positive cell line Raji. Both ITs showed strong cytotoxicity for Raji cells, but the anti-CD22 IT was two logs more efficient in killing, probably because of its faster internalization. The anti-CD22 IT gave slower but greater caspase activation than the anti-CD20 IT. The cytotoxic effect of both immunotoxins can be partially prevented by either the pan-caspase inhibitor Z-VAD or the necroptosis inhibitor necrostatin-1. Oxidative stress seems to be involved in the cell killing activity of anti-CD20 IT, as demonstrated by the protective role of the H₂O₂ scavenger catalase, but not in that of anti-CD22 IT. Moreover, the IT toxicity can be augmented by the contemporary administration of other chemotherapeutic drugs, such as PS-341, MG-132, and fludarabine. These results contribute to the understanding of the immunotoxin mechanism of action that is required for their clinical use, either alone or in combination with other drugs.

  17. A Preclinical Population Pharmacokinetic Model for Anti-CD20/CD3 T-Cell-Dependent Bispecific Antibodies.

    PubMed

    Ferl, Gregory Z; Reyes, Arthur; Sun, Liping L; Cheu, Melissa; Oldendorp, Amy; Ramanujan, Saroja; Stefanich, Eric G

    2018-05-01

    CD20 is a cell-surface receptor expressed by healthy and neoplastic B cells and is a well-established target for biologics used to treat B-cell malignancies. Pharmacokinetic (PK) and pharmacodynamic (PD) data for the anti-CD20/CD3 T-cell-dependent bispecific antibody BTCT4465A were collected in transgenic mouse and nonhuman primate (NHP) studies. Pronounced nonlinearity in drug elimination was observed in the murine studies, and time-varying, nonlinear PK was observed in NHPs, where three empirical drug elimination terms were identified using a mixed-effects modeling approach: i) a constant nonsaturable linear clearance term (7 mL/day/kg); ii) a rapidly decaying time-varying, linear clearance term (t ½  = 1.6 h); and iii) a slowly decaying time-varying, nonlinear clearance term (t ½  = 4.8 days). The two time-varying drug elimination terms approximately track with time scales of B-cell depletion and T-cell migration/expansion within the central blood compartment. The mixed-effects NHP model was scaled to human and prospective clinical simulations were generated. © 2018 The Authors. Clinical and Translational Science published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.

  18. Yttrium-90 radioembolization as a bridge to liver transplantation: a single-institution experience.

    PubMed

    Tohme, Samer; Sukato, Daniel; Chen, Hui-Wei; Amesur, Nikhil; Zajko, Albert B; Humar, Abhinav; Geller, David A; Marsh, James W; Tsung, Allan

    2013-11-01

    To evaluate our experience with the use of yttrium-90 ((90)Y) radioembolization in maintaining potential candidacy and, in some instances, downstaging hepatocellular carcinoma (HCC) that does not meet Milan criteria for liver transplantation. A retrospective review of 20 consecutive patients with HCC who were listed to receive a liver transplant and were treated with (90)Y radioembolization as a sole modality for locoregional "bridge" therapy was performed. Demographics, radiographic and pathologic response, survival, and recurrences were examined. Twenty-two (90)Y treatments were performed in 20 patients before transplantation. Median time from first treatment to transplantation was 3.5 months. HCC in 14 patients met the Milan criteria at the time of the first (90)Y treatment, and HCC in six did not. All cases that originally met the Milan criteria remained within the criteria before transplantation, and two of six patients whose disease did not meet the criteria (33%) had their disease successfully downstaged to meet the criteria. Overall, nine patients (45%) had complete or partial radiologic response to (90)Y radioembolization according to modified Response Evaluation Criteria In Solid Tumors. Complete necrosis of tumor with no evidence of viable tumor on pathologic examination was observed in five patients (36%) whose disease met the Milan criteria. Particularly in regions with long wait list times, (90)Y treatment is effective in maintaining tumor size in potential liver transplantation candidates with HCC. In addition, it can also be considered as a downstaging therapy in select patients before transplantation. © SIR, 2013.

  19. (90)Y microspheres prepared by sol-gel method, promising medical material for radioembolization of liver malignancies.

    PubMed

    Łada, Wiesława; Iller, Edward; Wawszczak, Danuta; Konior, Marcin; Dziel, Tomasz

    2016-10-01

    A new technology for the production of radiopharmaceutical (90)Y microspheres in the form of spherical yttrium oxide grains obtained by sol-gel method has been described. The authors present and discuss the results of investigations performed in the development of new production technology of yttrium microspheres and determination of their physic-chemical properties. The final product has the structure of spherical yttrium oxide grains with a diameter 25-100μm, is stable and free from contaminants. Irradiation of 20mg samples of grains with diameter of 20-50μm in the thermal neutron flux of 1.7×10(14)cm(-2)s(-1) at the core of MARIA research nuclear reactor allowed to obtain microspheres labelled with the (90)Y isotope on the way of the nuclear reaction (89)Y(n, ɤ)(90)Y. Specific activity of irradiated microspheres has been determined by application of absolute triple to double coincidence ratio method (TDCR) and has been evaluated at 190MBq/mg Y. (90)Y microspheres prepared by the proposed technique can be regarded as a promising medical material for radioembolization of liver malignancies. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Conventional and pretargeted radioimmunotherapy using bismuth-213 to target and treat non-Hodgkin lymphomas expressing CD20: a preclinical model toward optimal consolidation therapy to eradicate minimal residual disease.

    PubMed

    Park, Steven I; Shenoi, Jaideep; Pagel, John M; Hamlin, Don K; Wilbur, D Scott; Orgun, Nural; Kenoyer, Aimee L; Frayo, Shani; Axtman, Amanda; Bäck, Tom; Lin, Yukang; Fisher, Darrell R; Gopal, Ajay K; Green, Damian J; Press, Oliver W

    2010-11-18

    Radioimmunotherapy (RIT) with α-emitting radionuclides is an attractive approach for the treatment of minimal residual disease because the short path lengths and high energies of α-particles produce optimal cytotoxicity at small target sites while minimizing damage to surrounding normal tissues. Pretargeted RIT (PRIT) using antibody-streptavidin (Ab-SA) constructs and radiolabeled biotin allows rapid, specific localization of radioactivity at tumor sites, making it an optimal method to target α-emitters with short half-lives, such as bismuth-213 (²¹³Bi). Athymic mice bearing Ramos lymphoma xenografts received anti-CD20 1F5(scFv)(4)SA fusion protein (FP), followed by a dendrimeric clearing agent and [²¹³Bi]DOTA-biotin. After 90 minutes, tumor uptake for 1F5(scFv)₄SA was 16.5% ± 7.0% injected dose per gram compared with 2.3% ± .9% injected dose per gram for the control FP. Mice treated with anti-CD20 PRIT and 600 μ Ci [²¹³Bi]DOTA-biotin exhibited marked tumor growth delays compared with controls (mean tumor volume .01 ± .02 vs. 203.38 ± 83.03 mm³ after 19 days, respectively). The median survival for the 1F5(scFv)₄SA group was 90 days compared with 23 days for the control FP (P < .0001). Treatment was well tolerated, with no treatment-related mortalities. This study demonstrates the favorable biodistribution profile and excellent therapeutic efficacy attainable with ²¹³Bi-labeled anti-CD20 PRIT.

  1. A process for the separation and purification of yttrium-90 for medical applications

    DOEpatents

    Horwitz, P.E.; Dietz, M.L.

    1993-01-01

    An extraction chromatographic method for the preparation of {sup 90}Y of high chemical and radiochemical purity is disclosed. After an initial purification of a {sup 90}Sr stock solution and a suitable period of {sup 90}Y ingrowth, the solution is passed through a series of strontium-selective chromatographic columns, each of which lowers the {sup 90}Sr content of the mixture by a factor of about 10{sup 3}. The {sup 90}Y remaining is freed from any residual {sup 90}Sr, from its {sup 90}Zr daughter, and from any remaining impurities by passing the sample through a final column designed to selectively retain yttrium.

  2. In vitro experimental (211)At-anti-CD33 antibody therapy of leukaemia cells overcomes cellular resistance seen in vivo against gemtuzumab ozogamicin.

    PubMed

    Petrich, Thorsten; Korkmaz, Zekiye; Krull, Doris; Frömke, Cornelia; Meyer, Geerd J; Knapp, Wolfram H

    2010-05-01

    Monoclonal anti-CD33 antibodies conjugated with toxic calicheamicin derivative (gemtuzumab ozogamicin, GO) are a novel therapy option for acute myeloid leukaemia (AML). Key prognostic factors for patients with AML are high CD33 expression on the leukaemic cells and the ability to overcome mechanisms of resistance to cytotoxic chemotherapies, including drug efflux or other mechanisms decreasing apoptosis. Alpha particle-emitting radionuclides overwhelm such anti-apoptotic mechanisms by producing numerous DNA double-stranded breaks (DSBs) accompanied by decreased DNA repair. We labelled anti-CD33 antibodies with the alpha-emitter (211)At and compared survival of leukaemic HL-60 and K-562 cells treated with the (211)At-labelled antibodies, GO or unlabelled antibodies as controls. We also measured caspase-3/7 activity, DNA fragmentation and necrosis in HL-60 cells after treatment with the different antibodies or with free (211)At. The mean labelling ratio of (211)At-labelled antibodies was 1:1,090 +/- 364 (range: 1:738-1:1,722) in comparison to 2-3:1 for GO. Tumour cell binding of (211)At-anti-CD33 was high in the presence of abundant CD33 expression and could be specifically blocked by unlabelled anti-CD33. (211)At-anti-CD33 decreased survival significantly more than did GO at comparable dilution (1:1,000). No significant differences in induction of apoptosis or necrosis or DNA DSB or in decreased survival were observed after (211)At-anti-CD33 (1:1,090) versus GO (1:1) treatment. Our results suggest that (211)At is a promising, highly cytotoxic radioimmunotherapy in CD33-positive leukaemia and kills tumour cells more efficiently than does calicheamicin-conjugated antibody. Labelling techniques leading to higher chemical yield and specific activities must be developed to increase (211)At-anti-CD33 therapeutic effects.

  3. Radiographic Response to Yttrium-90 Radioembolization in Anterior Versus Posterior Liver Segments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ibrahim, Saad M.; Lewandowski, Robert J.; Ryu, Robert K.

    2008-11-15

    The purpose of our study was to determine if preferential radiographic tumor response occurs in tumors located in posterior versus anterior liver segments following radioembolization with yttrium-90 glass microspheres. One hundred thirty-seven patients with chemorefractory liver metastases of various primaries were treated with yttrium-90 glass microspheres. Of these, a subset analysis was performed on 89 patients who underwent 101 whole-right-lobe infusions to liver segments V, VI, VII, and VIII. Pre- and posttreatment imaging included either triphasic contrast material-enhanced CT or gadolinium-enhanced MRI. Responses to treatment were compared in anterior versus posterior right lobe lesions using both RECIST and WHO criteria.more » Statistical comparative studies were conducted in 42 patients with both anterior and posterior segment lesions using the paired-sample t-test. Pearson correlation was used to determine the relationship between pretreatment tumor size and posttreatment tumor response. Median administered activity, delivered radiation dose, and treatment volume were 2.3 GBq, 118.2 Gy, and 1,072 cm{sup 3}, respectively. Differences between the pretreatment tumor size of anterior and posterior liver segments were not statistically significant (p = 0.7981). Differences in tumor response between anterior and posterior liver segments were not statistically significant using WHO criteria (p = 0.8557). A statistically significant correlation did not exist between pretreatment tumor size and posttreatment tumor response (r = 0.0554, p = 0.4434). On imaging follow-up using WHO criteria, for anterior and posterior regions of the liver, (1) response rates were 50% (PR = 50%) and 45% (CR = 9%, PR = 36%), and (2) mean changes in tumor size were -41% and -40%. In conclusion, this study did not find evidence of preferential radiographic tumor response in posterior versus anterior liver segments treated with yttrium-90 glass microspheres.« less

  4. Radiographic response to yttrium-90 radioembolization in anterior versus posterior liver segments.

    PubMed

    Ibrahim, Saad M; Lewandowski, Robert J; Ryu, Robert K; Sato, Kent T; Gates, Vanessa L; Mulcahy, Mary F; Kulik, Laura; Larson, Andrew C; Omary, Reed A; Salem, Riad

    2008-01-01

    The purpose of our study was to determine if preferential radiographic tumor response occurs in tumors located in posterior versus anterior liver segments following radioembolization with yttrium-90 glass microspheres. One hundred thirty-seven patients with chemorefractory liver metastases of various primaries were treated with yttrium-90 glass microspheres. Of these, a subset analysis was performed on 89 patients who underwent 101 whole-right-lobe infusions to liver segments V, VI, VII, and VIII. Pre- and posttreatment imaging included either triphasic contrast material-enhanced CT or gadolinium-enhanced MRI. Responses to treatment were compared in anterior versus posterior right lobe lesions using both RECIST and WHO criteria. Statistical comparative studies were conducted in 42 patients with both anterior and posterior segment lesions using the paired-sample t-test. Pearson correlation was used to determine the relationship between pretreatment tumor size and posttreatment tumor response. Median administered activity, delivered radiation dose, and treatment volume were 2.3 GBq, 118.2 Gy, and 1,072 cm(3), respectively. Differences between the pretreatment tumor size of anterior and posterior liver segments were not statistically significant (p = 0.7981). Differences in tumor response between anterior and posterior liver segments were not statistically significant using WHO criteria (p = 0.8557). A statistically significant correlation did not exist between pretreatment tumor size and posttreatment tumor response (r = 0.0554, p = 0.4434). On imaging follow-up using WHO criteria, for anterior and posterior regions of the liver, (1) response rates were 50% (PR = 50%) and 45% (CR = 9%, PR = 36%), and (2) mean changes in tumor size were -41% and -40%. In conclusion, this study did not find evidence of preferential radiographic tumor response in posterior versus anterior liver segments treated with yttrium-90 glass microspheres.

  5. PET Imaging of Abdominal Aortic Aneurysm with 64Cu-Labeled Anti-CD105 Antibody Fab Fragment.

    PubMed

    Shi, Sixiang; Orbay, Hakan; Yang, Yunan; Graves, Stephen A; Nayak, Tapas R; Hong, Hao; Hernandez, Reinier; Luo, Haiming; Goel, Shreya; Theuer, Charles P; Nickles, Robert J; Cai, Weibo

    2015-06-01

    The critical challenge in abdominal aortic aneurysm (AAA) research is the accurate diagnosis and assessment of AAA progression. Angiogenesis is a pathologic hallmark of AAA, and CD105 is highly expressed on newly formed vessels. Our goal was to use (64)Cu-labeled anti-CD105 antibody Fab fragment for noninvasive assessment of angiogenesis in the aortic wall in a murine model of AAA. Fab fragment of TRC105, a mAb that specifically binds to CD105, was generated by enzymatic papain digestion and conjugated to NOTA (1,4,7-triazacyclononane-1,4,7-triacetic acid) for (64)Cu labeling. The binding affinity/specificity of NOTA-TRC105-Fab was evaluated by flow cytometry and various ex vivo studies. BALB/c mice were anesthetized and treated with calcium phosphate to induce AAA and underwent weekly PET scans using (64)Cu-NOTA-TRC105-Fab. Biodistribution and autoradiography studies were also performed to confirm the accuracy of PET results. NOTA-TRC105-Fab exhibited high purity and specifically bound to CD105 in vitro. Uptake of (64)Cu-NOTA-TRC105-Fab increased from a control level of 3.4 ± 0.1 to 9.5 ± 0.4 percentage injected dose per gram (%ID/g) at 6 h after injection on day 5 and decreased to 7.2 ± 1.4 %ID/g on day 12, which correlated well with biodistribution and autoradiography studies (i.e., much higher tracer uptake in AAA than normal aorta). Of note, enhanced AAA contrast was achieved, due to the minimal background in the abdominal area of mice. Degradation of elastic fibers and highly expressed CD105 were observed in ex vivo studies. (64)Cu-NOTA-TRC105-Fab cleared rapidly through the kidneys, which enabled noninvasive PET imaging of the aorta with enhanced contrast and showed increased angiogenesis (CD105 expression) during AAA. (64)Cu-NOTA-TRC105-Fab PET may potentially be used for future diagnosis and prognosis of AAA. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  6. Radiochemistry, pre-clinical studies and first clinical investigation of 90Y-labeled hydroxyapatite (HA) particles prepared utilizing 90Y produced by (n,γ) route.

    PubMed

    Vimalnath, K V; Chakraborty, Sudipta; Rajeswari, A; Sarma, H D; Nuwad, Jitendra; Pandey, Usha; Kamaleshwaran, K; Shinto, Ajit; Dash, Ashutosh

    2015-05-01

    The scope of using no carrier added (NCA) (90)Y [T(1/2) = 64.1 h, Eβ(max) = 2.28 MeV] obtained from (90)Sr/(90)Y generator in radiation synovectomy (RSV) is widely accepted. In the present study, the prospect of using (90)Y produced by (n,γ) route in a medium flux research reactor for use in RSV was explored. Yttrium-90 was produced by thermal neutron irradiation of Y(2)O(3) target at a neutron flux of ~1×10(14) n/cm(2).s for 14 d. The influence of various experimental parameters were systematically investigated and optimized to arrive at the most favorable conditions for the formulation of (90)Y labeled hydroxyapatite (HA) using HA particles of 1-10 μm size range. An optimized kit formulation strategy was developed for convenient one-step compounding of (90)Y-HA, which is easily adaptable at hospital radiopharmacy. The pre-clinical biological evaluation of (90)Y-HA particles was studied by carrying out biodistribution and bioluminiscence imaging studies in Wistar rats. The first clinical investigation using the radiolabeled preparation was performed on a patient suffering from chronic arthritis in knee joint by administering 185 MBq (90)Y-HA formulated at the hospital radiopharmacy deploying the proposed strategy. Yttrium-90 was produced with a specific activity of 851 ± 111 MBq/mg and radionuclidic purity of 99.95 ± 0.02%. (90)Y-labeled HA particles (185 ± 10 MBq doses) were formulated in high radiochemical purity (>99%) and excellent in vitro stability. The preparation showed promising results in pre-clinical studies carried out in Wistar rats. The preliminary results of the first clinical investigation of (90)Y-HA preparation in a patient with rheumatoid arthritis in knee joints demonstrated the effectiveness of the formulation prepared using (90)Y produced via (n,γ) route in the management of the disease. The studies revealed that effective utilization of (90)Y produced via (n,γ) route in a medium flux research reactor coupled with the developed

  7. Sensitive Detection of the Natural Killer Cell-Mediated Cytotoxicity of Anti-CD20 Antibodies and Its Impairment by B-Cell Receptor Pathway Inhibitors

    PubMed Central

    Knödgen, Eva; Göckeritz, Elisa; Vondey, Verena; Neumann, Lars; Herter, Sylvia; Klein, Christian; Hallek, Michael

    2018-01-01

    The antibody-dependent cell-mediated cytotoxicity (ADCC) of the anti-CD20 monoclonal antibodies (mAbs) rituximab and obinutuzumab against the cell line Raji and isolated CLL cells and its potential impairment by kinase inhibitors (KI) was determined via lactate dehydrogenase release or calcein retention, respectively, using genetically modified NK92 cells expressing CD16-176V as effector cells. Compared to peripheral blood mononuclear cells, recombinant effector cell lines showed substantial alloreactivity-related cytotoxicity without addition of mAbs but afforded determination of ADCC with reduced interassay variability. The cytotoxicity owing to alloreactivity was less susceptible to interference by KI than the ADCC of anti-CD20 mAbs, which was markedly diminished by ibrutinib, but not by idelalisib. Compared to rituximab, the ADCC of obinutuzumab against primary CLL cells showed approximately 30% higher efficacy and less interference with KI. Irreversible BTK inhibitors at a clinically relevant concentration of 1 μM only weakly impaired the ADCC of anti-CD20 mAbs, with less influence in combinations with obinutuzumab than with rituximab and by acalabrutinib than by ibrutinib or tirabrutinib. In summary, NK cell line-based assays permitted the sensitive detection of ADCC of therapeutic anti-CD20 mAbs against CLL cells and of the interference of KI with this important killing mechanism. PMID:29750146

  8. Anti-CD20 antibody induces the improvement of cytokine-induced killer cell activity via the STAT and MAPK/ERK signaling pathways

    PubMed Central

    DENG, QI; BAI, XUE; LV, HAI-RONG; XIAO, XIA; ZHAO, MING-FENG; LI, YU-MING

    2015-01-01

    There is a current requirement for novel therapeutic strategies for the treatment of hematopoietic tumors. Residual tumor cells are the main origin of tumor relapse. The aim of this study was to eliminate the residual tumor cells of hematopoietic tumors. Cytokine-induced killer (CIK) cells are used in immunotherapy to deplete the residual cells. However, it is necessary to increase the antitumor activity and clinical applicability of CIK cells. The present study investigated the antitumor activity of CIK cells to the SU-DHL2 human B-cell lymphoma and K562 human chronic myelogenous leukemia cell lines. CD3+CD56+ cells from healthy donors were expanded in culture with cytokines and anti-CD20 monoclonal antibody (mAb; rituximab) to generate CIK cells. A preliminary investigation of their mechanism was then performed. The increase in the cytotoxicity of the CIK cells induced by the anti-CD20 mAb was associated with an increase in the expression of cytotoxic factors. The expression of components of the signal transducer and activator of transcription (STAT) and mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) signaling pathways was found to increase. Upregulation of the expression of STAT1, STAT3 and STAT5 is important as these co-stimulatory molecules enhance T-cell proliferation. Activation of the MAPK signaling pathway is a possible mechanism for the anti-apoptosis effect on the proliferation of CIK cells. In conclusion, anti-CD20 mAb may play an important role in the improvement of CIK-mediated cytotoxicity to tumor cells. These observations may aid in the improvement of the effects of immunotherapy in depleting the residual cells of hematopoietic tumors. Thus, the use of CIK cells cultured with anti-CD20 mAb could be a novel therapeutic strategy for the depletion of chemotherapy-resistant or residual cells in anaplastic large and B-cell lymphoma. PMID:25780412

  9. Functional anti-CD94/NKG2A and anti-CD94/NKG2C autoantibodies in patients with systemic lupus erythematosus.

    PubMed

    Hagberg, Niklas; Theorell, Jakob; Hjorton, Karin; Spee, Pieter; Eloranta, Maija-Leena; Bryceson, Yenan T; Rönnblom, Lars

    2015-04-01

    Recently we serendipitously identified a patient with systemic lupus erythematosus (SLE) who was positive for autoantibodies to CD94/natural killer receptor group 2A (NKG2A). The present study was undertaken to investigate the occurrence and function of autoantibodies targeting lectin-like NK cell receptors in SLE. Sera from 203 SLE patients and 90 healthy individuals were analyzed, by flow cytometry, for Ig binding to Ba/F3 cells transfected with CD94/NKG2A, CD94/NKG2C, or NKG2D. Autoantibodies identified were characterized with regard to interference with HLA-E binding, effect on NK cell activation in response to HLA-E-transfected K562 cells, and capacity to facilitate antibody-dependent cell-mediated cytotoxicity (ADCC). Levels of autoantibodies were determined in longitudinally sampled sera, and correlations with disease activity (SLE Disease Activity Index 2000) and severity (Systemic Lupus International Collaborating Clinics/American College of Rheumatology Damage Index) were investigated. Anti-CD94/NKG2A autoantibodies were identified in 7 SLE patients. The autoantibodies from 6 patients inhibited binding of HLA-E to CD94/NKG2A, whereas those from the seventh patient augmented this binding. Autoantibodies from 2 patients also reacted with the activating receptor CD94/NKG2C, with inhibition of the binding of HLA-E to CD94/NKG2C observed in 1 case and enhancement of this binding in the other. None of the sera contained anti-NKG2D autoantibodies. The levels of anti-CD94/NKG2A and anti-CD94/NKG2C autoantibodies correlated with disease activity and with a more severe SLE phenotype. Mechanistically, anti-CD94/NKG2A and anti-CD94/NKG2C autoantibodies both interfered with HLA-E-mediated regulation of NK cell activation and facilitated the elimination of target cells expressing CD94/NKG2A or CD94/NKG2C through ADCC. Anti-CD94/NKG2A and anti-CD94/NKG2C autoantibodies occur in a subset of patients with clinically active SLE. Given their capacity to deplete certain NK

  10. Experience with indium-111 and yttrium-90-labeled somatostatin analogs.

    PubMed

    Virgolini, I; Traub, T; Novotny, C; Leimer, M; Füger, B; Li, S R; Patri, P; Pangerl, T; Angelberger, P; Raderer, M; Burggasser, G; Andreae, F; Kurtaran, A; Dudczak, R

    2002-01-01

    lung cancer ((99m)Tc-depreotide), indicating high diagnostic cabability of this type of receptor tracers. Consequently to their use as receptor imaging agents, hSSTR recognizing radioligands have also been implemented for experimental receptor-targeted radionuclide therapy. Beneficial results were reported for high-dose treatment with (111)In-DTPA-DPhe(1)-octreotide, based on the emission of Auger electrons. The Phase IIa study "MAURITIUS" (Multicenter Analysis of a Universal Receptor Imaging and Treatment Initiative, a eUropean Study) showed in progressive cancer patients (therapy entry criteria) with a calculated tumor dose > 10 Gy / GBq (90)Y-DOTA-lanreotide, the proof-of-principle for treating tumor patients with peptide receptor imaging agents. In the "MAURITIUS" study, cummulative treatment doses up to 200 mCi (90)Y-DOTA-lanreotide were given as short-term infusion. Overall treatment results in 70 patients indicated stable tumor disease in 35% of patients and regressive tumor disease in 10% of tumor patients with different tumor entities expressing hSSTR. No acute or chronic severe hematological toxicity, change in renal or liver function parameters due to (90)Y-DOTA-lanreotide treatment, were reported. (90)Y-DOTA-DPhe(1)-Tyr(3)-octreotide may show a higher tumor uptake in neuroendocrine tumor lesions and may therefore be superior for treatment in patients with neuroendocrine tumors. However, there is only limited excess to long-term and survival data at present. Potential indications for (90Y-DOTA-lanreotide are radioiodine-negative thyroid cancer, hepatocellular cancer and lung cancer. Besides newer approaches and recent developments of 188)Re-labeled radioligands, no clinical results on the treatment response are yet available. In conclusion, several radioligands have been implemented on the basis of peptide receptor recognition throughout the last decade. A plentitude of preclinical data and clinical studies confirm their potential use in diagnosis as well as

  11. Novel synthesizing method of pH-dependent doxorubicin-loaded anti-CD22-labelled drug delivery nanosystem.

    PubMed

    Sun, Mengjiao; Wang, Jun; Lu, Qin; Xia, Guohua; Zhang, Yu; Song, Lina; Fang, Yongjun

    2015-01-01

    The objective of this study was to investigate the anticancer efficacy of dimercaptosuccinic acid-modified iron oxide magnetic nanoparticles coloaded with anti-CD22 antibodies and doxorubicin (anti-CD22-MNPs-DOX) on non-Hodgkin's lymphoma cells. The physical properties of anti-CD22-MNPs-DOX were studied and its antitumor effect on Raji cells in vitro was evaluated using the Cell Counting Kit-8 assay. Furthermore, cell apoptosis and intracellular accumulation of doxorubicin were determined by flow cytometry. The results revealed that anti-CD22-MNPs-DOX inhibited the proliferation of Raji cells, significantly increased the uptake of doxorubicin, and induced apoptosis. Therefore, it was concluded that a coloaded antibody and chemotherapeutic drug with magnetic nanoparticles might be an efficient targeted treatment strategy for non-Hodgkin's lymphoma.

  12. Novel synthesizing method of pH-dependent doxorubicin-loaded anti-CD22-labelled drug delivery nanosystem

    PubMed Central

    Sun, Mengjiao; Wang, Jun; Lu, Qin; Xia, Guohua; Zhang, Yu; Song, Lina; Fang, Yongjun

    2015-01-01

    The objective of this study was to investigate the anticancer efficacy of dimercaptosuccinic acid-modified iron oxide magnetic nanoparticles coloaded with anti-CD22 antibodies and doxorubicin (anti-CD22-MNPs-DOX) on non-Hodgkin’s lymphoma cells. The physical properties of anti-CD22-MNPs-DOX were studied and its antitumor effect on Raji cells in vitro was evaluated using the Cell Counting Kit-8 assay. Furthermore, cell apoptosis and intracellular accumulation of doxorubicin were determined by flow cytometry. The results revealed that anti-CD22-MNPs-DOX inhibited the proliferation of Raji cells, significantly increased the uptake of doxorubicin, and induced apoptosis. Therefore, it was concluded that a coloaded antibody and chemotherapeutic drug with magnetic nanoparticles might be an efficient targeted treatment strategy for non-Hodgkin’s lymphoma. PMID:26379425

  13. L-Cysteine capped CdTe-CdS core-shell quantum dots: preparation, characterization and immuno-labeling of HeLa cells.

    PubMed

    Zhang, Hongyan; Sun, Pan; Liu, Chang; Gao, Huanyu; Xu, Linru; Fang, Jin; Wang, Meng; Liu, Jinling; Xu, Shukun

    2011-01-01

    Functionalized CdTe-CdS core-shell quantum dots (QDs) were synthesized in aqueous solution via water-bathing combined hydrothermal method using L-cysteine (L-Cys) as a stabilizer. This method possesses both the advantages of water-bathing and hydrothermal methods for preparing high-quality QDs with markedly reduced synthesis time, and better stability than a lone hydrothermal method. The QDs were characterized by transmission electronic microscopy and powder X-ray diffraction and X-ray photoelectron spectroscopy. The CdTe-CdS QDs with core-shell structure showed both enhanced fluorescence and better photo stability than nude CdTe QDs. After conjugating with antibody rabbit anti-CEACAM8 (CD67), the as-prepared l-Cys capped CdTe-CdS QDs were successfully used as fluorescent probes for the direct immuno-labeling and imaging of HeLa cells. It was indicated that this kind of QD would have application potential in bio-labeling and cell imaging. Copyright © 2009 John Wiley & Sons, Ltd.

  14. Immunoassay of serum polypeptide hormones by using 125I-labelled anti(-immunoglobulin G) antibodies.

    PubMed

    Beck, P; Nicholas, H

    1975-03-01

    1. A technique for indirectly labelling antibodies to polypeptide hormones, by combining them with radioactively labelled anti-(immunoglobulin G) is described. (a) 125I-labelled anti-(rabbit immunoglobulin G) and anti-(guinea-pig immunoglobulin G) antibodies with high specific radioactivity were prepared after purification of the antibodies on immunoadsorbents containing the respective antigens. (b) Rabbit immunoglobulin G antibodies to human growth hormone, porcine glucagon and guinea-pig immunoglobulin G antibodies to bovine insulin and bovine parathyroid hormone were combined with immunoadsorbents containing the respective polypeptide hormone antigen. (c) The immunoglobulin G antibodies to the polypeptide hormones were reacted with 125-I-labelled anti-(immunoglobulin G) antibodies directed against the appropriate species of immunoglobulin G,and the anti-hormone antibodies were combined with the hormone-containing immunoadsorbent. (d) 125I-labelled anti-(immunoglobulin G) antibodies and anti-hormone antibodies were simultaneously eluted from the hormone-containing immunoadsorbent by dilute HCl, pH 2.0. After elution the anti-(immunoglobulin G) antibodies and antihormone antibodies were allowed to recombine at pH 8.0 and 4 degrees C. 2. The resultant immunoglobulin G-anti-immunoglobulin G complex was used in immunoradiometric (labelled antibody) and two-site assays of the respective polypeptide hormone. 3. By using these immunoassays, concentrations down to 90pg of human growth hormone/ml, 100 pg of bovine insulin/ml, 80 pg of bovine parathyroid hormone/ml and 150 pg of glucagon/ml were readily detected. Assays of human plasma for growth hormone and insulin by these methods showed good agreement with results obtained by using a directly 125I-labelled anti-hormone antibody in an immunoradiometric assay of human growth hormone or by radioimmunoassay of human insulin. 4. The method described allows immunoradiometric or two-site assays to be performed starting with as

  15. Detection of CdSe quantum dot photoluminescence for security label on paper

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isnaeni,, E-mail: isnaeni@lipi.go.id; Sugiarto, Iyon Titok; Bilqis, Ratu

    CdSe quantum dot has great potential in various applications especially for emitting devices. One example potential application of CdSe quantum dot is security label for anti-counterfeiting. In this work, we present a practical approach of security label on paper using one and two colors of colloidal CdSe quantum dot, which is used as stamping ink on various types of paper. Under ambient condition, quantum dot is almost invisible. The quantum dot security label can be revealed by detecting emission of quantum dot using photoluminescence and cnc machine. The recorded quantum dot emission intensity is then analyzed using home-made program tomore » reveal quantum dot pattern stamp having the word ’RAHASIA’. We found that security label using quantum dot works well on several types of paper. The quantum dot patterns can survive several days and further treatment is required to protect the quantum dot. Oxidation of quantum dot that occurred during this experiment reduced the emission intensity of quantum dot patterns.« less

  16. Effectiveness of radiation synovectomy with Yttrium-90 and Samarium-153 particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled, randomized, double-blinded trial.

    PubMed

    Dos Santos, Marla Francisca; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa; Silva, Constancia Pagano Gonçalves; Natour, Jamil

    2011-01-01

    The aim of the present study was to investigate the long-term effectiveness of and tolerance to Yttrium-90 and Samarium-153-particulate hydroxyapatite radiation synovectomy in patients with rheumatoid arthritis (RA) and chronic knee synovitis. Eight-four patients (90 knees) with chronic knee synovitis and RA (according to the American College of Rheumatology criteria) participated in a controlled, double-blinded trial. Patients were randomized to receive an intra-articular injection with either 5 mCi Yttrium-90 plus 40 mg of triamcinolone hexacetonide (Y/TH Group), 15 mCi Samarium-153 hydroxyapatite plus 40 mg of triamcinolone hexacetonide (Sm/TH Group), or 40 mg triamcinolone hexacetonide alone (Control Group). Blinded examination at baseline, 1, 4, 12, 32, and 48 weeks post-intervention included a visual analog scale for joint pain and swelling, morning stiffness, range of motion, knee circumference, Likert scale, percentage of improvement, Stanford Health Assessment Questionnaire, Lequesne index, use of non-steroidal anti-inflammatory drugs and corticosteroids, events and adverse effects, calls to the physician, and hospital visits. There were three withdrawals prior to the injections. Regarding the pain, there was a significantly better response in the Y/TH Group versus the Sm/TH Group at T1 (p = 0.025) and versus TH alone at T48 (p = 0.026). The Sm/TH group had more adverse effects (p = 0.042), but these were mild and transitory. For the pain parameter alone, Yttrium-90 radiosynovectomy associated to TH proved superior to Samarium-153 hydroxyapatite radiosynovectomy associated to TH at T1 and to synovectomy with TH at T48. No other statistically significant inter-group differences were detected.

  17. Immunohistochemistry of a choroidal melanoma: nestin, CD34 and CD117÷c-kit labeling.

    PubMed

    Vrapciu, Alexandra Diana; Rusu, Mugurel Constantin; Voinea, Liliana Mary

    2014-01-01

    In a case of choroidal melanoma (CM) in a 70-year-old male patient, was firstly aimed at studying the processes of angiogenesis by use of nestin and CD34 antibodies. Anti-CD117÷c-kit antibodies were further considered for their progenitor cells specificity. Choroidal melanoma was histopathologically confirmed. Nestin-positive endothelia were found in the CM and the adjacent retina, but not in endothelia elsewhere in that eye. Nestin-positive non-pigmentary cells were found within the CM. Filopodia-projecting endothelial tip cells (ETCs), nestin- and CD34-positive were found in the CM. CD34-positive ETCs were also found in the iridial stroma. There were found two different immune patterns of the retinal Müller cells (MCs). They were nestin-positive in the retina adjacent to the tumor, but negative in any other part of retina. On the other hand, CD117÷c-kit antibodies labeled MCs as follows: (a) discontinuously, or continuously, in the retina adjacent to the CM; (b) only the inner segments of the MCs were labeled in the retina unrelated to the CM. While nestin could be a reliable marker for retinal damage, the CD117÷c-kit phenotype of MCs still needs further investigations. Antiangiogenic therapy appears as a good choice for tumor therapy.

  18. Mechanisms involved in synergistic anticancer immunity of anti-4-1BB and anti-CD4 therapy.

    PubMed

    Choi, Beom K; Kim, Young H; Kang, Woo J; Lee, Sun K; Kim, Kwang H; Shin, Su M; Yokoyama, Wayne M; Kim, Tae Y; Kwon, Byoung S

    2007-09-15

    Anti-4-1BB-mediated anticancer effects were potentiated by depletion of CD4+ cells in B16F10 melanoma-bearing C57BL/6 mice. Anti-4-1BB induced the expansion and differentiation of polyclonal tumor-specific CD8+ T cells into IFN-gamma-producing CD11c+CD8+ T cells. The CD4+ cell depletion was responsible for facilitating immune cell infiltration into tumor tissues and removing some regulatory barriers such as T regulatory and indoleamine-2,3-dioxygenase (IDO)+ dendritic cells. Both monoclonal antibodies (mAb) contributed to the efficient induction of MHC class I molecules on the tumor cells in vivo. The effectors that mediated the anti-4-1BB effect were NKG2D+KLRG1+CD11c+CD8+ T cells that accumulated preferentially in the tumor tissues. Blocking NKG2D reduced the therapeutic effect by 20% to 26%, which may indicate that NKG2D contributes partially to tumor killing by the differentiated CD8+ T cells. Our results indicate that the combination of the two mAbs, agonistic anti-4-1BB and depleting anti-CD4, results in enhanced production of efficient tumor-killing CTLs, facilitation of their infiltration, and production of a susceptible tumor microenvironment.

  19. Chemoembolic Hepatopulmonary Shunt Reduction to Allow Safe Yttrium-90 Radioembolization Lobectomy of Hepatocellular Carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaba, Ron C., E-mail: rgaba@uic.edu; VanMiddlesworth, Kyle A.

    2012-12-15

    Yttrium-90 ({sup 90}Y) radioembolization represents an emerging transcatheter treatment option for the management of hepatocellular carcinoma (HCC). Elevation of the hepatopulmonary shunt fraction risks nontarget radiation to the lungs and may limit the use of {sup 90}Y therapy in patients with locally advanced disease with vascular invasion, who often demonstrate increased shunting. We present two cases in which patients with HCC and portal vein invasion resulting in elevated hepatopulmonary shunt fractions underwent chemoembolic shunt closure to allow safe {sup 90}Y radioembolization. Both patients demonstrated excellent tumor response and patient survival. On this basis, we propose a role for chemoembolic reductionmore » of the lung shunt fraction before {sup 90}Y radioembolization in patients with extensive tumor-related hepatopulmonary shunting.« less

  20. Complete eradication of hepatic metastasis from colorectal cancer by Yttrium-90 SIRT

    PubMed Central

    Garrean, Sean; Muhs, Amanda; Bui, James T; Blend, Michael J; Owens, Charles; Helton, William S; Espat, N Joseph

    2007-01-01

    Yttrium-90 (Y-90) radioembolization, also known as selective internal radiation therapy (SIRT), is a regional hepatic therapy used in the treatment of unresectable colorectal cancer (CRC) liver metastases. In SIRT, Y-90 impregnated microspheres are injected into the VASCULAR SUPPLY of hepatic tumor, leading to selective irradiation and necrosis of tumor TISSUE. While several studies demonstrate improved local control and survival with SIRT, the specific indications for this therapy have yet to be defined. Typically, SIRT is given in combination with chemotherapy as multimodal treatment for unresectable hepatic CRC. However, it HAS ALSO FOUND INCREASING USE as a salvage therapy in chemo-refractory patients. Herein, the authors describe their experience with SIRT as “stand alone” therapy in a surgically-prohibitive, chemotherapy naive patient with hepatic CRC metastasis. The results suggest that Y-90 SIRT may have potential applications beyond its usual role as a palliative or salvage therapy for unresectable hepatic CRC. PMID:17589957

  1. Anti-CD22 and anti-CD79b antibody-drug conjugates preferentially target proliferating B cells.

    PubMed

    Fuh, Franklin K; Looney, Caroline; Li, Dongwei; Poon, Kirsten A; Dere, Randall C; Danilenko, Dimitry M; McBride, Jacqueline; Reed, Chae; Chung, Shan; Zheng, Bing; Mathews, William Rodney; Polson, Andrew; Prabhu, Saileta; Williams, Marna

    2017-04-01

    CD22 and CD79b are cell-surface receptors expressed on B-cell-derived malignancies such as non-Hodgkin's lymphoma (NHL). An anti-mitotic agent, monomethyl auristatin E, was conjugated to anti-CD22 and anti-CD79b antibodies to develop target-specific therapies for NHL. The mechanism of action (MOA) and pharmacological and pharmacokinetic (PK) profiles of these antibody-drug conjugates (ADCs) were investigated in cynomolgus monkeys. Animals were administered anti-CD22 or anti-CD79b ADCs, respective unconjugated antibodies or vehicle. Pharmacodynamic effects on total and proliferating B cells and serum PK were then assessed. Antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) of the ADCs were evaluated in vitro. Depletion of B cells was observed after administration of either ADC or the respective unconjugated antibodies. An extended duration of depletion was observed in animals administered ADCs. Similarly, preferential depletion of proliferating B cells in blood and germinal centre B cells in spleen were only observed in animals administered ADCs. Serum PK profiles of ADCs and respective unconjugated antibodies were comparable. In vitro, anti-human CD22 and anti-human CD79b antibodies showed no or only moderate ADCC activity, respectively; neither antibody had CDC activity. The findings support the proposed MOA: initial depletion of total B cells by antibody-mediated opsonization, followed by preferential, sustained depletion of proliferating B cells by the auristatin conjugate due to its anti-mitotic action. Delivering potent anti-mitotic agents to B cells via the specificity of monoclonal antibodies provides a means to eliminate pathogenic B cells in NHL with improved risk-benefit profiles over traditional chemotherapeutics. © 2016 Genentech. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of British Pharmacological Society.

  2. Anti-CD20 single chain variable antibody fragment-apolipoprotein A-I chimera containing nanodisks promote targeted bioactive agent delivery to CD20-positive lymphomas.

    PubMed

    Crosby, Natasha M; Ghosh, Mistuni; Su, Betty; Beckstead, Jennifer A; Kamei, Ayako; Simonsen, Jens B; Luo, Bing; Gordon, Leo I; Forte, Trudy M; Ryan, Robert O

    2015-08-01

    A fusion protein comprising an α-CD20 single chain variable fragment (scFv) antibody, a spacer peptide, and human apolipoprotein (apo) A-I was constructed and expressed in Escherichia coli. The lipid interaction properties intrinsic to apoA-I as well as the antigen recognition properties of the scFv were retained by the chimera. scFv•apoA-I was formulated into nanoscale reconstituted high-density lipoprotein particles (termed nanodisks; ND) and incubated with cultured cells. α-CD20 scFv•apoA-I ND bound to CD20-positive non-Hodgkins lymphoma (NHL) cells (Ramos and Granta) but not to CD20-negative T lymphocytes (i.e., Jurkat). Binding to NHL cells was partially inhibited by pre-incubation with rituximab, a monoclonal antibody directed against CD20. Confocal fluorescence microscopy analysis of Granta cells following incubation with α-CD20 scFv•apoA-I ND formulated with the intrinsically fluorescent hydrophobic polyphenol, curcumin, revealed α-CD20 scFv•apoA-I localizes to the cell surface, while curcumin off-loads and gains entry to the cell. Compared to control incubations, viability of cultured NHL cells was decreased upon incubation with α-CD20 scFv•apoA-I ND harboring curcumin. Thus, formulation of curcumin ND with α-CD20 scFv•apoA-I as the scaffold component confers cell targeting and enhanced bioactive agent delivery, providing a strategy to minimize toxicity associated with chemotherapeutic agents.

  3. Use of Chelex-100 for selectively removing Y-90 from its parent Sr-90

    DOEpatents

    Huntley, Mark W.

    1996-01-01

    A method for selectively removing yttrium-90 from its parent strontium-90 contained in an environmental sample includes loading the sample onto a column containing a chelating ion-exchange resin capable of retaining yttrium-90; washing the column with a solution capable of removing strontium, calcium, and other contaminants from the yttrium-90 fraction retained on the column; removing excess acetate salts from the column; eluting yttrium-90 solution from the column and adjusting the pH of this solution to about 2.7; filtering the yttrium-90 solution and weighing this solution for gravimetric yield; and, counting the yttrium-90 containing solution with a radiological counter for a time sufficient to achieve the statistical accuracy desired. It is preferred that the chelating ion-exchange resin is a bidente ligand having the chemical name iminodiacetic acid mounted on a divinyl benzene substrate, converted from sodium form to ammonia form.

  4. Use of Chelex-100 for selectively removing Y-90 from its parent Sr-90

    DOEpatents

    Huntley, M.W.

    1996-02-27

    A method for selectively removing yttrium-90 from its parent strontium-90 contained in an environmental sample includes loading the sample onto a column containing a chelating ion-exchange resin capable of retaining yttrium-90; washing the column with a solution capable of removing strontium, calcium, and other contaminants from the yttrium-90 fraction retained on the column; removing excess acetate salts from the column; eluting yttrium-90 solution from the column and adjusting the pH of this solution to about 2.7; filtering the yttrium-90 solution and weighing this solution for gravimetric yield; and, counting the yttrium-90 containing solution with a radiological counter for a time sufficient to achieve the statistical accuracy desired. It is preferred that the chelating ion-exchange resin is a ligand having the chemical name iminodiacetic acid mounted on a divinyl benzene substrate, converted from sodium form to ammonia form.

  5. B cell-targeted therapy with anti-CD20 monoclonal antibody in a mouse model of Graves' hyperthyroidism

    PubMed Central

    Ueki, I; Abiru, N; Kobayashi, M; Nakahara, M; Ichikawa, T; Eguchi, K; Nagayama, Y

    2011-01-01

    Graves' disease is a B cell-mediated and T cell-dependent autoimmune disease of the thyroid which is characterized by overproduction of thyroid hormones and thyroid enlargement by agonistic anti-thyrotrophin receptor (TSHR) autoantibody. In addition to antibody secretion, B cells have recently been recognized to function as antigen-presenting/immune-modulatory cells. The present study was designed to evaluate the efficacy of B cell depletion by anti-mouse (m) CD20 monoclonal antibody (mAb) on Graves' hyperthyroidism in a mouse model involving repeated injection of adenovirus expressing TSHR A-subunit (Ad-TSHR289). We observe that a single injection of 250 µg/mouse anti-mCD20 mAb eliminated B cells efficiently from the periphery and spleen and to a lesser extent from the peritoneum for more than 3 weeks. B cell depletion before immunization suppressed an increase in serum immunoglobulin (Ig)G levels, TSHR-specific splenocyte secretion of interferon (IFN)-γ, anti-TSHR antibody production and development of hyperthyroidism. B cell depletion 2 weeks after the first immunization, a time-point at which T cells were primed but antibody production was not observed, was still effective at inhibiting antibody production and disease development without inhibiting splenocyte secretion of IFN-γ. By contrast, B cell depletion in hyperthyroid mice was therapeutically ineffective. Together, these data demonstrate that B cells are critical not only as antibody-producing cells but also as antigen-presenting/immune-modulatory cells in the early phase of the induction of experimental Graves' hyperthyroidism and, although therapeutically less effective, B cell depletion is highly efficient for preventing disease development. PMID:21235532

  6. B cell-targeted therapy with anti-CD20 monoclonal antibody in a mouse model of Graves' hyperthyroidism.

    PubMed

    Ueki, I; Abiru, N; Kobayashi, M; Nakahara, M; Ichikawa, T; Eguchi, K; Nagayama, Y

    2011-03-01

    Graves' disease is a B cell-mediated and T cell-dependent autoimmune disease of the thyroid which is characterized by overproduction of thyroid hormones and thyroid enlargement by agonistic anti-thyrotrophin receptor (TSHR) autoantibody. In addition to antibody secretion, B cells have recently been recognized to function as antigen-presenting/immune-modulatory cells. The present study was designed to evaluate the efficacy of B cell depletion by anti-mouse (m) CD20 monoclonal antibody (mAb) on Graves' hyperthyroidism in a mouse model involving repeated injection of adenovirus expressing TSHR A-subunit (Ad-TSHR289). We observe that a single injection of 250 µg/mouse anti-mCD20 mAb eliminated B cells efficiently from the periphery and spleen and to a lesser extent from the peritoneum for more than 3 weeks. B cell depletion before immunization suppressed an increase in serum immunoglobulin (Ig)G levels, TSHR-specific splenocyte secretion of interferon (IFN)-γ, anti-TSHR antibody production and development of hyperthyroidism. B cell depletion 2 weeks after the first immunization, a time-point at which T cells were primed but antibody production was not observed, was still effective at inhibiting antibody production and disease development without inhibiting splenocyte secretion of IFN-γ. By contrast, B cell depletion in hyperthyroid mice was therapeutically ineffective. Together, these data demonstrate that B cells are critical not only as antibody-producing cells but also as antigen-presenting/immune-modulatory cells in the early phase of the induction of experimental Graves' hyperthyroidism and, although therapeutically less effective, B cell depletion is highly efficient for preventing disease development. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.

  7. Chemotherapeutic Effect of CD147 Antibody-labeled Micelles Encapsulating Doxorubicin Conjugate Targeting CD147-Expressing Carcinoma Cells.

    PubMed

    Asakura, Tadashi; Yokoyama, Masayuki; Shiraishi, Koichi; Aoki, Katsuhiko; Ohkawa, Kiyoshi

    2018-03-01

    CD147 (basigin/emmprin) is expressed on the surface of carcinoma cells. For studying the efficacy of CD147-targeting medicine on CD147-expressing cells, we studied the effect of anti-CD147-labeled polymeric micelles (CD147ab micelles) that encapsulated a conjugate of doxorubicin with glutathione (GSH-DXR), with specific accumulation and cytotoxicity against CD147-expressing A431 human epidermoid carcinoma cells, Ishikawa human endometrial adenocarcinoma cells, and PC3 human prostate carcinoma cells. By treatment of each cell type with CD147ab micelles for 1 h, a specific accumulation of CD147ab micelles in CD147-expressing cells was observed. In addition, the cytotoxicity of GSH-DXR-encapsulated micelles against each cell type was measured by treatment of the micelles for 1 h. The cytotoxic effect of CD147ab micelles carrying GSH-DXR was 3- to 10-fold higher for these cells than that of micelles without GSH-DXR. These results suggest that GSH-DXR-encapsulated CD147ab micelles could serve as an effective drug delivery system to CD147-expressing carcinoma cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  8. Effects of in vivo injection of anti-chicken CD25 monoclonal antibody on regulatory T cell depletion and CD4+CD25- T cell properties in chickens.

    PubMed

    Shanmugasundaram, Revathi; Selvaraj, Ramesh K

    2012-03-01

    Regulatory T cells (Tregs) are defined as CD4(+)CD25(+) cells in chickens. This study examined the effects of an anti-chicken CD25 monoclonal antibody injection (0.5 mg/bird) on in vivo depletion of Tregs and the properties of CD4(+)CD25(-) cells in Treg-depleted birds. The CD4(+)CD25(+) cell percentage in the blood was lower at 8 d post injection than at 0 d. Anti-CD25-mediated CD4(+)CD25(+) cell depletion in blood was maximum at 12 d post injection. The anti-CD25 antibody injection depleted CD4(+)CD25(+) cells in the spleen and cecal tonsils, but not in the thymus, at 12 d post antibody injection. CD4(+)CD25(-) cells from the spleen and cecal tonsils of birds injected with the anti-chicken CD25 antibody had higher proliferation and higher IL-2 and IFNγ mRNA amounts than the controls at 12 d post injection. At 20 d post injection, CD4(+)CD25(+) cell percentages in the blood, spleen and thymus were comparable to that of the 0 d post injection. It could be concluded that anti-chicken CD25 injection temporarily depleted Treg population and increased and IL-2 and IFNγ mRNA amounts in CD4(+)CD25(-) cells at 12d post injection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Phase II trial of yttrium-90-DOTA-biotin pretargeted by NR-LU-10 antibody/streptavidin in patients with metastatic colon cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Knox, S J.; Goris, M L.; Tempero, M

    A Phase II study of yttrium-90-tetra-azacyclododecanetetra-acetic acid-biotin (Y-90-DOTA-biotin) pretargeted by NR-LU-10 antibody/streptavidin (SA) was performed. The primary objectives of the study were to evaluate the efficacy and safety of this therapy in patients with metastatic colon cancer. Twenty-five patients were treated with a single dose of 110 mCi/m{sup 2} (mean administered dose, 106.5-10.3 mCi/m{sup 2}) of Y-90-DOTA-biotin. There were three components of the therapy. Patients first received NR-LU-10/SA on day 1. A clearing agent (biotin-galactose-human serum albumin) was administered 48 h after the NR-LU-10/SA to remove residual circulating unbound NR-LU-10/SA. Lastly, 24 h after administration of clearing agent, patients receivedmore » biotin-DOTA-labeled with 110 mCi/m{sup 2} Y-90. All three components of the therapy were administered i.v. Both hematological and nonhematological toxicities were observed. Diarrhea was the most frequent grade 4 nonhematological toxicity (16%; with 16% grade 3 diarrhea). Hematological toxicity was less severe with 8% grade 3 and 8% grade 4 neutropenia and 8% grade 3 and 16% grade 4 thrombocytopenia. The overall response rate was 8%. Two partial responders had freedom from progression of 16 weeks. Four patients (16%) had stable disease with freedom from progression of 10-20 weeks. Despite the relatively disappointing results of this study in terms of therapeutic efficacy and toxicity, proof of principle was obtained for the pretargeting approach. In addition, valuable new information was obtained about normal tissue tolerance to low-dose-rate irradiation that will help to provide useful guidelines for future study designs.« less

  10. Comparison of TOF-PET and Bremsstrahlung SPECT Images of Yttrium-90: A Monte Carlo Simulation Study.

    PubMed

    Takahashi, Akihiko; Himuro, Kazuhiko; Baba, Shingo; Yamashita, Yasuo; Sasaki, Masayuki

    2018-01-01

    Yttrium-90 ( 90 Y) is a beta particle nuclide used in targeted radionuclide therapy which is available to both single-photon emission computed tomography (SPECT) and time-of-flight (TOF) positron emission tomography (PET) imaging. The purpose of this study was to assess the image quality of PET and Bremsstrahlung SPECT by simulating PET and SPECT images of 90 Y using Monte Carlo simulation codes under the same conditions and to compare them. In-house Monte Carlo codes, MCEP-PET and MCEP-SPECT, were employed to simulate images. The phantom was a torso-shaped phantom containing six hot spheres of various sizes. The background concentrations of 90 Y were set to 50, 100, 150, and 200 kBq/mL, and the concentrations of the hot spheres were 10, 20, and 40 times of those of the background concentrations. The acquisition time was set to 30 min, and the simulated sinogram data were reconstructed using the ordered subset expectation maximization method. The contrast recovery coefficient (CRC) and contrast-to-noise ratio (CNR) were employed to evaluate the image qualities. The CRC values of SPECT images were less than 40%, while those of PET images were more than 40% when the hot sphere was larger than 20 mm in diameter. The CNR values of PET images of hot spheres of diameter smaller than 20 mm were larger than those of SPECT images. The CNR values mostly exceeded 4, which is a criterion to evaluate the discernibility of hot areas. In the case of SPECT, hot spheres of diameter smaller than 20 mm were not discernable. On the contrary, the CNR values of PET images decreased to the level of SPECT, in the case of low concentration. In almost all the cases examined in this investigation, the quantitative indexes of TOF-PET 90 Y images were better than those of Bremsstrahlung SPECT images. However, the superiority of PET image became critical in the case of low activity concentrations.

  11. In ovo injection of anti-chicken CD25 monoclonal antibodies depletes CD4+CD25+ T cells in chickens.

    PubMed

    Shanmugasundaram, Revathi; Selvaraj, Ramesh K

    2013-01-01

    The CD4(+)CD25(+) cells have T regulatory cell properties in chickens. This study investigated the effect of in ovo injection of anti-chicken CD25 monoclonal antibodies (0.5 mg/egg) on CD4(+)CD25(+) cell depletion and on amounts of interleukin-2 mRNA and interferon-γ mRNA in CD4(+)CD25(-) cells posthatch. Anti-chicken CD25 or PBS (control) was injected into 16-d-old embryos. Chicks hatched from eggs injected with anti-chicken CD25 antibodies had a lower CD4(+)CD25(+) cell percentage in the blood until 25 d posthatch. The anti-chicken CD25 antibody injection nearly depleted CD4(+)CD25(+) cells in the blood until 16 d posthatch. At 30 d posthatch, the CD4(+)CD25(+) cell percentage in the anti-CD25-antibody-injected group was comparable with the percentage in the control group. At 16 d posthatch, the anti-chicken CD25 antibody injection decreased CD4(+)CD25(+) cell percentages in the thymus, spleen, and cecal tonsils. Chickens hatched from anti-CD25-antibody-injected eggs had approximately 25% of CD4(+)CD25(+) cells in the cecal tonsils and thymus compared with those in the cecal tonsils and thymus of the control group. The CD4(+)CD25(-) cells from the spleen and cecal tonsils of chicks hatched from anti-chicken-CD25-injected eggs had higher amounts of interferon-γ and interleukin-2 mRNA than CD4(+)CD25(-) cells from the control group. It could be concluded that injecting anti-chicken CD25 antibodies in ovo at 16 d of incubation nearly depleted the CD4(+)CD25(+) cells until 25 d posthatch.

  12. Immuno-biosensor for Detection of CD20-Positive Cells Using Surface Plasmon Resonance.

    PubMed

    Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili; Fathi, Farzaneh; Ezzati Nazhad Dolatabadi, Jafar

    2017-06-01

    Purpose: Surface plasmon resonance (SPR) sensing confers a real-time assessment of molecular interactions between biomolecules and their ligands. This approach is highly sensitive and reproducible and could be employed to confirm the successful binding of drugs to cell surface targets. The specific affinity of monoclonal antibodies (MAb) for their target antigens is being utilized for development of immuno-sensors and therapeutic agents. CD20 is a surface protein of B lymphocytes which has been widely employed for immuno-targeting of B-cell related disorders. In the present study, binding ability of an anti-CD20 MAb to surface antigens of intact target cells was investigated by SPR technique. Methods: Two distinct strategies were used for immobilization of the anti-CD20 MAb onto gold (Au) chips. MUA (11-mercaptoundecanoic acid) and Staphylococcus aureus protein A (SpA) were the two systems used for this purpose. A suspension of CD20-positive Raji cells was injected in the analyte phase and the resulting interactions were analyzed and compared to those of MOLT-4 cell line as CD20-negative control. Results: Efficient binding of anti-CD20 MAb to the surface antigens of Raji cell line was confirmed by both immobilizing methods, whereas this MAb had not a noticeable affinity to the MOLT-4 cells. Conclusion: According to the outcomes, the investigated MAb had acceptable affinity and specificity to the target antigens on the cell surface and could be utilized for immuno-detection of CD20-positive intact cells by SPR method.

  13. Immuno-biosensor for Detection of CD20-Positive Cells Using Surface Plasmon Resonance

    PubMed Central

    Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili; Fathi, Farzaneh; Ezzati Nazhad Dolatabadi, Jafar

    2017-01-01

    Purpose: Surface plasmon resonance (SPR) sensing confers a real-time assessment of molecular interactions between biomolecules and their ligands. This approach is highly sensitive and reproducible and could be employed to confirm the successful binding of drugs to cell surface targets. The specific affinity of monoclonal antibodies (MAb) for their target antigens is being utilized for development of immuno-sensors and therapeutic agents. CD20 is a surface protein of B lymphocytes which has been widely employed for immuno-targeting of B-cell related disorders. In the present study, binding ability of an anti-CD20 MAb to surface antigens of intact target cells was investigated by SPR technique. Methods: Two distinct strategies were used for immobilization of the anti-CD20 MAb onto gold (Au) chips. MUA (11-mercaptoundecanoic acid) and Staphylococcus aureus protein A (SpA) were the two systems used for this purpose. A suspension of CD20-positive Raji cells was injected in the analyte phase and the resulting interactions were analyzed and compared to those of MOLT-4 cell line as CD20-negative control. Results: Efficient binding of anti-CD20 MAb to the surface antigens of Raji cell line was confirmed by both immobilizing methods, whereas this MAb had not a noticeable affinity to the MOLT-4 cells. Conclusion: According to the outcomes, the investigated MAb had acceptable affinity and specificity to the target antigens on the cell surface and could be utilized for immuno-detection of CD20-positive intact cells by SPR method. PMID:28761820

  14. Current Role of Selective Internal Irradiation With Yttrium-90 Microspheres in the Management of Hepatocellular Carcinoma: A Systematic Review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lau, Wan Yee, E-mail: josephlau@cuhk.edu.hk; Lai, Eric C.H.; Leung, Thomas W.T.

    2011-10-01

    Purpose: This article reviews the role of selective internal irradiation (SIR) with yttrium-90 ({sup 90}Y) microspheres for hepatocellular carcinoma (HCC). Methods and Materials: Studies were identified by searching Medline and PubMed databases for articles from 1990 to 2009 using the keywords 'selective internal irradiation,' 'hepatocellular carcinoma,' 'therapeutic embolization,' and 'yttrium-90.' Results: {sup 90}Y microspheres are a safe and well-tolerated therapy for unresectable HCC (median survival range, 7 -21.6 months). The evidence was limited to cohort studies and comparative studies with historical control. {sup 90}Y microspheres have been reported to downstage unresectable HCC to allow for salvage treatments with curative intent,more » act as a bridging therapy before liver transplantation, and treat HCC with curative intent for patients who are not surgical candidates because of comorbidities. Conclusions: {sup 90}Y microsphere is recommended as an option of palliative therapy for large or multifocal HCC without major portal vein invasion or extrahepatic spread. It can also be used for recurrent unresectable HCC, as a bridging therapy before liver transplantation, as a tumor downstaging treatment, and as a curative treatment for patients with associated comorbidities who are not candidates for surgery.« less

  15. In vitro and in vivo comparison of binding of 99m-Tc-labeled anti-CEA MAb F33-104 with 99m-Tc-labeled anti-CEA MAb BW431/26.

    PubMed

    Watanabe, N; Oriuchi, N; Sugiyama, S; Kuroki, M; Matsuoka, Y; Tanada, S; Murata, H; Inoue, T; Sasaki, Y

    1999-01-01

    The purpose of this study was to assess the potential for radio-immunodetection (RAID) of murine anti-carcinoembryonic antigen (CEA) monoclonal antibody (MAb) F33-104 labeled with technetium-99m (99m-Tc) by a reduction-mediated labeling method. The binding capacity of 99m-Tc-labeled anti-CEA MAb F33-104 with CEA by means of in vitro procedures such as immunoradiometric assay and cell binding assay and the biodistribution of 99m-Tc-labeled anti-CEA MAb F33-104 in normal nude mice and nude mice bearing human colon adenocarcinoma LS180 tumor were investigated and compared with 99m-Tc-labeled anti-CEA MAb BW431/26. The in vitro binding rate of 99m-Tc-labeled anti-CEA MAb F33-104 with CEA in solution and attached to the cell membrane was significantly higher than 99m-Tc-labeled anti-CEA MAb BW431/261 (31.4 +/- 0.95% vs. 11.9 +/- 0.55% at 100 ng/mL of soluble CEA, 83.5 +/- 2.84% vs. 54.0 +/- 2.54% at 10(7) of LS 180 cells). In vivo, accumulation of 99m-Tc-labeled anti-CEA MAb F33-104 was higher at 18 h postinjection than 99m-Tc-labeled anti-CEA MAb BW431/26 (20.1 +/- 3.50% ID/g vs. 14.4 +/- 3.30% ID/g). 99m-Tc-activity in the kidneys of nude mice bearing tumor was higher at 18 h postinjection than at 3 h (12.8 +/- 2.10% ID/g vs. 8.01 +/- 2.40% ID/g of 99m-Tc-labeled anti-CEA MAb F33-104, 10.7 +/- 1.70% ID/g vs. 8.10 +/- 1.75% ID/g of 99m-Tc-labeled anti-CEA MAb BW431/26). 99m-Tc-labeled anti-CEA MAb F33-104 is a potential novel agent for RAID of recurrent colorectal cancer.

  16. Distribution of anti-CD68 (EBM11) immunoreactivity in formalin-fixed, paraffin-embedded bovine tissues.

    PubMed

    Ackermann, M R; DeBey, B M; Stabel, T J; Gold, J H; Register, K B; Meehan, J T

    1994-05-01

    A commercially acquired anti-human macrophage antibody (anti-CD68; EBM11) was used in an immunocytochemical technique to detect macrophages in formalin-fixed, paraffin-embedded tissues from cattle, pigs, humans, rats, turkeys, dogs, and cats. In healthy cattle, the antibody labeled alveolar macrophages, pulmonary intravascular cells (presumably intravascular macrophages), and macrophage-like cells in other tissues. In bovine lungs infected with Pasteurella haemolytica, EBM11 antibody labeled 95% of alveolar macrophages and macrophages within alveolar septa but only 0-2% of streaming or "oat" leukocytes. Alveolar macrophages were also stained by EBM11 in pigs but not in rats, turkeys, dogs, and cats. The antibody also stained macrophage aggregates in the mesenteric lymph nodes and intestinal lamina propria of Mycobacterium paratuberculosis-infected cattle. This study shows that the anti-CD68 (EBM11) antibody is a useful marker of macrophages in normal bovine tissues or tissues from areas of acute or chronic inflammation that have been routinely processed. The study also adds strength to the growing evidence suggesting that streaming leukocytes seen in pneumonic pasteurellosis are neutrophils.

  17. Fast simulation of yttrium-90 bremsstrahlung photons with GATE.

    PubMed

    Rault, Erwann; Staelens, Steven; Van Holen, Roel; De Beenhouwer, Jan; Vandenberghe, Stefaan

    2010-06-01

    Multiple investigators have recently reported the use of yttrium-90 (90Y) bremsstrahlung single photon emission computed tomography (SPECT) imaging for the dosimetry of targeted radionuclide therapies. Because Monte Carlo (MC) simulations are useful for studying SPECT imaging, this study investigates the MC simulation of 90Y bremsstrahlung photons in SPECT. To overcome the computationally expensive simulation of electrons, the authors propose a fast way to simulate the emission of 90Y bremsstrahlung photons based on prerecorded bremsstrahlung photon probability density functions (PDFs). The accuracy of bremsstrahlung photon simulation is evaluated in two steps. First, the validity of the fast bremsstrahlung photon generator is checked. To that end, fast and analog simulations of photons emitted from a 90Y point source in a water phantom are compared. The same setup is then used to verify the accuracy of the bremsstrahlung photon simulations, comparing the results obtained with PDFs generated from both simulated and measured data to measurements. In both cases, the energy spectra and point spread functions of the photons detected in a scintillation camera are used. Results show that the fast simulation method is responsible for a 5% overestimation of the low-energy fluence (below 75 keV) of the bremsstrahlung photons detected using a scintillation camera. The spatial distribution of the detected photons is, however, accurately reproduced with the fast method and a computational acceleration of approximately 17-fold is achieved. When measured PDFs are used in the simulations, the simulated energy spectrum of photons emitted from a point source of 90Y in a water phantom and detected in a scintillation camera closely approximates the measured spectrum. The PSF of the photons imaged in the 50-300 keV energy window is also accurately estimated with a 12.4% underestimation of the full width at half maximum and 4.5% underestimation of the full width at tenth maximum

  18. Possible role of CD22, CD79b and CD20 expression in distinguishing small lymphocytic lymphoma from chronic lymphocytic leukemia.

    PubMed

    Jovanovic, Danijela; Djurdjevic, Predrag; Andjelkovic, Nebojsa; Zivic, Ljubica

    2014-01-01

    Flow cytometry has an important role in diagnosis and classification of B-cell lymphoproliferative disorders (BCLPDs). However, in distinguishing chronic lymphocytic leukemia (CLL) from small lymphocytic lymphoma (SLL) only clinical criteria are available so far. Aim of the study was to determine differences in the expression of common B cell markers (CD22, CD79b and CD20) on the malignant lymphocytes in the peripheral blood samples of CLL and SLL patients. Peripheral blood samples of 56 CLL and 11 SLL patients were analyzed by 5-color flow cytometry on the CD45/CD19/CD5 gate for CD22, CD79b and CD20. In the samples collected from the CLL patients, CD22 expression was detected in only 20% of patients in the low pattern, while in SLL patients the expression was medium and present in 90.9% of patients (p < 0.0001). For CD79b expression, statistical significance is reached both in the expression pattern, which was low/medium for CLL and high for SLL, and expression level (p = 0.006). The expression of CD20 was counted as the CD20/CD19 ratio. The average ratio was 0.512 in the CLL patients vs. 0.931 in the SLL patients (p = 0.0001). The pattern of expression and expression level of CD22, CD79b and CD20 in peripheral blood could be used for distinguishing SLL from CLL patients.

  19. Production of Zr-89 using sputtered yttrium coin targets 89Zr using sputtered yttrium coin targets.

    PubMed

    Queern, Stacy Lee; Aweda, Tolulope Aramide; Massicano, Adriana Vidal Fernandes; Clanton, Nicholas Ashby; El Sayed, Retta; Sader, Jayden Andrew; Zyuzin, Alexander; Lapi, Suzanne Elizabeth

    2017-07-01

    An increasing interest in zirconium-89 ( 89 Zr) can be attributed to the isotope's half-life which is compatible with antibody imaging using positron emission tomography (PET). The goal of this work was to develop an efficient means of production for 89 Zr that provides this isotope with high radionuclidic purity and specific activity. We investigated the irradiation of yttrium sputtered niobium coins and compared the yields and separation efficiency to solid yttrium coins. The sputtered coins were irradiated with an incident beam energy of 17.5MeV or 17.8MeV providing a degraded transmitted energy through an aluminum degrader of 12.5MeV or 12.8MeV, respectively, with various currents to determine optimal cyclotron conditions for 89 Zr production. Dissolution of the solid yttrium coin took 2h with 50mL of 2M HCl and dissolution of the sputtered coin took 15-30min with 4mL of 2M HCl. During the separation of 89 Zr from the solid yttrium coins, 77.9 ± 11.2% of the activity was eluted off in an average of 7.3mL of 1M oxalic acid whereas for the sputtered coins, 91 ± 6% was eluted off in an average of 1.2mL of 1M oxalic acid with 100% radionuclidic purity. The effective specific activity determined via DFO-SCN titration from the sputtered coins was 108±7mCi/μmol as compared to 20.3mCi/μmol for the solid yttrium coin production. ICP-MS analysis of the yttrium coin and the sputtered coins showed 99.99% yttrium removed with 178μg of yttrium in the final solution and 99.93-100% of yttrium removed with remaining range of 0-42μg of yttrium in the final solution, respectively. The specific activity calculated for the solid coin and 3 different sputtered coins using the concentration of Zr found via ICP-MS was 140±2mCi/μmol, 300±30mCi/μmol, 410±60mCi/μmol and 1719±5mCi/μmol, respectively. Labeling yields of the 89 Zr produced via sputtered targets for 89 Zr- DFO-trastuzumab were >98%. Overall, these results show the irradiation of yttrium sputtered niobium coins

  20. Peptide receptor radionuclide therapy of treatment-refractory metastatic thyroid cancer using 90Yttrium and 177Lutetium labeled somatostatin analogs: toxicity, response and survival analysis

    PubMed Central

    Budiawan, Hendra; Salavati, Ali; Kulkarni, Harshad R; Baum, Richard P

    2014-01-01

    The overall survival rate of non-radioiodine avid differentiated (follicular, papillary, medullary) thyroid carcinoma is significantly lower than for patients with iodine-avid lesions. The purpose of this study was to evaluate toxicity and efficacy (response and survival) of peptide receptor radionuclide therapy (PRRT) in non-radioiodine-avid or radioiodine therapy refractory thyroid cancer patients. Sixteen non-radioiodine-avid and/or radioiodine therapy refractory thyroid cancer patients, including follicular thyroid carcinoma (n = 4), medullary thyroid carcinoma (n = 8), Hürthle cell thyroid carcinoma (n = 3), and mixed carcinoma (n = 1) were treated with PRRT by using 90Yttrium and/or 177Lutetium labeled somatostatin analogs. 68Ga somatostatin receptor PET/CT was used to determine the somatostatin receptor density in the residual tumor/metastatic lesions and to assess the treatment response. Hematological profiles and renal function were periodically examined after treatment. By using fractionated regimen, only mild, reversible hematological toxicity (grade 1) or nephrotoxicity (grade 1) were seen. Response assessment (using EORTC criteria) was performed in 11 patients treated with 2 or more (maximum 5) cycles of PRRT and showed disease stabilization in 4 (36.4%) patients. Two patients (18.2%) showed partial remission, in the remaining 5 patients (45.5%) disease remained progressive. Kaplan-Meier analysis resulted in a mean survival after the first PRRT of 4.2 years (95% CI, range 2.9-5.5) and median progression free survival of 25 months (inter-quartiles: 12-43). In non-radioiodine-avid/radioiodine therapy refractory thyroid cancer patients, PRRT is a promising therapeutic option with minimal toxicity, good response rate and excellent survival benefits. PMID:24380044

  1. Chimpanzees Immunized with Recombinant Soluble CD4 Develop Anti-Self CD4 Antibody Responses with Anti-Human Immunodeficiency Virus Activity

    NASA Astrophysics Data System (ADS)

    Watanabe, Mamoru; Boyson, Jonathan E.; Lord, Carol I.; Letvin, Norman L.

    1992-06-01

    In view of the efficiency with which human immunodeficiency virus replication can be blocked in vitro with anti-CD4 antibodies, the elicitation of an anti-CD4 antibody response through active immunization might represent a useful therapeutic strategy for AIDS. Here we demonstrate that immunization of chimpanzees with recombinant soluble human CD4 elicited an anti-CD4 antibody response. The elicited antibody bound self CD4 on digitonin-treated but not freshly isolated lymphocytes. Nevertheless, this antibody blocked human immunodeficiency virus replication in chimpanzee and human lymphocytes. These observations suggest that immunization with recombinant soluble CD4 from human immunodeficiency virus-infected humans may be feasible and therapeutically beneficial.

  2. Anti-leukemic activity and tolerability of anti-human CD47 monoclonal antibodies

    PubMed Central

    Pietsch, E C; Dong, J; Cardoso, R; Zhang, X; Chin, D; Hawkins, R; Dinh, T; Zhou, M; Strake, B; Feng, P-H; Rocca, M; Santos, C Dos; Shan, X; Danet-Desnoyers, G; Shi, F; Kaiser, E; Millar, H J; Fenton, S; Swanson, R; Nemeth, J A; Attar, R M

    2017-01-01

    CD47, a broadly expressed cell surface protein, inhibits cell phagocytosis via interaction with phagocyte-expressed SIRPα. A variety of hematological malignancies demonstrate elevated CD47 expression, suggesting that CD47 may mediate immune escape. We discovered three unique CD47-SIRPα blocking anti-CD47 monoclonal antibodies (mAbs) with low nano-molar affinity to human and cynomolgus monkey CD47, and no hemagglutination and platelet aggregation activity. To characterize the anti-cancer activity elicited by blocking CD47, the mAbs were cloned into effector function silent and competent Fc backbones. Effector function competent mAbs demonstrated potent activity in vitro and in vivo, while effector function silent mAbs demonstrated minimal activity, indicating that blocking CD47 only leads to a therapeutic effect in the presence of Fc effector function. A non-human primate study revealed that the effector function competent mAb IgG1 C47B222-(CHO) decreased red blood cells (RBC), hematocrit and hemoglobin by >40% at 1 mg/kg, whereas the effector function silent mAb IgG2σ C47B222-(CHO) had minimal impact on RBC indices at 1 and 10 mg/kg. Taken together, our findings suggest that targeting CD47 is an attractive therapeutic anti-cancer approach. However, the anti-cancer activity observed with anti-CD47 mAbs is Fc effector dependent as are the side effects observed on RBC indices. PMID:28234345

  3. Intraläsionale Therapie niedrig maligner primär kutaner B-Zell-Lymphome mit Anti-CD20-Antikörper: Nebenwirkungen korrelieren mit gutem klinischen Ansprechen.

    PubMed

    Eberle, Franziska C; Holstein, Julia; Scheu, Alexander; Fend, Falko; Yazdi, Amir S

    2017-03-01

    Die intraläsionale Gabe von Anti-CD20-Antikörpern (Rituximab) wurde als effektive Therapieoption für Patienten mit niedrig malignen primär kutanen B-Zell-Lymphomen beschrieben. Bis heute wurden allerdings keine Parameter identifiziert, welche reproduzierbar ein gutes klinisches Ansprechen dieser Therapie vorhersagen. Ziel dieser Studie ist, sowohl das klinische Ansprechen und die unerwünschten Nebenwirkungen als auch die Patientenwahrnehmung hinsichtlich intraläsionaler Injektionen von anti-CD20-Antikörpern zur Behandlung indolenter primär kutaner B-Zell-Lymphome im Vergleich mit anderen Therapien zu evaluieren. Elf Patienten mit einem primär kutanen B-Zell-Lymphom, namentlich primär kutanes Keimzentrumslymphom (n = 9) und primär kutanes Marginalzonenlymphom (n = 2), welche mittels intraläsionalem Anti-CD20-Antikörper behandelt wurden, wurden retrospektiv evaluiert hinsichtlich der Ansprechrate und unerwünschter Nebenwirkungen sowie in Bezug auf deren Selbsteinschätzung dieser und anderer Therapien des primär kutanen B-Zell-Lymphoms. Patienten, deren primär kutanes B-Zell-Lymphom mittels intraläsionaler Gabe von Anti-CD20-Antikörper behandelt wurde, zeigten ein komplettes oder partielles Ansprechen in 45 % beziehungsweise 27 % aller Patienten. Speziell Patienten mit grippeähnlichen Symptomen nach erfolgter Injektion zeigten ein gutes Ansprechen. Die Mehrheit der Patienten empfand die Therapie mit Rituximab als die beste Therapie im Vergleich zu anderen Therapien wie beispielsweise chirurgische Exzision oder Radiotherapie. Intraläsionales Rituximab ist eine effektive Therapie mit hoher Patientenzufriedenheit. Starke therapiebedingte Nebenwirkungen wie Fieber, Schüttelfrost und Kopfschmerzen nach Gabe von Rituximab könnten als Indikator für gute Wirksamkeit dienen. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

  4. Combination of two anti-CD5 monoclonal antibodies synergistically induces complement-dependent cytotoxicity of chronic lymphocytic leukaemia cells.

    PubMed

    Klitgaard, Josephine L; Koefoed, Klaus; Geisler, Christian; Gadeberg, Ole V; Frank, David A; Petersen, Jørgen; Jurlander, Jesper; Pedersen, Mikkel W

    2013-10-01

    The treatment of chronic lymphocytic leukaemia (CLL) has been improved by introduction of monoclonal antibodies (mAbs) that exert their effect through secondary effector mechanisms. CLL cells are characterized by expression of CD5 and CD23 along with CD19 and CD20, hence anti-CD5 Abs that engage secondary effector functions represent an attractive opportunity for CLL treatment. Here, a repertoire of mAbs against human CD5 was generated and tested for ability to induce complement-dependent cytotoxicity (CDC) and antibody-dependent cell-mediated cytotoxicity (ADCC) both as single mAbs and combinations of two mAbs against non-overlapping epitopes on human CD5. The results demonstrated that combinations of two mAbs significantly increased the level of CDC compared to the single mAbs, while no enhancement of ADCC was seen with anti-CD5 mAb combinations. High levels of CDC and ADCC correlated with low levels of Ab-induced CD5 internalization and degradation. Importantly, an anti-CD5 mAb combination enhanced CDC of CLL cells when combined with the anti-CD20 mAbs rituximab and ofatumumab as well as with the anti-CD52 mAb alemtuzumab. These results suggest that an anti-CD5 mAb combination inducing CDC and ADCC may be effective alone, in combination with mAbs against other targets or combined with chemotherapy for CLL and other CD5-expressing haematological or lymphoid malignancies. © 2013 John Wiley & Sons Ltd.

  5. Feasibility assessment of yttrium-90 liver radioembolization imaging using amplitude-based gated PET/CT

    PubMed Central

    Acuff, Shelley N.; Neveu, Melissa L.; Syed, Mumtaz; Kaman, Austin D.; Fu, Yitong

    2018-01-01

    Purpose The usage of PET/computed tomography (CT) to monitor hepatocellular carcinoma patients following yttrium-90 (90Y) radioembolization has increased. Respiratory motion causes liver movement, which can be corrected using gating techniques at the expense of added noise. This work examines the use of amplitude-based gating on 90Y-PET/CT and its potential impact on diagnostic integrity. Patients and methods Patients were imaged using PET/CT following 90Y radioembolization. A respiratory band was used to collect respiratory cycle data. Patient data were processed as both standard and motion-corrected images. Regions of interest were drawn and compared using three methods. Activity concentrations were calculated and converted into dose estimates using previously determined and published scaling factors. Diagnostic assessments were performed using a binary scale created from published 90Y-PET/CT image interpretation guidelines. Results Estimates of radiation dose were increased (P<0.05) when using amplitude-gating methods with 90Y PET/CT imaging. Motion-corrected images show increased noise, but the diagnostic determination of success, using the Kao criteria, did not change between static and motion-corrected data. Conclusion Amplitude-gated PET/CT following 90Y radioembolization is feasible and may improve 90Y dose estimates while maintaining diagnostic assessment integrity. PMID:29351124

  6. A preclinical model of CD38-pretargeted radioimmunotherapy for plasma cell malignancies.

    PubMed

    Green, Damian J; Orgun, Nural N; Jones, Jon C; Hylarides, Mark D; Pagel, John M; Hamlin, Donald K; Wilbur, D S; Lin, Yukang; Fisher, Darrell R; Kenoyer, Aimee L; Frayo, Shani L; Gopal, Ajay K; Orozco, Johnnie J; Gooley, Theodore A; Wood, Brent L; Bensinger, William I; Press, Oliver W

    2014-02-15

    The vast majority of patients with plasma cell neoplasms die of progressive disease despite high response rates to novel agents. Malignant plasma cells are very radiosensitive, but the potential role of radioimmunotherapy (RIT) in the management of plasmacytomas and multiple myeloma has undergone only limited evaluation. Furthermore, CD38 has not been explored as a RIT target despite its uniform high expression on malignant plasma cells. In this report, both conventional RIT (directly radiolabeled antibody) and streptavidin-biotin pretargeted RIT (PRIT) directed against the CD38 antigen were assessed as approaches to deliver radiation doses sufficient for multiple myeloma cell eradication. PRIT demonstrated biodistributions that were markedly superior to conventional RIT. Tumor-to-blood ratios as high as 638:1 were seen 24 hours after PRIT, whereas ratios never exceeded 1:1 with conventional RIT. (90)Yttrium absorbed dose estimates demonstrated excellent target-to-normal organ ratios (6:1 for the kidney, lung, liver; 10:1 for the whole body). Objective remissions were observed within 7 days in 100% of the mice treated with doses ranging from 800 to 1,200 μCi of anti-CD38 pretargeted (90)Y-DOTA-biotin, including 100% complete remissions (no detectable tumor in treated mice compared with tumors that were 2,982% ± 2,834% of initial tumor volume in control animals) by day 23. Furthermore, 100% of animals bearing NCI-H929 multiple myeloma tumor xenografts treated with 800 μCi of anti-CD38 pretargeted (90)Y-DOTA-biotin achieved long-term myeloma-free survival (>70 days) compared with none (0%) of the control animals. ©2013 AACR.

  7. Aberrant expression of cancer stem cell markers (CD44, CD90, and CD133) contributes to disease progression and reduced survival in hepatoblastoma patients: 4-year survival data.

    PubMed

    Bahnassy, Abeer A; Fawzy, Mohamed; El-Wakil, Mohamed; Zekri, Abdel-Rahman N; Abdel-Sayed, Ahmed; Sheta, Marwa

    2015-03-01

    Hepatoblastoma (HB) is an embryonal tumor of the liver in children. Prognosis and response to treatment in HB are highly variable. Cancer stem cells (CSCs) constitute a population of cells, which contribute to the development and progression of many tumors. However, their role in HB is not well defined yet. We assessed the prognostic and predictive values of some CSC markers in HB patients. Protein and messenger RNA expressions of the CSC markers CD133, CD90, and CD44 were assessed in 43 HB patients and 20 normal hepatic tissues using immunohistochemistry and quantitative real-time polymerase chain reaction. The expression levels of these markers were correlated to standard prognostic factors, patients' response to treatment, overall survival (OS), and disease-free survival (DFS). CD44, CD90, and CD133 proteins were detected in 48.8%, 32.6%, and 48.8% compared with 46.5%, 41.7%, and 58.1% RNA, respectively (concordance, 77.8%-96%). None of the normal tissue samples was positive for any of the markers. Significant correlations were reported between α-fetoprotein and both CD44 and CD133 (P = 0.02) as well as between tumor types CD90 and CD133 (P = 0.009). Reduced OS correlated with CD44, CD90, and CD133 expressions (P < 0.001), advanced stage (P < 0.001), response to treatment (P < 0.001), and total excision of the tumor. Reduced DFS correlated with CD44 and CD133 expressions (P < 0.001) only. In conclusion, CD133, CD44, and CD90 could be used as prognostic and predictive markers in HB. High expression of these markers is significantly associated with poor response to treatment and reduced survival. Moreover, complete surgical resection and systemic chemotherapy are essential to achieve good response and prolonged survival, especially in early stage patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. CD20-based Immunotherapy of B-cell Derived Hematologic Malignancies.

    PubMed

    Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili

    2017-01-01

    CD20 is a surface antigen, which is expressed at certain stages of B-cell differentiation. Targeting the CD20-positive B-cells with therapeutic monoclonal antibodies (MAbs) has been an effectual strategy in the treatment of hematologic malignancies such as non-Hodgkin's lymphoma (NHL) and chronic lymphocytic leukemia (CLL). Initial success with Rituximab (RTX) has encouraged the creation and development of more effective CD20 based therapeutics. However, treatment with conventional MAbs has not been adequate to overcome the problems such as refractory/ relapsed disease. In this regard, new generations of MAbs with enhanced affinity or improved anti-tumor properties have been developed. CD20 directed therapeutics have heterogeneous features and mechanisms of action. Hence, having sufficient knowledge on the immunological and molecular aspects of CD20 based cancer therapy is necessary for predicting the clinical outcomes and taking the necessary measures. An extensive search was performed in PubMed and similar databases for peer-reviewed articles concerning the biology, function and characteristics of CD20 molecule as well as the mechanisms of action and evolutionary process of CD20 targeting agents. This review provides information about the current situation of CD20 targeting immunotherapeutics including MAbs, bispecific antibodies (which exert multiple functions or involve Tcells in tumor elimination) and CAR T-cells (engineered T-cells armed with chimeric antigen receptors). Moreover, limitations, challenges and available solutions regarding the application of CD20 targeting treatments are addressed. Utilization of CD20-targeted therapeutics, due to their diverse properties, requires special considerations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  9. Tumor-Targeting Anti-CD20 Antibodies Mediate In Vitro Expansion of Memory Natural Killer Cells: Impact of CD16 Affinity Ligation Conditions and In Vivo Priming.

    PubMed

    Capuano, Cristina; Battella, Simone; Pighi, Chiara; Franchitti, Lavinia; Turriziani, Ombretta; Morrone, Stefania; Santoni, Angela; Galandrini, Ricciarda; Palmieri, Gabriella

    2018-01-01

    Natural killer (NK) cells represent a pivotal player of innate anti-tumor immune responses. The impact of environmental factors in shaping the representativity of different NK cell subsets is increasingly appreciated. Human cytomegalovirus (HCMV) infection profoundly affects NK cell compartment, as documented by the presence of a CD94/NKG2C + FcεRIγ - long-lived "memory" NK cell subset, endowed with enhanced CD16-dependent functional capabilities, in a fraction of HCMV-seropositive subjects. However, the requirements for memory NK cell pool establishment/maintenance and activation have not been fully characterized yet. Here, we describe the capability of anti-CD20 tumor-targeting therapeutic monoclonal antibodies (mAbs) to drive the selective in vitro expansion of memory NK cells and we show the impact of donor' HCMV serostatus and CD16 affinity ligation conditions on this event. In vitro expanded memory NK cells maintain the phenotypic and functional signature of their freshly isolated counterpart; furthermore, our data demonstrate that CD16 affinity ligation conditions differently affect memory NK cell proliferation and functional activation, as rituximab-mediated low-affinity ligation represents a superior proliferative stimulus, while high-affinity aggregation mediated by glycoengineered obinutuzumab results in improved multifunctional responses. Our work also expands the molecular and functional characterization of memory NK cells, and investigates the possible impact of CD16 functional allelic variants on their in vivo and in vitro expansions. These results reveal new insights in Ab-driven memory NK cell responses in a therapeutic setting and may ultimately inspire new NK cell-based intervention strategies against cancer, in which the enhanced responsiveness to mAb-bound target could significantly impact therapeutic efficacy.

  10. 21 CFR 341.90 - Professional labeling.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Professional labeling. 341.90 Section 341.90 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE COLD, COUGH, ALLERGY, BRONCHODILATOR, AND ANTIASTHMATIC DRUG PRODUCTS FOR OVER-THE-COUNTER...

  11. 21 CFR 341.90 - Professional labeling.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 5 2011-04-01 2011-04-01 false Professional labeling. 341.90 Section 341.90 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE COLD, COUGH, ALLERGY, BRONCHODILATOR, AND ANTIASTHMATIC DRUG PRODUCTS FOR OVER-THE-COUNTER...

  12. 21 CFR 341.90 - Professional labeling.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 5 2014-04-01 2014-04-01 false Professional labeling. 341.90 Section 341.90 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE COLD, COUGH, ALLERGY, BRONCHODILATOR, AND ANTIASTHMATIC DRUG PRODUCTS FOR OVER-THE-COUNTER...

  13. 21 CFR 341.90 - Professional labeling.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 5 2012-04-01 2012-04-01 false Professional labeling. 341.90 Section 341.90 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE COLD, COUGH, ALLERGY, BRONCHODILATOR, AND ANTIASTHMATIC DRUG PRODUCTS FOR OVER-THE-COUNTER...

  14. 21 CFR 341.90 - Professional labeling.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 5 2013-04-01 2013-04-01 false Professional labeling. 341.90 Section 341.90 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE COLD, COUGH, ALLERGY, BRONCHODILATOR, AND ANTIASTHMATIC DRUG PRODUCTS FOR OVER-THE-COUNTER...

  15. Anti-CD22 and anti-CD79B antibody drug conjugates are active in different molecular diffuse large B-cell lymphoma subtypes.

    PubMed

    Pfeifer, M; Zheng, B; Erdmann, T; Koeppen, H; McCord, R; Grau, M; Staiger, A; Chai, A; Sandmann, T; Madle, H; Dörken, B; Chu, Y-W; Chen, A I; Lebovic, D; Salles, G A; Czuczman, M S; Palanca-Wessels, M C; Press, O W; Advani, R; Morschhauser, F; Cheson, B D; Lenz, P; Ott, G; Polson, A G; Mundt, K E; Lenz, G

    2015-07-01

    Antibody drug conjugates (ADCs), in which cytotoxic drugs are linked to antibodies targeting antigens on tumor cells, represent promising novel agents for the treatment of malignant lymphomas. Pinatuzumab vedotin is an anti-CD22 ADC and polatuzumab vedotin an anti-CD79B ADC that are both linked to the microtubule-disrupting agent monomethyl auristatin E (MMAE). In the present study, we analyzed the activity of these agents in different molecular subtypes of diffuse large B-cell lymphoma (DLBCL) both in vitro and in early clinical trials. Both anti-CD22-MMAE and anti-CD79B-MMAE were highly active and induced cell death in the vast majority of activated B-cell-like (ABC) and germinal center B-cell-like (GCB) DLBCL cell lines. Similarly, both agents induced cytotoxicity in models with and without mutations in the signaling molecule CD79B. In line with these observations, relapsed and refractory DLBCL patients of both subtypes responded to these agents. Importantly, a strong correlation between CD22 and CD79B expression in vitro and in vivo was not detectable, indicating that patients should not be excluded from anti-CD22-MMAE or anti-CD79B-MMAE treatment because of low target expression. In summary, these studies suggest that pinatuzumab vedotin and polatuzumab vedotin are active agents for the treatment of patients with different subtypes of DLBCL.

  16. Assessment of cell death mechanisms triggered by 177Lu-anti-CD20 in lymphoma cells.

    PubMed

    Azorín-Vega, E; Rojas-Calderón, E; Martínez-Ventura, B; Ramos-Bernal, J; Serrano-Espinoza, L; Jiménez-Mancilla, N; Ordaz-Rosado, D; Ferro-Flores, G

    2018-08-01

    The aim of this research was to evaluate the cell cycle redistribution and activation of early and late apoptotic pathways in lymphoma cells after treatment with 177 Lu-anti-CD20. Experimental and computer models were used to calculate the radiation absorbed dose to cancer cell nuclei. The computer model (Monte Carlo, PENELOPE) consisted of twenty spheres representing cells with an inner sphere (cell nucleus) embedded in culture media. Radiation emissions of the radiopharmaceutical located in cell membranes and in culture media were considered for nuclei dose calculations. Flow cytometric analyses demonstrated that doses as low as 4.8Gy are enough to induce cell cycle arrest and activate late apoptotic pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Activating Photodynamic Therapy in vitro with Cerenkov Radiation Generated from Yttrium-90

    PubMed Central

    Hartl, Brad A.; Hirschberg, Henry; Marcu, Laura; Cherry, Simon R.

    2017-01-01

    The translation of photodynamic therapy (PDT) to the clinical setting has primarily been limited to easily accessible and/or superficial diseases, for which traditional light delivery can be performed noninvasively. Cerenkov radiation, as generated from medically relevant radionuclides, has been suggested as a means to deliver light to deeper tissues noninvasively to overcome this depth limitation. This article investigates the utility of Cerenkov radiation, as generated from the radionuclide yttrium-90, for activating the PDT process using clinically approved aminolevulinic acid at 1.0 mm and also the more efficient porphyrin-based photosensitizer mesotetraphenylporphine with two sulfonate groups on adjacent phenyl rings (TPPS2a) at 1.2 μM. Experiments were conducted with monolayer cultured glioma and breast tumor cell lines. Although aminolevulinic acid proved to be ineffective for generating a therapeutic effect at all but the highest activity levels, TPPS2a produced at least a 20% therapeutic effect at activities ranging from 6 to 60 μCi/well for the C6 glioma cell line. Importantly, these results demonstrate for the first time, to our knowledge, that Cerenkov radiation generated from a radionuclide can be used to activate PDT using clinically relevant photosensitizers. These results therefore provide evidence that it may be possible to generate a phototherapeutic effect in vivo using Cerenkov radiation and clinically relevant photosensitizers. PMID:27481495

  18. Optimization of yttrium-90 PET for simultaneous PET/MR imaging: A phantom study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eldib, Mootaz

    2016-08-15

    Purpose: Positron emission tomography (PET) imaging of yttrium-90 in the liver post radioembolization has been shown useful for personalized dosimetry calculations and evaluation of extrahepatic deposition. The purpose of this study was to quantify the benefits of several MR-based data correction approaches offered by using a combined PET/MR system to improve Y-90 PET imaging. In particular, the feasibility of motion and partial volume corrections were investigated in a controlled phantom study. Methods: The ACR phantom was filled with an initial concentration of 8 GBq of Y-90 solution resulting in a contrast of 10:1 between the hot cylinders and the background.more » Y-90 PET motion correction through motion estimates from MR navigators was evaluated by using a custom-built motion stage that simulated realistic amplitudes of respiration-induced liver motion. Finally, the feasibility of an MR-based partial volume correction method was evaluated using a wavelet decomposition approach. Results: Motion resulted in a large (∼40%) loss of contrast recovery for the 8 mm cylinder in the phantom, but was corrected for after MR-based motion correction was applied. Partial volume correction improved contrast recovery by 13% for the 8 mm cylinder. Conclusions: MR-based data correction improves Y-90 PET imaging on simultaneous PET/MR systems. Assessment of these methods must be studied further in the clinical setting.« less

  19. Labelling of 90Y- and 177Lu-DOTA-Bioconjugates for Targeted Radionuclide Therapy: A Comparison among Manual, Semiautomated, and Fully Automated Synthesis.

    PubMed

    Iori, Michele; Capponi, Pier C; Rubagotti, Sara; Esposizione, Luca Rosario; Seemann, Johanna; Pitzschler, Riccardo; Dreger, Thorsten; Formisano, Debora; Grassi, Elisa; Fioroni, Federica; Versari, Annibale; Asti, Mattia

    2017-01-01

    In spite of the hazard due to the radiation exposure, preparation of 90 Y- and 177 Lu-labelled radiopharmaceuticals is still mainly performed using manual procedures. In the present study the performance of a commercial automatic synthesizer based on disposable cassettes for the labelling of 177 Lu- and 90 Y-DOTA-conjugated biomolecules (namely, DOTATOC and PSMA-617) was evaluated and compared to a manual and a semiautomated approach. The dose exposure of the operators was evaluated as well. More than 300 clinical preparations of both 90 Y- and 177 Lu-labelled radiopharmaceuticals have been performed using the three different methods. The mean radiochemical yields for 90 Y-DOTATOC were 96.2 ± 4.9%, 90.3 ± 5.6%, and 82.0 ± 8.4%, while for 177 Lu-DOTATOC they were 98.3%  ± 0.6, 90.8%  ± 8.3, and 83.1 ± 5.7% when manual, semiautomated, and automated approaches were used, respectively. The mean doses on the whole hands for yttrium-90 preparations were 0.15 ± 0.4 mSv/GBq, 0.04 ± 0.1 mSv/GBq, and 0.11 ± 0.3 mSv/GBq for manual, semiautomated, and automated synthesis, respectively, and for lutetium-177 preparations, they were 0.02 ± 0.008 mSv/GBq, 0.01 ± 0.03 mSv/GBq, and 0.01 ± 0.02 mSv/GBq, respectively. In conclusion, the automated approach guaranteed reliable and reproducible preparations of pharmaceutical grade therapeutic radiopharmaceuticals in a decent RCY. The radiation exposure of the operators remained comparable to the manual approach mainly due to the fact that a dedicated shielding was still not available for the system.

  20. Cloning and molecular characterization of the cDNAs encoding the variable regions of an anti-CD20 monoclonal antibody.

    PubMed

    Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili

    2017-01-01

    CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.

  1. Antibodies against CD20 or B-Cell Receptor Induce Similar Transcription Patterns in Human Lymphoma Cell Lines

    PubMed Central

    Franke, Andreas; Niederfellner, Gerhard J.; Klein, Christian; Burtscher, Helmut

    2011-01-01

    Background CD20 is a cell surface protein exclusively expressed on B cells. It is a clinically validated target for Non-Hodgkin's lymphomas (NHL) and autoimmune diseases. The B cell receptor (BCR) plays an important role for development and proliferation of pre-B and B cells. Physical interaction of CD20 with BCR and components of the BCR signaling cascade has been reported but the consequences are not fully understood. Methodology In this study we employed antibodies against CD20 and against the BCR to trigger the respective signaling. These antibodies induced very similar expression patterns of up- and down-regulated genes in NHL cell lines indicating that CD20 may play a role in BCR signaling and vice versa. Two of the genes that were rapidly and transiently induced by both stimuli are CCL3 and CCL4. 4 hours after stimulation the concentration of these chemokines in culture medium reaches a maximum. Spleen tyrosine kinase Syk is a cytoplasmic tyrosine kinase and a key component of BCR signaling. Both siRNA mediated silencing of Syk and inhibition by selective small molecule inhibitors impaired CCL3/CCL4 protein induction after treatment with either anti-CD20 or anti-BCR antibodies. Conclusion Our results suggest that treatment with anti-CD20 antibodies triggers at least partially a BCR activation-like response in NHL cell lines. PMID:21364752

  2. A comparative analysis of conventional and pretargeted radioimmunotherapy of B-cell lymphomas by targeting CD20, CD22, and HLA-DR singly and in combinations

    PubMed Central

    Orgun, Nural; Hamlin, Donald K.; Wilbur, D. Scott; Gooley, Theodore A.; Gopal, Ajay K.; Park, Steven I.; Green, Damian J.; Lin, Yukang; Press, Oliver W.

    2009-01-01

    Relapsed B-cell lymphomas are currently incurable with conventional chemotherapy and radiation treatments. Radiolabeled antibodies directed against B-cell surface antigens have emerged as effective and safe therapies for relapsed lymphomas. We therefore investigated the potential utility of both directly radiolabeled 1F5 (anti-CD20), HD39 (anti-CD22), and Lym-1 (anti-DR) antibodies (Abs) and of pretargeted radioimmunotherapy (RIT) using Ab-streptavidin (SA) conjugates, followed by an N-acetylgalactosamine dendrimeric clearing agent and radiometal-labeled DOTA-biotin, for treatment of lymphomas in mouse models using Ramos, Raji, and FL-18 human lymphoma xenografts. This study demonstrates the marked superiority of pretargeted RIT for each of the antigenic targets with more complete tumor regressions and longer mouse survival compared with conventional one-step RIT. The Ab-SA conjugate yielding the best tumor regression and progression-free survival after pretargeted RIT varied depending upon the lymphoma cell line used, with 1F5 Ab-SA and Lym-1 Ab-SA conjugates yielding the most promising results overall. Contrary to expectations, the best rates of mouse survival were obtained using optimal single Ab-SA conjugates rather than combinations of conjugates targeting different antigens. We hypothesize that clinical implementation of pretargeted RIT methods will provide a meaningful prolongation of survival for patients with relapsed lymphomas compared with currently available treatment strategies. PMID:19124831

  3. Production of anti-CD14 monoclonal antibody using synthetic peptide of human CD14 as immunizing antigen.

    PubMed

    Maleki, Leili Aghebati; Shanehbandi, Dariush; Majidi, Jafar; Yusefi, Mehdi; Abdolalizadeh, Jalal; Orangi, Mona; Baradaran, Behzad

    2013-01-01

    CD14 is a myeloid differentiation antigen expressed primarily on peripheral blood monocytes, dendritic cells and macrophages. It is a key regulator of inflammatory responses to gram-negative bacteria, oxidative burst and septic shock. The aim of this study was to produce and characterize monoclonal antibody against CD14 for use in detection and diagnosis of monocytes. To produce MAb against CD14 protein, mice were immunized with two KLH-conjugated CD14 peptides. The spleen cells of the immunized mice were then fused with SP2/0 by hybridoma technique. Fused cells were grown in selective medium and cloned by limiting dilution method. The desired clones were selected and supernatants of hybridoma cells were screened by ELISA for antibody. Monoclonal antibody was purified by chromatography and confirmed by SDS-PAGE. Finally, immunoblotting and flowcytometry were recruited to explore the specificity of the MAb. Our results showed successful production and characterization of anti CD14 monoclonal antibody. The MAb was IgG2a with Kappa light chain and immunobloting and flowcytometry results demonstrated specific reactivity of this MAb with CD14. The results show that, the produced anti- CD14 MAb is highly specific and functional in biomedical applications such as flow cytometry and western blotting and could be utilized for identification of monocytes.

  4. The HDAC inhibitor valproate induces a bivalent status of the CD20 promoter in CLL patients suggesting distinct epigenetic regulation of CD20 expression in CLL in vivo

    PubMed Central

    Scialdone, Annarita; Hasni, Muhammad Sharif; Damm, Jesper Kofoed; Lennartsson, Andreas; Gullberg, Urban; Drott, Kristina

    2017-01-01

    Treatment with anti-CD20 antibodies is only moderately efficient in chronic lymphocytic leukemia (CLL), a feature which has been explained by the inherently low CD20 expression in CLL. It has been shown that CD20 is epigenetically regulated and that histone deacetylase inhibitors (HDACis) can increase CD20 expression in vitro in CLL. To assess whether HDACis can upregulate CD20 also in vivo in CLL, the HDACi valproate was given to three del13q/NOTCH1wt CLL patients and CD20 levels were analysed (the PREVAIL study). Valproate treatment resulted in expected global activating histone modifications suggesting HDAC inhibitory effects. However, although valproate induced expression of CD20 mRNA and protein in the del13q/NOTCH1wt I83-E95 CLL cell line, no such effects were observed in the patients studied. In contrast to the cell line, in patients valproate treatment resulted in transient recruitment of the transcriptional repressor EZH2 to the CD20 promoter, correlating to an increase of the repressive histone mark H3K27me3. This suggests that valproate-mediated induction of CD20 may be hampered by EZH2 mediated H3K27me3 in vivo in CLL. Moreover, valproate treatment resulted in induction of EZH2 and global H3K27me3 in patient cells, suggesting transcriptionally repressive effects of valproate in CLL. Our results suggest new in vivo mechanisms of HDACis which may have implications on the design of future clinical trials in B-cell malignancies. PMID:28445158

  5. Astatine-211 conjugated to an anti-CD20 monoclonal antibody eradicates disseminated B-cell lymphoma in a mouse model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Green, Damian J.; Shadman, Mazyar; Jones, Jon C.

    Alpha emitting radionuclides release a large amount of energy within a few cell diameters and may be particularly effective for radioimmunotherapy targeting minimal residual disease (MRD) conditions in which micrometastatic disease satellites are broadly distributed. To evaluate this hypothesis, 211At conjugated 1F5 mAb (anti-CD20) was studied in both bulky lymphoma tumor xenograft and MRD animal models. Superior treatment responses to 211At conjugated 1F5 mAb were evident in the MRD setting. Lymphoma xenograft tumor bearing animals treated with doses of up to 48µCi of anti-CD20 211At-decaborate [211At-B10-1F5] experienced modest responses (0% cures but 2-3-fold prolongation of survival compared to negative controls).more » In contrast, 70% of animals in the MRD lymphoma model demonstrated complete eradication of disease when treated with 211At-B10-1F5 at a radiation dose that was less than one-third (15 µCi) of the highest dose given to xenograft animals. Tumor progression among untreated control animals in both models was uniformly lethal. After 130 days, no significant renal or hepatic toxicity is observed in the cured animals receiving 15 µCi of 211At-B10-1F5. These findings suggest that in a MRD lymphoma model, where isolated cells and tumor microclusters prevail, α-emitters may be uniquely efficacious.« less

  6. Yttrium-90 and indium-111 labelling, receptor binding and biodistribution of [DOTA0,d-Phe1,Tyr3]octreotide, a promising somatostatin analogue for radionuclide therapy.

    PubMed

    de Jong, M; Bakker, W H; Krenning, E P; Breeman, W A; van der Pluijm, M E; Bernard, B F; Visser, T J; Jermann, E; Béhé, M; Powell, P; Mäcke, H R

    1997-04-01

    In vitro octreotide receptor binding of [111In-DOTA0,d-Phe1, Tyr3]octreotide (111In-DOTATOC) and the in vivo metabolism of 90Y- or 111In-labelled DOTATOC were investigated in rats in comparison with [111In-DTPA0]octreotide [111In-DTPAOC). 111In-DOTATOC was found to have an affinity similar to octreotide itself for the octreotide receptor in rat cerebral cortex microsomes. Twenty-four hours after injection of 90Y- or 111In-labelled DOTATOC, uptake of radioactivity in the octreotide receptor-expressing tissues pancreas, pituitary, adrenals and tumour was a factor of 2-6 that after injection of 111In-DTPAOC. Uptake of labelled DOTATOC in pituitary, pancreas, adrenals and tumour was almost completely blocked by pretreatment with 0.5 mg unlabelled octreotide, indicating specific binding to the octreotide receptors. These findings strongly indicate that 90Y-DOTATOC is a promising radiopharmaceutical for radiotherapy and that 111In-DOTATOC is of potential value for diagnosis of patients with octreotide receptor-positive lesions, such as most neuroendocrine tumours.

  7. Yttrium-90 DOTA peptide chimeric L6 toxicity and therapeutic potential in nude mice with human breast tumors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DeNardo, S.J.; Zhong, G.R.; Miers, L.A.

    1994-05-01

    Chimeric L6 MoAb (ChL6) as I-131 ChL6 has shown therapeutic promise for radioimmunotherapy in breast cancer patients. In order to enhance this therapeutic potential, we have developed an yttrium-90 (Y-90) ChL6 radiopharmaceutical by conjugating Y-90 DOTA peptide to ChL6 using DOTA-Gly-3L(p-isothiocyanato)-Phe-NH2. This DOTA peptide forms neutral complexes with trivalent metals allowing excess chelating agents and divalent metal complexes to be removed by ion exchange chromatography prior to conjugation, thus yielding a high Y-90/DOTA ratio on the final immune conjugate. Groups of 9-10 nude mice bearing subcutaneous 40-200 mg HBT 3477 xenographs were given 150,250,350,400,450 or 500 {mu}Ci of Y-90 DOTAmore » peptide ChL6 (specific activity 1.1-3.5 {mu}Ci/{mu}g). Live cell immunoreactivity was 73-80% and 100% Y-90 moved with ChL6 on SEC3000 HPLC and TLC. Peripheral blood counts, weight, tumor size, blood and body clearance of Y-90 were monitored for 10 weeks. Whole body autoradiography was performed at 1,3 and 5 days post injection at the 250 and 450 {mu}Ci dose levels. No mouse that received less than 450 {mu}Ci of Y-90 died. The LD50/30 was 479 {mu}Ci. The nadirs of RBC, WBC and platelets were 10-20 days post 479 {mu}Ci. The nadirs of RBC, WBC and platelets were 10-20 days post injection. The depth of the nadir was dose dependent but occured in all groups. In the lowest dose group having substantial tumor response (350{mu}Ci) mean tumor volume decreased by >50% and 5 of 19 tumors completely regressed over the 10 week follow-up. This is the greatest LD50/30 for Y-90 immunoconjugate reported in nude mice to date. These results confirm the significance of the biodistribution and autoradiographic studies demonstrating tumor uptake of 18 {plus_minus} 8% ID/gm with 3/1 tumor to liver and 8/1 tumor to bone ratios 1, 3, and 5 days post injection.« less

  8. Inhibition of heat-shock protein 90 sensitizes liver cancer stem-like cells to magnetic hyperthermia and enhances anti-tumor effect on hepatocellular carcinoma-burdened nude mice

    PubMed Central

    Yang, Rui; Tang, Qiusha; Miao, Fengqin; An, Yanli; Li, Mengfei; Han, Yong; Wang, Xihui; Wang, Juan; Liu, Peidang; Chen, Rong

    2015-01-01

    Purpose To explore the thermoresistance and expression of heat-shock protein 90 (HSP90) in magnetic hyperthermia-treated human liver cancer stem-like cells (LCSCs) and the effects of a heat-shock protein HSP90 inhibitor 17-allylamino-17-demethoxgeldanamycin (17-AAG) on hepatocellular carcinoma-burdened nude mice. Methods CD90+ LCSCs were isolated by magnetic-activated cell sorting from BEL-7404. Spheroid formation, proliferation, differentiation, drug resistance, and tumor formation assays were performed to identify stem cell characteristics. CD90-targeted thermosensitive magnetoliposomes (TMs)-encapsulated 17-AAG (CD90@17-AAG/TMs) was prepared by reverse-phase evaporation and its characteristics were studied. Heat tolerance in CD90+ LCSCs and the effect of CD90@17-AAG/TMs-mediated heat sensitivity were examined in vitro and in vivo. Results CD90+ LCSCs showed significant stem cell-like properties. The 17-AAG/TMs were successfully prepared and were spherical in shape with an average size of 128.9±7.7 nm. When exposed to magnetic hyperthermia, HSP90 was up-regulated in CD90+ LCSCs. CD90@17-AAG/TMs inhibited the activity of HSP90 and increased the sensitivity of CD90+ LCSCs to magnetic hyperthermia. Conclusion The inhibition of HSP90 could sensitize CD90+ LCSCs to magnetic hyperthermia and enhance its anti-tumor effects in vitro and in vivo. PMID:26677324

  9. Root Cause Analysis of Gastroduodenal Ulceration After Yttrium-90 Radioembolization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lam, Marnix G. E. H.; Banerjee, Subhas; Louie, John D.

    IntroductionA root cause analysis was performed on the occurrence of gastroduodenal ulceration after hepatic radioembolization (RE). We aimed to identify the risk factors in the treated population and to determine the specific mechanism of nontarget RE in individual cases. Methods: The records of 247 consecutive patients treated with yttrium-90 RE for primary (n = 90) or metastatic (n = 157) liver cancer using either resin (n = 181) or glass (n = 66) microspheres were reviewed. All patients who developed a biopsy-proven microsphere-induced gastroduodenal ulcer were identified. Univariate and multivariate analyses were performed on baseline parameters and procedural data tomore » determine possible risk factors in the total population. Individual cases were analyzed to ascertain the specific cause, including identification of the culprit vessel(s) leading to extrahepatic deposition of the microspheres. Results: Eight patients (3.2 %) developed a gastroduodenal ulcer. Stasis during injection was the strongest independent risk factor (p = 0.004), followed by distal origin of the gastroduodenal artery (p = 0.004), young age (p = 0.040), and proximal injection of the microspheres (p = 0.043). Prolonged administrations, pain during administration, whole liver treatment, and use of resin microspheres also showed interrelated trends in multivariate analysis. Retrospective review of intraprocedural and postprocedural imaging showed a probable or possible culprit vessel, each a tiny complex collateral vessel, in seven patients. Conclusion: Proximal administrations and those resulting in stasis of flow presented increased risk for gastroduodenal ulceration. Patients who had undergone bevacizumab therapy were at high risk for developing stasis.« less

  10. Patient Selection and Activity Planning Guide for Selective Internal Radiotherapy With Yttrium-90 Resin Microspheres

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lau, Wan-Yee, E-mail: josephlau@surgery.cuhk.edu.hk; Kennedy, Andrew S.; Department of Biomedical Engineering, North Carolina State University, Raleigh, NC

    Purpose: Selective internal radiotherapy (SIRT) with yttrium-90 ({sup 90}Y) resin microspheres can improve the clinical outcomes for selected patients with inoperable liver cancer. This technique involves intra-arterial delivery of {beta}-emitting microspheres into hepatocellular carcinomas or liver metastases while sparing uninvolved structures. Its unique mode of action, including both {sup 90}Y brachytherapy and embolization of neoplastic microvasculature, necessitates activity planning methods specific to SIRT. Methods and Materials: A panel of clinicians experienced in {sup 90}Y resin microsphere SIRT was convened to integrate clinical experience with the published data to propose an activity planning pathway for radioembolization. Results: Accurate planning is essentialmore » to minimize potentially fatal sequelae such as radiation-induced liver disease while delivering tumoricidal {sup 90}Y activity. Planning methods have included empiric dosing according to degree of tumor involvement, empiric dosing adjusted for the body surface area, and partition model calculations using Medical Internal Radiation Dose principles. It has been recommended that at least two of these methods be compared when calculating the microsphere activity for each patient. Conclusions: Many factors inform {sup 90}Y resin microsphere SIRT activity planning, including the therapeutic intent, tissue and vasculature imaging, tumor and uninvolved liver characteristics, previous therapies, and localization of the microsphere infusion. The influence of each of these factors has been discussed.« less

  11. Radioembolization of Symptomatic, Unresectable Neuroendocrine Hepatic Metastases Using Yttrium-90 Microspheres

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paprottka, Philipp M., E-mail: philipp.paprottka@med.uni-muenchen.de; Hoffmann, Ralf-T.; Haug, Alexander

    2012-04-15

    Purpose: To evaluate safety, efficacy, and symptom-control of radioembolization in patients with unresectable liver metastases from neuroendocrine tumors (NETLMs). Materials and Methods: Forty-two patients (mean age of 62 years) with treatment-refractory NETLMs underwent radioembolization using yttrium-90 ({sup 90}Y) resin microspheres. Posttreatment tumor response was assessed by cross-sectional imaging using the Response Evaluation Criteria in Solid Tumors (RECIST) and tumor-marker levels. Laboratory and clinical toxicities and clinical symptoms were monitored. Results: The median activity delivered was 1.63 GBq (range 0.63-2.36). Imaging follow-up using RECIST at 3-month follow-up demonstrated partial response, stable disease, and progressive disease in 22.5, 75.0, and 2.5% ofmore » patients, respectively. In 97.5% of patients, the liver lesions appeared hypovascular or partially necrotic. The mean follow-up was 16.2 months with 40 patients (95.2%) remaining alive. The median decrease in tumor-marker levels at 3 months was 54.8% (chromogranin A) and 37.3% (serotonin), respectively. There were no acute or delayed toxicities greater than grade 2 according to Common Terminology Criteria for Adverse Events [CTCAE (v3.0)]. No radiation-induced liver disease was noted. Improvement of clinical symptoms 3 months after treatment was observed in 36 of 38 symptomatic patients. Conclusion: Radioembolization with {sup 90}Y-microspheres is a safe and effective treatment option in patients with otherwise treatment-refractory NETLMs. Antitumoral effect is supported by good local tumor control, decreased tumor-marker levels, and improved clinical symptoms. Further investigation is warranted to define the role of radioembolization in the treatment paradigm for NETLMs.« less

  12. Evaluation of Efficacy of Radioimmunotherapy with 90Y-Labeled Fully Human Anti-Transferrin Receptor Monoclonal Antibody in Pancreatic Cancer Mouse Models

    PubMed Central

    Sugyo, Aya; Tsuji, Atsushi B.; Sudo, Hitomi; Okada, Maki; Koizumi, Mitsuru; Satoh, Hirokazu; Kurosawa, Gene; Kurosawa, Yoshikazu; Saga, Tsuneo

    2015-01-01

    Objective Pancreatic cancer is an aggressive tumor and the prognosis remains poor. Therefore, development of more effective therapy is needed. We previously reported that 89Zr-labeled TSP-A01, an antibody against transferrin receptor (TfR), is highly accumulated in a pancreatic cancer xenograft, but not in major normal organs. In the present study, we evaluated the efficacy of radioimmunotherapy (RIT) with 90Y-TSP-A01 in pancreatic cancer mouse models. Methods TfR expression in pancreatic cancer cell lines (AsPC-1, BxPC-3, MIAPaCa-2) was evaluated by immunofluorescence staining. 111In-labeled anti-TfR antibodies (TSP-A01, TSP-A02) were evaluated in vitro by cell binding assay with the three cell lines and by competitive inhibition assay with MIAPaCa-2. In vivo biodistribution was evaluated in mice bearing BxPC-3 and MIAPaCa-2 xenografts. Tumor volumes of BxPC-3 and MIAPaCa-2 were sequentially measured after 90Y-TSP-A01 injection and histological analysis of tumors was conducted. Results MIAPaCa-2 cells showed the highest TfR expression, followed by AsPC-1 and BxPC-3 cells. 111In-TSP-A01 and 111In-TSP-A02 bound specifically to the three cell lines according to TfR expression. The dissociation constants for TSP-A01, DOTA-TSP-A01, TSP-A02, and DOTA-TSP-A02 were 0.22, 0.28, 0.17, and 0.22 nM, respectively. 111In-TSP-A01 was highly accumulated in tumors, especially in MIAPaCa-2, but this was not true of 111In-TSP-A02. The absorbed dose for 90Y-TSP-A01 was estimated to be 8.3 Gy/MBq to BxPC-3 and 12.4 Gy/MBq to MIAPaCa-2. MIAPaCa-2 tumors treated with 3.7 MBq of 90Y-TSP-A01 had almost completely disappeared around 3 weeks after injection and regrowth was not observed. Growth of BxPC-3 tumors was inhibited by 3.7 MBq of 90Y-TSP-A01, but the tumor size was not reduced. Conclusion 90Y-TSP-A01 treatment achieved an almost complete response in MIAPaCa-2 tumors, whereas it merely inhibited the growth of BxPC-3 tumors. 90Y-TSP-A01 is a promising RIT agent for pancreatic cancer

  13. Anti-CD25 monoclonal antibody enhances the protective efficacy of Schistosoma japonicum GST vaccine via inhibition of CD4+CD25+Foxp3+ regulatory T cells.

    PubMed

    Tang, Chun-Lian; Yang, Jin; Cheng, Liang-Yu; Cheng, Lan-Fang; Liu, Zhi-Ming

    2017-10-01

    The effect of anti-CD25 monoclonal antibody (anti-CD25 mAb) on the protection efficacy of Schistosoma japonicum 26 kDa GST (glutathione-S-transferase) vaccine was evaluated. Mice were immunized with GST before infection with S. japonicum cercariae and then injected with anti-CD25 mAb. The worm reduction rate was promoted from 24.18% in mice with GST immunization to 47.09% in mice with GST plus anti-CD25 mAb. Compared with the control group, the percentages of splenic CD4 + CD25 + Foxp3 + regulatory T cells (Tregs) were significantly lower after administration of anti-CD25 mAb; meanwhile, elevated levels of IFN-γ and IL-2 were secreted by splenocytes. These results indicate that the poor protective efficacy of the GST vaccine against S. japonicum results from the presence of CD4 + CD25 + Foxp3 + Tregs, while anti-CD25 mAb can partially block CD4 + CD25 + Foxp3 + Tregs and thus enhance the protective efficacy of the GST vaccine.

  14. Synthesis, Radiolabelling and In Vitro Characterization of the Gallium-68-, Yttrium-90- and Lutetium-177-Labelled PSMA Ligand, CHX-A''-DTPA-DUPA-Pep.

    PubMed

    Baur, Benjamin; Solbach, Christoph; Andreolli, Elena; Winter, Gordon; Machulla, Hans-Jürgen; Reske, Sven N

    2014-04-29

    Since prostate-specific membrane antigen (PSMA) has been identified as a diagnostic target for prostate cancer, many urea-based small PSMA-targeting molecules were developed. First, the clinical application of these Ga-68 labelled compounds in positron emission tomography (PET) showed their diagnostic potential. Besides, the therapy of prostate cancer is a demanding field, and the use of radiometals with PSMA bearing ligands is a valid approach. In this work, we describe the synthesis of a new PSMA ligand, CHX-A''-DTPA-DUPA-Pep, the subsequent labelling with Ga-68, Lu-177 and Y-90 and the first in vitro characterization. In cell investigations with PSMA-positive LNCaP C4-2 cells, KD values of ≤14.67 ± 1.95 nM were determined, indicating high biological activities towards PSMA. Radiosyntheses with Ga-68, Lu-177 and Y-90 were developed under mild reaction conditions (room temperature, moderate pH of 5.5 and 7.4, respectively) and resulted in nearly quantitative radiochemical yields within 5 min.

  15. Synthesis, Radiolabelling and In Vitro Characterization of the Gallium-68-, Yttrium-90- and Lutetium-177-Labelled PSMA Ligand, CHX-A''-DTPA-DUPA-Pep

    PubMed Central

    Baur, Benjamin; Solbach, Christoph; Andreolli, Elena; Winter, Gordon; Machulla, Hans-Jürgen; Reske, Sven N.

    2014-01-01

    Since prostate-specific membrane antigen (PSMA) has been identified as a diagnostic target for prostate cancer, many urea-based small PSMA-targeting molecules were developed. First, the clinical application of these Ga-68 labelled compounds in positron emission tomography (PET) showed their diagnostic potential. Besides, the therapy of prostate cancer is a demanding field, and the use of radiometals with PSMA bearing ligands is a valid approach. In this work, we describe the synthesis of a new PSMA ligand, CHX-A''-DTPA-DUPA-Pep, the subsequent labelling with Ga-68, Lu-177 and Y-90 and the first in vitro characterization. In cell investigations with PSMA-positive LNCaP C4-2 cells, KD values of ≤14.67 ± 1.95 nM were determined, indicating high biological activities towards PSMA. Radiosyntheses with Ga-68, Lu-177 and Y-90 were developed under mild reaction conditions (room temperature, moderate pH of 5.5 and 7.4, respectively) and resulted in nearly quantitative radiochemical yields within 5 min. PMID:24787458

  16. Determination of strontium-90 in milk samples using a controlled precipitation clean-up step prior to ion-chromatography.

    PubMed

    Cobb, J; Warwick, P; Carpenter, R C; Morrison, R T

    1995-12-01

    Strontium-90 may be determined by beta-counting its yttrium-90 daughter following separation by ion-chromatography, using a three column system comprising a chelating concentrator column, a cation-exchange column and an anion-exchange separator column. The column system has previously been applied to the determination of strontium-90 in water and urine samples. The applicability of the system to the analysis of milk is hampered by the large concentrations of calcium present, which significantly reduces the extraction of yttrium-90 by the concentrator column. A maximum of approximately 200 mg of calcium can be present for the successful extraction of yttrium-90, which greatly limits the quantity of milk that can be analysed. The quantity of milk analysed can be increased by the inclusion of a controlled precipitation step prior to the ion-chromatographic separation. The precipitation is carried out on acid digested milk samples by the addition of ammonia solution until the addition of one drop causes a reduction in pH resulting in the precipitation of calcium hydrogenphosphate. Under these conditions, approximately 20% of the calcium present in the original milk sample is precipitated, yttrium-90 is precipitated whereas strontium-90 is not precipitated. Dissolution of the precipitate, followed by separation of yttrium-90 using the ion-chromatography system facilitates the analysis of a litre of milk with recoveries of greater than 80%.

  17. Increased T cell proliferative responses to islet antigens identify clinical responders to anti-CD20 monoclonal antibody (rituximab) therapy in type 1 diabetes.

    PubMed

    Herold, Kevan C; Pescovitz, Mark D; McGee, Paula; Krause-Steinrauf, Heidi; Spain, Lisa M; Bourcier, Kasia; Asare, Adam; Liu, Zhugong; Lachin, John M; Dosch, H Michael

    2011-08-15

    Type 1 diabetes mellitus is believed to be due to the autoimmune destruction of β-cells by T lymphocytes, but a single course of rituximab, a monoclonal anti-CD20 B lymphocyte Ab, can attenuate C-peptide loss over the first year of disease. The effects of B cell depletion on disease-associated T cell responses have not been studied. We compare changes in lymphocyte subsets, T cell proliferative responses to disease-associated target Ags, and C-peptide levels of participants who did (responders) or did not (nonresponders) show signs of β-cell preservation 1 y after rituximab therapy in a placebo-controlled TrialNet trial. Rituximab decreased B lymphocyte levels after four weekly doses of mAb. T cell proliferative responses to diabetes-associated Ags were present at baseline in 75% of anti-CD20- and 82% of placebo-treated subjects and were not different over time. However, in rituximab-treated subjects with significant C-peptide preservation at 6 mo (58%), the proliferative responses to diabetes-associated total (p = 0.032), islet-specific (p = 0.048), and neuronal autoantigens (p = 0.005) increased over the 12-mo observation period. This relationship was not seen in placebo-treated patients. We conclude that in patients with type 1 diabetes mellitus, anti-B cell mAb causes increased proliferative responses to diabetes Ags and attenuated β-cell loss. The way in which these responses affect the disease course remains unknown.

  18. Temporary balloon occlusion of the common hepatic artery for administration of yttrium-90 resin microspheres in a patient with patent hepatoenteric collaterals.

    PubMed

    Mahvash, Armeen; Zaer, Navid; Shaw, Colette; Chasen, Beth; Avritscher, Rony; Murthy, Ravi

    2012-02-01

    The most common serious complication of yttrium-90 ((90)Y) therapy is gastrointestinal ulceration caused by extrahepatic microsphere dispersion. The authors describe the use of a balloon catheter for temporary occlusion of the common hepatic artery to reverse hepatoenteric flow for lobar administration of resin microspheres when coil embolization of a retroportal artery was impossible. At 9 months after treatment, the patient had no gastrointestinal side effects and showed a partial response. Copyright © 2012 SIR. Published by Elsevier Inc. All rights reserved.

  19. [Regulatory B cells activated by CpG-ODN combined with anti-CD40 monoclonal antibody inhibit CD4(+)T cell proliferation].

    PubMed

    Wang, Keng; Tao, Lei; Su, Jianbing; Zhang, Yueyang; Zou, Binhua; Wang, Yiyuan; Li, Xiaojuan

    2016-09-01

    Objective To observe the immunosuppressive function of regulatory B cells (Bregs) in vitro after activated by CpG oligodeoxynucleotide (CpG-ODN) and anti-CD40 mAb. Methods Mice splenic CD5(+)CD1d(high)B cells and CD5(-)CD1d(low)B cells were sorted by flow cytometry. These B cells were first stimulated with CpG-ODN combined with anti-CD40 mAb for 24 hours, and then co-cultured with purified CD4(+)T cells. The interleukin 10 (IL-10) expression in the activated Bregs and other B cell subset, as well as the proliferation and interferon γ (IFN-γ) expression in the CD4(+) T cells activated by anti-CD3 mAb plus anti-CD28 mAb were determined by flow cytometry. Results CD5(+)CD1d(high) B cells activated by CpG-ODN plus anti-CD40 mAb blocked the up-regulated CD4(+)T proliferation and significantly reduced the IFN-γ level. At the same time, activated CD5(-)CD1d(low)B cells showed no inhibitory effect on CD4(+)T cells. Further study revealed that IL-10 expression in the CD5(+)CD1d(high) B cells were much higher than that in the CD5(-)CD1d(low)B cells after stimulated with CpG-ODN combined with anti-CD40 mAb for 24 hours. Conclusion CD5(+)CD1d(high) B cells activated by CpG-ODN combined with anti-CD40 mAb have immune inhibitory effects on CD4(+)T cell activation in vitro , which possibly due to IL-10 secretion.

  20. Quantification of Cells with Specific Phenotypes I: Determination of CD4+ Cell Count Per Microliter in Reconstituted Lyophilized Human PBMC Prelabeled with Anti-CD4 FITC Antibody

    PubMed Central

    Stebbings, Richard; Wang, Lili; Sutherland, Janet; Kammel, Martin; Gaigalas, Adolfas K; John, Manuela; Roemer, Bodo; Kuhne, Maren; Schneider, Rudolf J; Braun, Michael; Engel, Andrea; Dikshit, Dinesh K; Abbasi, Fatima; Marti, Gerald E; Paola Sassi, Maria; Revel, Laura; Kim, Sook-Kyung; Baradez, Marc-Olivier; Lekishvili, Tamara; Marshall, Damian; Whitby, Liam; Jing, Wang; Ost, Volker; Vonsky, Maxim; Neukammer, Jörg

    2015-01-01

    A surface-labeled lyophilized lymphocyte (sLL) preparation has been developed using human peripheral blood mononuclear cells prelabeled with a fluorescein isothiocyanate conjugated anti-CD4 monoclonal antibody. The sLL preparation is intended to be used as a reference material for CD4+ cell counting including the development of higher order reference measurement procedures and has been evaluated in the pilot study CCQM-P102. This study was conducted across 16 laboratories from eight countries to assess the ability of participants to quantify the CD4+ cell count of this reference material and to document cross-laboratory variability plus associated measurement uncertainties. Twelve different flow cytometer platforms were evaluated using a standard protocol that included calibration beads used to obtain quantitative measurements of CD4+ T cell counts. There was good overall cross-platform and counting method agreement with a grand mean of the laboratory calculated means of (301.7 ± 4.9) μL−1 CD4+ cells. Excluding outliers, greater than 90% of participant data agreed within ±15%. A major contribution to variation of sLL CD4+ cell counts was tube to tube variation of the calibration beads, amounting to an uncertainty of 3.6%. Variation due to preparative steps equated to an uncertainty of 2.6%. There was no reduction in variability when data files were centrally reanalyzed. Remaining variation was attributed to instrument specific differences. CD4+ cell counts obtained in CCQM-P102 are in excellent agreement and show the robustness of both the measurements and the data analysis and hence the suitability of sLL as a reference material for interlaboratory comparisons and external quality assessment. © 2015 The Authors. Published by Wiley Periodicals, Inc. PMID:25655255

  1. Doxorubicin-loaded platelets conjugated with anti-CD22 mAbs: a novel targeted delivery system for lymphoma treatment with cardiopulmonary avoidance

    PubMed Central

    Zhou, Rongfu; Wang, Fan; Liu, Xu; Ouyang, Jian; Chen, Bing

    2017-01-01

    B-cell lymphoma accounts for approximately 85% of all adult non-Hodgkin's lymphoma cases. Doxorubicin (DOX) is an indispensable drug for the treatment of non-Hodgkin's lymphoma. However, DOX causes severe cardiotoxicity, which limits its use in conventional treatment strategies. In this study, we developed a novel drug delivery system for lymphoma treatment: DOX-loaded platelets that were conjugated with anti-CD22 monoclonal antibodies (mAbs) (DOX–platelet–CD22). Platelets are bio- and immune-compatible drug carriers that can prolong the circulation time of drugs. Anti-CD22 mAb-labeled platelets can precisely deliver DOX to tumor cells. Our in vitro and in vivo experiments showed the enhanced antitumor activity and attenuated cardiotoxicity of DOX when delivered as DOX–platelet–CD22. Compared with other delivery systems, the uptake of DOX–platelet–CD22 by macrophage-like cells decreased. Moreover, DOX–platelet–CD22 showed platelet properties, such as tumor cell-induced platelet aggregation. Therefore, targeted chemotherapy that is mediated by DOX–platelet–CD22 is a promising option for lymphoma treatment. PMID:28938559

  2. Doxorubicin-loaded platelets conjugated with anti-CD22 mAbs: a novel targeted delivery system for lymphoma treatment with cardiopulmonary avoidance.

    PubMed

    Xu, Peipei; Zuo, Huaqin; Zhou, Rongfu; Wang, Fan; Liu, Xu; Ouyang, Jian; Chen, Bing

    2017-08-29

    B-cell lymphoma accounts for approximately 85% of all adult non-Hodgkin's lymphoma cases. Doxorubicin (DOX) is an indispensable drug for the treatment of non-Hodgkin's lymphoma. However, DOX causes severe cardiotoxicity, which limits its use in conventional treatment strategies. In this study, we developed a novel drug delivery system for lymphoma treatment: DOX-loaded platelets that were conjugated with anti-CD22 monoclonal antibodies (mAbs) (DOX-platelet-CD22). Platelets are bio- and immune-compatible drug carriers that can prolong the circulation time of drugs. Anti-CD22 mAb-labeled platelets can precisely deliver DOX to tumor cells. Our in vitro and in vivo experiments showed the enhanced antitumor activity and attenuated cardiotoxicity of DOX when delivered as DOX-platelet-CD22. Compared with other delivery systems, the uptake of DOX-platelet-CD22 by macrophage-like cells decreased. Moreover, DOX-platelet-CD22 showed platelet properties, such as tumor cell-induced platelet aggregation. Therefore, targeted chemotherapy that is mediated by DOX-platelet-CD22 is a promising option for lymphoma treatment.

  3. Unexpected cross-reactivity of anti-cathepsin B antibodies leads to uncertainties regarding the mechanism of action of anti-CD20 monoclonal antibody GA101.

    PubMed

    Chien, Wei Wen; Niogret, Charlène; Jugé, Romain; Lionnard, Loïc; Cornut-Thibaut, Aurélie; Kucharczak, Jérôme; Savina, Ariel; Salles, Gilles; Aouacheria, Abdel

    2017-04-01

    GA101, also known as obinutuzumab or Gazyva (Gazyvaro), is a glycoengineered type II humanized antibody that targets the CD20 antigen expressed at the surface of B-cells. This novel anti-CD20 antibody is currently assessed in clinical trials with promising results as a single agent or as part of therapeutic combinations for the treatment of B-cell malignancies. Detailed understanding of the mechanisms of GA101-induced cell death is needed to get insight into possible resistance mechanisms occurring in patients. Although multiple in vitro and in vivo mechanisms have been suggested to describe the effects of GA101 on B-cells, currently available data are ambiguous. The aim of our study was to clarify the cellular mechanisms involved in GA101-induced cell death in vitro, and more particularly the respective roles played by lysosomal and mitochondrial membrane permeabilization. Our results confirm previous reports suggesting that GA101 triggers homotypic adhesion and caspase-independent cell death, two processes that are dependent on actin remodeling and involve the production of reactive oxygen species. With respect to lysosomal membrane permeabilization (LMP), our data suggest that lack of specificity of available antibodies directed against cathepsin B may have confounded previously published results, possibly challenging current LMP-driven model of GA101 action mode. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Immune system cells in healthy ferrets: an immunohistochemical study.

    PubMed

    Vidaña, B; Majó, N; Pérez, M; Montoya, M; Martorell, J; Martínez, J

    2014-07-01

    The ferret has emerged as an excellent animal model to characterize several physiologic and pathologic conditions. The distribution and characterization of different types of immune system cells were studied in healthy ferret tissues. Eight primary antibodies were tested for immunohistochemistry in formalin-fixed tissues: anti-CD3, anti-CD79α, anti-CD20, anti-HLA-DR, anti-lysozyme, anti-CD163, anti-SWC3, and anti-Mac387. The anti-CD3 antibody labeled T cells mainly in interfollicular and paracortical areas of lymph nodes, cortex and thymic medulla, and periarteriolar lymphoid sheaths in the spleen. The anti-CD79α and anti-CD20 antibodies immunolabeled B cells located in lymphoid follicles at lymph nodes, spleen, and Peyer patches. The CD79α and CD20 antibodies also labeled cells with nonlymphoid morphology in atypical B-cell locations. The anti-HLA-DR antibody labeled macrophages, some populations of B and T lymphocytes, and different populations of dendritic cells in lymph nodes, Peyer patches, spleen, and thymus. The anti-lysozyme antibody immunolabeled macrophages in the liver, lymph nodes, spleen, and thymus. The Mac-387, CD163, and SWC3 antibodies did not show any positive reaction in formalin-fixed or frozen tissues. To elucidate the origin of the uncommon CD79α/CD20 positive cells, a double immunohistochemistry was carried out using the anti-HLA-DR + the anti-CD79α, the anti-HLA-DR + the anti-CD20, and the anti-lysozyme + the anti-CD79α antibodies. Double labeling was mainly observed when the anti-HLA-DR + the anti-CD79α antibodies were combined. The immunohistologic characterization and distribution of these immune system cells in healthy ferret tissues should be of value in future comparative studies of diseases in ferrets. © The Author(s) 2013.

  5. CD90 (Thy-1)-positive selection enhances osteogenic capacity of human adipose-derived stromal cells.

    PubMed

    Chung, Michael T; Liu, Chunjun; Hyun, Jeong S; Lo, David D; Montoro, Daniel T; Hasegawa, Masakazu; Li, Shuli; Sorkin, Michael; Rennert, Robert; Keeney, Michael; Yang, Fan; Quarto, Natalina; Longaker, Michael T; Wan, Derrick C

    2013-04-01

    Stem cell-based bone tissue engineering with adipose-derived stromal cells (ASCs) has shown great promise for revolutionizing treatment of large bone deficits. However, there is still a lack of consensus on cell surface markers identifying osteoprogenitors. Fluorescence-activated cell sorting has identified a subpopulation of CD105(low) cells with enhanced osteogenic differentiation. The purpose of the present study was to compare the ability of CD90 (Thy-1) to identify osteoprogenitors relative to CD(105). Unsorted cells, CD90(+), CD90(-), CD105(high), and CD105(low) cells were treated with an osteogenic differentiation medium. For evaluation of in vitro osteogenesis, alkaline phosphatase (ALP) staining and alizarin red staining were performed at 7 days and 14 days, respectively. RNA was harvested after 7 and 14 days of differentiation, and osteogenic gene expression was examined by quantitative real-time polymerase chain reaction. For evaluation of in vivo osteogenesis, critical-sized (4-mm) calvarial defects in nude mice were treated with the hydroxyapatite-poly(lactic-co-glycolic acid) scaffold seeded with the above-mentioned subpopulations. Healing was followed using micro-CT scans for 8 weeks. Calvaria were harvested at 8 weeks postoperatively, and sections were stained with Movat's Pentachrome. Transcriptional analysis revealed that the CD90(+) subpopulation was enriched for a more osteogenic subtype relative to the CD105(low) subpopulation. Staining at day 7 for ALP was greatest in the CD90(+) cells, followed by the CD105(low) cells. Staining at day 14 for alizarin red demonstrated the greatest amount of mineralized extracellular matrix in the CD90(+) cells, again followed by the CD105(low) cells. Quantification of in vivo healing at 2, 4, 6, and 8weeks postoperatively demonstrated increased bone formation in defects treated with CD90(+) ASCs relative to all other groups. On Movat's Pentachrome-stained sections, defects treated with CD90(+) cells showed the

  6. Method of separation of yttrium-90 from strontium-90

    DOEpatents

    Bray, Lane A.; Wester, Dennis W.

    1996-01-01

    A method for purifying Y-90 from a Sr-90/Y-90 "cow" wherein raw Sr-90/Y-90 source containing impurities is obtained from nuclear material reprocessing. Raw Sr-90/Y-90 source is purified to a fresh Sr-90/Y-90 source "cow" by removing impurities by addition of sodium hydroxide and by removing Cs-137 by further addition of sodium carbonate. The "cow" is set aside to allow ingrowth. An HDEHP organic extractant is obtained from a commercial supplier and further purified by saturation with Cu(II), precipitation with acetone, and washing with nitric acid. The "cow" is then dissolved in nitric acid and the purified HDEHP is washed with nitric acid and scrubbed with either nitric or hydrochloric acid. The dissolved "cow" and scrubbed HDEHP are combined in an organic extraction, separating Y-90 from Sr-90, resulting in a Sr-90/Y-90 concentration ratio of not more than 10(E-7), and a metal impurity concentration of not more than 10 ppm per curie of Y-90. The separated Y-90 may then be prepared for delivery.

  7. Characterization of the CD4+ and CD8+ tumor infiltrating lymphocytes propagated with bispecific monoclonal antibodies.

    PubMed

    Wong, J T; Pinto, C E; Gifford, J D; Kurnick, J T; Kradin, R L

    1989-11-15

    To study the CD4+ and CD8+ tumor infiltrating lymphocytes (TIL) in the antitumor response, we propagated these subsets directly from tumor tissues with anti-CD3:anti-CD8 (CD3,8) and anti-CD3:anti-CD4 (CD3,4) bispecific mAb (BSMAB). CD3,8 BSMAB cause selective cytolysis of CD8+ lymphocytes by bridging the CD8 molecules of target lymphocytes to the CD3 molecular complex of cytolytic T lymphocytes with concurrent activation and proliferation of residual CD3+CD4+ T lymphocytes. Similarly, CD3,4 BSMAB cause selective lysis of CD4+ lymphocytes whereas concurrently activating the residual CD3+CD8+ T cells. Small tumor fragments from four malignant melanoma and three renal cell carcinoma patients were cultured in medium containing CD3,8 + IL-2, CD3,4 + IL-2, or IL-2 alone. CD3,8 led to selective propagation of the CD4+ TIL whereas CD3,4 led to selective propagation of the CD8+ TIL from each of the tumors. The phenotypes of the TIL subset cultures were generally stable when assayed over a 1 to 3 months period and after further expansion with anti-CD3 mAb or lectins. Specific 51Cr release of labeled target cells that were bridged to the CD3 molecular complexes of TIL suggested that both CD4+ and CD8+ TIL cultures have the capacity of mediating cytolysis via their Ti/CD3 TCR complexes. In addition, both CD4+ and CD8+ TIL cultures from most patients caused substantial (greater than 20%) lysis of the NK-sensitive K562 cell line. The majority of CD4+ but not CD8+ TIL cultures also produced substantial lysis of the NK-resistant Daudi cell line. Lysis of the autologous tumor by the TIL subsets was assessed in two patients with malignant melanoma. The CD8+ TIL from one tumor demonstrated cytotoxic activity against the autologous tumor but negligible lysis of allogeneic melanoma targets. In conclusion, immunocompetent CD4+ and CD8+ TIL subsets can be isolated and expanded directly from small tumor fragments of malignant melanoma and renal cell carcinoma using BSMAB. The resultant

  8. Method of separation of yttrium-90 from strontium-90

    DOEpatents

    Bray, L.A.; Wester, D.W.

    1996-04-30

    A method is described for purifying Y-90 from a Sr-90/Y-90 ``cow`` wherein raw Sr-90/Y-90 source containing impurities is obtained from nuclear material reprocessing. Raw Sr-90/Y-90 source is purified to a fresh Sr-90/Y-90 source ``cow`` by removing impurities by addition of sodium hydroxide and by removing Cs-137 by further addition of sodium carbonate. The ``cow`` is set aside to allow ingrowth. An HDEHP organic extractant is obtained from a commercial supplier and further purified by saturation with Cu(II), precipitation with acetone, and washing with nitric acid. The ``cow`` is then dissolved in nitric acid and the purified HDEHP is washed with nitric acid and scrubbed with either nitric or hydrochloric acid. The dissolved ``cow`` and scrubbed HDEHP are combined in an organic extraction, separating Y-90 from Sr-90, resulting in a Sr-90/Y-90 concentration ratio of not more than 10(E-7), and a metal impurity concentration of not more than 10 ppm per curie of Y-90. The separated Y-90 may then be prepared for delivery. 1 fig.

  9. Yttrium-90 (Y-90) Resin Microsphere Therapy for Patients with Unresectable Hepatocellular Carcinoma: a Single-Center Experience.

    PubMed

    İnce, Semra; Karaman, Bülent; Alagoz, Engin; Karadurmuş, Nuri; Şan, Hüseyin; Erçin, Cemal Nuri; Arslan, Nuri

    2017-09-01

    Selective intraarterial radionuclide therapy (SIRT) with yttrium-90 (Y-90) resin microspheres presently has successful results in primary or metastatic inoperable liver tumors. This procedure, which is also known as radioembolisation, delivers high doses of radiation selectively to hepatic tumors while minimum healthy liver exposure. The aim of this study was to present our clinical experience of radiomicrosphere therapy for the treatment of patients with unresectable hepatocellular carcinoma (HCC). We performed 40 Y-90 microsphere therapies in 28 patients (5 females, 23 males; mean age ± SD 48 ± 8) with HCC during the period from April 2008 through December 2016. Pretreatment Tc-99m microaggregated albumin (MAA) scintigraphy was performed to all patients in order to detect eligibility for SIRT. All patients had pre- and post-biochemical tests (hemogram and serologic tests) and imaging methods (CT or MRI or PET/CT) at regular intervals to detect any possible complication and determine response rates. The mean shunting to the lungs on MAA scan was 6.5% and the mean ± SD administered dose of Y-90 was 1.55 ± 0.32 GBq in all patients. The estimated doses to the target tumors, normal liver parenchyma and lungs were 105.7 ± 55.3, 25.5 ± 8.2 and 5.8 ± 1.7 Gy, respectively. No significant complication was observed during or early after (first week) the treatment procedure and it was well tolerated by all the patients. Only one patient developed a treatment-related gastroduodenal ulcer 3 weeks after the treatment. In control imaging tests (MRI or FDG PET/CT) performed 2.5 months after the treatment, we observed complete response in 2 (7%) patients, partial response in 10 (36%) patients, stable disease in 5 (18%) patients and progressive disease in 11 (39%) patients. According to our clinical experience, we can conclude that Y-90 microsphere therapy is a safe and effective treatment option for the patients with unresectable HCC without any serious

  10. Therapeutic equivalence in survival for hepatic arterial chemoembolization and 90Yttrium microspheres (Y90) treatments in unresectable hepatocellular carcinoma: a 2 cohort study

    PubMed Central

    Carr, Brian I.; Kondragunta, Venkateswarlu; Buch, Shama C.; Branch, Robert A.

    2009-01-01

    BACKGROUND Intra-hepatic arterial 90Yttrium (Y90) microspheres (Theraspheres) have been proposed as a less toxic, invasive therapeutic option to trans-hepatic arterial chemoembolization (TACE) for surgically unresectable hepatocellular carcinoma (HCC). TACE has been shown to prolong survival. However, long term survival remains uncertain. METHODS A 2 cohort experience of the treatment of advanced, unresectable and biopsy-proven HCC in North American patients is presented. 691 patients received repetitive cisplatin-based chemoembolization and a following 99 patient cohort with similar treatment criteria, received a planned single dose of Y90. Over this time period, an additional 142 patients were followed without treatment (total: 932 patients). RESULTS Overall survival was slightly better in the Y90 group compared to TACE, median of 11.5 vs. 8.5 months. However, selection criteria indicated a small but significant bias towards milder disease in the Y90 group. Using stratification in a 3 tier model, with cases dichotomized by bilirubin of less than 1.5 mg/dL, patients without PVT or with low alpha-fetoprotein plasma levels of less than 25 units/dL, analysis of survival in clinical subgroups showed that the 2 treatments resulted in similar survival. Similarly, patients with PVT or a high alpha-fetoprotein also had similar survival in the 2 treatment groups. CONCLUSION Given the present evidence of therapeutic equivalence in survival, Y90 and TACE seem to be equivalent regional therapies for patients with unresectable, non-metastatic HCC. PMID:20066715

  11. Critical assessment of the efficiency of CD34 and CD133 antibodies for enrichment of rabbit hematopoietic stem cells.

    PubMed

    Vašíček, Jaromír; Shehata, Medhat; Schnabl, Susanne; Hilgarth, Martin; Hubmann, Rainer; Jäger, Ulrich; Bauer, Miroslav; Chrenek, Peter

    2018-06-08

    Rabbits have many hereditary diseases common to humans and are therefore a valuable model for regenerative disease and hematopoietic stem cell (HSC) therapies. Currently, there is no substantial data on the isolation and/or enrichment of rabbit HSCs. This study was initiated to evaluate the efficiency of the commercially available anti-CD34 and anti-CD133 antibodies for the detection and potential enrichment of rabbit HSCs from peripheral blood. PBMCs from rabbit and human blood were labelled with different clones of anti-human CD34 monoclonal antibodies (AC136, 581 and 8G12) and rabbit polyclonal CD34 antibody (pCD34) and anti-human CD133 monoclonal antibodies (AC133 and 293C3). Flow cytometry showed a higher percentage of rabbit CD34 + cells labelled by AC136 in comparison to the clone 581 and pCD34 (P<0.01). A higher percentage of rabbit CD133 + cells were also detected by 293C3 compared to the AC133 clone (P<0.01). Therefore, AC136 clone was used for the indirect immunomagnetic enrichment of rabbit CD34 + cells using magnetic-activated cell sorting (MACS). The enrichment of the rabbit CD34 + cells after sorting was low in comparison to human samples (2.4% vs. 39.6%). PCR analyses confirmed the efficient enrichment of human CD34 + cells and the low expression of CD34 mRNA in rabbit positive fraction. In conclusion, the tested antibodies might be suitable for detection, but not for sorting the rabbit CD34 + HSCs and new specific anti-rabbit CD34 antibodies are needed for efficient enrichment of rabbit HSCs. This article is protected by copyright. All rights reserved. © 2018 American Institute of Chemical Engineers.

  12. Anti-CD45 radioimmunotherapy using 211At with bone marrow transplantation prolongs survival in a disseminated murine leukemia model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orozco, Johnnie J.; Back, Tom; Kenoyer, Aimee L.

    2013-05-15

    Anti-CD45 Radioimmunotherapy using an Alpha-Emitting Radionuclide 211At Combined with Bone Marrow Transplantation Prolongs Survival in a Disseminated Murine Leukemia Model ABSTRACT Despite aggressive chemotherapy combined with hematopoietic cell transplant (HCT), many patients with acute myeloid leukemia (AML) relapse. Radioimmunotherapy (RIT) using antibodies (Ab) labeled primarily with beta-emitting radionuclides has been explored to reduce relapse.

  13. CD90 (Thy-1)-Positive Selection Enhances Osteogenic Capacity of Human Adipose-Derived Stromal Cells

    PubMed Central

    Chung, Michael T.; Liu, Chunjun; Hyun, Jeong S.; Lo, David D.; Montoro, Daniel T.; Hasegawa, Masakazu; Li, Shuli; Sorkin, Michael; Rennert, Robert; Keeney, Michael; Yang, Fan; Quarto, Natalina; Longaker, Michael T.

    2013-01-01

    Background Stem cell-based bone tissue engineering with adipose-derived stromal cells (ASCs) has shown great promise for revolutionizing treatment of large bone deficits. However, there is still a lack of consensus on cell surface markers identifying osteoprogenitors. Fluorescence-activated cell sorting has identified a subpopulation of CD105low cells with enhanced osteogenic differentiation. The purpose of the present study was to compare the ability of CD90 (Thy-1) to identify osteoprogenitors relative to CD105. Methods Unsorted cells, CD90+, CD90−, CD105high, and CD105low cells were treated with an osteogenic differentiation medium. For evaluation of in vitro osteogenesis, alkaline phosphatase (ALP) staining and alizarin red staining were performed at 7 days and 14 days, respectively. RNA was harvested after 7 and 14 days of differentiation, and osteogenic gene expression was examined by quantitative real-time polymerase chain reaction. For evaluation of in vivo osteogenesis, critical-sized (4-mm) calvarial defects in nude mice were treated with the hydroxyapatite-poly(lactic-co-glycolic acid) scaffold seeded with the above-mentioned subpopulations. Healing was followed using micro-CT scans for 8 weeks. Calvaria were harvested at 8 weeks postoperatively, and sections were stained with Movat's Pentachrome. Results Transcriptional analysis revealed that the CD90+ subpopulation was enriched for a more osteogenic subtype relative to the CD105low subpopulation. Staining at day 7 for ALP was greatest in the CD90+ cells, followed by the CD105low cells. Staining at day 14 for alizarin red demonstrated the greatest amount of mineralized extracellular matrix in the CD90+ cells, again followed by the CD105low cells. Quantification of in vivo healing at 2, 4, 6, and 8weeks postoperatively demonstrated increased bone formation in defects treated with CD90+ ASCs relative to all other groups. On Movat's Pentachrome-stained sections, defects treated with CD90+ cells showed

  14. The anti-CD6 antibody itolizumab provides clinical benefit without lymphopenia in rheumatoid arthritis patients: results from a 6-month, open-label Phase I clinical trial.

    PubMed

    Rodríguez, P C; Prada, D M; Moreno, E; Aira, L E; Molinero, C; López, A M; Gómez, J A; Hernández, I M; Martínez, J P; Reyes, Y; Milera, J M; Hernández, M V; Torres, R; Avila, Y; Barrese, Y; Viada, C; Montero, E; Hernández, P

    2018-02-01

    Itolizumab is a humanized anti-CD6 monoclonal antibody (mAb) that has previously shown encouraging results, in terms of safety and positive clinical effects, in a 6-week monotherapy clinical trial conducted in rheumatoid arthritis (RA) patients. The current Phase I study evaluated the safety and clinical response for a longer treatment of 12 itolizumab intravenous doses in subjects with active RA despite previous disease-modifying anti-rheumatic drug (DMARD) therapy. Twenty-one subjects were enrolled into four dosage groups (0·1, 0·2, 0·4 and 0·8 mg/kg). Efficacy end-points including American College of Rheumatology (ACR)20, ACR50 and ACR70 response rates and disease activity score in 28 joints (DAS28) were monitored at baseline and at specific time-points during a 10-week follow-up period. Itolizumab was well tolerated up to the highest tested dose. No related serious adverse events were reported and most adverse events were mild. Remarkably, itolizumab treatment did not produce lymphopenia and, therefore, was not associated with infections. All patients achieved a clinical response (ACR20) at least once during the study. Eleven subjects (55%) achieved at least a 20% improvement in ACR just 1 week after the first itolizumab administration. The clinical response was observed from the beginning of the treatment and was sustained during 24 weeks. The efficacy profile of this 12-week treatment was similar to that of the previous study (6-week treatment). These results reinforce the safety profile of itolizumab and provide further evidence on the clinical benefit from the use of this anti-CD6 mAb in RA patients. © 2017 British Society for Immunology.

  15. Efficacy and safety of selective internal radiotherapy with yttrium-90 resin microspheres compared with sorafenib in locally advanced and inoperable hepatocellular carcinoma (SARAH): an open-label randomised controlled phase 3 trial.

    PubMed

    Vilgrain, Valérie; Pereira, Helena; Assenat, Eric; Guiu, Boris; Ilonca, Alina Diana; Pageaux, Georges-Philippe; Sibert, Annie; Bouattour, Mohamed; Lebtahi, Rachida; Allaham, Wassim; Barraud, Hélène; Laurent, Valérie; Mathias, Elodie; Bronowicki, Jean-Pierre; Tasu, Jean-Pierre; Perdrisot, Rémy; Silvain, Christine; Gerolami, René; Mundler, Olivier; Seitz, Jean-Francois; Vidal, Vincent; Aubé, Christophe; Oberti, Frédéric; Couturier, Olivier; Brenot-Rossi, Isabelle; Raoul, Jean-Luc; Sarran, Anthony; Costentin, Charlotte; Itti, Emmanuel; Luciani, Alain; Adam, René; Lewin, Maïté; Samuel, Didier; Ronot, Maxime; Dinut, Aurelia; Castera, Laurent; Chatellier, Gilles

    2017-12-01

    Sorafenib is the recommended treatment for patients with advanced hepatocellular carcinoma. We aimed to compare the efficacy and safety of sorafenib to that of selective internal radiotherapy (SIRT) with yttrium-90 ( 90 Y) resin microspheres in patients with hepatocellular carcinoma. SARAH was a multicentre, open-label, randomised, controlled, investigator-initiated, phase 3 trial done at 25 centres specialising in liver diseases in France. Patients were eligible if they were aged at least 18 years with a life expectancy greater than 3 months, had an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1, Child-Pugh liver function class A or B score of 7 or lower, and locally advanced hepatocellular carcinoma (Barcelona Clinic Liver Cancer [BCLC] stage C), or new hepatocellular carcinoma not eligible for surgical resection, liver transplantation, or thermal ablation after a previously cured hepatocellular carcinoma (cured by surgery or thermoablative therapy), or hepatocellular carcinoma with two unsuccessful rounds of transarterial chemoembolisation. Patients were randomly assigned (1:1) by a permutated block method with block sizes two and four to receive continuous oral sorafenib (400 mg twice daily) or SIRT with 90 Y-loaded resin microspheres 2-5 weeks after randomisation. Patients were stratified according to randomising centre, ECOG performance status, previous transarterial chemoembolisation, and presence of macroscopic vascular invasion. The primary endpoint was overall survival. Analyses were done on the intention-to-treat population; safety was assessed in all patients who received at least one dose of sorafenib or underwent at least one of the SIRT work-up exams. This study has been completed and the final results are reported here. The trial is registered with ClinicalTrials.gov, number NCT01482442. Between Dec 5, 2011, and March 12, 2015, 467 patients were randomly assigned; after eight patients withdrew consent, 237 were assigned to

  16. [In vitro hepatic targeting tendency of galactosyl-anti CD3 McAb-TILS].

    PubMed

    Jiang, P; He, S; Zhang, C

    1999-03-01

    This study was undertaken to enhance the hepatic targeting tendency of tumor infiltrating lymphocytes (TILs) and hence to lower the recurrence rate of primary liver cancer after hepatectomy. Galactosyl-anti CD3McAb-TILs were prepared and then were incubated together with hepatocytes. Their interaction through asialoglycoprotein receptor-mediated mechanism was observed under the inverted phase contrast microscope. The carbohydrate density of galactosyl-anti CD3McAb and the combining rate of galactosyl-anti CD3McAb with TILs were measured. The results revealed that galactosyl-anti CD3 McAb-TIL obviously were adhered to hepatocytes. The carbohydrate density of galactosyl-anti CD3McAb was 62.18, and the combining rate of galactosyl-anti CD3McAb with TILs was 97.9%. The results suggested that in vitro hepatic targeting tendency of galactosyl-anti CD3McAb-TILs was satisfactory, and that the carbohydrate density of 62.18 and the combining rate of 97.9% ensured the effective use of TILs.

  17. Daoy medulloblastoma cells that express CD133 are radioresistant relative to CD133- cells, and the CD133+ sector is enlarged by hypoxia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blazek, Ed R.; Foutch, Jennifer L.; Maki, Guitta

    2007-01-01

    Purpose: Primary medulloblastoma and glioblastoma multiforme tumor cells that express the surface marker CD133 are believed to be enriched for brain tumor stem cells because of their unique ability to initiate or reconstitute tumors in immunodeficient mice. This study sought to characterize the radiobiological properties and marker expression changes of CD133+ vs. CD133- cells of an established medulloblastoma cell line. Methods and Materials: Daoy and D283 Med cell lines were stained with fluorescently labeled anti-CD133 antibody and sorted into CD133+ and CD133- populations. The effect of oxygen (2% vs. 20%) on CD133 expression was measured. Both populations were analyzed formore » marker stability, cell cycle distribution, and radiosensitivity. Results: CD133+ Daoy cells restored nearly native CD133+ and CD133- populations within 18 days, whereas CD133- cells remained overwhelmingly CD133-. Culturing Daoy cells in 2% oxygen rather than the standard 20% oxygen increased their CD133 expression 1.6-fold. CD133+ Daoy cells were radioresistant via the {beta}-parameter of the linear-quadratic model relative to CD133- Daoy cells, although their {alpha}-parameters and cell cycle distributions were identical. Conclusions: Restoration of the original CD133+ and CD133- populations from CD133+ Daoy cells in serum is further evidence that CD133+ cells are functionally distinct from CD133- cells. The radioresistance of CD133+ compared with CD133- Daoy cells is consistent with better repair of sublethal damage. Enlargement of the CD133+ sector is a new feature of the hypoxic response.« less

  18. A phase I study of PRO131921, a novel anti-CD20 monoclonal antibody in patients with relapsed/refractory CD20+ indolent NHL: correlation between clinical responses and AUC pharmacokinetics.

    PubMed

    Casulo, Carla; Vose, Julie M; Ho, William Y; Kahl, Brad; Brunvand, Mark; Goy, Andre; Kasamon, Yvette; Cheson, Bruce; Friedberg, Jonathan W

    2014-09-01

    PRO131921 is a third-generation, humanized anti-CD20 monoclonal antibody with increased antibody-dependent cytotoxicity and complement-dependent cytotoxicity compared to rituximab. In this phase I study, PRO131921 was administered as a single agent to patients with CD20+, relapsed or refractory, indolent non-Hodgkin lymphoma (NHL) who had been treated with a prior rituximab-containing regimen. The primary aim of this study was safety and tolerability of PRO131921. The secondary aim of the study, and focus of this report, was to determine the pharmacokinetics (PK) profile of PRO131921 and establish a correlation between drug exposure and clinical efficacy. Patients were treated with PRO131921 by intravenous infusion weekly for 4 weeks and the dose was escalated based on safety in a 3+3 design. Twenty-four patients were treated with PRO131921 at doses from 25mg/m(2) to 800 mg/m(2). Analysis of PK data demonstrated a correlation between higher normalized drug exposure (normalized AUC) and tumor shrinkage (p = .0035). Also, normalized AUC levels were higher among responders and subjects displaying tumor shrinkage versus subjects progressing or showing no regression (p = 0.030). In conclusion, PRO131921 demonstrated clinical activity in rituximab-relapsed and refractory indolent NHL patients. The observation that higher normalized AUC may be associated with improved clinical responses has potential implications in future trials of monoclonal antibody-based therapies, and emphasizes the importance of early PK studies to optimize antibody efficacy. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Anti-tumor efficacy study of the Bruton's tyrosine kinase (BTK) inhibitor, ONO/GS-4059, in combination with the glycoengineered type II anti-CD20 monoclonal antibody obinutuzumab (GA101) demonstrates superior in vivo efficacy compared to ONO/GS-4059 in combination with rituximab.

    PubMed

    Yasuhiro, Tomoko; Sawada, Wako; Klein, Christian; Kozaki, Ryohei; Hotta, Shingo; Yoshizawa, Toshio

    2017-03-01

    The activated B-cell diffuse large B-cell-like lymphoma (ABC-DLBCL) correlates with poor prognosis. The B-cell receptor signaling pathway is known to be dysregulated in NHL/CLL and given BTK is a downstream mediator of BCR signaling, BTK constitutes an interesting and obvious therapeutic target. Given the high potency and selectivity of the BTK inhibitor, ONO/GS-4059, it was hypothesized that, the anti-tumor activity of ONO/GS-4059 could be further enhanced by combining it with the anti-CD20 Abs, rituximab (RTX) or obinutuzumab (GA101). ONO/GS-4059 combined with GA101 or RTX was significantly better than the respective monotherapy with tumor growth inhibition (TGI) of 90% for the GA101 combination and 86% for the RTX combination. In contrast, ibrutinib (PCI-32765) combined with RTX did not result in improved efficacy compared with respective monotherapy. Taken together these data indicate that the combination of ONO/GS-4059 with rituximab and particularly obinutuzumab may be an effective treatment for ABC-DLBCL.

  20. ImmunoPET Imaging of Murine CD4+ T Cells Using Anti-CD4 Cys-Diabody: Effects of Protein Dose on T Cell Function and Imaging.

    PubMed

    Freise, Amanda C; Zettlitz, Kirstin A; Salazar, Felix B; Lu, Xiang; Tavaré, Richard; Wu, Anna M

    2017-08-01

    Molecular imaging of CD4 + T cells throughout the body has implications for monitoring autoimmune disease and immunotherapy of cancer. Given the key role of these cells in regulating immunity, it is important to develop a biologically inert probe. GK1.5 cys-diabody (cDb), a previously developed anti-mouse CD4 antibody fragment, was tested at different doses to assess its effects on positron emission tomography (PET) imaging and CD4 + T cell viability, proliferation, CD4 expression, and function. The effect of protein dose on image contrast (lymphoid tissue-to-muscle ratio) was assessed by administering different amounts of 89 Zr-labeled GK1.5 cDb to mice followed by PET imaging and ex vivo biodistribution analysis. To assess impact of GK1.5 cDb on T cell biology, GK1.5 cDb was incubated with T cells in vitro or administered intravenously to C57BL/6 mice at multiple protein doses. CD4 expression and T cell proliferation were analyzed with flow cytometry and cytokines were assayed. For immunoPET imaging, the lowest protein dose of 2 μg of 89 Zr-labeled GK1.5 cDb resulted in significantly higher % injected dose/g in inguinal lymph nodes (ILN) and spleen compared to the 12-μg protein dose. In vivo administration of GK1.5 cDb at the high dose of 40 μg caused a transient decrease in CD4 expression in spleen, blood, lymph nodes, and thymus, which recovered within 3 days postinjection; this effect was reduced, although not abrogated, when 2 μg was administered. Proliferation was inhibited in vivo in ILN but not the spleen by injection of 40 μg GK1.5 cDb. Concentrations of GK1.5 cDb in excess of 25 nM significantly inhibited CD4 + T cell proliferation and interferon-γ production in vitro. Overall, using low-dose GK1.5 cDb minimized biological effects on CD4 + T cells. Low-dose GK1.5 cDb yields high-contrast immunoPET images with minimal effects on T cell biology in vitro and in vivo and may be a useful tool for investigating CD4 + T cells in the context of

  1. Alanine-170 and proline-172 are critical determinants for extracellular CD20 epitopes; heterogeneity in the fine specificity of CD20 monoclonal antibodies is defined by additional requirements imposed by both amino acid sequence and quaternary structure.

    PubMed

    Polyak, Maria J; Deans, Julie P

    2002-05-01

    In vivo ablation of malignant B cells can be achieved using antibodies directed against the CD20 antigen. Fine specificity differences among CD20 monoclonal antibodies (mAbs) are assumed not to be a factor in determining their efficacy because evidence from antibody-blocking studies indicates limited epitope diversity with only 2 overlapping extracellular CD20 epitopes. However, in this report a high degree of heterogeneity among antihuman CD20 mAbs is demonstrated. Mutation of alanine and proline at positions 170 and 172 (AxP) (single-letter amino acid codes; x indicates the identical amino acid at the same position in the murine and human CD20 sequences) in human CD20 abrogated the binding of all CD20 mAbs tested. Introduction of AxP into the equivalent positions in the murine sequence, which is not otherwise recognized by antihuman CD20 mAbs, fully reconstituted the epitope recognized by B1, the prototypic anti-CD20 mAb. 2H7, a mAb previously thought to recognize the same epitope as B1, did not recognize the murine AxP mutant. Reconstitution of the 2H7 epitope was achieved with additional mutations replacing VDxxD in the murine sequence for INxxN (positions 162-166 in the human sequence). The integrity of the 2H7 epitope, unlike that of B1, further depends on the maintenance of CD20 in an oligomeric complex. The majority of 16 antihuman CD20 mAbs tested, including rituximab, bound to murine CD20 containing the AxP mutations. Heterogeneity in the fine specificity of these antibodies was indicated by marked differences in their ability to induce homotypic cellular aggregation and translocation of CD20 to a detergent-insoluble membrane compartment previously identified as lipid rafts.

  2. Temporary Arterial Balloon Occlusion as an Adjunct to Yttrium-90 Radioembolization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Nambiar, Ashwin, E-mail: uvashwin@gmail.com; Hagspiel, Lauren M., E-mail: lmh4gg@virginia.edu

    2013-06-15

    Purpose. This study was designed to describe the technique of arterial occlusion using a temporary occlusion balloon system as an alternative to coil occlusion during Yttrium-90 radioembolization of hepatic tumors. Methods. Review of charts, angiography, and follow-up imaging studies of consecutive patients undergoing oncological embolization procedures in which a HyperForm system (ev3 Neurovascular, Irvine, CA) was used. Intraprocedural target vessel occlusion and patency of the target vessel on follow-up were recorded. Clinical data and Bremsstrahlung scans were reviewed for evidence of nontarget embolization. Results. Four radioembolization procedures were performed in three patients (all female, age 48-54 (mean 52) years). Fivemore » arteries were temporarily occluded (three gastroduodenal arteries, one right gastric artery, and one cystic artery). All radioembolization procedures were successfully completed. Follow-up imaging (either digital subtraction angiography (DSA) or computed tomography angiography (CTA)) was available for all patients between 28-454 (mean 183) days following the procedure, demonstrating all five vessels to be patent. No clinical or imaging evidence for nontarget embolization was found. Conclusions. Temporary balloon occlusion of small and medium-sized arteries during radioembolization allows safe therapy with preserved postprocedural vessel patency on early and midterm follow-up.« less

  3. 28 CFR 90.20 - Application content.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Application content. 90.20 Section 90.20 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) VIOLENCE AGAINST WOMEN The STOP (Services ⢠Training ⢠Officers ⢠Prosecutors) Violence Against Women Formula Grant Program § 90.20 Application content. (a) Format. Applications from the...

  4. 28 CFR 90.20 - Application content.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Application content. 90.20 Section 90.20 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) VIOLENCE AGAINST WOMEN The STOP (Services ⢠Training ⢠Officers ⢠Prosecutors) Violence Against Women Formula Grant Program § 90.20 Application content. (a) Format. Applications from the...

  5. 28 CFR 90.20 - Application content.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Application content. 90.20 Section 90.20 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) VIOLENCE AGAINST WOMEN The STOP (Services ⢠Training ⢠Officers ⢠Prosecutors) Violence Against Women Formula Grant Program § 90.20 Application content. (a) Format. Applications from the...

  6. 28 CFR 90.20 - Application content.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Application content. 90.20 Section 90.20 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) VIOLENCE AGAINST WOMEN The STOP (Services ⢠Training ⢠Officers ⢠Prosecutors) Violence Against Women Formula Grant Program § 90.20 Application content. (a) Format. Applications from the...

  7. 28 CFR 90.20 - Application content.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Application content. 90.20 Section 90.20 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) VIOLENCE AGAINST WOMEN The STOP (Services ⢠Training ⢠Officers ⢠Prosecutors) Violence Against Women Formula Grant Program § 90.20 Application content. (a) Format. Applications from the...

  8. Early Dose Response to Yttrium-90 Microsphere Treatment of Metastatic Liver Cancer by a Patient-Specific Method Using Single Photon Emission Computed Tomography and Positron Emission Tomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campbell, Janice M.; Department of Radiation Oncology, Wayne State University, Detroit, MI; Wong, C. Oliver

    2009-05-01

    Purpose: To evaluate a patient-specific single photon emission computed tomography (SPECT)-based method of dose calculation for treatment planning of yttrium-90 ({sup 90}Y) microsphere selective internal radiotherapy (SIRT). Methods and Materials: Fourteen consecutive {sup 90}Y SIRTs for colorectal liver metastasis were retrospectively analyzed. Absorbed dose to tumor and normal liver tissue was calculated by partition methods with two different tumor/normal liver vascularity ratios: an average 3:1 and a patient-specific ratio derived from pretreatment technetium-99m macroaggregated albumin SPECT. Tumor response was quantitatively evaluated from fluorine-18 fluoro-2-deoxy-D-glucose positron emission tomography scans. Results: Positron emission tomography showed a significant decrease in total tumor standardizedmore » uptake value (average, 52%). There was a significant difference in the tumor absorbed dose between the average and specific methods (p = 0.009). Response vs. dose curves fit by linear and linear-quadratic modeling showed similar results. Linear fit r values increased for all tumor response parameters with the specific method (+0.20 for mean standardized uptake value). Conclusion: Tumor dose calculated with the patient-specific method was more predictive of response in liver-directed {sup 90}Y SIRT.« less

  9. Clinical Trials Using Anti-CD19/CD28/CD3zeta CAR Gammaretroviral Vector-transduced Autologous T Lymphocytes KTE-C19

    Cancer.gov

    NCI supports clinical trials that test new and more effective ways to treat cancer. Find clinical trials studying anti-cd19/cd28/cd3zeta car gammaretroviral vector-transduced autologous t lymphocytes kte-c19.

  10. Activation of photodynamic therapy in vitro with Cerenkov luminescence generated from Yttrium-90 (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Hartl, Brad A.; Hirschberg, Henry; Marcu, Laura; Cherry, Simon R.

    2016-03-01

    Translation of photodynamic therapy to the clinical setting has primarily been limited to easily accessible and/or superficial diseases where traditional light delivery can be performed noninvasively. Cerenkov luminescence, as generated from medically relevant radionuclides, has been suggested as a means to deliver light to deeper tissues noninvasively in order to overcome this depth limitation. We report on the use of Cerenkov luminescence generated from Yttrium-90 as a means to active the photodynamic therapy process in monolayer tumor cell cultures. The current study investigates the utility of Cerenkov luminescence for activating both the clinically relevant aminolevulinic acid at 1.0 mM and also the more efficient photosensitizer TPPS2a at 1.2 µM. Cells were incubated with aminolevulinic acid for 6 hours prior to radionuclide addition, as well as additional daily treatments for three days. TPPS2a was delivered as a single treatment with an 18 hour incubation time before radionuclide addition. Experiments were completed for both C6 glioma cells and MDA-MB-231 breast tumor cells. Although aminolevulinic acid proved ineffective for generating a therapeutic effect at any activity for either cell line, TPPS2a produced at least a 20% therapeutic effect at activities ranging from 6 to 60 µCi/well for the C6 cell line. Current results demonstrate that it may be possible to generate a therapeutic effect in vivo using Cerenkov luminescence to activate the photodynamic therapy process with clinically relevant photosensitizers.

  11. Treating B-cell cancer with T cells expressing anti-CD19 chimeric antigen receptors.

    PubMed

    Kochenderfer, James N; Rosenberg, Steven A

    2013-05-01

    Most B-cell malignancies express CD19, and a majority of patients with B-cell malignancies are not cured by current standard therapies. Chimeric antigen receptors (CARs) are fusion proteins consisting of antigen recognition moieties and T-cell activation domains. T cells can be genetically modified to express CARs, and adoptive transfer of anti-CD19 CAR T cells is now being tested in clinical trials. Effective clinical treatment with anti-CD19 CAR T cells was first reported in 2010 after a patient with advanced-stage lymphoma treated at the NCI experienced a partial remission of lymphoma and long-term eradication of normal B cells. Additional patients have subsequently obtained long-term remissions of advanced-stage B-cell malignancies after infusions of anti-CD19 CAR T cells. Long-term eradication of normal CD19(+) B cells from patients receiving infusions of anti-CD19 CAR T cells demonstrates the potent antigen-specific activity of these T cells. Some patients treated with anti-CD19 CAR T cells have experienced acute adverse effects, which were associated with increased levels of serum inflammatory cytokines. Although anti-CD19 CAR T cells are at an early stage of development, the potent antigen-specific activity observed in patients suggests that infusions of anti-CD19 CAR T cells might become a standard therapy for some B-cell malignancies.

  12. Evaluation of Ginger (Zingiber officinale Roscoe) Bioactive Compounds in Increasing the Ratio of T-cell Surface Molecules of CD3+CD4+:CD3+CD8+ In-Vitro.

    PubMed

    Tejasari, Dr

    2007-09-01

    The potential ability of ginger bioactive compounds in increasing the ratio of T-cell surface molecules of CD3+CD4+:CD3+CD8+ was investigated using dual tagging FITC and PE of monoclonal antibody anti-human with its fluorescence measured by flow cytometer. Oleoresin was extracted using sinkhole distillation technique. Its components namely, gingerol in fraction-1, shogaol in fraction 2 and zingeron in fraction-3 were separated by column vacuum chromatography method. The doses of oleoresin, gingerol, shogaol, and zingeron tested were 50, 100,150, 200, and 250 μg/ml. Lymphocytes (2x106 cell/ml) from human peripheral blood were isolated using ficoll density gradient technique, and cultured in the presence of the compounds in RPMI-1640 medium and phytohemaglutinin (PHA) mitogen for 96 h under normal conditions. Percentages of T-cell surface molecules (CD4+ and CD8+) were determined using dual-tagging FITC and PE fluorescents labeled on monoclonal antibody anti human. The fluorescence-labeled bands on the T-cell surface molecules were counted using flow cytometer. The experiment revealed that oleoresin and its three fractions increased the percentage of CD3+CD4+. The compound in fraction 3 of oleoresin at 200 μg/ml increased by the highest percentage of CD3+CD4+ of 9%, but slightly decreased the percentage of CD3+CD8+. These ginger bioactive compounds increased the ratio of CD3+CD4:CD3+CD8+ T-cells with the highest increment of 30% from effects of 200 μg/ml fraction 3 of oleoresin. This in vitro finding revealed that ginger bioactive compounds potentially increased cellular and humoral immune response. Further clinical studies are needed to confirm the benefits of these ginger bioactive compounds as a potential functional food for testing on HIV infected patients.

  13. HSP90 inhibitor 17-DMAG enhances EphA2+ tumor cell recognition by specific CD8+ T cells

    PubMed Central

    Kawabe, Mayumi; Mandic, Maja; Taylor, Jennifer L.; Vasquez, Cecilia A.; Wesa, Amy K.; Neckers, Leonard M.; Storkus, Walter J.

    2009-01-01

    EphA2, a member of the receptor tyrosine kinase (RTK) family, is commonly expressed by a broad range of cancer types, where its level of (over)expression correlates with poor clinical outcome. Since tumor cell expressed EphA2 is a non-mutated “self” protein, specific CD8+ T cells are subject to self-tolerance mechanisms and typically exhibit only moderate-to-low functional avidity, rendering them marginally competent to recognize EphA2+ tumor cells in vitro or in vivo. We have recently reported that the ability of specific CD8+ T cells to recognize EphA2+ tumor cells can be augmented after the cancer cells are pretreated with EphA2 agonists that promote proteasomal degradation and upregulated expression of EphA2/class I complexes on the tumor cell membrane (Wesa et al., J. Immunol. 2008;181:7721-7). In the current study we show that treatment of EphA2+ tumor cells with the irreversible HSP90 inhibitor, 17-DMAG, similarly enhances their recognition by EphA2-specific CD8+ T cell lines and clones in vitro via a mechanism that is dependent on proteasome and TAP function, as well as, the retrotranslocation of EphA2 into the tumor cytoplasm. When 17-DMAG and agonist anti-EphA2 mAb are co-applied, T cell recognition of tumor cells is further increased over that observed for either agent alone. These studies suggest that EphA2 represents a novel HSP90 client protein and that the treatment of cancer patients with 17-DMAG-based “pulse” therapy may improve the anti-tumor efficacy of CD8+ T effector cells reactive against EphA2-derived epitopes. PMID:19690146

  14. Simplified process for the production of anti-CD19-CAR engineered T cells

    PubMed Central

    Tumaini, Barbara; Lee, Daniel W.; Lin, Tasha; Castiello, Luciano; Stroncek, David F.; Mackall, Crystal; Wayne, Alan; Sabatino, Marianna

    2014-01-01

    Background Adoptive Immunotherapy using chimeric antigen receptor (CAR) engineered T cells specific for CD19 has shown promising results for the treatment of B cell lymphomas and leukemia. This therapy involves the transduction of autologous T cells with a viral vector and the subsequent cell expansion. Here, we describe a new, simplified method to produce anti-CD19-CAR T cells. Methods T cells were isolated from peripheral blood mononuclear cell (PBMC) with anti-CD3/anti-CD28 paramagnetic beads. After 2 days, the T cells were added to culture bags pre-treated with RetroNectin and loaded with the retroviral anti-CD19 CAR vector. The cells, beads and vector were incubated for 24 hours and then a second transduction was performed. No spinoculation was used. Cells were then expanded for an additional 9 days. Results The method was validated using 2 PBMC products from a patient with B-CLL and one PBMC product from a healthy subject. The 2 PBMC products from the B-CLL patient contained 11.4% and 12.9% T cells. The manufacture process led to final products highly enriched in T cells with a mean CD3+ cell content of 98%, a mean expansion of 10.6 fold and a mean transduction efficiency of 68%. Similar results were obtained from the PBMCs of the first 4 ALL patients treated at our institution. Discussion We developed a simplified semi-closed system for the initial selection, activation, transduction and expansion of T cells using anti-CD3/anti-CD28 beads and bags, to produce autologous anti-CD19 CAR transduced T cells to support an ongoing clinical trial. PMID:23992830

  15. High treatment efficacy by dual targeting of Burkitt's lymphoma xenografted mice with a (177)Lu-based CD22-specific radioimmunoconjugate and rituximab.

    PubMed

    Weber, Tobias; Bötticher, Benedikt; Mier, Walter; Sauter, Max; Krämer, Susanne; Leotta, Karin; Keller, Armin; Schlegelmilch, Anne; Grosse-Hovest, Ludger; Jäger, Dirk; Haberkorn, Uwe; Arndt, Michaela A E; Krauss, Jürgen

    2016-03-01

    Dual-targeted therapy has been shown to be a promising treatment option in recurrent and/or refractory B-cell non-Hodgkin's lymphoma (B-NHL). We generated radioimmunoconjugates (RICs) comprising either a novel humanized anti-CD22 monoclonal antibody, huRFB4, or rituximab, and the low-energy β-emitter (177)Lu. Both RICs were evaluated as single agents in a human Burkitt's lymphoma xenograft mouse model. To increase the therapeutic efficacy of the anti-CD22 RIC, combination therapy with unlabelled anti-CD20 rituximab was explored. The binding activity of CHX-A″-DTPA-conjugated antibodies to target cells was analysed by flow cytometry. To assess tumour targeting of (177)Lu-labelled antibodies, in vivo biodistribution experiments were performed. For radioimmunotherapy (RIT) studies, non-obese diabetic recombination activating gene-1 (NOD-Rag1 (null) ) interleukin-2 receptor common gamma chain (IL2rγ (null) ) null mice (NRG mice) were xenografted subcutaneously with Raji Burkitt's lymphoma cells. (177)Lu-conjugated antibodies were administered at a single dose of 9.5 MBq per mouse. For dual-targeted therapy, rituximab was injected at weekly intervals (0.5 - 1.0 mg). Tumour accumulation of RICs was monitored by planar scintigraphy. Conjugation of CHX-A"-DTPA resulted in highly stable RICs with excellent antigen-binding properties. Biodistribution experiments revealed higher tumour uptake of the (177)Lu-labelled anti-CD22 IgG than of (177)Lu-labelled rituximab. Treatment with (177)Lu-conjugated huRFB4 resulted in increased tumour growth inhibition and significantly longer survival than treatment with (177)Lu-conjugated rituximab. The therapeutic efficacy of the anti-CD22 RIC could be markedly enhanced by combination with unlabelled rituximab. These findings suggest that dual targeting with (177)Lu-based CD22-specific RIT in combination with rituximab is a promising new treatment option for refractory B-NHL.

  16. Marrow Ablative and Immunosuppressive Effects of I-131-anti-CD45 Antibody in Congenic and H2-Mismatched Murine Transplant Models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthews, D. C.; Martin, P J.; Nourigat, C.

    1998-12-01

    Targeted hematopoietic irradiation delivered by I-131-anti-CD45 antibody has been combined with conventional marrow transplant preparative regimens in an effort to decrease relapse. Before increasing the proportion of therapy delivered by radiolabeled antibody, the myeloablative and immunosuppressive effects of such low dose rate irradiation must be quantitated. We have examined the ability of I-131-anti-CD45 antibody to facilitate engraftment in Ly5-congenic and H2-mismatched murine marrow transplant models. Recipient B6-Ly5-a mice were treated with 30F11 antibody labeled with 0.1 to 1.5 mCi I-131 and/or total body irradiation (TBI), followed by T-cell-depleted marrow from Ly5-b-congenic (C57BL/6) or H2-mismatched (BALB/c) donors. Engraftment was achieved readilymore » in the Ly5-congenic setting, with greater than 80% donor granulocytes and T cells after 0.5 mCi I-131 (estimated 17 Gy to marrow) or 8 Gy TBI. A higher TBI dose (14 Gy) was required to achieve engraftment of H2-mismatched mar row, and engraftment occurred in only 3 of 11 mice receiving 1.5 mCi I-131 delivered by anti-CD45 antibody. Engraftment of H2-mismatched marrow was achieved in 22 of 23 animals receiving 0.75 mCi I-131 delivered by anti-CD45 antibody combined with 8 Gy TBI. Thus, targeted radiation delivered via I-131-anti-CD45 antibody can enable engraftment of congenic marrow and can partially replace TBI when transplanting T-cell-depleted H2-mismatched marrow.« less

  17. Experiments in Radiochemistry: Paper Electrophorectic Separation of Superscript 90 Sr and Superscript 90 Y.

    ERIC Educational Resources Information Center

    Miekely, N.; Roldao, L. A.

    1982-01-01

    Using different supporting electrolytes, the influence of complex-forming equilibria on migration velocities of strontium-90 and yttrium-90 can be demonstrated in this experiment. Includes procedures and materials needed. (SK)

  18. Specific Conjugation of the Hinge Region for Homogeneous Preparation of Antibody Fragment-Drug Conjugate: A Case Study for Doxorubicin-PEG-anti-CD20 Fab' Synthesis.

    PubMed

    Zhou, Zhan; Zhang, Jing; Zhang, Yan; Ma, Guanghui; Su, Zhiguo

    2016-01-20

    Conventional preparation strategies for antibody-drug conjugates (ADCs) result in heterogeneous products with various molecular sizes and species. In this study, we developed a homogeneous preparation strategy by site-specific conjugation of the anticancer drug with an antibody fragment. The model drug doxorubicin (DOX) was coupled to the Fab' fragment of anti-CD20 IgG at its permissive sites through a heterotelechelic PEG linker, generating an antibody fragment-drug conjugate (AFDC). Anti-CD20 IgG was digested and reduced specifically with β-mercaptoethylamine to generate the Fab' fragment with two free mercapto groups in its hinge region. Meanwhile, DOX was conjugated with α-succinimidylsuccinate ω-maleimide polyethylene glycol (NHS-PEG-MAL) to form MAL-PEG-DOX, which was subsequently linked to the free mercapto containing Fab' fragment to form a Fab'-PEG-DOX conjugate. The dual site-specific bioconjugation was achieved through the combination of highly selective reduction of IgG and introduction of heterotelechelic PEG linker. The resulting AFDC provides an utterly homogeneous product, with a definite ratio of one fragment to two drugs. Laser confocal microscopy and cell ELISA revealed that the AFDC could accumulate in the antigen-positive Daudi tumor cell. In addition, the Fab'-PEG-DOX retained appreciable targeting ability and improved antitumor activity, demonstrating an excellent therapeutic effect on the lymphoma mice model for better cure rate and significantly reduced side effects.

  19. [Anti-mouse CD122 antibody promotes the hematopoietic repopulating capacity of cord blood CD34⁺ cells in NOD/SCID mice].

    PubMed

    Sheng, Men-Yao; Shi, Hui; Xing, Wen; Wang, Wen-Jun; Si, Xiao-Hui; Bai, Jie; Yuan, Wei-Ping; Zhou, Yuan; Yang, Feng-Chun

    2014-12-01

    The study was aimed to investigate the effect of anti-mouse CD122 antibody on the hematopoietic repopulating capacity of cord blood CD34⁺ cells in a humanized murine model-non obese diabetic/severe combined immunodeficiency (NOD/SCID) mice. After sublethal irradiation with γ-ray, NOD/SCID mice were intraperitoneally injected with 200 µg mouse isotype control antibody or anti-mouse CD122 antibody. Human cord blood CD34⁺ cells or phosphate-buffered saline (PBS) were injected via the tail vein at 6-8 hours later. Cohort of the mice injected with anti-mice CD122 antibody or control antibody alone were sacrificed at different time point (at week 2, 3, and 4 weeks) after the injection, and the percentage of NK cells in the peripheral blood was analyzed by flow cytometry. To evaluate the effect of anti-mouse CD122 antibody on the repopulating capacity of cord blood CD34⁺ cells in the recipient mice, phenotype analysis was performed in the bone marrow at 6 and 8 weeks after the transplantation. The results showed that the proportion of NK cells in the peripheral blood were (4.6 ± 0.6)% and (5.7 ± 1.7)% at week 2 and 3 after anti-CD122 antibody injection respectively,which decreased by 60%, compared with the mice injected with isotype control antibody. After 6 and 8 weeks of cord blood CD34⁺ cell transplantation,the percentage of human CD45⁺ in the bone marrow of the recipient mice treated with anti-mice CD122 antibody was (63.0 ± 12.2)% and (53.2 ± 16.3)%,respectively,which were dramatically higher than that in the mice treated with isotype control antibody (7.7 ± 3.6)% and (6.1 ± 2.4)%. Moreover,at 8 weeks after transplantation,human CD34⁺ cells appeared significantly in the recipients treated with anti-CD122 antibody. It is concluded that the anti-mouse CD122 antibody enhances the hematopoietic repopulating capacity of cord blood CD34⁺ cells in the NOD/SCID mice through decreasing the proportion of NK cells.

  20. Dissection of a circulating CD3+ CD20+ T cell subpopulation in patients with psoriasis.

    PubMed

    Niu, J; Zhai, Z; Hao, F; Zhang, Y; Song, Z; Zhong, H

    2018-05-01

    CD3 + CD20 + T cells are a population of CD3 + T cells that express CD20 and identified in healthy donors and autoimmune diseases. However, the nature and role of these cells in patients with psoriasis remain unclear. In this study, we aimed to investigate the level, phenotype, functional and clinical relevance of CD3 + CD20 + T cells in the peripheral blood of patients with psoriasis. We found that a small subset of CD3 + T cells expressed CD20 molecule in the peripheral blood of patients with psoriasis, and their levels were similar to those in healthy donors. Circulating CD3 + CD20 + T cells in patients with psoriasis were enriched in CD4 + cells and displayed an activated effector phenotype, as these cells contained fewer CD45RA + -naive and CCR7 + cells with increased activity than those of CD3 + T cells lacking CD20. In addition, compared with healthy donors, circulating CD3 + CD20 + T cells in patients with psoriasis produced more cytokines, interleukin (IL)-17A, tumour necrosis factor (TNF)-α and IL-21, but not IL-4 and IFN-γ. Furthermore, a significantly positive correlation was found between the levels of IL-17A, TNF-α and IL-21-production CD3 + CD20 + T cells with Psoriasis Area and Severity Index scores. Our findings suggest that CD3 + CD20 + T cells may play a role in the pathogenesis of psoriasis. © 2018 British Society for Immunology.

  1. The DC-SIGN-CD56 interaction inhibits the anti-dendritic cell cytotoxicity of CD56 expressing cells.

    PubMed

    Nabatov, Alexey A; Raginov, Ivan S

    2015-01-01

    This study aimed to clarify interactions of the pattern-recognition receptor DC-SIGN with cells from the HIV-infected peripheral blood lymphocyte cultures. Cells from control and HIV-infected peripheral blood lymphocyte cultures were tested for the surface expression of DC-SIGN ligands. The DC-SIGN ligand expressing cells were analyzed for the role of DC-SIGN-ligand interaction in their functionality. In the vast majority of experiments HIV-infected lymphocytes did not express detectable DC-SIGN ligands on their cell surfaces. In contrast, non-infected cells, carrying NK-specific marker CD56, expressed cell surface DC-SIGN ligands. The weakly polysialylated CD56 was identified as a novel DC-SIGN ligand. The treatment of DC-SIGN expressing dendritic cells with anti-DC-SIGN antibodies increased the anti-dendritic cell cytotoxicity of CD56(pos) cells. The treatment of CD56(pos) cells with a peptide, blocking the weakly polysialylated CD56-specifc trans-homophilic interactions, inhibited their anti-dendritic cells cytotoxicity. The interaction between DC-SIGN and CD56 inhibits homotypic intercellular interactions of CD56(pos) cells and protects DC-SIGN expressing dendritic cells against CD56(pos) cell-mediated cytotoxicity. This finding can have an impact on the development of approaches to HIV infection and cancer therapy as well as in transplantation medicine.

  2. CD22 expression on blastic plasmacytoid dendritic cell neoplasms and reactivity of anti-CD22 antibodies to peripheral blood dendritic cells.

    PubMed

    Reineks, Edmunds Z; Osei, Ebenezer S; Rosenberg, Arlene; Auletta, Jeffrey; Meyerson, Howard J

    2009-07-01

    We identified CD22 expression on a blastic plasmacytoid dendritic cell (pDC) neoplasm presenting as a leukemia in a child. CD22 expression, as determined by the antibody s-HCL-1, was also noted on the neoplastic cells from three additional patients with blastic pDC tumors identified at our institution. Subsequently we determined that peripheral blood pDCs react with the s-HCL-1 antibody demonstrating that normal pDCs express CD22. Evaluation of five additional anti-CD22 antibodies indicated that staining of pDCs with these reagents was poor except for s-HCL-1. Therefore, the detection of CD22 on pDCs is best demonstrated with the use of this specific antibody clone. All anti-CD22 antibodies stained conventional DCs. We also evaluated the reactivity of the anti-CD22 antibodies with basophils and noted that the pattern of staining was similar to that seen with pDCs. The studies demonstrate that normal DCs and pDC neoplasms express CD22, and highlight clone specific differences in anti-CD22 antibody reactivity patterns on pDCs and basophils. (c) 2009 Clinical Cytometry Society.

  3. Histological Comparison of Kidney Tissue Following Radioembolization with Yttrium-90 Resin Microspheres and Embolization with Bland Microspheres

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silva, Suresh de, E-mail: suresh.desilva@unsw.edu.au; Mackie, Simon; Aslan, Peter

    BackgroundIntra-arterial brachytherapy with yttrium-90 ({sup 90}Y) resin microspheres (radioembolization) is a procedure to selectively deliver high-dose radiation to tumors. The purpose of this research was to compare the radioembolic effect of {sup 90}Y-radioembolization versus the embolic effect of bland microspheres in the porcine kidney model.MethodsIn each of six pigs, ~25–33 % of the kidney volume was embolized with {sup 90}Y resin microspheres and an equivalent number of bland microspheres in the contralateral kidney. Kidney volume was estimated visually from contrast-enhanced fluoroscopy imaging. Morphologic and histologic analysis was performed 8–9 weeks after the procedure to assess the locations of the microspheres and extentmore » of tissue necrosis from {sup 90}Y-radioembolization and bland embolization. A semi-quantified evaluation of the non-acute peri-particle and perivascular tissue reaction was conducted. All guidelines for the care and use of animals were followed.ResultsKidneys embolized with {sup 90}Y-radioembolization decreased in mass by 30–70 % versus the contralateral kidney embolized with bland microspheres. These kidneys showed significant necrosis/fibrosis, avascularization, and glomerular atrophy in the immediate vicinity of the {sup 90}Y resin microspheres. By contrast, glomerular changes were not observed, even with clusters of bland microspheres in afferent arterioles. Evidence of a foreign body reaction was recorded in some kidneys with bland microspheres, and subcapsular scarring/infarction only with the highest load (4.96 × 10{sup 6}) of bland microspheres.ConclusionThis study showed that radioembolization with {sup 90}Y resin microspheres produces localized necrosis/fibrosis and loss of kidney mass in a porcine kidney model. This result supports the study of {sup 90}Y resin microspheres for the localized treatment of kidney tumors.« less

  4. Contribution of herpesvirus specific CD8 T cells to anti-viral T cell response in humans.

    PubMed

    Sandalova, Elena; Laccabue, Diletta; Boni, Carolina; Tan, Anthony T; Fink, Katja; Ooi, Eng Eong; Chua, Robert; Shafaeddin Schreve, Bahar; Ferrari, Carlo; Bertoletti, Antonio

    2010-08-19

    Herpesviruses infect most humans. Their infections can be associated with pathological conditions and significant changes in T cell repertoire but evidences of symbiotic effects of herpesvirus latency have never been demonstrated. We tested the hypothesis that HCMV and EBV-specific CD8 T cells contribute to the heterologous anti-viral immune response. Volume of activated/proliferating virus-specific and total CD8 T cells was evaluated in 50 patients with acute viral infections: 20 with HBV, 12 with Dengue, 12 with Influenza, 3 with Adenovirus infection and 3 with fevers of unknown etiology. Virus-specific (EBV, HCMV, Influenza) pentamer+ and total CD8 T cells were analyzed for activation (CD38/HLA-DR), proliferation (Ki-67/Bcl-2(low)) and cytokine production. We observed that all acute viral infections trigger an expansion of activated/proliferating CD8 T cells, which differs in size depending on the infection but is invariably inflated by CD8 T cells specific for persistent herpesviruses (HCMV/EBV). CD8 T cells specific for other non-related non persistent viral infection (i.e. Influenza) were not activated. IL-15, which is produced during acute viral infections, is the likely contributing mechanism driving the selective activation of herpesvirus specific CD8 T cells. In addition we were able to show that herpesvirus specific CD8 T cells displayed an increased ability to produce the anti-viral cytokine interferon-gamma during the acute phase of heterologous viral infection. Taken together, these data demonstrated that activated herpesvirus specific CD8 T cells inflate the activated/proliferating CD8 T cells population present during acute viral infections in human and can contribute to the heterologous anti-viral T cell response.

  5. Three-year clinical follow-up after strontium-90/yttrium-90 beta-irradiation for the treatment of in-stent coronary restenosis.

    PubMed

    Baierl, Verena; Baumgartner, Simone; Pöllinger, Barbara; Leibig, Marcus; Rieber, Johannes; König, Andreas; Krötz, Florian; Sohn, Hae-Young; Siebert, Uwe; Haimerl, Wolfgang; Dühmke, Eckhart; Theisen, Karl; Klauss, Volker; Schiele, Thomas M

    2005-11-15

    Because late vessel failure has been speculated as a possible limitation of vascular brachytherapy, we conducted a prospective clinical evaluation at 6, 12, 24, and 36 months of follow-up after irradiation with strontium-90/yttrium-90 for in-stent restenosis, regardless of the patient's symptomatic status. We report complete 3-year follow-up data for 106 consecutive patients. The cumulative rate of death at 6, 12, 24, and 36 months was 0.9%, 0.9%, 0.9%, and 1.9% respectively. The corresponding rates for acute ST-elevation myocardial infarction were 2.8%, 4.7%, 4.7%, and 4.7%, respectively. The cumulative rate of late thrombotic occlusion at 6, 12, 24, and 36 months was 3.8%, 4.7%, 4.7%, and 4.7%, respectively. The corresponding rates of target lesion revascularization and target vessel revascularization were 8.5% and 12.3% (p = 0.046), 14.2% (p = 0.157) and 18.0% (p = 0.046), 12.3% and 18.9% (p = 0.008), and 21.7% (p = 0.083) and 29.2% (p = 0.005), respectively. The cumulative rate of all major adverse cardiovascular events at 6, 12, 24, and 36 months was 16.1%, 24.5% (p = 0.003), 27.4% (p = 0.083), and 35.8% (p = 0.003), respectively. In conclusion, these results indicate a delayed and, even in the third year after the index procedure, continued restenotic process after beta irradiation of in-stent restenotic lesions.

  6. Preparation & in vitro evaluation of 90Y-DOTA-rituximab

    PubMed Central

    Kameswaran, Mythili; Pandey, Usha; Dash, Ashutosh; Samuel, Grace; Venkatesh, Meera

    2016-01-01

    Background & objectives: Radioimmunotherapy is extensively being used for the treatment of non-Hodgkin's lymphoma (NHL). Use of rituximab, a chimeric anti-CD20 antibody directed against the CD20 antigen in combination with suitable beta emitters is expected to result in good treatment response by its cross-fire and bystander effects. The present work involves the conjugation of p-isothiocyanatobenzyl DOTA (p-SCN-Bn-DOTA) to rituximab, its radiolabelling with 90Y and in vitro and in vivo evaluation to determine its potential as a radioimmunotherapeutic agent. Methods: Rituximab was conjugated with p-SCN-Bn-DOTA at 1:1 antibody: DOTA molar ratio. The number of DOTA molecules linked to one molecule of rituximab was determined by radioassay and spectroscopic assay. Radiolabelling of rituximab with 90Y was carried out and its in vitro stability was evaluated. In vitro cell binding studies were carried out in Raji cells expressing CD20 antigen. Biodistribution studies were carried out in normal Swiss mice. Results: Using both radioassay and spectroscopic method, it was determined that about five molecules of DOTA were linked to rituximab. Radiolabelling of the rituximab conjugate with 90Y and subsequent purification on PD-10 column gave a product with radiochemical purity (RCP) > 98 per cent which was retained at > 90 per cent up to 72 h when stored at 37°C. In vitro cell binding experiments of 90Y-DOTA-rituximab with Raji cells exhibited specific binding of 20.7 ± 0.1 per cent with 90Y-DOTA-rituximab which reduced to 15.5 ± 0.2 per cent when incubated with cold rituximab. The equilibrium constant Kd for 90Y-DOTA-Rituximab was determined to be 3.38 nM. Radiolabelled antibody showed clearance via hepatobiliary and renal routes and activity in tibia was found to be quite low indicating in vivo stability of 90Y-DOTA-rituximab. Interpretation & conclusions: p-SCN-Bn-DOTA was conjugated with rituximab and radiolabelling with 90Y was carried out. In vitro studies carried

  7. Near-infrared emitting fluorescent nanocrystals-labeled natural killer cells as a platform technology for the optical imaging of immunotherapeutic cells-based cancer therapy

    NASA Astrophysics Data System (ADS)

    Taik Lim, Yong; Cho, Mi Young; Noh, Young-Woock; Chung, Jin Woong; Chung, Bong Hyun

    2009-11-01

    This study describes the development of near-infrared optical imaging technology for the monitoring of immunotherapeutic cell-based cancer therapy using natural killer (NK) cells labeled with fluorescent nanocrystals. Although NK cell-based immunotherapeutic strategies have drawn interest as potent preclinical or clinical methods of cancer therapy, there are few reports documenting the molecular imaging of NK cell-based cancer therapy, primarily due to the difficulty of labeling of NK cells with imaging probes. Human natural killer cells (NK92MI) were labeled with anti-human CD56 antibody-coated quantum dots (QD705) for fluorescence imaging. FACS analysis showed that the NK92MI cells labeled with anti-human CD56 antibody-coated QD705 have no effect on the cell viability. The effect of anti-human CD56 antibody-coated QD705 labeling on the NK92MI cell function was investigated by measuring interferon gamma (IFN- γ) production and cytolytic activity. Finally, the NK92MI cells labeled with anti-human CD56 antibody-coated QD705 showed a therapeutic effect similar to that of unlabeled NK92MI cells. Images of intratumorally injected NK92MI cells labeled with anti-human CD56 antibody-coated could be acquired using near-infrared optical imaging both in vivo and in vitro. This result demonstrates that the immunotherapeutic cells labeled with fluorescent nanocrystals can be a versatile platform for the effective tracking of injected therapeutic cells using optical imaging technology, which is very important in cell-based cancer therapies.

  8. Improved labelling of DTPA- and DOTA-conjugated peptides and antibodies with 111In in HEPES and MES buffer.

    PubMed

    Brom, Maarten; Joosten, Lieke; Oyen, Wim Jg; Gotthardt, Martin; Boerman, Otto C

    2012-01-27

    In single photon emission computed tomography [SPECT], high specific activity of 111In-labelled tracers will allow administration of low amounts of tracer to prevent receptor saturation and/or side effects. To increase the specific activity, we studied the effect of the buffer used during the labelling procedure: NaAc, NH4Ac, HEPES and MES buffer. The effect of the ageing of the 111InCl3 stock and cadmium contamination, the decay product of 111In, was also examined in these buffers. Escalating amounts of 111InCl3 were added to 1 μg of the diethylene triamine pentaacetic acid [DTPA]- and 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid [DOTA]-conjugated compounds (exendin-3, octreotide and anti-carbonic anhydrase IX [CAIX] antibody). Five volumes of 2-(N-morpholino)ethanesulfonic acid [MES], 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES], NH4Ac or NaAc (0.1 M, pH 5.5) were added. After 20 min at 20°C (DTPA-conjugated compounds), at 95°C (DOTA-exendin-3 and DOTA-octreotide) or at 45°C (DOTA-anti-CAIX antibody), the labelling efficiency was determined by instant thin layer chromatography. The effect of the ageing of the 111InCl3 stock on the labelling efficiency of DTPA-exendin-3 as well as the effect of increasing concentrations of Cd2+ (the decay product of 111In) were also examined. Specific activities obtained for DTPA-octreotide and DOTA-anti-CAIX antibody were five times higher in MES and HEPES buffer. Radiolabelling of DTPA-exendin-3, DOTA-exendin-3 and DTPA-anti-CAIX antibody in MES and HEPES buffer resulted in twofold higher specific activities than that in NaAc and NH4Ac. Labelling of DTPA-exendin-3 decreased with 66% and 73% for NaAc and NH4Ac, respectively, at day 11 after the production date of 111InCl3, while for MES and HEPES, the maximal decrease in the specific activity was 10% and 4% at day 11, respectively. The presence of 1 pM Cd2+ in the labelling mixture of DTPA-exendin-3 in NaAc and NH4Ac markedly reduced the labelling

  9. Treating and Downstaging Hepatocellular Carcinoma in the Caudate Lobe with Yttrium-90 Radioembolization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ibrahim, Saad M.; Kulik, Laura; Baker, Talia

    2012-10-15

    Purpose: This study was designed to determine the technical feasibility, safety, efficacy, and potential to downstage patients to within transplantation criteria when treating patients with hepatocellular carcinoma (HCC) of the caudate lobe using Y90 radioembolization. Methods: During a 4-year period, 8 of 291 patients treated with radioembolization for unresectable HCC had disease involving the caudate lobe. All patients were followed for treatment-related clinical/biochemical toxicities, serum tumor marker response, and treatment response. Imaging response was assessed with the World Health Organization (WHO) and European Association for the Study of the Liver (EASL) classification schemes. Pathologic response was reported as percent necrosismore » at explantation. Results: Caudate lobe radioembolization was successfully performed in all eight patients. All patients presented with both cirrhosis and portal hypertension. Half were United Network for Organ Sharing (UNOS) stage T3 (n = 4, 50%). Fatigue was reported in half of the patients (n = 4, 50%). One (13%) grade 3/4 bilirubin toxicity was reported. One patient (13%) showed complete tumor response by WHO criteria, and three patients (38%) showed complete response using EASL guidelines. Serum AFP decreased by more than 50% in most patients (n = 6, 75%). Four patients (50%) were UNOS downstaged from T3 to T2, three of who underwent transplantation. One specimen showed histopathologic evidence of 100% complete necrosis, and two specimens demonstrated greater than 50% necrosis. Conclusions: Radioembolization with yttrium-90 appears to be a feasible, safe, and effective treatment option for patients with unresectable caudate lobe HCC. It has the potential to downstage patients to transplantation.« less

  10. 21 CFR 20.90 - Disclosure to contractors.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... INFORMATION Limitations on Exemptions § 20.90 Disclosure to contractors. (a) Data and information otherwise... employees; (4) Limitations on reproduction, transmission, and disclosure of the data and information; (5) A... 21 Food and Drugs 1 2012-04-01 2012-04-01 false Disclosure to contractors. 20.90 Section 20.90...

  11. 21 CFR 20.90 - Disclosure to contractors.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... INFORMATION Limitations on Exemptions § 20.90 Disclosure to contractors. (a) Data and information otherwise... employees; (4) Limitations on reproduction, transmission, and disclosure of the data and information; (5) A... 21 Food and Drugs 1 2014-04-01 2014-04-01 false Disclosure to contractors. 20.90 Section 20.90...

  12. 21 CFR 20.90 - Disclosure to contractors.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Disclosure to contractors. 20.90 Section 20.90... INFORMATION Limitations on Exemptions § 20.90 Disclosure to contractors. (a) Data and information otherwise exempt from public disclosure may be disclosed to contractors with the Food and Drug Administration and...

  13. Expansion of CD25+ Innate Lymphoid Cells Reduces Atherosclerosis

    PubMed Central

    Engelbertsen, Daniel; Foks, Amanda C.; Alberts-Grill, Noah; Kuperwaser, Felicia; Chen, Tao; Lederer, James A.; Jarolim, Petr; Grabie, Nir; Lichtman, Andrew H.

    2015-01-01

    Objective Innate lymphoid cells (ILCs) are a newly discovered subset of immune cells that promote tissue homeostasis and protect against pathogens. ILCs produce cytokines also produced by T lymphocytes that have been shown to affect atherosclerosis, but the influence of ILCs on atherosclerosis has not been explored. Approach and Results We demonstrate that CD25+ ILCs that produce type 2 cytokines (ILC2s) are present in the aorta of atherosclerotic immunodeficient ldlr−/−rag1−/− mice. To investigate the role of ILCs in atherosclerosis, ldlr−/−rag1−/− mice were concurrently fed an atherogenic diet and treated with either ILC-depleting anti-CD90.2 antibodies or with IL-2/anti-IL-2 complexes that expand CD25+ ILCs. Lesion development was not affected by anti-CD90.2 treatment, but was reduced in IL-2/anti-IL-2 -treated mice. These IL-2 treated mice had reduced VLDL cholesterol and increased triglycerides compared to controls and reduced apolipoprotein B100 gene expression in the liver. IL-2/anti-IL-2 treatment caused expansion of ILC2s in aorta and other tissues, elevated levels of IL-5, systemic eosinophila and hepatic eosinophilic inflammation. Blockade of IL-5 reversed the IL-2-complex-induced eosinophilia but did not change lesion size. Conclusions This study demonstrates that expansion of CD25-expressing ILCs by IL-2/anti-IL-2 complexes leads to a reduction in VLDL cholesterol and atherosclerosis. Global depletion of ILCs by anti-CD90.2 did not significantly affect lesion size indicating that different ILC subsets may have divergent effects on atherosclerosis. PMID:26494229

  14. 47 CFR 90.20 - Public Safety Pool.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 5 2014-10-01 2014-10-01 false Public Safety Pool. 90.20 Section 90.20 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND MOBILE RADIO SERVICES Public Safety Radio Pool § 90.20 Public Safety Pool. (a) Eligibility. The following are eligible to hold authorizations in...

  15. 47 CFR 90.20 - Public Safety Pool.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 5 2013-10-01 2013-10-01 false Public Safety Pool. 90.20 Section 90.20 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND MOBILE RADIO SERVICES Public Safety Radio Pool § 90.20 Public Safety Pool. (a) Eligibility. The following are eligible to hold authorizations in...

  16. 47 CFR 90.20 - Public Safety Pool.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 5 2012-10-01 2012-10-01 false Public Safety Pool. 90.20 Section 90.20 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND MOBILE RADIO SERVICES Public Safety Radio Pool § 90.20 Public Safety Pool. (a) Eligibility. The following are eligible to hold authorizations in...

  17. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  18. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Generation of anti-idiotype scFv for pharmacokinetic measurement in lymphoma patients treated with chimera anti-CD22 antibody SM03.

    PubMed

    Zhao, Qi; Wong, Pui-Fan; Lee, Susanna S T; Leung, Shui-On; Cheung, Wing-Tai; Wang, Jun-Zhi

    2014-01-01

    Pre-clinical and clinical studies of therapeutic antibodies require highly specific reagents to examine their immune responses, bio-distributions, immunogenicity, and pharmacodynamics in patients. Selective antigen-mimicking anti-idiotype antibody facilitates the assessment of therapeutic antibody in the detection, quantitation and characterization of antibody immune responses. Using mouse specific degenerate primer pairs and splenocytic RNA, we generated an idiotype antibody-immunized phage-displayed scFv library in which an anti-idiotype antibody against the therapeutic chimera anti-CD22 antibody SM03 was isolated. The anti-idiotype scFv recognized the idiotype of anti-CD22 antibody and inhibited binding of SM03 to CD22 on Raji cell surface. The anti-idiotype scFv was subsequently classified as Ab2γ type. Moreover, our results also demonstrated firstly that the anti-idiotype scFv could be used for pharmacokinetic measurement of circulating residual antibody in lymphoma patients treated with chimera anti-CD22 monoclonal antibody SM03. Of important, the present approach could be easily adopted to generate anti-idiotype antibodies for therapeutic antibodies targeting membrane proteins, saving the cost and time for producing a soluble antigen.

  20. Generation of Anti-Idiotype scFv for Pharmacokinetic Measurement in Lymphoma Patients Treated with Chimera Anti-CD22 Antibody SM03

    PubMed Central

    Zhao, Qi; Wong, Pui-Fan; Lee, Susanna S. T.; Leung, Shui-On; Cheung, Wing-Tai; Wang, Jun-Zhi

    2014-01-01

    Pre-clinical and clinical studies of therapeutic antibodies require highly specific reagents to examine their immune responses, bio-distributions, immunogenicity, and pharmacodynamics in patients. Selective antigen-mimicking anti-idiotype antibody facilitates the assessment of therapeutic antibody in the detection, quantitation and characterization of antibody immune responses. Using mouse specific degenerate primer pairs and splenocytic RNA, we generated an idiotype antibody-immunized phage-displayed scFv library in which an anti-idiotype antibody against the therapeutic chimera anti-CD22 antibody SM03 was isolated. The anti-idiotype scFv recognized the idiotype of anti-CD22 antibody and inhibited binding of SM03 to CD22 on Raji cell surface. The anti-idiotype scFv was subsequently classified as Ab2γ type. Moreover, our results also demonstrated firstly that the anti-idiotype scFv could be used for pharmacokinetic measurement of circulating residual antibody in lymphoma patients treated with chimera anti-CD22 monoclonal antibody SM03. Of important, the present approach could be easily adopted to generate anti-idiotype antibodies for therapeutic antibodies targeting membrane proteins, saving the cost and time for producing a soluble antigen. PMID:24816427

  1. Dense nanocrystalline yttrium iron garnet films formed at room temperature by aerosol deposition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Scooter D., E-mail: scooter.johnson@nrl.navy.mil; Glaser, Evan R.; Cheng, Shu-Fan

    Highlights: • We deposit yttrium iron garnet films at room temperature using aerosol deposition. • Films are 96% of theoretical density for yttrium iron garnet. • We report magnetic and structural properties post-deposition and post-annealing. • Low-temperature annealing decreases the FMR linewidth. • We discuss features of the FMR spectra at each anneal temperature. - Abstract: We have employed aerosol deposition to form polycrystalline yttrium iron garnet (YIG) films on sapphire at room temperature that are 90–96% dense. We characterize the structural and dynamic magnetic properties of the dense films using scanning electron microscopy, X-ray diffraction, and ferromagnetic resonance techniques.more » We find that the as-deposited films are pure single-phase YIG formed of compact polycrystallites ∼20 nm in size. The ferromagnetic resonance mode occurs at 2829 G with a linewidth of 308 G. We perform a series of successive anneals up to 1000 °C on a film to explore heat treatment on the ferromagnetic resonance linewidth. We find the narrowest linewidth of 98 G occurs after a 750 °C anneal.« less

  2. Dose, timing, schedule, and the choice of targeted epitope alter the efficacy of anti-CD22 immunotherapy in mice bearing human lymphoma xenografts.

    PubMed

    O'Donnell, Robert T; Ma, Yunpeng; McKnight, Hayes C; Pearson, David; Tuscano, Joseph M

    2009-12-01

    CD22 is a cell-surface adhesion molecule on most B-cell NHL, so it is a promising target for immunotherapy. HB22.7 is an anti-CD22 mAb that binds the two NH(2)-terminal immunoglobulin domains and specifically blocks the interaction of CD22 with its ligand. CD22-blocking mAbs induce apoptosis in neoplastic B-cells and are functionally distinguishable from other anti-CD22 mAbs. This study assessed the optimal dose, route, schedule, and the targeted CD22 epitope. Raji NHL-bearing nude mice were studied. A non-blocking anti-CD22 mAb (HB22.27) was used as a control. HB22.27 had minimal effect, whereas HB22.7 improved survival and shrank tumors substantially. HB22.7 doses greater than 1.4 mg/week did not further increase efficacy (or toxicity). Tumors less than 200 mm(3) had a higher response rate than did larger tumors. Various schedules of HB22.7 administration were tested; one dose every other week was more effective than more or less frequent dosing. Pharmacokinetic studies revealed that the half-life of HB22.7 was 28 days; this correlated with the time needed to re-populate cell-surface CD22 after treatment with HB22.7. Immuno-PET showed that NHL was rapidly and specifically targeted by copper-64-labeled-HB22.7. This study provided data as to an optimal dose, route, schedule and interval between doses of HB22.7.

  3. Comparison of humanized IgG and FvFc anti-CD3 monoclonal antibodies expressed in CHO cells.

    PubMed

    Serpieri, Flavia; Inocencio, Andre; de Oliveira, Jose Marcelino; Pimenta, Alécio A; Garbuio, Angélica; Kalil, Jorge; Brigido, Marcelo M; Moro, Ana Maria

    2010-07-01

    Two humanized monoclonal antibody constructs bearing the same variable regions of an anti-CD3 monoclonal antibody, whole IgG and FvFc, were expressed in CHO cells. Random and site-specific integration were used resulting in similar expression levels. The transfectants were selected with appropriate selection agent, and the surviving cells were plated in semi-solid medium for capture with FITC-conjugated anti-human IG antibody and picked with the robotic ClonePix FL. Conditioned media from selected clones were purified by affinity chromatography and characterized by SDS-PAGE, Western-blot, SEC-HPLC, and isoelectric focusing. Binding to the target present in healthy human mononuclear cells was assessed by flow cytometry, as well as by competition between the two constructs and the original murine monoclonal antibody. The humanized constructs were not able to dislodge the murine antibody while the murine anti-CD3 antibody could dislodge around 20% of the FvFc or IgG humanized versions. Further in vitro and in vivo pre-clinical analyses will be carried out to verify the ability of the humanized versions to demonstrate the immunoregulatory profile required for a humanized anti-CD3 monoclonal antibody.

  4. 20 CFR 401.90 - Contractors.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Contractors. 401.90 Section 401.90 Employees... Privacy Act § 401.90 Contractors. (a) All contracts which require a contractor to maintain, or on behalf... requiring the contractor to comply with the Privacy Act and this part. (b) A contractor and any employee of...

  5. CD38-NAD+Axis Regulates Immunotherapeutic Anti-Tumor T Cell Response.

    PubMed

    Chatterjee, Shilpak; Daenthanasanmak, Anusara; Chakraborty, Paramita; Wyatt, Megan W; Dhar, Payal; Selvam, Shanmugam Panneer; Fu, Jianing; Zhang, Jinyu; Nguyen, Hung; Kang, Inhong; Toth, Kyle; Al-Homrani, Mazen; Husain, Mahvash; Beeson, Gyda; Ball, Lauren; Helke, Kristi; Husain, Shahid; Garrett-Mayer, Elizabeth; Hardiman, Gary; Mehrotra, Meenal; Nishimura, Michael I; Beeson, Craig C; Bupp, Melanie Gubbels; Wu, Jennifer; Ogretmen, Besim; Paulos, Chrystal M; Rathmell, Jeffery; Yu, Xue-Zhong; Mehrotra, Shikhar

    2018-01-09

    Heightened effector function and prolonged persistence, the key attributes of Th1 and Th17 cells, respectively, are key features of potent anti-tumor T cells. Here, we established ex vivo culture conditions to generate hybrid Th1/17 cells, which persisted long-term in vivo while maintaining their effector function. Using transcriptomics and metabolic profiling approaches, we showed that the enhanced anti-tumor property of Th1/17 cells was dependent on the increased NAD + -dependent activity of the histone deacetylase Sirt1. Pharmacological or genetic inhibition of Sirt1 activity impaired the anti-tumor potential of Th1/17 cells. Importantly, T cells with reduced surface expression of the NADase CD38 exhibited intrinsically higher NAD + , enhanced oxidative phosphorylation, higher glutaminolysis, and altered mitochondrial dynamics that vastly improved tumor control. Lastly, blocking CD38 expression improved tumor control even when using Th0 anti-tumor T cells. Thus, strategies targeting the CD38-NAD + axis could increase the efficacy of anti-tumor adoptive T cell therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Rapid determination of strontium-90 by solid phase extraction using DGA Resin® for seawater monitoring

    NASA Astrophysics Data System (ADS)

    Tazoe, H.; Obata, H.; Yamagata, T.; Karube, Z.; Yamada, M.

    2015-12-01

    Strontium-90 concentrations in seawater exceeding the background level have been observed at the accidents of nuclear facilities, such as Chernobyl and Fukushima. However, analytical procedure for strontium-90 in seawater is still quite complicated and challenging. Here we show a simple and rapid analytical technique for the determination of strontium-90 in seawater samples without time-consuming separation of strontium from calcium. The separation with DGA Resin® is used to determine the abundance of strontium-90, which selectively collects yttrium-90, progeny of strontium-90. Naturally occurring radioactive nuclides (such as potassium, lead, bismuth, uranium, and thorium) and anthropogenic radionuclides (such as cesium, barium, lanthanum, and cerium) were separated from yttrium. Through a sample separation procedure, a high chemical yield of yttrium-90 was achieved at 93.9 % for seawater. The result of IAEA 443 certified seawater analysis was in good agreement with the certified value. At 20 hrs counting a lower detection limit of 1.5 mBq L-1 was obtained from 3 L of seawater. The proposed method can finish analyzing 8 samples per day, which is a reasonably fast throughput in actual seawater monitoring. Reproducibility was found to be 3.4 % according to 10 separate analyses of natural seawater samples from the vicinity of Fukushima Daiichi Nuclear Power Plant in September 2013.

  7. Activatory and Inhibitory Fcγ Receptors Augment Rituximab-mediated Internalization of CD20 Independent of Signaling via the Cytoplasmic Domain*

    PubMed Central

    Vaughan, Andrew T.; Chan, Claude H. T.; Klein, Christian; Glennie, Martin J.; Beers, Stephen A.; Cragg, Mark S.

    2015-01-01

    Type I anti-CD20 mAb such as rituximab and ofatumumab engage with the inhibitory FcγR, FcγRIIb on the surface of B cells, resulting in immunoreceptor tyrosine-based inhibitory motif (ITIM) phosphorylation. Internalization of the CD20·mAb·FcγRIIb complex follows, the rate of which correlates with FcγRIIb expression. In contrast, although type II anti-CD20 mAb such as tositumomab and obinutuzumab also interact with and activate FcγRIIb, this interaction fails to augment the rate of CD20·mAb internalization, raising the question of whether ITIM phosphorylation plays any role in this process. We have assessed the molecular requirements for the internalization process and demonstrate that in contrast to internalization of IgG immune complexes, FcγRIIb-augmented internalization of rituximab-ligated CD20 occurs independently of the FcγRIIb ITIM, indicating that signaling downstream of FcγRIIb is not required. In transfected cells, activatory FcγRI, FcγRIIa, and FcγRIIIa augmented internalization of rituximab-ligated CD20 in a similar manner. However, FcγRIIa mediated a slower rate of internalization than cells expressing equivalent levels of the highly homologous FcγRIIb. The difference was maintained in cells expressing FcγRIIa and FcγRIIb lacking cytoplasmic domains and in which the transmembrane domains had been exchanged. This difference may be due to increased degradation of FcγRIIa, which traffics to lysosomes independently of rituximab. We conclude that the cytoplasmic domain of FcγR is not required for promoting internalization of rituximab-ligated CD20. Instead, we propose that FcγR provides a structural role in augmenting endocytosis that differs from that employed during the endocytosis of immune complexes. PMID:25568316

  8. EMBOLIZATION OF DOG PROSTATES WITH YTTRIUM-90 MICROSPHERES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Greene, W.M.

    1963-10-01

    Experiments exploring means for the protection of adjacent normal tissue while delivering a destructive dose of radiation to malignant tissue were conducted. By injection of radioactive ceramic spheres or particles, too large to pass through capillaries or arteriovenous shunts, relatively high doses of radiation can be distributed homogeneously to a circumscribed area. Attempts were made to determine the uniformity of distribution and the radiation effect of varying doses of spheres injected into the arterial supply of the dog prostate. Nonradioactive and radioactive ceramic microspheres of 60 mu dia were used since this size exceeds the diameter of capillaries and arteriovenousmore » shunts. Yttrium-90 microspheres of varying radioactivity were used. Doses injected into right and left hypogastric arteries varied from 0.69 to 28.4 mc/side (92-1260 mc/ g prostate). Homogeneous distribution of radioactivity within the prostate was demonstrated by autoradiography. Distribution to some other organs (rectum, penis, and bladder) occurred because arterial supply to these structures was not isolated and occluded. The amount of radioactivity found in the lungs suggested more venous drainage in some cases than seemed apparent, and because of the infarctions of pelvic organs may have leaked radioactive spheres into the venous circuit. In 6 of the 8 dogs which died prematurely (2 to 7 days after surgery) obvious infarction of the prostate and in some other pelvic structures had occurred. That the radioactivity contributed to the infarction is suggested by the results in the dogs which received large doses of radioactivity (18.9 and 28.4 mc per side) in minimal amounts of spheres (100to 150 mg per side). The intensely concentrated radioactivity within the arteriolar lumens may have caused vasculitis and subsequent thrombosis. Although homogeneous destruction of the prostate gland occurred, the effect of a given dose ranged unpredictably through three groups: no apparent

  9. Anti-CD22-chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia.

    PubMed

    Haso, Waleed; Lee, Daniel W; Shah, Nirali N; Stetler-Stevenson, Maryalice; Yuan, Constance M; Pastan, Ira H; Dimitrov, Dimiter S; Morgan, Richard A; FitzGerald, David J; Barrett, David M; Wayne, Alan S; Mackall, Crystal L; Orentas, Rimas J

    2013-02-14

    Immune targeting of B-cell malignancies using chimeric antigen receptors (CARs) is a promising new approach, but critical factors impacting CAR efficacy remain unclear. To test the suitability of targeting CD22 on precursor B-cell acute lymphoblastic leukemia (BCP-ALL), lymphoblasts from 111 patients with BCP-ALL were assayed for CD22 expression and all were found to be CD22-positive, with median CD22 expression levels of 3500 sites/cell. Three distinct binding domains targeting CD22 were fused to various TCR signaling domains ± an IgG heavy chain constant domain (CH2CH3) to create a series of vector constructs suitable to delineate optimal CAR configuration. CARs derived from the m971 anti-CD22 mAb, which targets a proximal CD22 epitope demonstrated superior antileukemic activity compared with those incorporating other binding domains, and addition of a 4-1BB signaling domain to CD28.CD3 constructs diminished potency, whereas increasing affinity of the anti-CD22 binding motif, and extending the CD22 binding domain away from the membrane via CH2CH3 had no effect. We conclude that second-generation m971 mAb-derived anti-CD22 CARs are promising novel therapeutics that should be tested in BCP-ALL.

  10. Survival after yttrium-90 resin microsphere radioembolization of hepatocellular carcinoma across Barcelona clinic liver cancer stages: a European evaluation.

    PubMed

    Sangro, Bruno; Carpanese, Livio; Cianni, Roberto; Golfieri, Rita; Gasparini, Daniele; Ezziddin, Samer; Paprottka, Philipp M; Fiore, Francesco; Van Buskirk, Mark; Bilbao, Jose Ignacio; Ettorre, Giuseppe Maria; Salvatori, Rita; Giampalma, Emanuela; Geatti, Onelio; Wilhelm, Kai; Hoffmann, Ralf Thorsten; Izzo, Francesco; Iñarrairaegui, Mercedes; Maini, Carlo Ludovico; Urigo, Carlo; Cappelli, Alberta; Vit, Alessandro; Ahmadzadehfar, Hojjat; Jakobs, Tobias Franz; Lastoria, Secondo

    2011-09-02

    A multicenter analysis was conducted to evaluate the main prognostic factors driving survival after radioembolization using yttrium-90-labeled resin microspheres in patients with hepatocellular carcinoma at eight European centers. In total, 325 patients received a median activity of 1.6 GBq between September 2003 and December 2009, predominantly as whole-liver (45.2%) or right-lobe (38.5%) infusions. Typically, patients were Child-Pugh class A (82.5%), had underlying cirrhosis (78.5%), and had good Eastern Cooperative Oncology Group (ECOG) performance status (ECOG 0-1; 87.7%), but many had multinodular disease (75.9%) invading both lobes (53.1%) and/or portal vein occlusion (13.5% branch; 9.8% main). Over half had advanced Barcelona Clinic Liver Cancer (BCLC) staging (BCLC C, 56.3%) and one-quarter had intermediate staging (BCLC B, 26.8%). The median overall survival was 12.8 months (95% confidence interval, 10.9-15.7), which varied significantly by disease stage (BCLC A, 24.4 months [95% CI, 18.6-38.1 months]; BCLC B, 16.9 months [95% CI, 12.8-22.8 months]; BCLC C, 10.0 months [95% CI, 7.7-10.9 months]). Consistent with this finding , survival varied significantly by ECOG status, hepatic function (Child-Pugh class, ascites, and baseline total bilirubin), tumor burden (number of nodules, alpha-fetoprotein), and presence of extrahepatic disease. When considered within the framework of BCLC staging, variables reflecting tumor burden and liver function provided additional prognostic information. The most significant independent prognostic factors for survival upon multivariate analysis were ECOG status, tumor burden (nodules >5), international normalized ratio >1.2, and extrahepatic disease. Common adverse events were: fatigue, nausea/vomiting, and abdominal pain. Grade 3 or higher increases in bilirubin were reported in 5.8% of patients. All-cause mortality was 0.6% and 6.8% at 30 and 90 days, respectively. This analysis provides robust evidence of the survival

  11. Breaking chemoresistance and radioresistance with [213Bi]anti-CD45 antibodies in leukemia cells.

    PubMed

    Friesen, Claudia; Glatting, Gerhard; Koop, Bernd; Schwarz, Klaus; Morgenstern, Alfred; Apostolidis, Christos; Debatin, Klaus-Michael; Reske, Sven N

    2007-03-01

    Chemoresistance and radioresistance are considered one of the primary reasons for therapeutic failure in leukemias and solid tumors. Targeted radiotherapy using monoclonal antibodies radiolabeled with alpha-particles is a promising treatment approach for high-risk leukemia. We found that targeted radiotherapy using monoclonal CD45 antibodies radiolabeled with the alpha-emitter (213)Bi ([(213)Bi]anti-CD45) induces apoptosis, activates apoptosis pathways, and breaks beta-irradiation-, gamma-irradiation-, doxorubicin-, and apoptosis-resistance in leukemia cells. In contrast to beta-irradiation-, gamma-irradiation-, and doxorubicin-mediated apoptosis and DNA damage, [(213)Bi]anti-CD45-induced DNA damage was not repaired, and apoptosis was not inhibited by the nonhomologous end-joining DNA repair mechanism. Depending on the activation of caspase-3, caspase-8, and caspase-9, [(213)Bi]anti-CD45 activated apoptosis pathways in leukemia cells through the mitochondrial pathway but independent of CD95 receptor/CD95 ligand interaction. Furthermore, [(213)Bi]anti-CD45 reversed deficient activation of caspase-3, caspase-8, and caspase-9, deficient cleavage of poly(ADP-ribose) polymerase, and deficient activation of mitochondria in chemoresistant and in radioresistant and apoptosis-resistant leukemia cells. These findings show that [(213)Bi]anti-CD45 is a promising therapeutic agent to break chemoresistance and radioresistance by overcoming DNA repair mechanisms in leukemia cells and provide the foundation for discovery of novel anticancer compounds.

  12. Model-Based Radiation Dose Correction for Yttrium-90 Microsphere Treatment of Liver Tumors With Central Necrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ching-Sheng; Department of Nuclear Medicine, Taipei Veterans General Hospital, Taipei, Taiwan; Lin, Ko-Han

    Purpose: The objectives of this study were to model and calculate the absorbed fraction {phi} of energy emitted from yttrium-90 ({sup 90}Y) microsphere treatment of necrotic liver tumors. Methods and Materials: The tumor necrosis model was proposed for the calculation of {phi} over the spherical shell region. Two approaches, the semianalytic method and the probabilistic method, were adopted. In the former method, the range--energy relationship and the sampling of electron paths were applied to calculate the energy deposition within the target region, using the straight-ahead and continuous-slowing-down approximation (CSDA) method. In the latter method, the Monte Carlo PENELOPE code wasmore » used to verify results from the first method. Results: The fraction of energy, {phi}, absorbed from {sup 90}Y by 1-cm thickness of tumor shell from microsphere distribution by CSDA with complete beta spectrum was 0.832 {+-} 0.001 and 0.833 {+-} 0.001 for smaller (r{sub T} = 5 cm) and larger (r{sub T} = 10 cm) tumors (where r is the radii of the tumor [T] and necrosis [N]). The fraction absorbed depended mainly on the thickness of the tumor necrosis configuration, rather than on tumor necrosis size. The maximal absorbed fraction {phi} that occurred in tumors without central necrosis for each size of tumor was different: 0.950 {+-} 0.000, and 0.975 {+-} 0.000 for smaller (r{sub T} = 5 cm) and larger (r{sub T} = 10 cm) tumors, respectively (p < 0.0001). Conclusions: The tumor necrosis model was developed for dose calculation of {sup 90}Y microsphere treatment of hepatic tumors with central necrosis. With this model, important information is provided regarding the absorbed fraction applicable to clinical {sup 90}Y microsphere treatment.« less

  13. CD90/THY1 is over-expressed in prostate cancer-associated fibroblasts and could serve as a cancer biomarker

    PubMed Central

    True, Lawrence D; Zhang, Hui; Ye, Mingliang; Huang, Chung-Ying; Nelson, Peter S; von Haller, Priska D; Tjoelker, Larry W; Kim, Jong-Seo; Qian, Wei-Jun; Smith, Richard D; Ellis, William J; Liebeskind, Emily S; Liu, Alvin Y

    2010-01-01

    A by-product in the processing of prostate tissue for cell sorting by collagenase digestion is the media supernatant that remains after the cells are harvested. These supernatants contain proteins made by the cells within the tissue. Quantitative proteomic analysis of N-glycosylated proteins detected an increased amount of CD90/THY1 in cancer supernatants compared to non-cancer supernatants. Immunohistochemistry showed that in all carcinomas, regardless of Gleason grade, a layer of CD90-positive stromal fibroblastic cells, approximately 5-to-10 cells deep, was localized to tumor glands. In contrast, a no more than 1-cell wide girth of CD90-positive stromal cells was found around benign glands. The increased number of CD90-positive stromal cells in cancer correlated with overexpression of CD90 mRNA detected by gene expression analysis of stromal cells obtained by laser-capture microdissection. There is increasing evidence that cancer-associated stroma plays a role in both tumor progression and carcinogenesis. Most experiments to identify cancer biomarkers have focused on the cancer cells. CD90, being a marker for prostate cancer-associated stroma, might be a potential biomarker for this cancer. A non-invasive test could be provided by a urine test. Proteomic analysis of urine from patients with prostate cancer identified CD90; conversely, CD90 was not detected in the urine of post-prostatectomy patients. Furthermore, this urinary CD90 protein was a variant CD90 protein not known to be expressed by such cells as lymphocytes that express CD90. These CD90 results were obtained from ∼90 cases consisting of proteomic analysis of tissue and urine, immunohistochemistry, Western blot analysis of tissue media, flow cytometry of cells from digested tissue, and reverse transcriptase polymerase chain reaction analysis of isolated stromal cells. PMID:20562849

  14. Dancing partners at the ball: Rational selection of next generation anti-CD20 antibodies for combination therapy of chronic lymphocytic leukemia in the novel agents era.

    PubMed

    Butler, L A; Tam, C S; Seymour, J F

    2017-09-01

    The anti-CD20 antibodies represent a major advancement in the therapeutic options available for chronic lymphocytic leukemia. The addition of rituximab, ofatumumab and obinutuzumab to various chemotherapy regimens has led to considerable improvements in both response and survival. Ocaratuzumab, veltuzumab and ublituximab are currently being explored within the trial setting. We review the current status of these antibodies, and discuss how their mechanisms of action may impact on the choice of combinations with novel small molecule agents. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Monitoring of antigen-specific CD8 T cells in patients with type 1 diabetes treated with antiCD3 monoclonal antibodies.

    PubMed

    Cernea, Simona; Herold, Kevan C

    2010-02-01

    The way in which anti-CD3 monoclonal antibodies (mAbs) modify human immune responses in type 1 diabetes (T1DM) is not known. We prepared a panel of Class I HLA-A2.1 tetramers with peptides from diabetes-associated antigens and studied the frequency and phenotype of the cells in patients with T1DM and blood donors and in patients treated with anti-CD3 mAb (Teplizumab). More patients with T1DM showed positive staining for at least 1 tetramer using frozen and fresh samples (p<0.05). Three months following treatment with anti-CD3 mAb, the proportion of GAD65- and InsB-peptide reactive CD8+ T cells increased (p<0.05). The phenotype of these cells was modulated from naïve to effector memoryRA+. We concludethat Class I MHC tetramers can identify antigen specific CD8+ T cells in patients with T1DM. The frequency of certain specificities increases after treatment with anti-CD3 mAb. Their modulated phenotype may have functional consequences for their pathogenicity. Copyright 2009 Elsevier Inc. All rights reserved.

  16. Generation of dendritic cells from positively selected CD14+ monocytes for anti-tumor immunotherapy.

    PubMed

    Curti, Antonio; Isidori, Alessandro; Ferri, Elisa; Terragna, Carolina; Neyroz, Paolo; Cellini, Claudia; Ratta, Marina; Baccarani, Michele; Lemoli, Roberto M

    2004-07-01

    Peripheral blood CD14+ monocytes from multiple myeloma (MM) patients can be induced to differentiate into fully functional, mature, CD83+ dendritic cells (DCs) which are highly efficient in priming autologous T lymphocytes in response to the patient-specific tumor idiotype (Id). We have recently scaled up our manufacturing protocol for application in a phase I-II clinical trial of anti-Id vaccination with DCs in MM patients. Elegible patients received a series of by-monthly immunizations consisting of three subcutaneous and two intravenous injections of Id-keyhole limpet hemocyanin (KLH)-pulsed DCs (5 x -, 10 x -, 50 x 10(6) cells and 10 x -, 50 x 10(6) cells, respectively). To generate DCs, monocytes were labeled with clinical grade anti-CD14 conjugates and positively selected by immunomagnetic separation. Cells were then cultured, according to Good Manufacturing Practice guidelines, in FCS-free medium in cell culture bags, and differentiated to DCs with GM-CSF plus IL-4 followed by TNF-alpha or, more recently, by a cocktail of IL-1beta, IL-6, TNF-alpha and prostaglandin-E2. Before maturation, Mo-DCs were pulsed with the autologous Id as whole protein or Id (VDJ)-derived HLA class I restricted peptides. Ten MM patients, who had been treated with two courses of high-dose chemotherapy with peripheral blood stem cell support, entered into the clinical study. CD14+ monocytes were enriched from 16.1+/-5.7% to 95.5+/-3.2% (recovery 67.9+/-15%, viability > 97%). After cell culture, phenotypic analysis showed that 89.6+/-6.6% of the cells were mature DCs. We obtained 2.89+/-1 x 10(8) DCs/leukapheresis which represented 24.5+/-9% of the initial number of CD14+ cells. Notably, the cytokine cocktail induced a significantly higher percentage and yield (31+/-10.9 of initial CD14+ cells) of DCs than TNF-alpha alone, secretion of larger amounts of IL-12, potent stimulatory activity on allogeneic and autologous T cells. Storage in liquid nitrogen did not modify the phenotype or

  17. Autoantibody-mediated regulation of B cell responses by functional anti-CD22 autoantibodies in patients with systemic sclerosis.

    PubMed

    Odaka, M; Hasegawa, M; Hamaguchi, Y; Ishiura, N; Kumada, S; Matsushita, T; Komura, K; Sato, S; Takehara, K; Fujimoto, M

    2010-02-01

    Studies have demonstrated that B cells play important roles in systemic sclerosis (SSc), especially through the CD19/CD22 autoimmune loop. CD22 is a B cell-specific inhibitory receptor that dampens B cell antigen receptor (BCR) signalling via tyrosine phosphorylation-dependent mechanism. In this study, we examined the presence and functional property of circulating autoantibodies reacting with CD22 in systemic sclerosis. Serum samples from 10 tight skin (TSK/+) mice and 50 SSc patients were assessed for anti-CD22 autoantibodies by enzyme-linked immunosorbent assays using recombinant mouse or human CD22. The association between anti-CD22 antibodies and clinical features was also investigated in SSc patients. Furthermore, the influence of SSc serum including anti-CD22 autoantibodies for CD22 tyrosine phosphorylation was examined by Western blotting using phosphotyrosine-specific antibodies reacting with four major tyrosine motifs of CD22 cytoplasmic domain. Anti-CD22 autoantibodies were positive in 80% of TSK/+ mice and in 22% of SSc patients. Patients positive for anti-CD22 antibodies showed significantly higher modified Rodnan skin thickness score compared with patients negative for anti-CD22 antibodies. Furthermore, anti-CD22 antibodies from patients' sera were capable of reducing phosphorylation of all four CD22 tyrosine motifs, while sera negative for anti-CD22 antibodies did not affect CD22 phosphorylation. Thus, a subset of SSc patients possessed autoantibodies reacting with a major inhibitory B cell response regulator, CD22. Because these antibodies can interfere CD22-mediated suppression onto B cell activation in vitro, SSc B cells produce functional autoantibodies that can enhance their own activation. This unique regulation may contribute to the autoimmune aspect of SSc.

  18. Preparation of goat and rabbit anti-camel immunoglobulin G whole molecule labeled with horseradish peroxidase

    PubMed Central

    Abdel-Rahman, Eman Hussein; El-Jakee, Jakeen Kamal; Hatem, Mahmoud Essam; Ata, Nagwa Sayed; Fouad, Ehab Ali

    2017-01-01

    Aim: As the labeled anti-camel immunoglobulins (Igs) with enzymes for enzyme-linked immunosorbent assay (ELISA) are unavailable in the Egyptian market, the present investigation was directed for developing local labeled anti-camel IgG with horseradish peroxidase (HRP) to save hard curacy. Materials and Methods: For purification of camel IgG whole molecule, camel sera was preliminary precipitated with 50% saturated ammonium sulfate and dialyzed against 15 mM phosphate-buffered saline pH 7.2 then concentrated. This preparation was further purified by protein A sepharose affinity column chromatography. The purity of the eluted camel IgG was tested by sodium dodecyl sulfate polyacrylamide gel electrophoresi. Anti-camel IgG was prepared by immunization of goats and rabbits separately, with purified camel IgG. The anti-camel IgG was purified by protein A sepharose affinity column chromatography. Whole molecule anti-camel IgG was conjugated with HRP using glutraldehyde based assay. Sensitivity and specificity of prepared conjugated secondary antibodies were detected using positive and negative camel serum samples reacted with different antigens in ELISA, respectively. The potency of prepared conjugated antibodies was evaluated compared with protein A HRP. The stability of the conjugate at −20°C during 1 year was assessed by ELISA. Results: The electrophoretic profile of camel IgG showed four bands of molecular weight 63, 52, 40 and 33 kDa. The recorded sensitivity and specificity of the product are 100%. Its potency is also 100% compared to 58-75% of commercial protein A HRP. The conjugates are stable for 1 year at −20°C as proved by ELISA. Conclusion: Collectively, this study introduces goat and rabbit anti-camel IgG whole molecules with simple, inexpensive method, with 100% sensitivity, 100% specificity and stability up to 1 year at −20°C. The important facet of the current study is saving hard curacy. Future investigations are necessary for preparation of Ig

  19. CD83 Antibody Inhibits Human B Cell Responses to Antigen as well as Dendritic Cell-Mediated CD4 T Cell Responses.

    PubMed

    Wong, Kuan Y; Baron, Rebecca; Seldon, Therese A; Jones, Martina L; Rice, Alison M; Munster, David J

    2018-05-15

    Anti-CD83 Ab capable of Ab-dependent cellular cytotoxicity can deplete activated CD83 + human dendritic cells, thereby inhibiting CD4 T cell-mediated acute graft-versus-host disease. As CD83 is also expressed on the surface of activated B lymphocytes, we hypothesized that anti-CD83 would also inhibit B cell responses to stimulation. We found that anti-CD83 inhibited total IgM and IgG production in vitro by allostimulated human PBMC. Also, Ag-specific Ab responses to immunization of SCID mice xenografted with human PBMC were inhibited by anti-CD83 treatment. This inhibition occurred without depletion of all human B cells because anti-CD83 lysed activated CD83 + B cells by Ab-dependent cellular cytotoxicity and spared resting (CD83 - ) B cells. In cultured human PBMC, anti-CD83 inhibited tetanus toxoid-stimulated B cell proliferation and concomitant dendritic cell-mediated CD4 T cell proliferation and expression of IFN-γ and IL-17A, with minimal losses of B cells (<20%). In contrast, the anti-CD20 mAb rituximab depleted >80% of B cells but had no effect on CD4 T cell proliferation and cytokine expression. By virtue of the ability of anti-CD83 to selectively deplete activated, but not resting, B cells and dendritic cells, with the latter reducing CD4 T cell responses, anti-CD83 may be clinically useful in autoimmunity and transplantation. Advantages might include inhibited expansion of autoantigen- or alloantigen-specific B cells and CD4 T cells, thus preventing further production of pathogenic Abs and inflammatory cytokines while preserving protective memory and regulatory cells. Copyright © 2018 by The American Association of Immunologists, Inc.

  20. Mass-Production and Characterization of Anti-CD20 Monoclonal Antibody in Peritoneum of Balb/c Mice

    PubMed Central

    Sineh sepehr, Koushan; Baradaran, Behzad; Majidi, Jafar; Abdolalizadeh, Jalal; Aghebati, leili; Zare Shahneh, Fatemeh

    2013-01-01

    Purpose: Monoclonal antibodies are important tools are used in basic research as well as, in diagnosis, imaging and treatment of immunodeficiency diseases, infections and cancers. The purpose of this study was to produce large scale of monoclonal antibody against CD20 in order to diagnostic application in leukemia and lymphomas disorders. Methods: Hybridoma cells that produce monoclonal antibody against human CD20 were administered into the peritoneum of the Balb/c mice which have previously been primed with 0.5 ml Pristane. After twelve days, approximately 7 ml ascetic fluid was harvested from the peritoneum of each mouse. Evaluation of mAb titration was assessed by ELISA method. In the present study, we describe a protocol for large scale production of MAbs. Results: We prepared monoclonal antibodies (mAbs) with high specificity and sensitivity against human CD20 by hybridoma method and characterized them by ELISA. The subclass of antibody was IgG2a and its light chain was kappa. Ascetic fluid was purified by Protein-A Sepharose affinity chromatography and the purified monoclonal antibody was conjugated with FITC and Immunofluorescence was done for confirming the specific binding. Conclusion: The conjugated monoclonal antibody could have application in diagnosis B-cell lymphomas, hairy cell leukemia, B-cell chronic lymphocytic leukemia, and melanoma cancer stem cells. PMID:24312821

  1. Development of DOTA-Rituximab to be Labeled with 90Y for Radioimmunotherapy of B-cell Non-Hodgkin Lymphoma

    PubMed Central

    Johari doha, Fariba; Rahmani, Siyavash; Rikhtechi, Pedram; Rasaneh, Samira; Sheikholislam, Zahra; Shahhosseini, Soraya

    2017-01-01

    NHL is the most common hematologic cancer in adults. Rituximab is the FDA approved treatment of relapsed or refractory low grade B-cell Non-Hodgkin Lymphoma (NHL). But patients eventually become resistant to rituximab. Since lymphocytes and lymphoma cells are highly radiosensitive, low grade NHL that has relapsed or refractory to standard therapy is treated by RIT in which a beta-emitting radionuclide coupled to anti-CD20 antibody. The association of beta emitter radionuclide to rituximab enhances its therapeutic efficacy. The cells which lack antigen or cells which cannot be reached due to poor vascularization and intratumoral pressure in a bulky tumor would be irradiated and killed by cross fire effect of beta emitter. 90Y, a pure high energy β-emitter with a half-life of 64 h, a maximum energy of 2.28 MeV, and maximum board of 11.3 mm in tissue is radionuclide of choice for radioimmunotherapy of outpatient administration. In this study, rituximab was conjugated to DOTA and radiolabeled with 90YCl3. The stability, affinity, and immunoreactivity of radiolabeled antibody was determined in vitro and the conditions were optimized. Biodistribution studies were done in normal mice. The optimum conditions of conjugation and radiolabeling was 1-2 h at 37 °C and 1 h at 45 °C, respectively. Results showed approximately 4 DOTA molecules conjugated per antibody molecule. The purified antibody was stable and intact over 6 months stored at -20 °C. The result of immunoreactivity (≈70%), affinity (≈3 nM) and biodistribution in normal mice are acceptable. PMID:28979315

  2. Comparative Assessment of Clinically Utilized CD20-directed Antibodies in Chronic Lymphocytic Leukemia Cells Reveals Divergent NK cell, Monocyte and Macrophage Properties

    PubMed Central

    Rafiq, Sarwish; Butchar, Jonathon P.; Cheney, Carolyn; Mo, Xiaokui; Trotta, Rossana; Caligiuri, Michael; Jarjoura, David; Tridandapani, Susheela; Muthusamy, Natarajan; Byrd, John C.

    2013-01-01

    CD20 is a widely validated, B cell specific target for therapy in B cell malignancies. Rituximab is an anti-CD20 antibody that when combined with chemotherapy prolongs survival of CLL patients. Ofatumumab and GA101 (obinutuzumab) are CD20-directed antibodies now being developed as alternative agents to rituximab in CLL based upon different properties of enhanced direct cell death (DCD), NK cell-mediated antibody dependent cellular cytotoxicity (ADCC), or complement-dependent cytotoxicity (CDC). Despite wide spread study, ofatumumab and GA101 have not been directly compared to one another, nor studied for interaction with monocytes and macrophages that are critical to CD20-mediated antibody efficacy in murine models. In CLL cells, we show that DCD is greatest with GA101 and CDC with ofatumumab. GA101 promotes enhanced NK cell activation and ADCC at high antibody concentrations. Ofatumumab has superior antibody dependent cellular phagocytosis (ADCP) with monocyte derived macrophages (MDM). GA101 demonstrated reduced activation of monocytes with diminished pERK, TNF-α release, and FcγRIIa recruitment to lipid rafts. These data demonstrate GA101 and ofatumumab are superior to rituximab against CLL cells via different mechanisms of potential tumor elimination. These findings bear relevance to potential combination strategies with each of these anti-CD20 antibodies in the treatment of CLL. PMID:23418626

  3. Epidermal growth factor receptor inhibition by anti-CD147 therapy in cutaneous squamous cell carcinoma.

    PubMed

    Frederick, John W; Sweeny, Larissa; Hartman, Yolanda; Zhou, Tong; Rosenthal, Eben L

    2016-02-01

    Advanced cutaneous squamous cell carcinoma (SCC) is an uncommon and aggressive malignancy. As a result, there is limited understanding of its biology and pathogenesis. CD147 and epidermal growth factor receptor (EGFR) have been identified as oncologically important targets, but their relationship remains undefined in cutaneous SCC. Multiple cutaneous SCC cell lines (Colo-16, SRB-1, and SRB-12), were treated in vitro with a range of chimeric anti-CD147 monoclonal antibody (mAb) (0, 50, 100, and 200 µg/mL) or transfected with a small interfering RNA against CD147 (SiCD147). Cell proliferation, migration (scratch wound healing assay), and protein expression was then assessed. In vivo, Colo-16 flank xenografts were treated anti-CD147 mAb (150 µg i.p. triweekly). After treatment with anti-CD147 (200 µg/mL), there was a significant decrease in proliferation for all cell lines relative to controls (p < .005). In addition, treatment with anti-CD147 (200 µg/mL) resulted in decreased cell migration for all cell lines, with an average of 43% reduction in closure compared to controls (p < .001). Colo-16 SiCD147 expression demonstrated similar reduction in proliferation and wound closure. Anti-CD147 antibody therapy and siRNA mediated reduction in CD147 expression were both found to decrease protein expression of EGFR, which correlated with a reduction in downstream total and phosphorylated protein kinase B (pAKT). Tumor growth in vivo was reduced for both the anti-CD147 treatment group and the SiCD147 group relative to controls. Inhibition and downregulation of CD147 in cutaneous SCC resulted in suppression of the malignant phenotype in vitro and in vivo, which may be mediated in part by an alteration in EGFR expression. As a result, CD147 may serve as a potential therapeutic target for advanced cutaneous SCC. © 2014 Wiley Periodicals, Inc.

  4. [(90)Yttrium-DOTA]-TOC response is associated with survival benefit in iodine-refractory thyroid cancer: long-term results of a phase 2 clinical trial.

    PubMed

    Iten, Fabienne; Muller, Beat; Schindler, Christian; Rasch, Helmut; Rochlitz, Christoph; Oertli, Daniel; Maecke, Helmut R; Muller-Brand, Jan; Walter, Martin A

    2009-05-15

    The authors aimed to explore the efficacy of (90)Yttrium-1,4,7,10-tetra-azacyclododecane N,N',N'',N'''-tetraacetic acid [(90)Y-DOTA]-Tyr(3)-octreotide (TOC) in advanced iodine-refractory thyroid cancer. In a phase 2 trial, the authors investigated biochemical response (assessed by serum thyroglobulin levels), survival, and the long-term safety profile of systemic [(90)Y-DOTA]-TOC treatment in metastasized iodine-refractory thyroid cancer. Adverse events were assessed according to the National Cancer Institute criteria. Survival analyses were performed by using multiple regression models. A total of 24 patients were enrolled. A median cumulative activity of 13.0 GBq (range, 1.7-30.3 GBq) was administered. Response was found in 7 (29.2%) patients. Eight (33.3%) patients developed hematologic toxicity grade 1-3, and 4 (16.7%) patients developed renal toxicity grade 1-4. The median survival was 33.4 months (range, 3.6-126.8 months) from time of diagnosis and 16.8 months (range, 1.8-99.1 months) from time of first [(90)Y-DOTA]-TOC treatment. Response to treatment was associated with longer survival from time of diagnosis (hazard ratio [HR], 0.17; 95% confidence interval [CI], 0.03-0.92; P = .04) and from time of first [(90)Y-DOTA]-TOC therapy (HR, 0.20; 95% CI, 0.04-0.94; P = .04). The visual grade of scintigraphic tumor uptake was not associated with treatment response (odds ratio [OR], 0.98; 95% CI, 0.26-3.14; P = 1.00). Response to [(90)Y-DOTA]-TOC in metastasized iodine-refractory thyroid cancer was associated with longer survival. Upcoming trials should aim to increase the number of treatment cycles.

  5. CdTe/CdS-MPA quantum dots as fluorescent probes to label yeast cells: synthesis, characterization and conjugation with Concanavalin A

    NASA Astrophysics Data System (ADS)

    Kato, Ilka T.; Santos, Camila C.; Benetti, Endi; Tenório, Denise P. L. A.; Cabral Filho, Paulo E.; Sabino, Caetano P.; Fontes, Adriana; Santos, Beate S.; Prates, Renato A.; Ribeiro, Martha S.

    2012-03-01

    Candida albicans is the most frequent human opportunistic pathogenic fungus and one of the most important causes of nosocomial infections. In fact, diagnosis of invasive candidiasis presents unique problems. The aim of this work was to evaluate, by fluorescence image analysis, cellular labeling of C. albicans with CdTe/CdS quantum dots conjugated or not to concanavalin A (ConA). Yeast cells were incubated with CdTe/CdS quantum dots (QD) stabilized with mercaptopropionic acid (MPA) (emission peak at 530 nm) for 1 hour. In the overall study we observed no morphological alterations. The fluorescence microscopic analysis of the yeast cells showed that the non-functionalized QDs do not label C. albicans cells, while for the QD conjugated to ConA the cells showed a fluorescence profile indicating that the membrane was preferentially marked. This profile was expected since Concanavalin A is a protein that binds specifically to terminal carbohydrate residues at the membrane cell surface. The results suggest that the QD-labeled Candida cells represent a promising tool to open new possibilities for a precise evaluation of fungal infections in pathological conditions.

  6. 46 CFR 90.20-1 - Marine engineering details.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Marine engineering details. 90.20-1 Section 90.20-1... PROVISIONS General Marine Engineering Requirements § 90.20-1 Marine engineering details. (a) All marine engineering details such as piping, valves, fittings, boilers, pressure vessels, etc., and their appurtenances...

  7. 46 CFR 90.20-1 - Marine engineering details.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Marine engineering details. 90.20-1 Section 90.20-1... PROVISIONS General Marine Engineering Requirements § 90.20-1 Marine engineering details. (a) All marine engineering details such as piping, valves, fittings, boilers, pressure vessels, etc., and their appurtenances...

  8. 46 CFR 90.20-1 - Marine engineering details.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Marine engineering details. 90.20-1 Section 90.20-1... PROVISIONS General Marine Engineering Requirements § 90.20-1 Marine engineering details. (a) All marine engineering details such as piping, valves, fittings, boilers, pressure vessels, etc., and their appurtenances...

  9. 46 CFR 90.20-1 - Marine engineering details.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Marine engineering details. 90.20-1 Section 90.20-1... PROVISIONS General Marine Engineering Requirements § 90.20-1 Marine engineering details. (a) All marine engineering details such as piping, valves, fittings, boilers, pressure vessels, etc., and their appurtenances...

  10. 46 CFR 90.20-1 - Marine engineering details.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Marine engineering details. 90.20-1 Section 90.20-1... PROVISIONS General Marine Engineering Requirements § 90.20-1 Marine engineering details. (a) All marine engineering details such as piping, valves, fittings, boilers, pressure vessels, etc., and their appurtenances...

  11. Anti-CD22–chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia

    PubMed Central

    Haso, Waleed; Lee, Daniel W.; Shah, Nirali N.; Stetler-Stevenson, Maryalice; Yuan, Constance M.; Pastan, Ira H.; Dimitrov, Dimiter S.; Morgan, Richard A.; FitzGerald, David J.; Barrett, David M.; Wayne, Alan S.; Mackall, Crystal L.

    2013-01-01

    Immune targeting of B-cell malignancies using chimeric antigen receptors (CARs) is a promising new approach, but critical factors impacting CAR efficacy remain unclear. To test the suitability of targeting CD22 on precursor B-cell acute lymphoblastic leukemia (BCP-ALL), lymphoblasts from 111 patients with BCP-ALL were assayed for CD22 expression and all were found to be CD22-positive, with median CD22 expression levels of 3500 sites/cell. Three distinct binding domains targeting CD22 were fused to various TCR signaling domains ± an IgG heavy chain constant domain (CH2CH3) to create a series of vector constructs suitable to delineate optimal CAR configuration. CARs derived from the m971 anti-CD22 mAb, which targets a proximal CD22 epitope demonstrated superior antileukemic activity compared with those incorporating other binding domains, and addition of a 4-1BB signaling domain to CD28.CD3ζ constructs diminished potency, whereas increasing affinity of the anti-CD22 binding motif, and extending the CD22 binding domain away from the membrane via CH2CH3 had no effect. We conclude that second-generation m971 mAb-derived anti-CD22 CARs are promising novel therapeutics that should be tested in BCP-ALL. PMID:23243285

  12. IFN-γ Blocks CD4+CD25+ Tregs and Abolishes Immune Privilege of Minor Histocompatibility Mismatched Corneal Allografts

    PubMed Central

    Cunnusamy, Khrishen; Niederkorn, Jerry Y.

    2014-01-01

    Th1 CD4+ cells are believed to be the primary mediators of corneal allograft rejection. However, rejection of fully allogeneic C57BL/6 corneal allografts soared from 50% to 90% in both INF-γ−/− and anti-IFN-γ-treated BALB/c mice. In contrast, similar deficits in IFN-γ in BALB/c hosts enhanced immune privilege of BALB.B (minor histocompatibility antigen-matched, MHC-mismatched) and NZB (major histocompatibility complex-matched, minor histocompatibility antigen-mismatched) corneal allografts – decreasing rejection from 80% to ~20%. This effect of IFN-γ was independent of CD4+ T cell lineage commitment as both anti-IFN-γ-treated acceptor and rejector mice displayed a Th2 cytokine profile. The presence of IFN-γ prevented the generation of alloantigen-specific CD4+CD25+ Tregs in hosts receiving either MHC only mismatched BALB.B or minor only histocompatibility (minor H)-mismatched NZB corneal allografts. Tregs in these hosts, promoted corneal allograft survival by suppressing Th2 effector cells. By contrast, IFN-γ was necessary for the generation of CD4+CD25+ Tregs that prevented rejection of fully allogeneic C57BL/6 corneal allografts in BALB/c hosts. These findings suggest that MHC-matching in combination with blockade of IFN-γ holds promise as a means of enhancing corneal allograft survival. PMID:24119152

  13. Activatory and inhibitory Fcγ receptors augment rituximab-mediated internalization of CD20 independent of signaling via the cytoplasmic domain.

    PubMed

    Vaughan, Andrew T; Chan, Claude H T; Klein, Christian; Glennie, Martin J; Beers, Stephen A; Cragg, Mark S

    2015-02-27

    Type I anti-CD20 mAb such as rituximab and ofatumumab engage with the inhibitory FcγR, FcγRIIb on the surface of B cells, resulting in immunoreceptor tyrosine-based inhibitory motif (ITIM) phosphorylation. Internalization of the CD20·mAb·FcγRIIb complex follows, the rate of which correlates with FcγRIIb expression. In contrast, although type II anti-CD20 mAb such as tositumomab and obinutuzumab also interact with and activate FcγRIIb, this interaction fails to augment the rate of CD20·mAb internalization, raising the question of whether ITIM phosphorylation plays any role in this process. We have assessed the molecular requirements for the internalization process and demonstrate that in contrast to internalization of IgG immune complexes, FcγRIIb-augmented internalization of rituximab-ligated CD20 occurs independently of the FcγRIIb ITIM, indicating that signaling downstream of FcγRIIb is not required. In transfected cells, activatory FcγRI, FcγRIIa, and FcγRIIIa augmented internalization of rituximab-ligated CD20 in a similar manner. However, FcγRIIa mediated a slower rate of internalization than cells expressing equivalent levels of the highly homologous FcγRIIb. The difference was maintained in cells expressing FcγRIIa and FcγRIIb lacking cytoplasmic domains and in which the transmembrane domains had been exchanged. This difference may be due to increased degradation of FcγRIIa, which traffics to lysosomes independently of rituximab. We conclude that the cytoplasmic domain of FcγR is not required for promoting internalization of rituximab-ligated CD20. Instead, we propose that FcγR provides a structural role in augmenting endocytosis that differs from that employed during the endocytosis of immune complexes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Cohort study of somatostatin-based radiopeptide therapy with [(90)Y-DOTA]-TOC versus [(90)Y-DOTA]-TOC plus [(177)Lu-DOTA]-TOC in neuroendocrine cancers.

    PubMed

    Villard, Linda; Romer, Anna; Marincek, Nicolas; Brunner, Philippe; Koller, Michael T; Schindler, Christian; Ng, Quinn K T; Mäcke, Helmut R; Müller-Brand, Jan; Rochlitz, Christoph; Briel, Matthias; Walter, Martin A

    2012-04-01

    Radiopeptide therapy is commonly performed with a single radioisotope. We aimed to compare the effectiveness of somatostatin-based radiopeptide therapy with a single versus a combination of radioisotopes. In a cohort study, patients with metastasized neuroendocrine cancer were treated with repeated cycles of (90)yttrium-labeled tetraazacyclododecane-tetraacetic acid modified Tyr-octreotide ([(90)Y-DOTA]-TOC) or with cycles alternating between [(90)Y-DOTA]-TOC and (177)lutetium-labeled DOTA-TOC ([(177)Lu-DOTA]-TOC) until tumor progression or permanent toxicity. Multivariable Cox regression and competing risk regression were used to study predictors of survival and renal toxicity in patients completing three or more treatment cycles. A total of 486 patients completed three or more treatment cycles; 237 patients received [(90)Y-DOTA]-TOC and 249 patients received [(90)Y-DOTA]-TOC + [(177)Lu-DOTA]-TOC. Patients receiving [(90)Y-DOTA]-TOC + [(177)Lu-DOTA]-TOC had a significantly longer survival than patients receiving [(90)Y-DOTA]-TOC alone (5.51 v 3.96 years; hazard ratio, 0.64; 95% CI, 0.47 to 0.88; P = .006). The rates of severe hematologic toxicities (6.3% v 4.4%; P = .25) and severe renal toxicity (8.9% v 11.2%; P = .47) were comparable in both groups. [(90)Y-DOTA]-TOC + [(177)Lu-DOTA]-TOC was associated with improved overall survival compared with [(90)Y-DOTA]-TOC alone in patients completing three or more cycles of treatment. Contrary to the current practice in radiopeptide therapy, our results suggest an advantage of using a combination of radioisotopes.

  15. CD25 Preselective Anti-HIV Vectors for Improved HIV Gene Therapy

    PubMed Central

    Kalomoiris, Stefanos; Lawson, Je'Tai; Chen, Rachel X.; Bauer, Gerhard; Nolta, Jan A.

    2012-01-01

    Abstract As HIV continues to be a global public health problem with no effective vaccine available, new and innovative therapies, including HIV gene therapies, need to be developed. Due to low transduction efficiencies that lead to low in vivo gene marking, therapeutically relevant efficacy of HIV gene therapy has been difficult to achieve in a clinical setting. Methods to improve the transplantation of enriched populations of anti-HIV vector-transduced cells may greatly increase the in vivo efficacy of HIV gene therapies. Here we describe the development of preselective anti-HIV lentiviral vectors that allow for the purification of vector-transduced cells to achieve an enriched population of HIV-resistant cells. A selectable protein, human CD25, not normally found on CD34+ hematopoietic progenitor cells (HPCs), was incorporated into a triple combination anti-HIV lentiviral vector. Upon purification of cells transduced with the preselective anti-HIV vector, safety was demonstrated in CD34+ HPCs and in HPC-derived macrophages in vitro. Upon challenge with HIV-1, improved efficacy was observed in purified preselective anti-HIV vector-transduced macrophages compared to unpurified cells. These proof-of-concept results highlight the potential use of this method to improve HIV stem cell gene therapy for future clinical applications. PMID:23216020

  16. Intra-articular radioactive yttrium and triamcinolone hexacetonide: an inconclusive trial. Arthritis and Rheumatism Council Multicentre Radiosynoviorthesis Trial Group.

    PubMed

    1984-08-01

    A restricted sequential design multicentre controlled trial of yttrium-90 against triamcinolone intra-articularly was undertaken in patients with rheumatoid arthritis with knee involvement. The trial had to be discontinued because of dwindling recruitment over time. The reasons for this and other features contributing to an inconclusive outcome are noted. This experience lends little encouragement to the idea that yttrium-90 therapy is more or less advantageous than triamcinolone hexacetonide.

  17. Technetium-99m-labeled rituximab for use as a specific tracer of sentinel lymph node biopsy: a translational research study.

    PubMed

    Wang, Xuejuan; Yang, Zhi; Lin, Baohe; Zhang, Yan; Zhai, Shizhen; Zhao, Qichao; Xie, Qing; Liu, Fei; Han, Xuedi; Li, Jinfeng; Ouyang, Tao

    2016-06-21

    We aimed to develop and translate a CD20-antigen-targeted radiopharmaceutical, Technetium-99 m-labeled (99mTc) rituximab, for sentinel lymph node (SLN) detection. 99mTc-rituximab was synthesized and tested for stability in human serum. The binding affinity to CD20 was evaluated in Raji cells by flow cytometric analysis. Biodistribution and sentinel node mapping were carried out in bal b/c mice. Eighty-five patients with breast cancer participated in this study. Dynamic sentinel lymphoscintigraphy was first assessed in 12 patients before planar lymphoscintigraphy was assessed in a larger cohort. All patients underwent sentinel lymph node biopsy (SLNB), followed by axillary lymph node dissection. The cell-binding study showed that 99mTc-rituximab possessed compatible affinity to human CD20. In the mechanism study, 99mTc-labeled anti-mouse CD20 monoclonal antibodies could bind to mouse CD20 and accumulate in the SLN with 2.62±1.25 % of the percentage of injected activity, which could be blocked by excessive unlabeled antibody. Low uptake of non-sentinel nodes and fast clearance from the injection site were observed in the mice. Sentinel nodes were identified in 82 of 85 breast cancer patients (96.5%) by lymphoscintigraphy and SLNB. The sensitivity, specificity, and accuracy were 96.8% (30/31), 100% (51/51), and 98.8% (81/82), respectively. 99mTc-rituximab, specifically binding to CD20, met most of the requirements of an ideal sentinel mapping agent for use in clinical settings.

  18. Standardization of Procedures for the Preparation of (177)Lu- and (90)Y-labeled DOTA-Rituximab Based on the Freeze-dried Kit Formulation.

    PubMed

    Wojdowska, Wioletta; Karczmarczyk, Urszula; Maurin, Michal; Garnuszek, Piotr; Mikołajczak, Renata

    2015-01-01

    Rituximab when radiolabelled with (177)Lu or (90)Y has been investigated for the treatment of patients with Non-Hodgkin's Lymphoma. In this study, we optimized the preparation of antibody conjugates with chelating agent in the freeze-dried kit. It shortens procedures needed for the successful radiolabeling with lutetium-177 and yttrium-90 and assures reproducible labelling yields. Various molar ratios of Rituximab:DOTA (from 1:5 to 1:100) were used at the conjugation step and different purification method to remove unbound DOTA were investigated (size-exclusion chromatography, dialysis, ultrafiltration). The final monoclonal antibody concentration was quantified by Bradford method, and the number of DOTA molecules was determined by radiolabeling assay using (64)Cu. The specific activity of (177)Lu-DOTA-Rituximab and (90)Y-DOTA-Rituximab were optimized using various amounts of radiometal. Quality control (SE-HPLC, ITLC) and stability study were performed. An average of 4.2 ± 0.8 p-SCN-Bz-DOTA molecules could be randomly conjugated to a single molecule of Rituximab. The ultrafiltration system was the most efficient for purification and resulted in the highest recovery efficiency (77.2%). At optimized conditions the (177)Lu-DOTARituximab and (90)Y-DOTA-Rituximab were obtained with radiochemical purity >99% and specific activity ca. 600 MBq/mg. The radioimmunoconjugates were stable in human serum and 0.9% NaCl. After 72 h of incubation the radiochemical purity of (177)Lu-DOTA-Rituximab decreased to 94% but it was still more than 88% for (90)Y-DOTA-Rituximab. The radioimmunoconjugate showed stability after six months storage at 2 - 8(0)C, as a lyophilized formulation. Our study shows that Rituximab-DOTA can be efficiently radiolabeled with (177)Lu and (90)Y via p-SCN-Bn-DOTA using a freezedried kit.

  19. Characterization of CD22 Expression in Acute Lymphoblastic Leukemia

    PubMed Central

    Shah, Nirali N.; Stetler-Stevenson, Maryalice; Yuan, Constance M.; Richards, Kelly; Delbrook, Cindy; Kreitman, Robert J.; Pastan, Ira; Wayne, Alan S.

    2015-01-01

    Background CD22 is a B-lineage differentiation antigen that has emerged as a leading therapeutic target in acute lymphoblastic leukemia (ALL). Procedure Properties of CD22 expression relevant to therapeutic targeting were characterized in primary samples obtained from children and young adults with relapsed and chemotherapy refractory B-precursor (pre-B) ALL. Results CD22 expression was demonstrated in all subjects (n=163) with detection on at least 90% of blasts in 155 cases. Median antigen site density of surface CD22 was 3,470 sites/cell (range 349 – 19,653, n=160). Blasts from patients with known 11q23 (MLL) rearrangement had lower site density (median 1,590 sites/cell, range 349-3,624, n=20 versus 3,853 sites/cell, range 451-19,653, n=140; p=<0.0001) and 6 of 21 cases had sub-populations of blasts lacking CD22 expression (22% – 82% CD22+). CD22 expression was maintained in serial studies of 73 subjects, including those treated with anti-CD22 targeted therapy. The levels of soluble CD22 in blood and marrow by ELISA were low and not expected to influence the pharmacokinetics of anti-CD22 directed agents. Conclusions These characteristics make CD22 an excellent potential therapeutic target in patients with relapsed and chemotherapy-refractory ALL, although cases with MLL rearrangement require close study to exclude the presence of a CD22-negative blast population. PMID:25728039

  20. Prevention of diabetes: effect of mycophenolate mofetil and anti-CD25 on onset of diabetes in the DRBB rat.

    PubMed

    Ugrasbul, Figen; Moore, Wayne V; Tong, Pei Ying; Kover, Karen L

    2008-12-01

    Anti-CD25 and mycophenolate mofetil (MMF) treatment of patients with new-onset diabetes is currently being tested as one of the trials in TrialNet. We tested the effectiveness of MMF and anti-CD25 in preventing autoimmune diabetes in the diabetes-resistant biobreeding (DRBB) rat. Autoimmune diabetes in the DRBB rat was induced with a Treg cell depletion regimen starting at 24-26 d of age. Treatment was started on the first day of the depletion regimen in the following groups: (i) control (vehicle); (ii) MMF 25 mg/kg/d intramuscularly daily for 8 wk; (iii) anti-CD25 0.8 mg/kg/d intraperitoneally 5 d/wk for 3 wk; and (iv) combination of MMF and anti-CD25. In a second set of experiments, treatments were started on day 5 of the depletion regimen (delayed treatment) with groups 1, 3, and 4. Rats that had diabetes-free survival for at least 30 d after the treatment was stopped underwent a second Treg depletion (redepletion). In each of the three treatment groups (n = 10/group), onset of diabetes was delayed or prevented in 20, 40 and 80% in groups 2, 3, and 4, respectively. After redepletion, diabetes-free survival was unchanged in group 2 and decreased to 10 and 30% in groups 3 and 4, respectively. With delayed treatment, groups 3 and 4 had 33 and 50% diabetes-free survival that decreased to 0 and 33% after redepletion. MMF and anti-CD25 alone or in combination are effective in delaying and preventing diabetes in the DRBB rat especially if treatment is started before stimulation and expansion of the autoreactive T cells.

  1. The behaviour of selected yttrium containing bioactive glass microspheres in simulated body environments.

    PubMed

    Cacaina, D; Ylänen, H; Simon, S; Hupa, M

    2008-03-01

    The study aims at the manufacture and investigation of biodegradable glass microspheres incorporated with yttrium potentially useful for radionuclide therapy of cancer. The glass microspheres in the SiO2-Na2O-P2O5-CaO-K2O-MgO system containing yttrium were prepared by conventional melting and flame spheroidization. The behaviour of the yttrium silicate glass microspheres was investigated under in vitro conditions using simulated body fluid (SBF) and Tris buffer solution (TBS), for different periods of time, according to half-life time of the Y-90. The local structure of the glasses and the effect of yttrium on the biodegradability process were evaluated by Fourier Transform Infrared (FT-IR) spectroscopy and Back Scattered Electron Imaging of Scanning Electron Microscopy (BEI-SEM) equipped with Energy Dispersive X-ray (EDX) analysis. UV-VIS spectrometry and Inductively Coupled Plasma Mass Spectrometry (ICP-MS) was used for analyzing the release behaviour of silica and yttrium in the two used solutions. The results indicate that the addition of yttrium to a bioactive glass increases its structural stability which therefore, induced a different behaviour of the glasses in simulated body environments.

  2. Human anti-CD30 recombinant antibodies by guided phage antibody selection using cell panning

    PubMed Central

    Klimka, A; Matthey, B; Roovers, R C; Barth, S; Arends, J-W; Engert, A; Hoogenboom, H R

    2000-01-01

    In various clinical studies, Hodgkin’s patients have been treated with anti-CD30 immunotherapeutic agents and have shown promising responses. One of the problems that appeared from these studies is the development of an immune response against the non-human therapeutics, which limits repeated administration and reduces efficacy. We have set out to make a recombinant, human anti-CD30 single-chain variable fragment (scFv) antibody, which may serve as a targeting moiety with reduced immunogenicity and more rapid tumour penetration in similar clinical applications. Rather than selecting a naive phage antibody library on recombinant CD30 antigen, we used guided selection of a murine antibody in combination with panning on the CD30-positive cell line L540. The murine monoclonal antibody Ki-4 was chosen as starting antibody, because it inhibits the shedding of the extracellular part of the CD30 antigen. This makes the antibody better suited for CD30-targeting than most other anti-CD30 antibodies. We have previously isolated the murine Ki-4 scFv by selecting a mini-library of hybridoma-derived phage scFv-antibodies via panning on L540 cells. Here, we report that phage display technology was successfully used to obtain a human Ki-4 scFv version by guided selection. The murine variable heavy (VH) and light (VL) chain genes of the Ki-4 scFv were sequentially replaced by human V gene repertoires, while retaining only the major determinant for epitope-specificity: the heavy-chain complementarity determining region 3 (CDR3) of murine Ki-4. After two rounds of chain shuffling and selection by panning on L540 cells, a fully human anti-CD30 scFv was selected. It competes with the parental monoclonal antibody Ki-4 for binding to CD30, inhibits the shedding of the extracellular part of the CD30 receptor from L540 cells and is thus a promising candidate for the generation of anti-CD30 immunotherapeutics. © 2000 Cancer Research Campaign PMID:10901379

  3. Intra-articular radioactive yttrium and triamcinolone hexacetonide: an inconclusive trial. Arthritis and Rheumatism Council Multicentre Radiosynoviorthesis Trial Group.

    PubMed Central

    1984-01-01

    A restricted sequential design multicentre controlled trial of yttrium-90 against triamcinolone intra-articularly was undertaken in patients with rheumatoid arthritis with knee involvement. The trial had to be discontinued because of dwindling recruitment over time. The reasons for this and other features contributing to an inconclusive outcome are noted. This experience lends little encouragement to the idea that yttrium-90 therapy is more or less advantageous than triamcinolone hexacetonide. PMID:6383234

  4. Broad, Intense Anti-Human Immunodeficiency Virus (HIV) Ex Vivo CD8+ Responses in HIV Type 1-Infected Patients: Comparison with Anti-Epstein-Barr Virus Responses and Changes during Antiretroviral Therapy

    PubMed Central

    Dalod, Marc; Dupuis, Marion; Deschemin, Jean-Christophe; Sicard, Didier; Salmon, Dominique; Delfraissy, Jean-Francois; Venet, Alain; Sinet, Martine; Guillet, Jean-Gerard

    1999-01-01

    The ex vivo antiviral CD8+ repertoires of 34 human immunodeficiency virus (HIV)-seropositive patients with various CD4+ T-cell counts and virus loads were analyzed by gamma interferon enzyme-linked immunospot assay, using peptides derived from HIV type 1 and Epstein-Barr virus (EBV). Most patients recognized many HIV peptides, with markedly high frequencies, in association with all the HLA class I molecules tested. We found no correlation between the intensity of anti-HIV CD8+ responses and the CD4+ counts or virus load. In contrast, the polyclonality of anti-HIV CD8+ responses was positively correlated with the CD4+ counts. The anti-EBV responses were significantly less intense than the anti-HIV responses and were positively correlated with the CD4+ counts. Longitudinal follow-up of several patients revealed the remarkable stability of the anti-HIV and anti-EBV CD8+ responses in two patients with stable CD4+ counts, while both antiviral responses decreased in two patients with obvious progression toward disease. Last, highly active antiretroviral therapy induced marked decreases in the number of anti-HIV CD8+ T cells, while the anti-EBV responses increased. These findings emphasize the magnitude of the ex vivo HIV-specific CD8+ responses at all stages of HIV infection and suggest that the CD8+ hyperlymphocytosis commonly observed in HIV infection is driven mainly by virus replication, through intense, continuous activation of HIV-specific CD8+ T cells until ultimate progression toward disease. Nevertheless, highly polyclonal anti-HIV CD8+ responses may be associated with a better clinical status. Our data also suggest that a decrease of anti-EBV CD8+ responses may occur with depletion of CD4+ T cells, but this could be restored by highly active antiretroviral treatment. PMID:10438796

  5. Successful management of a hydropic fetus with severe anemia and thrombocytopenia caused by anti-CD36 antibody.

    PubMed

    Xu, Xiuzhang; Li, Lin; Xia, Wenjie; Ding, Haoqiang; Chen, Dawei; Liu, Jing; Deng, Jing; Chen, Yangkai; He, Zhiming; Wang, Jiali; Shao, Yuan; Santoso, Sentot; Ye, Xin; Fang, Qun

    2018-02-01

    Cases of CD36 deficiency are not rare in Asian populations, foetal and neonatal alloimmune thrombocytopenia (FNAIT) caused by anti-CD36 isoantibodies appears more frequent than other HPA alloantibodies. However, little is known about the treatment of anti-CD36 mediated FNAIT in this region. A Chinese male foetus, whose mother had a history of multiple intrauterine foetal demise and/or hydrops, was diagnosed with severe FNAIT at 27 weeks of gestational age. Immunological analysis revealed total absence of CD36 on platelets and monocytes from mother, caused by a 329-330delAC mutation of the CD36 gene. Anti-CD36 and anti-HLA class I antibodies were detected in the maternal serum, whereas only anti-CD36 isoantibodies were detectable in the foetal blood sample. Serial intrauterine transfusions with red blood cells (RBC) and platelets from a CD36null donor were performed to improve the severe anaemia and thrombocytopenia. The baby (2250 g; Apgar scores 10) was delivered vaginally at 32 weeks of gestation with normal haemoglobin (186 g/L) but low platelet count (48 × 10 9 /L). After 2 days the platelet count rose to 121 × 10 9 /L. This report suggests that intrauterine transfusions with compatible RBC and CD36null platelets are useful in preventing the deleterious clinical effects of anti-CD36-mediated severe FNAIT.

  6. Compliance in 2017 With Federal Calorie Labeling in 90 Chain Restaurants and 10 Retail Food Outlets Prior to Required Implementation.

    PubMed

    Cleveland, Lauren P; Simon, Denise; Block, Jason P

    2018-06-21

    To examine early compliance with the delayed federal calorie labeling regulation that requires posting calories on menus and menu boards at retail food chains with 20 or more establishments nationally. We explored implementation of calorie labeling at 90 of the largest US chain restaurants and the 10 highest-grossing supermarket chains from May to December 2017. We contacted corporate offices and at least 2 locations for each chain, made site visits when possible, and supplemented these efforts with targeted Internet searches. Overall, 71 (79%) restaurant chains partially or fully implemented labeling, as did 9 (90%) supermarket chains. Fast-food and fast-casual restaurants fully implemented labeling at a modestly higher rate than did full-service restaurants. Most of the retail food chains we assessed implemented calorie labeling policies in advance of the May 2018 compliance date. Public Health Implications. Although implementation of federal calorie labeling has been delayed repeatedly in the 8 years since the passage of the legislation, retail food chains have demonstrated a high rate of compliance with calorie labeling in advance of the required May 2018 implementation date. Despite reports from some retail food industries that compliance will be difficult, current implementation shows the feasibility of complying. (Am J Public Health. Published online ahead of print June 21, 2018: e1-e4. doi:10.2105/AJPH.2018.304513).

  7. Targeted suppression of autoreactive CD8+ T-cell activation using blocking anti-CD8 antibodies.

    PubMed

    Clement, Mathew; Pearson, James A; Gras, Stephanie; van den Berg, Hugo A; Lissina, Anya; Llewellyn-Lacey, Sian; Willis, Mark D; Dockree, Tamsin; McLaren, James E; Ekeruche-Makinde, Julia; Gostick, Emma; Robertson, Neil P; Rossjohn, Jamie; Burrows, Scott R; Price, David A; Wong, F Susan; Peakman, Mark; Skowera, Ania; Wooldridge, Linda

    2016-10-17

    CD8 + T-cells play a role in the pathogenesis of autoimmune diseases such as multiple sclerosis and type 1 diabetes. However, drugs that target the entire CD8 + T-cell population are not desirable because the associated lack of specificity can lead to unwanted consequences, most notably an enhanced susceptibility to infection. Here, we show that autoreactive CD8 + T-cells are highly dependent on CD8 for ligand-induced activation via the T-cell receptor (TCR). In contrast, pathogen-specific CD8 + T-cells are relatively CD8-independent. These generic differences relate to an intrinsic dichotomy that segregates self-derived and exogenous antigen-specific TCRs according to the monomeric interaction affinity with cognate peptide-major histocompatibility complex class I (pMHCI). As a consequence, "blocking" anti-CD8 antibodies can suppress autoreactive CD8 + T-cell activation in a relatively selective manner. These findings provide a rational basis for the development and in vivo assessment of novel therapeutic strategies that preferentially target disease-relevant autoimmune responses within the CD8 + T-cell compartment.

  8. Blinatumomab, a Bi-Specific Anti-CD19/CD3 BiTE® Antibody for the Treatment of Acute Lymphoblastic Leukemia: Perspectives and Current Pediatric Applications

    PubMed Central

    Hoffman, Lindsey M.; Gore, Lia

    2014-01-01

    Leukemia is the most common childhood malignancy and acute lymphoblastic leukemia (ALL) represents the largest sub-type. Despite remarkable improvements over the last 40 years, standard therapy fails in 10–20% of newly diagnosed patients. Survival for children with relapsed ALL is poor, and the development and implementation of novel therapeutic strategies in pediatric ALL are critical to further advancements. Immunotherapeutic approaches have been central to more novel ALL therapies. However, more recent innovation in antibody engineering has improved potency and efficacy, and antibody–drug conjugates (ADCs) are an especially attractive option in severely immunocompromised patients. An even more sophisticated antibody design is that of bi-specific T-cell engaging or BiTE® antibodies, which directly recruit effector T cells to augment the anti-neoplastic effect. This review focuses on blinatumomab, a bi-specific anti-CD19/CD3 antibody that has shown efficacy in adult patients with precursor B-ALL and is currently being evaluated in the pediatric setting. PMID:24744989

  9. What happened to anti-CD33 therapy for acute myeloid leukemia?

    PubMed

    Jurcic, Joseph G

    2012-03-01

    CD33, a 67-kDa glycoprotein expressed on the majority of myeloid leukemia cells as well as on normal myeloid and monocytic precursors, has been an attractive target for monoclonal antibody (mAb)-based therapy of acute myeloid leukemia (AML). Lintuzumab, an unconjugated, humanized anti-CD33 mAb, has modest single-agent activity against AML but failed to improve patient outcomes in two randomized trials when combined with conventional chemotherapy. Gemtuzumab ozogamicin, an anti-CD33 mAb conjugated to the antitumor antibiotic calicheamicin, improved survival in a subset of AML patients when combined with standard chemotherapy, but safety concerns led to US marketing withdrawal. The activity of these agents confirms that CD33 remains a viable therapeutic target for AML. Strategies to improve the results of mAb-based therapies for AML include antibody engineering to enhance effector function, use of alternative drugs and chemical linkers to develop safer and more effective drug conjugates, and radioimmunotherapeutic approaches.

  10. 10 CFR 20.1904 - Labeling containers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary Procedures § 20... handling or using the containers, or working in the vicinity of the containers, to take precautions to...

  11. 10 CFR 20.1904 - Labeling containers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary Procedures § 20... handling or using the containers, or working in the vicinity of the containers, to take precautions to...

  12. 10 CFR 20.1904 - Labeling containers.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary Procedures § 20... handling or using the containers, or working in the vicinity of the containers, to take precautions to...

  13. 10 CFR 20.1904 - Labeling containers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary Procedures § 20... handling or using the containers, or working in the vicinity of the containers, to take precautions to...

  14. 10 CFR 20.1904 - Labeling containers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary Procedures § 20... handling or using the containers, or working in the vicinity of the containers, to take precautions to...

  15. Ulex Europaeus lectin and anti-CD31 staining in squamous cell carcinoma of the uterine cervix: potential prognostic markers.

    PubMed

    Davidson, B; Goldberg, I; Gotlieb, W H; Lerner-Geva, L; Ben-Baruch, G; Kopolovic, J

    1998-07-01

    Seventy-five squamous cell carcinomas of the uterine cervix and 10 controls were stained for Ulex Europaeus lectin 1 (UEA-1) and anti-CD31, and the results were analyzed with respect to patient age, clinical stage, tumor grade, and survival during a follow-up period of 1 to 13 years. The patients' mean age at the time of diagnosis was 47.8 years (range, 27 to 83). Seventeen patients died of disease, 2 had disease recurrence, and 51 patients remained free of disease; 5 patients were lost to follow-up. Twenty-eight cases (37.3%) showed focal membranous staining for UEA-1 and 9 cases (12%) showed a diffuse pattern; 38 cases (50.7%) were UEA-1 negative. Poor survival was related to diffuse membranous UEA-1 immunoreactivity (p = 0.02), age (p = 0.014), grade (p = 0.02), and stage (p = 0.0002). CD31-positive neoplastic cells displayed a cytoplasmic pattern. Fifteen cases (20%) had diffuse staining and another 15 (20%) stained focally; 45 cases (60%) were CD31-negative. The adjacent nonneoplastic epithelium and all 10 controls were uniformly negative for CD31. Variable staining of the endocervical epithelium and weak or negative staining of ectocervical epithelium for UEA-1 were observed. However, the epithelium in all controls was negative for UEA-1. Poor survival was related to both focal and diffuse staining for CD31 (p = 0.01 and p = 0.03, respectively). Staining by both UEA-1 and anti-CD31 retained its correlation with survival after exclusion of stage la tumors.

  16. Recognition of Naegleriae ameba surface protein epitopes by anti-human CD45 antibodies.

    PubMed

    Ravine, Terrence J; Polski, Jacek M; Jenkins, James

    2010-04-01

    Phagocytosis is a highly conserved mechanism exhibited by both free-living amebas and mammalian blood cells. Similarities demonstrated by either cell type during engulfment of the same bacterial species may imply analogous surface proteins involved in receptor-mediated endocytosis. The increased availability of anti-human leukocyte antibodies or clusters of differentiation (CD) markers used in conjunction with flow cytometric (FCM) and/or immunohistochemical (IHC) analysis provides investigators with a relatively easy method to screen different cell populations for comparable plasma membrane proteins. In this study, we incubated Naegleria and Acanthamoeba amebas with several directly conjugated anti-human leukocyte monoclonal antibodies (mAb) for similarly recognized amebic epitopes. CD marker selection was based upon a recognized role of each mAb in phagocyte activation and/or uptake of bacteria. These included CD14, CD45, and CD206. In FCM, only one CD45 antibody demonstrated strong reactivity with both Naegleria fowleri and Naegleria gruberi that was not expressed in similarly tested Acanthamoeba species. Additional testing of N. gruberi by IHC demonstrated reactivity to a different CD45 antibody. Our results suggest a possible utility of using anti-human leukocyte antibodies to screen amebic cells for similarly expressed protein epitopes. In doing so, several important items must be considered when selecting potential mAbs for testing to increase the probability of a positive result.

  17. Clinical Utility of Urinary CD90 as a Biomarker for Prostate Cancer Detection — EDRN Public Portal

    Cancer.gov

    Tumor-associated stromal cells differ from normal gland-associated stromal cells in gene expression. Genes up-regulated in these stromal cells are potential cancer biomarkers, especially those encoding secreted or extracellular proteins. These proteins might be detected in urine. CD90/THY1 is one such candidate. A clinical test based on urinary CD90 would be useful in reducing the number of unnecessary biopsies done because of abnormal serum PSA and/or DRE finding. Elevated CD90 protein is found in tumor tissue and urine.

  18. Liver Resection for Colorectal Hepatic Metastases after Systemic Chemotherapy and Selective Internal Radiation Therapy with Yttrium-90 Microspheres: A Systematic Review.

    PubMed

    Baltatzis, Minas; Siriwardena, Ajith K

    2018-06-08

    Selective internal radiation therapy (SIRT) using yttrium-90 resin microspheres has been used together with systemic chemotherapy to treat patients with unresectable liver metastases. This study undertook the first systematic pooled assessment of the case profile, treatment and outcome in patients with initially inoperable colorectal hepatic metastases undergoing resection after systemic chemotherapy and SIRT. A systematic review of the literature was performed using Medline and Embase for publications between January 1998 and August 2017. Keywords and MESH headings "SIRT", "Yttrium-99 radio embolization" and "liver metastases" were used. Reports on patients undergoing liver resection after SIRT for colorectal liver metastases were included. Case reports, reviews and papers without original data were excluded. The study protocol was registered with PROSPERO, (registration number: CRD42017072374). The study population comprised of 120 patients undergoing liver resection after chemotherapy and SIRT. The conversion rate to hepatectomy in previously unresectable patients was 13.6% (109 of 802). All studies report a single application of SIRT. The interval from SIRT to surgery ranged from 39 days to 9 months. Overall, there were 4 (3.3%) deaths after hepatectomy in patients treated by chemotherapy and SIRT. This large pooled report of patients undergoing hepatectomy for colorectal liver metastases after chemotherapy and SIRT shows that 13.6% of patients with initially inoperable disease undergo resection with low procedure-related mortality. © 2018 S. Karger AG, Basel.

  19. Anti-proliferative effect of 20-hydroxyecdysone in a lepidopteran cell line.

    PubMed

    Auzoux-Bordenave, Stéphanie; Hatt, Philippe-Jacques; Porcheron, Patrick

    2002-02-01

    Ecdysteroids are steroid hormones involved in the epidermal growth of arthropods, controlling cell proliferation and further differentiation of target cells. The epidermal cell line IAL-PID2, established from imaginal discs of the Indian meal moth Plodia interpunctella kept its sensitivity to ecdysteroids in vitro, cells being able to respond to them by cytological and biochemical changes. When added to the culture medium, 20-hydroxyecdysone (20E) stopped cell proliferation and induced formation of epithelial-like aggregates. In order to better understand the cellular sequence of ecdysteroids signalling in epidermal cells we used the IAL-PID2 cell line for in vitro investigations of cytological events induced by the moulting hormone. After a 40 h serum deprivation, formazan assay (XTT) was routinely used to evaluate anti-proliferative effects of 20E during cell cycle. We established a more precise timing of the period of cell sensitivity to the hormone during the cell cycle, by the use of the mitotic index and the BrdU incorporation test. These in vitro assays were performed in parallel with the description of some hormone dependant cytological events, using immunofluorescent labelling with anti-beta tubulin/FITC antibodies and DNA staining.

  20. Safety of Radioembolization with {sup 90}Yttrium Resin Microspheres Depending on Coiling or No-Coiling of Aberrant/High-Risk Vessels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paprottka, P. M., E-mail: philipp.paprottka@med.lmu.de, E-mail: philipp.paprottka@med.uni-muenchen.de; Paprottka, K. J., E-mail: karolin.paprottka@med.lmu.de; Walter, A., E-mail: alexandra.Walter@campus.lmu.de

    2015-08-15

    PurposeTo evaluate the safety of radioembolization (RE) with {sup 90}Yttrium ({sup 90}Y) resin microspheres depending on coiling or no-coiling of aberrant/high-risk vessels.Materials and MethodsEarly and late toxicity after 566 RE procedures were analyzed retrospectively in accordance with the National Cancer Institute’s Common Terminology Criteria for Adverse Events (CTCAE v3.0). For optimal safety, aberrant vessels were either coil embolized (n = 240/566, coiling group) or a more peripheral position of the catheter tip was chosen to treat right or left liver lobes (n = 326/566, no-coiling group).ResultsClinically relevant late toxicities (≥Grade 3) were observed in 1 % of our overall cohort. The no-coiling group had significantlymore » less “any” (P = 0.0001) or “clinically relevant” (P = 0.0003) early toxicity. There was no significant difference (P > 0.05) in delayed toxicity in the coiling versus the no-coiling group. No RE-induced liver disease was noted after all 566 procedures.ConclusionRE with {sup 90}Y resin microspheres is a safe and effective treatment option. Performing RE without coil embolization of aberrant vessels prior to treatment could be an alternative for experienced centers.« less

  1. Characterization of CD22 expression in acute lymphoblastic leukemia.

    PubMed

    Shah, Nirali N; Stevenson, Maryalice Stetler; Yuan, Constance M; Richards, Kelly; Delbrook, Cindy; Kreitman, Robert J; Pastan, Ira; Wayne, Alan S

    2015-06-01

    CD22 is a B-lineage differentiation antigen that has emerged as a leading therapeutic target in acute lymphoblastic leukemia (ALL). Properties of CD22 expression relevant to therapeutic targeting were characterized in primary samples obtained from children and young adults with relapsed and chemotherapy refractory B-precursor (pre-B) ALL. CD22 expression was demonstrated in all subjects (n = 163) with detection on at least 90% of blasts in 155 cases. Median antigen site density of surface CD22 was 3,470 sites/cell (range 349-19,653, n = 160). Blasts from patients with known 11q23 (MLL) rearrangement had lower site density (median 1,590 sites/cell, range 349-3,624, n = 20 versus 3,853 sites/cell, range 451-19,653, n = 140; P = <0.0001) and 6 of 21 cases had sub-populations of blasts lacking CD22 expression (22%-82% CD22 +). CD22 expression was maintained in serial studies of 73 subjects, including those treated with anti-CD22 targeted therapy. The levels of soluble CD22 in blood and marrow by ELISA were low and not expected to influence the pharmacokinetics of anti-CD22 directed agents. These characteristics make CD22 an excellent potential therapeutic target in patients with relapsed and chemotherapy-refractory ALL, although cases with MLL rearrangement require close study to exclude the presence of a CD22-negative blast population. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  2. An anti-CD3/anti-CLL-1 bispecific antibody for the treatment of acute myeloid leukemia.

    PubMed

    Leong, Steven R; Sukumaran, Siddharth; Hristopoulos, Maria; Totpal, Klara; Stainton, Shannon; Lu, Elizabeth; Wong, Alfred; Tam, Lucinda; Newman, Robert; Vuillemenot, Brian R; Ellerman, Diego; Gu, Chen; Mathieu, Mary; Dennis, Mark S; Nguyen, Allen; Zheng, Bing; Zhang, Crystal; Lee, Genee; Chu, Yu-Waye; Prell, Rodney A; Lin, Kedan; Laing, Steven T; Polson, Andrew G

    2017-02-02

    Acute myeloid leukemia (AML) is a major unmet medical need. Most patients have poor long-term survival, and treatment has not significantly changed in 40 years. Recently, bispecific antibodies that redirect the cytotoxic activity of effector T cells by binding to CD3, the signaling component of the T-cell receptor, and a tumor target have shown clinical activity. Notably, blinatumomab is approved to treat relapsed/refractory acute lymphoid leukemia. Here we describe the design, discovery, pharmacologic activity, pharmacokinetics, and safety of a CD3 T cell-dependent bispecific (TDB) full-length human IgG1 therapeutic antibody targeting CLL-1 that could potentially be used in humans to treat AML. CLL-1 is prevalent in AML and, unlike other targets such as CD33 and CD123, is not expressed on hematopoietic stem cells providing potential hematopoietic recovery. We selected a high-affinity monkey cross-reactive anti-CLL-1 arm and tested several anti-CD3 arms that varied in affinity, and determined that the high-affinity CD3 arms were up to 100-fold more potent in vitro. However, in mouse models, the efficacy differences were less pronounced, probably because of prolonged exposure to TDB found with lower-affinity CD3 TDBs. In monkeys, assessment of safety and target cell depletion by the high- and low-affinity TDBs revealed that only the low-affinity CD3/CLL1 TDB was well tolerated and able to deplete target cells. Our data suggest that an appropriately engineered CLL-1 TDB could be effective in the treatment of AML. © 2017 by The American Society of Hematology.

  3. The SHH/Gli axis regulates CD90-mediated liver cancer stem cell function by activating the IL6/JAK2 pathway.

    PubMed

    Zhang, Ketao; Che, Siyao; Pan, Chuzhi; Su, Zheng; Zheng, Shangyou; Yang, Shanglin; Zhang, Huayao; Li, Wenda; Wang, Weidong; Liu, Jianping

    2018-05-02

    The cell surface antigen CD90 has recently been established as a promising marker for liver cancer stem cells. This study aimed to investigate potential implications of SHH/Gli signalling in CD90+ liver cancer stem cells. Correlation of the expression of SHH signalling components and CD90 in liver cancer cells and clinical tissues, as well as in enriched CD90+ liver cancer stem cells and the TCGA database, were analysed by quantitative RT-PCR, Western blotting and flow cytometry. Functional analysis was conducted by siRNA-mediated CD90, Gli1 and Gli3 gene knockdown, SHH treatment and application of the JAK2 inhibitor AZD1480 and IL6 neutralizing antibody in CD90+ liver cancer stem cells, followed by cell proliferation, migration, sphere formation and tumorigenicity assays. CD90 expression exhibited a high positive correlation with Gli1 and Gli3 in multiple liver cancer cell lines and human cancerous liver tissues, both of which showed a significant increase in liver cancer. Analysis of TCGA data revealed an association of CD90, Gli1 and Gli3 with a short overall survival and positive correlation between CD90 expression and Gli3 expression level. The stem cell potentials of CD90+ 97L liver cancer cells were greatly impaired by Gli1/3 knockdown with siRNA but enhanced by SHH treatment. Application of the JAK2 inhibitor AZD1480 and IL6 neutralizing antibody showed the CD90 and SHH/Gli-regulated liver cancer stem cell functions were mediated by the IL6/JAK2/STAT3 pathway. The stem cell properties of CD90+ liver cancer cells are regulated by the downstream SHH/Gli and IL6/JAK2/STAT3 signalling pathways. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  4. Prospective study to determine early hypertrophy of the contra-lateral liver lobe after unilobar, Yttrium-90, selective internal radiation therapy in patients with hepatocellular carcinoma.

    PubMed

    Teo, Jin Yao; Allen, John Carson; Ng, David Chee Eng; Abdul Latiff, Julianah Bee; Choo, Su Pin; Tai, David Wai-Meng; Low, Albert Su Chong; Cheah, Foong Koon; Chang, Jason Pik Eu; Kam, Juinn Huar; Lee, Victor T W; Chung, Alexander Yaw Fui; Chan, Chung Yip; Chow, Pierce Kah Hoe; Goh, Brian K P

    2018-05-01

    Liver resection is a major curative option in patients presenting with hepatocellular carcinoma. An inadequate functional liver remnant is a major limiting factor precluding liver resection. In recent years, hypertrophy of the functional liver remnant after selective internal radiation therapy hypertrophy has been observed, but the degree of hypertrophy in the early postselective internal radiation therapy period has not been well studied. We conducted a prospective study on patients undergoing unilobar, Yttrium-90 selective internal radiation therapy for hepatocellular carcinoma to evaluate early hypertrophy at 4-6 weeks and 8-12 weeks after selective internal radiation therapy. In the study, 24 eligible patients were recruited and had serial volumetric measurements performed. The median age was 66 years (38-75 years). All patients were either Child-Pugh Class A or B, and 6/24 patients had documented, clinically relevant portal hypertension; 15 of the 24 patients were hepatitis B positive. At 4-6 weeks, modest hypertrophy was seen (median 3%; range -12 to 42%) and this increased at 8-12 weeks (median 9%; range -12 to 179%). No preprocedural factors predictive of hypertrophy were identified. Hypertrophy of the functional liver remnant after selective internal radiation therapy with Yttrium-90 occurred in a subset of patients but was modest and unpredictable in the early stages. Selective internal radiation therapy cannot be recommended as a standard treatment modality to induce early hypertrophy for patients with hepatocellular carcinoma. (Surgery 2017;160:XXX-XXX.). Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Embolisation of the Gastroduodenal Artery is Not Necessary in the Presence of Reversed Flow Before Yttrium-90 Radioembolisation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daghir, Ahmed A., E-mail: ahmeddaghir@doctors.net.uk; Gungor, Hatice; Haydar, Ali A.

    2012-08-15

    Introduction: The gastroduodenal artery (GDA) is usually embolised to avoid nontarget dispersal before yttrium-90 (Y{sup 90}) radioembolisation to treat liver metastases. In a minority of patients, there is retrograde flow in the GDA. The purpose of this study was to determine if there is any increased risk from maintaining a patent GDA in patients with reversed flow. Materials and Methods: A retrospective review was performed of all patients undergoing Y{sup 90} radioembolisation at our institution. The incidence of toxicities arising from nontarget radioembolisation by way of the GDA (gastric/duodenal ulceration, gastric/duodenal bleeding, and pancreatitis) and death occurring within 2 monthsmore » of treatment were compared between the reversed and the antegrade GDA groups. Results: Ninety-two patients underwent preliminary angiography. Reversed GDA flow was found on angiography in 14.1% of cases; the GDA was not embolised in these patients. The GDA was coiled in 55.7% of patients with antegrade GDA flow to prevent inadvertent dispersal of radioembolic material. There was no increased toxicity related to nontarget dispersal by way of the GDA, or increased early mortality, in patients with reversed GDA flow (P > 0.05). Conclusion: In patients with reversed GDA flow, maintenance of a patent GDA before administration of Y{sup 90} radioembolisation does not increase the risk of toxicity from nontarget dispersal. Therapeutic injection, with careful monitoring to identify early vascular stasis, may be safely performed beyond the origin of the patent GDA. A patent GDA with reversed flow provides forward drive for infused particles and may allow alternative access to the hepatic circulation.« less

  6. Radiometals as payloads for radioimmunotherapy for lymphoma.

    PubMed

    DeNardo, Gerald L; Kennel, Stephen J; Siegel, Jeffry A; Denardo, Sally J

    2004-10-01

    Because of their remarkable effectiveness in radioimmunotherapy (RIT), 2 anti-CD20 monoclonal antibody (MAb) drugs, one labeled with indium 111 for imaging or yttrium 90 for therapy, and another labeled with iodine I 131 for imaging and therapy, have been approved for use in patients with non-Hodgkin's lymphoma (NHL). Successful RIT for lymphomas is due in large part to the rapid and efficient binding of the targeted MAb to lymphoma cells. Carcinomas are more difficult to access, necessitating novel strategies matched with radionuclides with specific physical properties. Because there are many radionuclides from which to choose, a systematic approach is required to select those preferred for a specific application. Thus far, radionuclides with g emissions for imaging and particulate emissions for therapy have been investigated. Radionuclides of iodine were the first to be used for RIT. Many conventionally radioiodinated MAbs are degraded after endocytosis by target cells, releasing radioiodinated peptides and amino acids. In contrast, radiometals have been shown to have residualizing properties, advantageous when the MAb is localized in malignant tissue. b-emitting lanthanides like those of 90Y, lutetium 177, etc. have attractive combinations of biologic, physical, radiochemical, production, economic, and radiation safety characteristics. Other radiometals, such as copper-67 and copper-64, are also of interest. a-emitters, including actinium-225 and bismuth-213, have been used for therapy in selected applications. Evidence for the impact of the radionuclide is provided by data from the randomized pivotal phase III trial of 90Y ibritumomab tiuxetan (Zevalin) in patients with NHL; responses were about 2 times greater in the 90Y ibritumomab tiuxetan arm than in the rituximab arm. It is clear that RIT has emerged as a safe and efficient method for treatment of NHL, especially in specific settings.

  7. Anti-ErbB-2 mAb therapy requires type I and II interferons and synergizes with anti-PD-1 or anti-CD137 mAb therapy.

    PubMed

    Stagg, John; Loi, Sherene; Divisekera, Upulie; Ngiow, Shin Foong; Duret, Helene; Yagita, Hideo; Teng, Michele W; Smyth, Mark J

    2011-04-26

    Trastuzumab, a monoclonal antibody targeting human epidermal growth factor receptor-2 (HER2/ErbB-2), has become the mainstay of treatment for HER2-positive breast cancer. Nevertheless, its exact mechanism of action has not been fully elucidated. Although several studies suggest that Fc receptor-expressing immune cells are involved in trastuzumab therapy, the relative contribution of lymphocyte-mediated cellular cytotoxicity and antitumor cytokines remains unknown. We report here that anti-ErbB-2 mAb therapy is dependent on the release of type I and type II IFNs but is independent of perforin or FasL. Our study thus challenges the notion that classical antibody-dependent, lymphocyte-mediated cellular cytotoxicity is important for trastuzumab. We demonstrate that anti-ErbB-2 mAb therapy of experimental tumors derived from MMTV-ErbB-2 transgenic mice triggers MyD88-dependent signaling and primes IFN-γ-producing CD8+ T cells. Adoptive cell transfer of purified T cell subsets confirmed the essential role of IFN-γ-producing CD8+ T cells. Notably, anti-ErbB-2 mAb therapy was independent of IL-1R or IL-17Ra signaling. Finally, we investigated whether immunostimulatory approaches with antibodies against programmed death-1 (PD-1) or 41BB (CD137) could be used to capitalize on the immune-mediated effects of trastuzumab. We demonstrate that anti-PD-1 or anti-CD137 mAb can significantly improve the therapeutic activity of anti-ErbB-2 mAb in immunocompetent mice.

  8. Redefining face contour with a novel anti-aging cosmetic product: an open-label, prospective clinical study

    PubMed Central

    Garre, Aurora; Martinez-Masana, Gemma; Piquero-Casals, Jaime; Granger, Corinne

    2017-01-01

    Background Skin aging is accelerated by multiple extrinsic factors: ultraviolet radiation, smoking and pollution increase oxidative activity, damaging cellular and extracellular components such as DNA, proteins, and lipids. With age, collagen and hyaluronic acid levels decline, resulting in loss of elasticity and moisture of the skin. Over time this damage leads to characteristic signs that make the skin look older: altered facial contour, sagging skin, wrinkles, and an uneven complexion. This study evaluated the anti-aging effects of a new facial cream formulated with carnosine, Alteromonas ferment extract, crosspolymer hyaluronic acid, and a tripeptide. Methods An open-label intra-individual study to assess the anti-aging efficacy of the investigational product in 33 women aged 45 to 65 years. The product was applied twice daily for 56 days. Facial contour and skin deformation, elasticity, hydration, and complexion were measured with specialized equipment at baseline and days 28 and 56. Additionally, subjects completed questionnaires at days 28 and 56 on the perceived efficacy and cosmetic characteristics of the product. Results After 56 days of use of the investigational product, a redefining effect was observed, with a significant decrease in sagging jawline (7%). Skin was significantly more hydrated (12%), firmer (29%), and more elastic (20%) (P<0.001 for all). On complexion assessment, skin texture (a measure of skin smoothness) and spots (brown and red skin lesions) also improved significantly (12% and 6% decrease, respectively). In the subjective self-evaluation, the majority of subjects reported that the skin was visibly tightened and more elastic, flexible, and moisturized (91%, 88%, 91%, and 90%, respectively). The product was well tolerated with no adverse events reported during the study. Conclusion This new cosmetic product demonstrated anti-aging effects after 56 days of use, most notably a redefined facial contour and improved complexion. It is a

  9. Redefining face contour with a novel anti-aging cosmetic product: an open-label, prospective clinical study.

    PubMed

    Garre, Aurora; Martinez-Masana, Gemma; Piquero-Casals, Jaime; Granger, Corinne

    2017-01-01

    Skin aging is accelerated by multiple extrinsic factors: ultraviolet radiation, smoking and pollution increase oxidative activity, damaging cellular and extracellular components such as DNA, proteins, and lipids. With age, collagen and hyaluronic acid levels decline, resulting in loss of elasticity and moisture of the skin. Over time this damage leads to characteristic signs that make the skin look older: altered facial contour, sagging skin, wrinkles, and an uneven complexion. This study evaluated the anti-aging effects of a new facial cream formulated with carnosine, Alteromonas ferment extract, crosspolymer hyaluronic acid, and a tripeptide. An open-label intra-individual study to assess the anti-aging efficacy of the investigational product in 33 women aged 45 to 65 years. The product was applied twice daily for 56 days. Facial contour and skin deformation, elasticity, hydration, and complexion were measured with specialized equipment at baseline and days 28 and 56. Additionally, subjects completed questionnaires at days 28 and 56 on the perceived efficacy and cosmetic characteristics of the product. After 56 days of use of the investigational product, a redefining effect was observed, with a significant decrease in sagging jawline (7%). Skin was significantly more hydrated (12%), firmer (29%), and more elastic (20%) ( P <0.001 for all). On complexion assessment, skin texture (a measure of skin smoothness) and spots (brown and red skin lesions) also improved significantly (12% and 6% decrease, respectively). In the subjective self-evaluation, the majority of subjects reported that the skin was visibly tightened and more elastic, flexible, and moisturized (91%, 88%, 91%, and 90%, respectively). The product was well tolerated with no adverse events reported during the study. This new cosmetic product demonstrated anti-aging effects after 56 days of use, most notably a redefined facial contour and improved complexion. It is a safe and effective anti-aging product.

  10. 27 CFR 20.147 - Labels on consumer-size containers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Labels on consumer-size containers. 20.147 Section 20.147 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... of Completely Denatured Alcohol § 20.147 Labels on consumer-size containers. (a) Each consumer-size...

  11. 27 CFR 20.147 - Labels on consumer-size containers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Labels on consumer-size containers. 20.147 Section 20.147 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... of Completely Denatured Alcohol § 20.147 Labels on consumer-size containers. (a) Each consumer-size...

  12. [Contralateral hepatic hypertrophy following unilateral yttrium-90 radioembolization : Implications for liver surgery].

    PubMed

    Garlipp, B; Seidensticker, M; Jechorek, D; Ptok, H; Bruns, C J; Ricke, J

    2016-05-01

    Preservation of an adequate future liver remnant (FLR) is the principal limitation to liver surgery in patients with primary or secondary liver malignancies. Hence, methods to increase the volume of the FLR in preparation for liver resection are gaining in importance. In addition to the traditional methods for induction of FLR hypertrophy, such as portal vein embolization (PVE) or portal vein ligation (PVL) with or without parenchymal dissection (ALPPS, in situ split), radioembolization (RE) using yttrium-90 microspheres also leads to a volume increase of non-embolized liver parenchyma. This review outlines its potential role as an alternative procedure for induction of liver hypertrophy. Synopsis and critical discussion of the available literature on the mechanisms of induction of liver hypertrophy, the advantages and drawbacks of the traditional methods, and current research on volume changes associated with RE as well as their implications for possible clinical use in preparation for liver surgery. Both PVE and PVL can achieve a substantial contralateral volume gain of up to 70 %. The development of contralateral hypertrophy can be accelerated by dissecting the liver parenchyma along the intended plane of resection in addition to PVL (in situ split). Compared to these methods, RE achieves less contralateral liver hypertrophy; however, this effect should not be disregarded as RE provides effective treatment of ipsilateral liver tumors along with induction of hypertrophy and may be associated with a reduced risk of tumor progression compared to PVE and PVL. The available data suggest that RE can complement the armamentarium of methods for induction of FLR hypertrophy in specific situations. Further studies are needed to establish its definitive role for this indication and are in preparation.

  13. Targeting CD47 Enhances the Efficacy of Anti-PD-1 and CTLA-4 in an Esophageal Squamous Cell Cancer Preclinical Model.

    PubMed

    Tao, Hua; Qian, Pudong; Wang, Feijiang; Yu, Hongliang; Guo, Yesong

    2017-11-02

    Esophageal squamous cell cancer is a highly aggressive cancer with a dismal 5-year survival rate. CD47 is a cell transmembrane protein that is involved in cell apoptosis, proliferation, adhesion, migration, and antigen presentation in the immune system. By interacting with signal regulatory protein-α expressed in antigen-presenting cells (APCs), CD47 acts as an antiphagocytic mechanism to inhibit APC-dependent antigen presentation. Overexpression of CD47 was found in various types of cancer. However, its role in esophageal squamous cell cancer is not yet clear. Anti-CD47 is an antagonist of CD47 signaling pathways by competing with its ligand. In the current study, we investigated the effects of anti-CD47 treatment on the antitumor immune response in an esophageal squamous cell cancer preclinical model. We found that anti-CD47 treatment enhanced proinflammatory responses and increased CD8+ T-cell infiltration in tumor tissue in the animal model. T cells in anti-CD47-treated tumors showed higher PD-1 and CTLA-4 expression, indicating T-cell activation and the rationale of combining anti-CD47 with anti-PD-1 and CLTA-4. The combinatory treatment showed the best antitumor response, implying a novel treatment strategy. The effects of anti-CD47 depended on dendritic cell function. In patient samples, expression of CD47 was negatively correlated with CD8+ T-cell infiltration in esophageal squamous cell cancer patients. Taken together, CD47 might be a novel target to enhance anti-PD-1 and CLTA-4 efficacy in esophageal squamous cell cancer.

  14. Anti-CD3 Antibody Treatment Induces Hypoglycemia and Super Tolerance to Glucose Challenge in Mice through Enhancing Glucose Consumption by Activated Lymphocytes

    PubMed Central

    Chernatynskaya, Anna V.; Looney, Benjamin; Wan, Suigui; Clare-Salzler, Michael J.

    2014-01-01

    Anti-CD3 antibody has been employed for various immune-mediated disorders. However, whether anti-CD3 administration leads to rapid metabolic alternation has not been well investigated. In the current study, we studied how anti-CD3 treatment affected blood glucose levels in mice. We found that anti-CD3 treatment induced immediate reduction of blood glucose after administration. Furthermore, a single dose of anti-CD3 treatment corrected hyperglycemia in all nonobese diabetic mice with recently diagnosed diabetes. This glucose-lowering effect was not attributable to major T cell produced cytokines. Of interest, when tested in a normal strain of mice (C57BL/6), the serum levels of C-peptide in anti-CD3 treated animals were significantly lower than control mice. Paradoxically, anti-CD3 treated animals were highly tolerant to exogenous glucose challenge. Additionally, we found that anti-CD3 treatment significantly induced activation of T and B cells in vitro and in vivo. Further studies demonstrated that anti-CD3 treatment lowered the glucose levels in T cell culture media and increased the intracellular transportation of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2 deoxyglucose (2-NBDG) particularly in activated T and B cells. In addition, injection of anti-CD3 antibodies induced enhanced levels of Glut1 expression in spleen cells. This study suggests that anti-CD3 therapy-induced hypoglycemia likely results from increased glucose transportation and consumption by the activated lymphocytes. PMID:24741590

  15. High soluble CD30 levels and associated anti-HLA antibodies in patients with failed renal allografts.

    PubMed

    Karahan, Gonca E; Caliskan, Yasar; Ozdilli, Kursat; Kekik, Cigdem; Bakkaloglu, Huseyin; Caliskan, Bahar; Turkmen, Aydin; Sever, Mehmet S; Oguz, Fatma S

    2017-01-13

    Serum soluble CD30 (sCD30), a 120-kD glycoprotein that belongs to the tumor necrosis factor receptor family, has been suggested as a marker of rejection in kidney transplant patients. The aim of this study was to evaluate the relationship between sCD30 levels and anti-HLA antibodies, and to compare sCD30 levels in patients undergoing hemodialysis (HD) with and without failed renal allografts and transplant recipients with functioning grafts. 100 patients undergoing HD with failed grafts (group 1), 100 patients undergoing HD who had never undergone transplantation (group 2), and 100 kidney transplant recipients (group 3) were included in this study. Associations of serum sCD30 levels and anti-HLA antibody status were analyzed in these groups. The sCD30 levels of group 1 and group 2 (154 ± 71 U/mL and 103 ± 55 U/mL, respectively) were significantly higher than those of the transplant recipients (group 3) (39 ± 21 U/mL) (p<0.001 and p<0.001). The serum sCD30 levels in group 1 (154 ± 71 U/mL) were also significantly higher than group 2 (103 ± 55 U/mL) (p<0.001). Anti-HLA antibodies were detected in 81 (81%) and 5 (5%) of patients in groups 1 and 2, respectively (p<0.001). When multiple regression analysis was performed to predict sCD30 levels, the independent variables in group 1 were the presence of class I anti-HLA antibodies (β = 0.295; p = 0.003) and age (β = -0.272; p = 0.005), and serum creatinine (β = 0.218; p = 0.027) and presence of class II anti-HLA antibodies (standardized β = 0.194; p = 0.046) in group 3. Higher sCD30 levels and anti-HLA antibodies in patients undergoing HD with failed renal allografts may be related to higher inflammatory status in these patients.

  16. Proximity labeling of cis-ligands of CD22/Siglec-2 reveals stepwise α2,6 sialic acid-dependent and -independent interactions.

    PubMed

    Alborzian Deh Sheikh, Amin; Akatsu, Chizuru; Imamura, Akihiro; Abdu-Allah, Hajjaj H M; Takematsu, Hiromu; Ando, Hiromune; Ishida, Hideharu; Tsubata, Takeshi

    2018-01-01

    Lectins expressed on the cell surface are often bound and regulated by the membrane molecules containing the glycan ligands on the same cell (cis-ligands). However, molecular nature and function of cis-ligands are generally poorly understood partly because of weak interaction between lectins and glycan ligands. Cis-ligands are most extensively studied in CD22 (also known as Siglec-2), an inhibitory B lymphocyte receptor specifically recognizing α2,6 sialic acids. CD22, CD45 and IgM are suggested to be ligands of CD22. Here we labeled molecules in the proximity of CD22 in situ on B cell surface using biotin-tyramide. Molecules including CD22, CD45 and IgM were labeled in wild-type but not ST6GalI -/- B cells that lack α2,6 sialic acids, indicating that these molecules associate with CD22 by lectin-glycan interaction, and are therefore cis-ligands. In ST6GalI -/- B cells, these cis-ligands are located in a slightly more distance from CD22. Thus, the lectin-glycan interaction recruits cis-ligands already located in the relative proximity of CD22 through non-lectin-glycan interaction to the close proximity. Moreover, cis-ligands are labeled in Cmah -/- B cells that lack Neu5Gc preferred by mouse CD22 as efficiently as in wild-type B cells, indicating that very low affinity lectin-glycan interaction is sufficient for recruiting cis-ligands, and can be detected by proximity labeling. Thus, proximity labeling with tyramide appears to be a useful method to identify cis-ligands and to analyze their interaction with the lectins. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. CCR 20th anniversary commentary: Radioactive Drones for B-cell lymphoma.

    PubMed

    Knox, Susan J; Levy, Ronald

    2015-02-01

    In a study published in the March 1, 1996, issue of Clinical Cancer Research, Knox and colleagues (1) demonstrated the safety and efficacy of Yttirium-90 ((90)Y)-anti-CD20 monoclonal antibody therapy, as well as the benefit of preinfusion of unlabeled antibody on radiolabeled antibody biodistribution. Subsequent clinical trials with this radiolabeled antibody led to regulatory approval of this treatment for B-cell lymphoma. See related article by Knox et al., Clin Cancer Res 1996;2(3) Mar 1996; 457-70. ©2015 American Association for Cancer Research.

  18. Increased anti-tumor effects using IL2 with anti-TGFβ reveals competition between mouse NK and CD8 T cells

    PubMed Central

    Alvarez, Maite; Bouchlaka, Myriam N.; Sckisel, Gail D.; Sungur, Can M.; Chen, Mingyi; Murphy, William J.

    2014-01-01

    Due to increasing interest in the removal of immunosuppressive pathways in cancer, the combination of IL2 with antibodies to neutralize TGFβ, a potent immunosuppressive cytokine, was assessed. Combination immunotherapy resulted in significantly greater anti-tumor effects. These were correlated with significant increases in the numbers and functionality of NK cells, NK progenitors and activated CD8 T cells resulting in the observed anti-tumor effects. Combination immunotherapy was also accompanied with lesser toxicities than IL2 therapy alone. Additionally, we observed a dual competition between NK and activated CD8 T cells such that after immunotherapy, the depletion of either effector population resulted in the increased total expansion of the other population and compensatory anti-tumor effects. This study demonstrates the efficacy of this combination immunotherapeutic regimen as a promising cancer therapy and illustrates the existence of potent competitive regulatory pathways between NK and CD8 T cells in response to systemic activation. PMID:25000978

  19. Enhanced anti-tumour immunity requires the interplay between resident and circulating memory CD8+ T cells

    PubMed Central

    Enamorado, Michel; Iborra, Salvador; Priego, Elena; Cueto, Francisco J.; Quintana, Juan A.; Martínez-Cano, Sarai; Mejías-Pérez, Ernesto; Esteban, Mariano; Melero, Ignacio; Hidalgo, Andrés; Sancho, David

    2017-01-01

    The goal of successful anti-tumoural immunity is the development of long-term protective immunity to prevent relapse. Infiltration of tumours with CD8+ T cells with a resident memory (Trm) phenotype correlates with improved survival. However, the interplay of circulating CD8+ T cells and Trm cells remains poorly explored in tumour immunity. Using different vaccination strategies that fine-tune the generation of Trm cells or circulating memory T cells, here we show that, while both subsets are sufficient for anti-tumour immunity, the presence of Trm cells improves anti-tumour efficacy. Transferred central memory T cells (Tcm) generate Trm cells following viral infection or tumour challenge. Anti-PD-1 treatment promotes infiltration of transferred Tcm cells within tumours, improving anti-tumour immunity. Moreover, Batf3-dependent dendritic cells are essential for reactivation of circulating memory anti-tumour response. Our findings show the plasticity, collaboration and requirements for reactivation of memory CD8+ T cells subsets needed for optimal tumour vaccination and immunotherapy. PMID:28714465

  20. Influence of Yttrium Ion-Implantation on the Growth Kinetics and Micro-Structure of NiO Oxide Film

    NASA Astrophysics Data System (ADS)

    Jin, Huiming; Adriana, Felix; Majorri, Aroyave

    2008-02-01

    Isothermal and cyclic oxidation behaviours of pure and yttrium-implanted nickel were studied at 1000°C in air. Scanning electronic microscopy (SEM) and transmission electronic microscopy (TEM) were used to examine the micro-morphology and structure of oxide scales formed on the nickel substrate. It was found that Y-implantation significantly improved the anti-oxidation ability of nickel in both isothermal and cyclic oxidizing experiments. Laser Raman microscopy was also used to study the stress status of oxide scales formed on nickel with and without yttrium. The main reason for the improvement in anti-oxidation of nickel was that Y-implantation greatly reduced the growing speed and grain size of NiO. This fine-grained NiO oxide film might have better high temperature plasticity and could relieve parts of compressive stress by means of creeping, and maintained a ridge character and a relatively low internal stress level. Hence yttrium ion-implantation remarkably enhanced the adhesion of protective NiO oxide scale formed on the nickel substrate.

  1. Gene transfer of Hodgkin cell lines via multivalent anti-CD30 scFv displaying bacteriophage.

    PubMed

    Chung, Yoon-Suk A; Sabel, Katja; Krönke, Martin; Klimka, Alexander

    2008-04-16

    The display of binding ligands, such as recombinant antibody fragments, on the surface of filamentous phage makes it possible to specifically attach these phage particles to target cells. After uptake of the phage, their internal single-stranded DNA is processed by the host cell, which allows transient expression of an encoded eukaryotic gene cassette. This opens the possibility to use bacteriophage as vectors for targeted gene therapy, although the transduction efficiency is very low. Here we demonstrate the display of an anti-CD30 single chain variable fragment fused to the major coat protein pVIII on the surface of bacteriophage. These phage particles showed an improved binding and transduction efficiency of CD30 positive Hodgkin-lymphoma cells, compared to bacteriophage with the anti-CD30 single chain variable fragment fused to the minor coat protein pIII. We can conclude from the results that the postulated multivalency of the anti-CD30-pVIII displaying bacteriophage combined with disseminated display of the anti-CD30 scFv on the whole particle surface is responsible for the improved gene transfer rate. These results mark an important step towards the use of phage particles as a cheap and safe gene transfer vehicle for the gene delivery of the desired target cells via their specific surface receptors.

  2. CMC-544 (inotuzumab ozogamicin), an anti-CD22 immuno-conjugate of calicheamicin, alters the levels of target molecules of malignant B-cells.

    PubMed

    Takeshita, A; Yamakage, N; Shinjo, K; Ono, T; Hirano, I; Nakamura, S; Shigeno, K; Tobita, T; Maekawa, M; Kiyoi, H; Naoe, T; Ohnishi, K; Sugimoto, Y; Ohno, R

    2009-07-01

    We studied the effect of CMC-544, the calicheamicin-conjugated anti-CD22 monoclonal antibody, used alone and in combination with rituximab, analyzing the quantitative alteration of target molecules, that is, CD20, CD22, CD55 and CD59, in Daudi and Raji cells as well as in cells obtained from patients with B-cell malignancies (BCM). Antibody inducing direct antiproliferative and apoptotic effect, complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC) were tested separately. In Daudi and Raji cells, the CDC effect of rituximab significantly increased within 12 h following incubation with CMC-544. The levels of CD22 and CD55 were significantly reduced (P<0.001 in both cells) after incubation with CMC-544, but CD20 level remained constant or increased for 12 h. Similar results were obtained in cells from 12 patients with BCM. The antiproliferative and apoptotic effect of CMC-544 were greater than that of rituximab. The ADCC of rituximab was not enhanced by CMC-544. Thus, the combination of CMC-544 and rituximab increased the in vitro cytotoxic effect in BCM cells, and sequential administration for 12 h proceeded by CMC-544 was more effective. The reduction of CD55 and the preservation of CD20 after incubation with CMC-544 support the rationale for the combined use of CMC-544 and rituximab.

  3. Treatment of conjunctival lymphomas by beta-ray brachytherapy using a strontium-90-yttrium-90 applicator.

    PubMed

    Regueiro, C A; Valcárcel, F J; Romero, J; de la Torre, A

    2002-12-01

    We reviewed the outcome of the 10 patients (13 eyes) with localized, biopsy-proven, low-grade lymphoma of the conjunctiva treated at our Department between 1988 and 1997. All patients were treated by beta-ray brachytherapy using a bidirectional 90Sr-90Y ophthalmic applicator (Applicator SIA 2, Amersham plc). Total doses, prescribed at the surface of the applicator, varied between 40 Gy and 80 Gy. With a median follow-up of 78 months (range: 14 to 146 months), seven patients remained with no evidence of relapse (67.5% 10 year disease free survival). Local control was achieved in 10 out of 13 eyes (76.9%). Two of the three local relapses were marginal. One of these three patients also developed a metachronous lymphoma in the contralateral conjunctiva. These three patients underwent a second course of brachytherapy with 90Sr/90Y and remained free of second relapse 109, 68 and 33 months after salvage therapy. No cases of systemic relapse were observed. Late (LENT-SOMA) complications were of grade 2 in five eyes, of grade 3 in one eye and of grade 4 in one eye. Late complications of grade 2 or higher were observed in one out of five patients (20%) treated with doses lower or equal to 50 Gy and in six out of eight patients (75%) treated with doses higher than 50 Gy (P=0.086). Our data indicates that beta-ray brachytherapy was ultimately able to control most conjunctival lymphomas but carried a risk of late complications and marginal relapses that was possibly higher than the rates reported for other radiotherapy techniques.

  4. Factors associated with increased incidence of severe toxicities following yttrium-90 resin microspheres in the treatment of hepatic malignancies.

    PubMed

    Roberson Ii, John D; McDonald, Andrew M; Baden, Craig J; Lin, Chee Paul; Jacob, Rojymon; Burnett Iii, Omer L

    2016-03-14

    To further define variables associated with increased incidences of severe toxicities following administration of yttrium-90 ((90)Y) microspheres. Fifty-eight patients undergoing 79 treatments were retrospectively assessed for development of clinical and laboratory toxicity incidence following (90)Y administration. Severe toxicity events were defined using Common Terminology Criteria for Adverse Events version 4.03 and defined as grade ≥ 3. Univariate logistic regression analyses were used to evaluate the effect of different factors on the incidence of severe toxicity events. Multicollinearity was assessed for all factors with P < 0.1 using Pearson correlation matrices. All factors not excluded due to multicollinearity were included in a multivariate logistic regression model for each measurement of severe toxicity. Severe (grade ≥ 3) toxicities occurred following 21.5% of the 79 treatments included in our analysis. The most common severe laboratory toxicities were severe alkaline phosphatase (17.7%), albumin (12.7%), and total bilirubin (10.1%) toxicities. Decreased pre-treatment albumin (OR = 26.2, P = 0.010) and increased pre-treatment international normalized ratio (INR) (OR = 17.7, P = 0.048) were associated with development of severe hepatic toxicity. Increased pre-treatment aspartate aminotransferase (AST; OR = 7.4, P = 0.025) and decreased pre-treatment hemoglobin (OR = 12.5, P = 0.025) were associated with severe albumin toxicity. Increasing pre-treatment model for end-stage liver disease (MELD) score (OR = 1.8, P = 0.033) was associated with severe total bilirubin toxicity. Colorectal adenocarcinoma histology was associated with severe alkaline phosphatase toxicity (OR = 5.4, P = 0.043). Clinicians should carefully consider pre-treatment albumin, INR, AST, hemoglobin, MELD, and colorectal histology when choosing appropriate candidates for (90)Y microsphere therapy.

  5. The P20R mutation of αB-crystallin diminishes its anti-apoptotic activity in human lens epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Peiran; Li, Weiwei; Ni, Mengxia

    αB-crystallin acts as an anti-apoptosis protein in human lens epithelial (HLE) cells. We recently identified a missense mutation in αB-crystallin that changes proline 20 to an arginine (P20R) in a Chinese family with autosomal dominant congenital posterior polar cataract. The impact of the P20R mutation on the anti-apoptosis function remains unclear. To explore the anti-apoptotic activity of αB-crystallin wild type (αB-wt) and its P20R mutant under oxidative stress, HLE cells were transfected with αB-wt and αB-P20R constructs and expression was measured by western blotting. Flow cytometry and terminal deoxynucleotidyl transferase (TdT)-mediated dUTP digoxigenin nick end-labelling (TUNEL) staining were performed tomore » investigate apoptosis. We found that αB-wt performed a dominant role in inhibiting stress-induced apoptosis, but this function was impeded in cells expressing αB-P20R. The P20R mutant of αB-crystallin exhibits diminished anti-apoptotic activity compared with the native protein. - Highlights: • We identified a novel mutation (P20R) in αB-crystallin. • The mutation decreased anti-apoptotic activity in αB-crystallin, which compared with the native protein. • We speculate that the mutation may influence phosphorylation, especially Ser19.« less

  6. 40 CFR 90.909 - Export exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Export exemptions. 90.909 Section 90... of Nonroad Engines from Regulations § 90.909 Export exemptions. (a) A new nonroad engine intended solely for export, and so labeled or tagged on the outside of the container and on the engine itself, is...

  7. CD27/CD70, CD134/CD134 ligand, and CD30/CD153 pathways are independently essential for generation of regulatory cells after intratracheal delivery of alloantigen.

    PubMed

    Aramaki, Osamu; Shirasugi, Nozomu; Akiyama, Yoshinobu; Shibutani, Shintaro; Takayama, Tadatoshi; Shimazu, Motohide; Kitajima, Masaki; Ikeda, Yoshifumi; Okumura, Ko; Yagita, Hideo; Niimi, Masanori

    2003-09-15

    We investigated whether blockade of tumor necrosis factor receptor-ligand pathways could generate regulatory cells induced by intratracheal delivery of alloantigen. CBA (H-2k) mice were pretreated with intratracheal delivery of splenocytes (1x10(7)) from C57BL/10 (H-2b) mice and intraperitoneal administration of monoclonal antibody (mAb) specific for CD70, CD134 ligand (CD134L), CD153, or CD137L. Seven days later, C57BL/10 hearts were transplanted into pretreated CBA mice. Some naive CBA mice underwent adoptive transfer of splenocytes (5x10(7)) from pretreated CBA mice and transplantation of a C57BL/10 heart on the same day. Untreated CBA mice rejected C57BL/10 cardiac grafts acutely (median survival time [MST] 12 days). Pretreatment with intratracheal delivery of C57BL/10 donor splenocytes prolonged graft survival significantly (MST 84 days). Mice given intratracheal delivery of alloantigen plus anti-CD70, anti-CD134L, or anti-CD153 mAb, but not those given intratracheal delivery of alloantigen plus anti-CD137L mAb, rejected their graft acutely (MST 16, 14, 10, and 65 days, respectively). Adoptive transfer of splenocytes from mice pretreated with intratracheal delivery of alloantigen plus anti-CD70, CD134L, or CD153 mAb did not prolong survival of C57BL/10 cardiac grafts in naive secondary CBA recipients (MST 14, 11, and 11 days, respectively), whereas adoptive transfer of splenocytes from mice given intratracheal delivery of alloantigen plus anti-CD137L mAb did (MST 75 days). The CD27/CD70, CD134/CD134L, and CD30/CD153 pathways are independently required for generation of regulatory cells in our model.

  8. 46 CFR 195.11-20 - Marking and label plate.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Marking and label plate. 195.11-20 Section 195.11-20 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS VESSEL... plate. (a) All vans shall be provided with a label plate stating light weight, gross weight, and power...

  9. Electrochemical magneto-actuated biosensor for CD4 count in AIDS diagnosis and monitoring.

    PubMed

    Carinelli, S; Xufré Ballesteros, C; Martí, M; Alegret, S; Pividori, M I

    2015-12-15

    The counting of CD4(+) T lymphocytes is a clinical parameter used for AIDS diagnosis and follow-up. As this disease is particularly prevalent in developing countries, simple and affordable CD4 cell counting methods are urgently needed in resource-limited settings. This paper describes an electrochemical magneto-actuated biosensor for CD4 count in whole blood. The CD4(+) T lymphocytes were isolated, preconcentrated and labeled from 100 μL of whole blood by immunomagnetic separation with magnetic particles modified with antiCD3 antibodies. The captured cells were labeled with a biotinylated antiCD4 antibody, followed by the reaction with the electrochemical reporter streptavidin-peroxidase conjugate. The limit of detection for the CD4 counting magneto-actuated biosensor in whole blood was as low as 44 cells μL(-1) while the logistic range was found to be from 89 to 912 cells μL(-1), which spans the whole medical interest range for CD4 counts in AIDS patients. The electrochemical detection together with the immunomagnetic separation confers high sensitivity, resulting in a rapid, inexpensive, robust, user-friendly method for CD4 counting. This approach is a promising alternative for the costly standard flow cytometry and suitable as diagnostic tool at decentralized practitioner sites in low resource settings, especially in less developed countries. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Phosphatase inhibition augments anti-CD22-mediated signaling and cytotoxicity in non-hodgkin's lymphoma cells.

    PubMed

    O'Donnell, Robert T; Pearson, David; McKnight, Hayes C; Ma, Ya Peng; Tuscano, Joseph M

    2009-07-01

    CD22 is a cell-surface molecule found on most B-cell lymphomas (NHL). HB22.7 is an anti-CD22 antibody that blocks CD22 ligand binding, initiates signaling, and kills NHL cells. The SHP-1 tyrosine phosphatase is disproportionately associated with the cytoplasmic domain of CD22. Sodium orthovanadate (NaV) and dephostatin (DP) are phosphatase inhibitors. The interaction of SHP-1 with CD22 presents an opportunity to manipulate CD22-mediated signaling effects. NaV caused dose dependent killing of NHL cells in vitro; when HB22.7 was given with NaV, antibody-mediated cell death increased. NaV caused a substantial increase in CD22-mediated SAPK and ERK-1/2 activation when CD22 was crosslinked by HB22.7; NaV did not significantly affect IgM-mediated signals. Studies using Raji NHL cells stably transfected with a SHP-1 dominant negative (DN) confirmed that these observations were due to SHP-1 inhibition. The relatively specific association of SHP-1 with CD22 suggests that CD22-specific signaling may be altered by phosphatase inhibition in ways that could prove useful for anti-CD22-based immunotherapy.

  11. [Treatment of idiopathic membranous nephropathy. Is the anti-CD20 antibody rituximab a reasonable option?].

    PubMed

    Busch, Martin; Gerth, Jens; Ott, Undine; Schip, Andre; Haufe, Christoph C; Gröne, Hermann-Josef; Wolf, Gunter

    2008-07-15

    Membranous nephropathy (MN) is characterized by proteinuria and other symptoms of the nephrotic syndrome. In many cases, the etiology is unknown. Whether and how to treat MN is still a controversial question. Despite the use of corticosteroids and alkylating agents, up to 40% of patients still progress to end-stage renal failure. A 40-year-old male patient with biopsy-proven idiopathic MN was initially treated with prednisolone and chlorambucil because of a proteinuria of 22 g/d. Treatment with cyclosporine was started because the nephrotic syndrome failed to improve. Proteinuria was reduced to a minimum of 4 g/d. Cyclosporine was stopped after 17 months leading to a fast relapse. Therapy with an ACE inhibitor and AT(1) receptor antagonist and retreatment with cyclosporine improved proteinuria. Cyclosporine was terminated after a total of 24 months. 5 months later, relapse occurred with a high proteinuria of 34 g/d. The monoclonal anti-CD20 antibody rituximab (375 mg/m(2)) was given four times every 4 weeks. 4 weeks and 4 months after the end of treatment, proteinuria decreased to 780 mg/d and <150 mg/d, but renal function remained impaired (creatinine clearance 65 ml/min, stage 2 according to K/DOQI). Now, remission of proteinuria (<150 mg/d) has been stable for almost 2 years. However, renal insufficiency progressed further (creatinine clearance 45 ml/min, stage 3 according to K/DOQI). Rituximab offers the possibility for a targeted treatment of idiopathic MN. Based on the existing evidence and experience from this case, rituximab can be recommended as a new treatment option for MN, possibly before starting any treatment with cytotoxic agents and high-dose prednisolone carrying the risk of severe side effects. However, long-term results of this treatment are still lacking.

  12. Anti-apoptotic effect of heat shock protein 90 on hypoxia-mediated cardiomyocyte damage is mediated via the phosphatidylinositol 3-kinase/AKT pathway.

    PubMed

    Wang, Wei; Peng, Yizhi; Wang, Yuanyuan; Zhao, Xiaohui; Yuan, Zhiqiang

    2009-09-01

    1. Hypoxia-induced cardiomyocyte apoptosis contributes significantly to cardiac dysfunction following trauma, shock and burn injury. There is evidence that heat shock protein (HSP) 90 is anti-apoptotic in cardiomyocytes subjected to a variety of apoptotic stimuli. Because HSP90 acts as an upstream regulator of the serine/threonine protein kinase Akt survival pathway during cellular stress, we hypothesized that HSP90 exerts a cardioprotective effect via the phosphatidylinositol 3-kinase (PI3-K)/Akt pathway. 2. Neonatal rat cardiomyocytes were subjected to normoxia or hypoxia in the absence or presence of the HSP90 inhibitor geldanamycin (1 μg/mL). Cardiomyocyte apoptosis was assessed by release of lactate dehydrogenase (LDH), terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labelling (TUNEL) staining and caspase 3 activity. Expression of HSP90, Akt, Bad and cytochrome c release was determined by western blot analysis. 3. Following exposure of cells to hypoxia, HSP90 was markedly elevated in a time-dependent manner, reaching a peak at 6 h (eightfold increase). Geldanamycin significantly increased hypoxia-induced release of LDH by 114%, the percentage of apoptotic cardiomyocytes by 102% and caspase 3 activity by 78%. Pretreatment of cells with geldanamycin also suppressed phosphorylation of both Akt and its downstream target Bad, but promoted the mitochondrial release of cytochrome c. 4. In conclusion, HSP90 activity is enhanced in cardiomyocytes following hypoxic insult. The anti-apoptotic effect of HSP90 on cardiomyocytes subjected to hypoxia is mediated, at least in part, by the PI3-K/Akt pathway. Key words: apoptosis, cardiomyocyte, heart failure, heat shock protein 90, hypoxia, phosphatidylinositol 3-kinase/Akt signalling pathway, serine/threonine protein kinase Akt.

  13. Quantitative Comparison of PET and Bremsstrahlung SPECT for Imaging the In Vivo Yttrium-90 Microsphere Distribution after Liver Radioembolization

    PubMed Central

    Elschot, Mattijs; Vermolen, Bart J.; Lam, Marnix G. E. H.; de Keizer, Bart; van den Bosch, Maurice A. A. J.; de Jong, Hugo W. A. M.

    2013-01-01

    Background After yttrium-90 (90Y) microsphere radioembolization (RE), evaluation of extrahepatic activity and liver dosimetry is typically performed on 90Y Bremsstrahlung SPECT images. Since these images demonstrate a low quantitative accuracy, 90Y PET has been suggested as an alternative. The aim of this study is to quantitatively compare SPECT and state-of-the-art PET on the ability to detect small accumulations of 90Y and on the accuracy of liver dosimetry. Methodology/Principal Findings SPECT/CT and PET/CT phantom data were acquired using several acquisition and reconstruction protocols, including resolution recovery and Time-Of-Flight (TOF) PET. Image contrast and noise were compared using a torso-shaped phantom containing six hot spheres of various sizes. The ability to detect extra- and intrahepatic accumulations of activity was tested by quantitative evaluation of the visibility and unique detectability of the phantom hot spheres. Image-based dose estimates of the phantom were compared to the true dose. For clinical illustration, the SPECT and PET-based estimated liver dose distributions of five RE patients were compared. At equal noise level, PET showed higher contrast recovery coefficients than SPECT. The highest contrast recovery coefficients were obtained with TOF PET reconstruction including resolution recovery. All six spheres were consistently visible on SPECT and PET images, but PET was able to uniquely detect smaller spheres than SPECT. TOF PET-based estimates of the dose in the phantom spheres were more accurate than SPECT-based dose estimates, with underestimations ranging from 45% (10-mm sphere) to 11% (37-mm sphere) for PET, and 75% to 58% for SPECT, respectively. The differences between TOF PET and SPECT dose-estimates were supported by the patient data. Conclusions/Significance In this study we quantitatively demonstrated that the image quality of state-of-the-art PET is superior over Bremsstrahlung SPECT for the assessment of the 90Y

  14. Fenoterol, a beta(2)-adrenoceptor agonist, inhibits LPS-induced membrane-bound CD14, TLR4/CD14 complex, and inflammatory cytokines production through beta-arrestin-2 in THP-1 cell line.

    PubMed

    Wang, Wei; Xu, Ming; Zhang, You-yi; He, Bei

    2009-11-01

    To investigate the molecular mechanism and signaling pathway by which fenoterol, a beta(2)-adrenergic receptor (beta(2)-AR) agonist, produces anti-inflammatory effects. THP-1, a monocytic cell line, was used to explore the mechanism of beta(2)-AR stimulation in LPS-induced secretion of inflammatory cytokines and changes of toll-like receptors (TLRs). We labeled TLR4 and CD14 using monoclonal anti-TLR4 PE-conjugated and anti-CD14 FITC-conjugated antibodies in THP-1 cells stimulated by beta(2)-AR in the presence or absence of lipopolysaccharide (LPS) and small, interfering RNA (siRNA)-mediated knockdown of beta-arrestin-2, and then analyzed their changes in distribution by flow cytometry, Western blotting and confocal analysis. LPS-induced membrane-bound CD14, TLR4/CD14 complex levels and elevation of inflammatory cytokines were all significantly reduced by pre-incubation of fenoterol (P<0.05). However, the total level of CD14 and TLR4 was not significantly changed. Interestingly, confocal microscopy revealed redistribution of CD14 and TLR4/CD14 complex under beta(2)-AR stimulation. Furthermore, siRNA-mediated knockdown of beta-arrestin-2 eliminated the anti-inflammatory effects and redistribution of CD14 and TLR4/CD14 complex stimulated by beta(2)-AR. beta(2)-AR agonist exerts its anti-inflammatory effects by down-regulating TLR signaling in THP-1 cells, potentially resulting from beta-arrestin-2 mediated redistribution of CD14 and TLR14/CD14 complex.

  15. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4

    NASA Astrophysics Data System (ADS)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

    2016-03-01

    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

  16. A CCD-based reader combined with CdS quantum dot-labeled lateral flow strips for ultrasensitive quantitative detection of CagA

    NASA Astrophysics Data System (ADS)

    Gui, Chen; Wang, Kan; Li, Chao; Dai, Xuan; Cui, Daxiang

    2014-02-01

    Immunochromatographic assays are widely used to detect many analytes. CagA is proved to be associated closely with initiation of gastric carcinoma. Here, we reported that a charge-coupled device (CCD)-based test strip reader combined with CdS quantum dot-labeled lateral flow strips for quantitative detection of CagA was developed, which used 365-nm ultraviolet LED as the excitation light source, and captured the test strip images through an acquisition module. Then, the captured image was transferred to the computer and was processed by a software system. A revised weighted threshold histogram equalization (WTHE) image processing algorithm was applied to analyze the result. CdS quantum dot-labeled lateral flow strips for detection of CagA were prepared. One hundred sera samples from clinical patients with gastric cancer and healthy people were prepared for detection, which demonstrated that the device could realize rapid, stable, and point-of-care detection, with a sensitivity of 20 pg/mL.

  17. Anti-CD22-MCC-DM1: an antibody-drug conjugate with a stable linker for the treatment of non-Hodgkin's lymphoma.

    PubMed

    Polson, A G; Williams, M; Gray, A M; Fuji, R N; Poon, K A; McBride, J; Raab, H; Januario, T; Go, M; Lau, J; Yu, S-F; Du, C; Fuh, F; Tan, C; Wu, Y; Liang, W-C; Prabhu, S; Stephan, J-P; Hongo, J-A; Dere, R C; Deng, R; Cullen, M; de Tute, R; Bennett, F; Rawstron, A; Jack, A; Ebens, A

    2010-09-01

    Antibody-drug conjugates (ADCs) are potent cytotoxic drugs linked to antibodies through chemical linkers, and allow specific targeting of drugs to neoplastic cells. The expression of CD22 is limited to B-cells, and we show that CD22 is expressed on the vast majority of non-Hodgkin's lymphomas (NHLs). An ideal target for an ADC for the treatment of NHL would have limited expression outside the B-cell compartment and be highly effective against NHL. We generated an ADC consisting of a humanized anti-CD22 antibody conjugated to the anti-mitotic agent maytansine with a stable linker (anti-CD22-MCC-DM1). Anti-CD22-MCC-DM1 was broadly effective in in vitro killing assays on NHL B-cell lines. We did not find a strong correlation between in vitro potency and CD22 surface expression, internalization of ADC or sensitivity to free drug. We show that anti-CD22-MCC-DM1 was capable of inducing complete tumor regression in NHL xenograft mouse models. Further, anti-CD22-MCC-DM1 was well tolerated in cynomolgus monkeys and substantially decreased circulating B-cells as well as follicle size and germinal center formation in lymphoid organs. These results suggest that anti-CD22-MCC-DM1 has an efficacy, safety and pharmacodynamic profile that support its use as a treatment for NHL.

  18. Collaboration between tumor-specific CD4+ T cells and B cells in anti-cancer immunity.

    PubMed

    Guy, Thomas V; Terry, Alexandra M; Bolton, Holly A; Hancock, David G; Zhu, Erhua; Brink, Robert; McGuire, Helen M; Shklovskaya, Elena; Fazekas de St. Groth, Barbara

    2016-05-24

    The role of B cells and antibodies in anti-tumor immunity is controversial, with both positive and negative effects reported in animal models and clinical studies. We developed a murine B16.F10 melanoma model to study the effects of collaboration between tumor-specific CD4+ T cells and B cells on tumor control. By incorporating T cell receptor transgenic T cells and B cell receptor isotype switching B cells, we were able to track the responses of tumor-reactive T and B cells and the development of anti-tumor antibodies in vivo. In the presence of tumor-specific B cells, the number of tumor-reactive CD4+ T cells was reduced in lymphoid tissues and the tumor itself, and this correlated with poor tumor control. B cells had little effect on the Th1 bias of the CD4+ T cell response, and the number of induced FoxP3+ regulatory cells (iTregs) generated from within the original naive CD4+ T cell inoculum was unrelated to the degree of B cell expansion. In response to CD4+ T cell help, B cells produced a range of isotype-switched anti-tumor antibodies, principally IgG1, IgG2a/c and IgG2b. In the absence of CD4+ T cells, B cells responded to agonistic anti-CD40 administration by switching to production of IgG2a/c and, to a lesser extent, IgG1, IgG3, IgA and IgE, which reduced the number of lung metastases after i.v. tumor inoculation but had no effect on the growth of subcutaneous tumors.

  19. Anti-CD20 Radioimmunotherapy Before Chemotherapy and Stem Cell Transplant in Treating Patients With High-Risk B-Cell Malignancies

    ClinicalTrials.gov

    2018-03-13

    Burkitt Lymphoma; CD20-Positive Neoplastic Cells Present; Diffuse Large B-Cell Lymphoma; Indolent Non-Hodgkin Lymphoma; Mantle Cell Lymphoma; Recurrent B-Cell Non-Hodgkin Lymphoma; Refractory Mature B-Cell Non-Hodgkin Lymphoma

  20. Combination of an agonistic anti-CD40 monoclonal antibody and the COX-2 inhibitor celecoxib induces anti-glioma effects by promotion of type-1 immunity in myeloid cells and T-cells

    PubMed Central

    Kosaka, Akemi; Ohkuri, Takayuki

    2014-01-01

    Malignant gliomas are heavily infiltrated by immature myeloid cells that mediate immuno-suppression. Agonistic CD40 monoclonal antibody (mAb) has been shown to activate myeloid cells and promote antitumor immunity. Our previous study has also demonstrated blockade of cyclooxygenase-2 (COX-2) reduces immunosuppressive myeloid cells, thereby suppressing glioma development in mice. We therefore hypothesized that a combinatory strategy to modulate myeloid cells via two distinct pathways, i.e., CD40/CD40L stimulation and COX-2 blockade, would enhance anti-glioma immunity. We used three different mouse glioma models to evaluate therapeutic effects and underlying mechanisms of a combination regimen with an agonist CD40 mAb and the COX-2 inhibitor celecoxib. Treatment of glioma-bearing mice with the combination therapy significantly prolonged survival compared with either anti-CD40 mAb or celecoxib alone. The combination regimen promoted maturation of CD11b+ cells in both spleen and brain, and enhanced Cxcl10 while suppressing Arg1 in CD11b+Gr-1+ cells in the brain. Anti-glioma activity of the combination regimen was T-cell dependent because depletion of CD4+ and CD8+ cells in vivo abrogated the anti-glioma effects. Furthermore, the combination therapy significantly increased the frequency of CD8+ T-cells, enhanced IFN-γ-production and reduced CD4+CD25+Foxp3+ T regulatory cells in the brain, and induced tumor-antigen-specific T-cell responses in lymph nodes. Our findings suggest that the combination therapy of anti-CD40 mAb with celecoxib enhances anti-glioma activities via promotion of type-1 immunity both in myeloid cells and T-cells. PMID:24878890

  1. Comparison of two dosing schedules for subcutaneous injections of low-dose anti-CD20 veltuzumab in relapsed immune thrombocytopenia

    PubMed Central

    Liebman, Howard A.; Saleh, Mansoor N.; Bussel, James B.; Negrea, O. George; Horne, Heather; Wegener, William A.; Goldenberg, David M.

    2016-01-01

    We compared two dosing schedules for subcutaneous injections of a low-dose humanized anti-CD20 antibody, veltuzumab, in immune thrombocytopenia. Fifty adults with primary immune thrombocytopenia, in whom one or more lines of standard therapy had failed and who had a platelet count <30×109/L but no major bleeding, initially received escalating 80, 160, or 320 mg doses of subcutaneous veltuzumab administered twice, 2 weeks apart; the last group received once-weekly doses of 320 mg for 4 weeks. In all dose groups, injection reactions were transient and mild to moderate; there were no other safety issues. Forty-seven response-evaluable patients had 23 (49%) objective responses (platelet counts ≥30×109/L and ≥2 × baseline) including 15 (32%) complete responses (platelets ≥100×109/L). Responses (including complete responses) and bleeding reduction occurred in all dose groups and were not dose-dependent. In contrast, response duration increased progressively with total dose, reaching a median of 2.7 years with the four once-weekly 320-mg doses. Among nine responders retreated at relapse, three at higher dose levels responded again, including one patient who was retreated four times. In all dose groups, B-cell depletion occurred after the first dose until recovery starting 12 to 16 weeks after treatment. Veltuzumab serum levels increased with dose group according to total dose administered, but terminal half-life and clearance were comparable. Human anti-veltuzumab antibody titers developed without apparent dose dependence in nine patients, of whom six responded including five who had complete responses. Subcutaneous veltuzumab was convenient, well-tolerated, and active, without causing significant safety concerns. Platelet responses and bleeding reduction occurred in all dose groups, and response durability appeared to improve with higher doses. Clinicaltrials.gov identifier: NCT00547066 PMID:27515248

  2. A Novel Anti-CD22 Anthracycline-Based Antibody-Drug Conjugate (ADC) That Overcomes Resistance to Auristatin-Based ADCs.

    PubMed

    Yu, Shang-Fan; Zheng, Bing; Go, MaryAnn; Lau, Jeff; Spencer, Susan; Raab, Helga; Soriano, Robert; Jhunjhunwala, Suchit; Cohen, Robert; Caruso, Michele; Polakis, Paul; Flygare, John; Polson, Andrew G

    2015-07-15

    We are interested in identifying mechanisms of resistance to the current generation of antibody-drug conjugates (ADC) and developing ADCs that can overcome this resistance. Pinatuzumab vedotin (anti-CD22-vc-MMAE) and polatuzumab vedotin (anti-CD79b-vc-MMAE) are ADCs that contain the microtubule inhibitor monomethyl auristatin E (MMAE) attached to the antibody by the protease-cleavable linker maleimidocaproyl-valine-citrulline-p-aminobenzoyloxycarbonyl (MC-vc-PAB). Early clinical trial data suggest that these ADCs have promising efficacy for the treatment of non-Hodgkin lymphoma (NHL); however, some patients do not respond or become resistant to the ADCs. Anthracyclines are very effective in NHL, but ADCs containing the anthracycline doxorubicin were not clinically efficacious probably due to the low drug potency and inadequate linker technology. The anthracycline analogue PNU-159682 is thousands of times more cytotoxic than doxorubicin, so we used it to develop a new class of ADCs. We used the same MC-vc-PAB linker and antibody in pinatuzumab vedotin but replaced the MMAE with a derivative of PNU-159682 to make anti-CD22-NMS249 and tested it for in vivo efficacy in xenograft tumors resistant to MMAE-based ADCs. We derived cell lines from in vivo xenograft tumors that were made resistant to anti-CD22-vc-MMAE and anti-CD79b-vc-MMAE. We identified P-gp (ABCB1/MDR1) as the major driver of resistance to the vc-MMAE-based conjugates. Anti-CD22-NMS249 was at least as effective as anti-CD22-vc-MMAE in xenograft models of the parental cell lines and maintained its efficacy in the resistant cell lines. These studies provide proof of concept for an anthracycline-based ADC that could be used to treat B-cell malignancies that are resistant to vc-MMAE conjugates. ©2015 American Association for Cancer Research.

  3. Effectiveness of hsp90 inhibitors as anti-cancer drugs.

    PubMed

    Xiao, Li; Lu, Xiangyi; Ruden, Douglas M

    2006-10-01

    Hsp90 is a chaperone with over 100 identified client proteins. What makes Hsp90 especially promising as a target for anti-cancer drugs is that many of its client proteins are in signaling and chromatin-remodeling pathways, and these pathways are often disrupted in many types of cancers. Recently, it was determined that Hsp90 bound to a client protein in a co-chaperone complex has a higher ATPase activity and binds to the geldanamycin inhibitor with over 100-fold higher affinity than the low-ATPase form. Consequently, despite Hsp90 being an abundant protein in most cell types, Hsp90 inhibitors accumulate at high levels primarily in tumor cells because tumor cells are "oncogene addicted" and require especially high levels of the high-ATPase form of Hsp90. Numerous classes of Hsp90 inhibitors have recently been developed, such as the anasamysin geldanamycin and derivatives 17-AAG and 17-DMAG; the macrolide radicicol and derivatives; purine-scaffold derivatives; pyrazoles; and shepherdins that bind to the N-terminal high-affinity ATP-binding domain of Hsp90. Other inhibitors have recently been shown to bind to the C-terminal dimerization domain of Hsp90, such as cisplatin and novobiocin, or modify Hsp90 postranslationally, such as histone deacetylase or proteasome inhibitors. In this mini-review, we present hypothetical mechanisms for Hsp90 inhibitors in treating cancers, preliminary studies in early clinical trials, and potential tumor-killing and tumor-promoting activities of Hsp90 inhibitors.

  4. Atypical Activin A and IL-10 Production Impairs Human CD16+ Monocyte Differentiation into Anti-Inflammatory Macrophages.

    PubMed

    González-Domínguez, Érika; Domínguez-Soto, Ángeles; Nieto, Concha; Flores-Sevilla, José Luis; Pacheco-Blanco, Mariana; Campos-Peña, Victoria; Meraz-Ríos, Marco A; Vega, Miguel A; Corbí, Ángel L; Sánchez-Torres, Carmen

    2016-02-01

    Human CD14(++)CD16(-) and CD14(+/lo)CD16(+) monocyte subsets comprise 85 and 15% of blood monocytes, respectively, and are thought to represent distinct stages in the monocyte differentiation pathway. However, the differentiation fates of both monocyte subsets along the macrophage (Mϕ) lineage have not yet been elucidated. We have now evaluated the potential of CD14(++) CD16(-) and CD16(+) monocytes to differentiate and to be primed toward pro- or anti-inflammatory Mϕs upon culture with GM-CSF or M-CSF, respectively (subsequently referred to as GM14, M14, GM16, or M16). Whereas GM16 and GM14 were phenotypic and functionally analogous, M16 displayed a more proinflammatory profile than did M14. Transcriptomic analyses evidenced that genes associated with M-CSF-driven Mϕ differentiation (including FOLR2, IL10, IGF1, and SERPINB2) are underrepresented in M16 with respect to M14. The preferential proinflammatory skewing of M16 relative to M14 was found to be mediated by the secretion of activin A and the low levels of IL-10 produced by M16. In fact, activin A receptor blockade during the M-CSF-driven differentiation of CD16(+) monocytes, or addition of IL-10-containing M14-conditioned medium, significantly enhanced their expression of anti-inflammatory-associated molecules while impairing their acquisition of proinflammatory-related markers. Thus, we propose that M-CSF drives CD14(++)CD16- monocyte differentiation into bona fide anti-inflammatory Mϕs in a self-autonomous manner, whereas M-CSF-treated CD16(+) monocytes generate Mϕs with a skewed proinflammatory profile by virtue of their high activin A expression unless additional anti-inflammatory stimuli such as IL-10 are provided. Copyright © 2016 by The American Association of Immunologists, Inc.

  5. Decrease of peritoneal inflammatory CD4(+), CD8(+), CD19(+) lymphocytes and apoptosis of eosinophils in a murine Taenia crassiceps infection.

    PubMed

    Zepeda, Nadia; Solano, Sandra; Copitin, Natalia; Fernández, Ana María; Hernández, Lilián; Tato, Patricia; Molinari, José L

    2010-10-01

    After an intraperitoneal infection of mice with Taenia crassiceps metacestodes, peritoneal inflammatory cells labeled with fluoresceinated MoAb anti-mouse were analyzed by flow cytometry. Apoptosis was studied by annexin A/PI, TUNEL assays, DNA laddering, caspase-3 activity, and electron microscopy. An important continuous decrease of CD4+, CD8+ and CD19+ lymphocytes, and an increase of eosinophils and macrophages throughout the observation time were found. Apoptosis of eosinophils was quantified during the observation period with a peak at 6 days post-infection (67.27%). In an additional experiment at 12 days post-infection using TUNEL staining, a high level of apoptosis of eosinophil (92.3%) and a significant decrease of CD4+, CD8+, and CD19+ lymphocytes were confirmed. Caspase-3 activity in peritoneal fluid, peritoneal cells' DNA fragmentation, and apoptosis of eosinophils and monocytes were found. The dramatic decrease of peritoneal inflammatory T and B cells and the high level of apoptosis of inflammatory eosinophils induced in mice by infection with T. crassiceps cysticerci may be important factors of the immunosuppression observed in cysticercosis.

  6. Serotonin-Labeled CdSe Nanocrystals: Applications for Neuroscience

    NASA Astrophysics Data System (ADS)

    Kippeny, Tadd; Adkins, Erika; Adams, Scott; Thomlinson, Ian; Schroeter, Sally; Defelice, Louis; Blakely, Randy; Rosenthal, Sandra

    2000-03-01

    Serotonin (5-hydroxytryptamine, 5-HT) is an important neurotransmitter which has been linked to the regulation of critical behaviors including sleep, appetite, and mood. The serotonin transporter (SERT) is a 12-transmembrane domain protein responsible for clearance of serotonin from extracellular spaces following release. In order to assess the potential for use of ligand-conjugated nanocrystals to target cell surface receptors, ion channels, and transporters we have measured the ability of serotonin-labeled CdSe nanocrystals (SNACs) to block the uptake of tritiated serotonin by the human and Drosophila serotonin transporters (hSERT and dSERT). Estimated Ki values, the SNAC concentration at which half of the serotonin transport activity is blocked, were determined by nonlinear regression to be Ki (hSERT ) = 74uM and Ki (dSERT ) = 29uM. These values and our inability to detect free serotonin indicate that SNACs selectively interact with the serotonin recognition site of the transporter. We have also exposed the SNACs to cells containing ionotropic serotonin receptors and have measured the electrical response of the cell using a two microelectrode voltage clamp. We find that serotonin receptors do respond to the SNACs and we measure currents similar to the free serotonin response. These results indicate that ligand-conjugated nanocrystals can be used to label both receptor and transporter proteins. Initial fluorescence labeling experiments will be discussed.

  7. Genome-wide expression profiling analysis to identify key genes in the anti-HIV mechanism of CD4+ and CD8+ T cells.

    PubMed

    Gao, Lijie; Wang, Yunqi; Li, Yi; Dong, Ya; Yang, Aimin; Zhang, Jie; Li, Fengying; Zhang, Rongqiang

    2018-07-01

    Comprehensive bioinformatics analyses were performed to explore the key biomarkers in response to HIV infection of CD4 + and CD8 + T cells. The numbers of CD4 + and CD8 + T cells of HIV infected individuals were analyzed and the GEO database (GSE6740) was screened for differentially expressed genes (DEGs) in HIV infected CD4 + and CD8 + T cells. Gene Ontology enrichment, KEGG pathway analyses, and protein-protein interaction (PPI) network were performed to identify the key pathway and core proteins in anti-HIV virus process of CD4 + and CD8 + T cells. Finally, we analyzed the expressions of key proteins in HIV-infected T cells (GSE6740 dataset) and peripheral blood mononuclear cells(PBMCs) (GSE511 dataset). 1) CD4 + T cells counts and ratio of CD4 + /CD8 + T cells decreased while CD8 + T cells counts increased in HIV positive individuals; 2) 517 DEGs were found in HIV infected CD4 + and CD8 + T cells at acute and chronic stage with the criterial of P-value <0.05 and fold change (FC) ≥2; 3) In acute HIV infection, type 1 interferon (IFN-1) pathway might played a critical role in response to HIV infection of T cells. The main biological processes of the DEGs were response to virus and defense response to virus. At chronic stage, ISG15 protein, in conjunction with IFN-1 pathway might play key roles in anti-HIV responses of CD4 + T cells; and 4) The expression of ISG15 increased in both T cells and PBMCs after HIV infection. Gene expression profile of CD4 + and CD8 + T cells changed significantly in HIV infection, in which ISG15 gene may play a central role in activating the natural antiviral process of immune cells. © 2018 Wiley Periodicals, Inc.

  8. ESCMID Study Group for Infections in Compromised Hosts (ESGICH) Consensus Document on the safety of targeted and biological therapies: an infectious diseases perspective (Agents targeting lymphoid or myeloid cells surface antigens [II]: CD22, CD30, CD33, CD38, CD40, SLAMF-7 and CCR4).

    PubMed

    Drgona, L; Gudiol, C; Lanini, S; Salzberger, B; Ippolito, G; Mikulska, M

    2018-03-20

    The present review is part of the ESCMID Study Group for Infections in Compromised Hosts (ESGICH) Consensus Document on the safety of targeted and biological therapies. To review, from an Infectious Diseases perspective, the safety profile of agents targeting CD22, CD30, CD33, CD38, CD40, SLAMF-7 and CCR4 and to suggest preventive recommendations. Computer-based MEDLINE searches with MeSH terms pertaining to each agent or therapeutic family. The risk and spectrum of infections in patients receiving CD22-targeted agents (i.e. inotuzumab ozogamicin) are similar to those observed with anti-CD20 antibodies. Anti-Pneumocystis prophylaxis and monitoring for cytomegalovirus (CMV) infection is recommended for patients receiving CD30-targeted agents (brentuximab vedotin). Due to the scarcity of data, the risk posed by CD33-targeted agents (gemtuzumab ozogamicin) cannot be assessed. Patients receiving CD38-targeted agents (i.e. daratumumab) face an increased risk of varicella-zoster virus (VZV) infection. Therapy with CD40-targeted agents (lucatumumab or dacetuzumab) is associated with opportunistic infections similar to those observed in hyper-IgM syndrome, and prevention strategies (including anti-Pneumocystis prophylaxis and pre-emptive therapy for CMV infection) are warranted. SLAMF-7 (CD319)-targeted agents (elotuzumab) induce lymphopenia and increase the risk of infection (particularly due to VZV). The impact of CCR4-targeted agents (mogamulizumab) on infection susceptibility is difficult to distinguish from the effect of underlying diseases and concomitant therapies. However, anti-Pneumocystis and anti-herpesvirus prophylaxis and screening for chronic hepatitis B virus (HBV) infection are recommended. Specific management strategies should be put in place to reduce the risk and/or the severity of infectious complications associated to the reviewed agents. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All

  9. Peripheral T-Cell Lymphoma with Aberrant Expression of CD19, CD20, and CD79a: Case Report and Literature Review

    PubMed Central

    Matnani, Rahul G.; Stewart, Rachel L.; Pulliam, Joseph; Jennings, Chester D.; Kesler, Melissa

    2013-01-01

    A case of lymphoma of T-cell derivation with aberrant expression of three B-cell lineage markers (CD19, CD20, and CD79a), which was diagnosed on a left axillary excision, is described. Immunohistochemical studies and flow cytometry analysis demonstrated neoplastic cells expressing CD3, CD19, CD20, and CD79a with absence of CD4, CD8, CD10, CD30, CD34, CD56, CD68, TDT, MPO, PAX-5, and surface immunoglobulin. Gene rearrangement studies performed on paraffin blocks demonstrated monoclonal T-cell receptor gamma chain rearrangement with no evidence of clonal heavy chain rearrangement. The neoplastic cells were negative for Epstein-Barr virus (EBV) or Human Herpes Virus 8 (HHV-8). At the time of diagnosis, the PET scan demonstrated hypermetabolic neoplastic cells involving the left axilla, bilateral internal jugular areas, mediastinum, right hilum, bilateral lungs, and spleen. However, bone marrow biopsy performed for hemolytic anemia revealed normocellular bone marrow with trilineage maturation. The patient had no evidence of immunodeficiency or infection with EBV or HHV-8. This is the first reported case of a mature T-cell lymphoma with aberrant expression of three B-cell lineage markers. The current report also highlights the need for molecular gene rearrangement studies to determine the precise lineage of ambiguous neoplastic clones. PMID:24066244

  10. Fenoterol, a β2-adrenoceptor agonist, inhibits LPS-induced membrane-bound CD14, TLR4/CD14 complex, and inflammatory cytokines production through β-arrestin-2 in THP-1 cell line

    PubMed Central

    Wang, Wei; Xu, Ming; Zhang, You-yi; He, Bei

    2009-01-01

    Aim: To investigate the molecular mechanism and signaling pathway by which fenoterol, a β2-adrenergic receptor (β2-AR) agonist, produces anti-inflammatory effects. Methods: THP-1, a monocytic cell line, was used to explore the mechanism of β2-AR stimulation in LPS-induced secretion of inflammatory cytokines and changes of toll-like receptors (TLRs). We labeled TLR4 and CD14 using monoclonal anti-TLR4 PE-conjugated and anti-CD14 FITC-conjugated antibodies in THP-1 cells stimulated by β2-AR in the presence or absence of lipopolysaccharide (LPS) and small, interfering RNA (siRNA)-mediated knockdown of β-arrestin-2, and then analyzed their changes in distribution by flow cytometry, Western blotting and confocal analysis. Results: LPS-induced membrane-bound CD14, TLR4/CD14 complex levels and elevation of inflammatory cytokines were all significantly reduced by pre-incubation of fenoterol (P<0.05). However, the total level of CD14 and TLR4 was not significantly changed. Interestingly, confocal microscopy revealed redistribution of CD14 and TLR4/CD14 complex under β2-AR stimulation. Furthermore, siRNA-mediated knockdown of β-arrestin-2 eliminated the anti-inflammatory effects and redistribution of CD14 and TLR4/CD14 complex stimulated by β2-AR. Conclusion: β2-AR agonist exerts its anti-inflammatory effects by down-regulating TLR signaling in THP-1 cells, potentially resulting from β-arrestin-2 mediated redistribution of CD14 and TLR14/CD14 complex. PMID:19890360

  11. Dielectric relaxation studies in Se{sub 90}Cd{sub 8}Sb{sub 2} glassy alloy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shukla, Nitesh; Rao, Vandita; Dwivedi, D. K.

    2016-05-06

    Se{sub 90}Cd{sub 8}Sb{sub 2} chalcogenide semiconducting alloy was prepared by melt quench technique. The prepared glassy alloy has been characterized by techniques such as scanning electron microscopy (SEM) and energy dispersive X-ray (EDAX).Dielectric properties of Se{sub 90}Cd{sub 8}Sb{sub 2} chalcogenide semiconductor have been studied using impedance spectroscopic technique in the frequency range 5×10{sup 2}Hz - 1×10{sup 5}Hz and in temperature range 303-318K. It is found that dielectric constant ε′ and dielectric loss factor ε″ are dependent on frequency and temperature.

  12. Yttrium-90 Resin Microsphere Radioembolization Using an Antireflux Catheter: An Alternative to Traditional Coil Embolization for Nontarget Protection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morshedi, Maud M., E-mail: maud.morshedi@my.rfums.org; Bauman, Michael, E-mail: mbauman@ucsd.edu; Rose, Steven C., E-mail: scrose@ucsd.edu

    2015-04-15

    PurposeSerious complications can result from nontarget embolization during yttrium-90 (Y-90) transarterial radioembolization. Hepatoenteric artery coil embolization has been traditionally performed to prevent nontarget radioembolization. The U.S. Food and Drug Administration–approved Surefire Infusion System (SIS) catheter, designed to prevent reflux, is an alternative to coils. The hypothesis that quantifiable SIS procedural parameters are comparable to coil embolization was tested.MethodsFourteen patients aged 36–79 years with colorectal, neuroendocrine, hepatocellular, and other predominantly bilobar hepatic tumors who underwent resin microsphere Y-90 radioembolization using only the SIS catheter (n = 7) versus only detachable coils (n = 7) for nontarget protection were reviewed retrospectively. Procedure time, fluoroscopy time, contrast dose,more » radiation dose, and cost were evaluated.ResultsMultivariate analysis identified significant cohort differences in the procedural parameters evaluated (F(10, 3) = 10.39, p = 0.04). Between-group comparisons of the pretreatment planning procedure in the SIS catheter group compared to the coil embolization group demonstrated a significant reduction in procedure time (102.6 vs. 192.1 min, respectively, p = 0.0004), fluoroscopy time (14.3 vs. 49.7 min, respectively, p = 0.0016), and contrast material dose (mean dose of 174.3 vs. 265.0 mL, respectively, p = 0.0098). Procedural parameters were not significantly different between the two groups during subsequent dose delivery procedures. Overall cost of combined first-time radioembolization procedures was significantly less in the SIS group ($4252) compared to retrievable coil embolization ($11,123; p = 0.001).ConclusionThe SIS catheter results in a reduction in procedure time, fluoroscopy time, and contrast material dose and may be an attractive cost-effective alternative to detachable coil embolization for prevention of nontarget radioembolization.« less

  13. A Rapid-Response Humoral Vaccine Platform Exploiting Pre-Existing Non-Cognate Populations of Anti-Vaccine or Anti-Viral CD4+ T Helper Cells to Confirm B Cell Activation.

    PubMed

    Hills, Thomas; Jakeman, Phillip G; Carlisle, Robert C; Klenerman, Paul; Seymour, Leonard W; Cawood, Ryan

    2016-01-01

    The need for CD4+ T cell responses to arise de novo following vaccination can limit the speed of B cell responses. Populations of pre-existing vaccine-induced or anti-viral CD4+ T cells recognising distinct antigens could be exploited to overcome this limitation. We hypothesise that liposomal vaccine particles encapsulating epitopes that are recognised, after processing and B cell MHCII presentation, by pre-existing CD4+ T cells will exploit this pre-existing T cell help and result in improved antibody responses to distinct target antigens displayed on the particle surface. Liposomal vaccine particles were engineered to display the malaria circumsporozoite (CSP) antigen on their surface, with helper CD4+ epitopes from distinct vaccine or viral antigens contained within the particle core, ensuring the B cell response is raised but focused against CSP. In vivo vaccination studies were then conducted in C57Bl/6 mice as models of either vaccine-induced pre-existing CD4+ T cell immunity (using ovalbumin-OVA) or virus-induced pre-existing CD4+ T cell immunity (murine cytomegalovirus-MCMV). Following the establishment of pre-existing by vaccination (OVA in the adjuvant TiterMax® Gold) or infection with MCMV, mice were administered CSP-coated liposomal vaccines containing the relevant OVA or MCMV core CD4+ T cell epitopes. In mice with pre-existing anti-OVA CD4+ T cell immunity, these vaccine particles elicited rapid, high-titre, isotype-switched CSP-specific antibody responses-consistent with the involvement of anti-OVA T helper cells in confirming activation of anti-CSP B cells. Responses were further improved by entrapping TLR9 agonists, combining humoral vaccination signals 'one', 'two' and 'three' within one particle. Herpes viruses can establish chronic infection and elicit significant, persistent cellular immune responses. We then demonstrate that this principle can be extended to re-purpose pre-existing anti-MCMV immunity to enhance anti-CSP vaccine responses

  14. Anti-CD74 antibodies have no diagnostic value in early axial spondyloarthritis: data from the spondyloarthritis caught early (SPACE) cohort.

    PubMed

    de Winter, Janneke J; van de Sande, Marleen G; Baerlecken, Niklas; Berg, Inger; Ramonda, Roberta; van der Heijde, Désirée; van Gaalen, Floris A; Witte, Torsten; Baeten, Dominique L

    2018-03-01

    Anti-CD74 IgG antibodies are reported to be elevated in patients with axial spondyloarthritis (axSpA). This study assessed the diagnostic value of anti-CD74 antibodies in patients with early axSpA. Anti-CD74 IgG and IgA antibodies were first measured in an exploratory cohort of patients with radiographic axSpA (138 patients with ankylosing spondyloarthritis (AS)) and 57 healthy controls and then were measured in patients with early axSpA (n = 274) and with non-SpA chronic back pain (CBP) (n = 319), participating in the spondyloarthritis caught early (SPACE) prospective cohort study of patients under 45 years old with early back pain (for ≥ 3 months, but ≤ 2 years). In the exploratory cohort, anti-CD74 IgG antibodies were present in 79.7% of patients with AS vs. 43.9% of healthy controls (p < 0.001). Anti-CD74 IgA antibodies were present in 28.5% of patients with AS vs. 5.3% of healthy controls (p < 0.001). In the SPACE cohort, anti-CD74 IgG antibody levels were present in 46.4% of the patients with axSpA vs. 47.9% of the patients with CBP (p = 0.71). Anti-CD74 IgA antibodies were present in 54.7% of the patients with axSpA and 37.0% of the patients with CBP (p < 0.001). This resulted in a positive predictive value of 58.8% (compared to a prior probability of 46.2%) and a negative predictive value of 59.1% (compared to a prior probability of 53.8%). In a regression model, total serum IgA was associated with axSpA odds ratio (OR) 1.19, p < 0.001) whereas anti-CD74 IgA was not (OR) 1.01, p = 0.33). Furthermore, anti-CD74 IgA was associated with sacroiliitis on magnetic resonance imaging (MRI) (OR) = 2.50, p = 0.005) and heel enthesitis (OR) = 2.56, p = 0.002). Albeit anti-CD74 IgA is elevated in patients with early axSpA, this elevation is not sufficiently specific to yield significant diagnostic value in patients under 45 years old presenting with early back pain.

  15. Impaired Upregulation of the Costimulatory Molecules, CD27 and CD28, on CD4+ T Cells from HIV Patients Receiving ART Is Associated with Poor Proliferative Responses.

    PubMed

    Tanaskovic, Sara; Price, Patricia; French, Martyn A; Fernandez, Sonia

    2017-02-01

    HIV patients beginning antiretroviral therapy (ART) with advanced immunodeficiency often retain low CD4 + T cell counts despite virological control. We examined proliferative responses and upregulation of costimulatory molecules, following anti-CD3 stimulation, in HIV patients with persistent CD4 + T cell deficiency on ART. Aviremic HIV patients with nadir CD4 + T cell counts <100 cells/μL and who had received ART for a median time of 7 (range 1-11) years were categorized into those achieving low (<350 cells/μL; n = 13) or normal (>500 cells/μL; n = 20) CD4 + T cell counts. Ten healthy controls were also recruited. CD4 + T cell proliferation (Ki67) and upregulation of costimulatory molecules (CD27 and CD28) after anti-CD3 stimulation were assessed by flow cytometry. Results were related to proportions of CD4 + T cells expressing markers of T cell senescence (CD57), activation (HLA-DR), and apoptotic potential (Fas). Expression of CD27 and/or CD28 on uncultured CD4 + T cells was similar in patients with normal CD4 + T cell counts and healthy controls, but lower in patients with low CD4 + T cell counts. Proportions of CD4 + T cells expressing CD27 and/or CD28 correlated inversely with CD4 + T cell expression of CD57, HLA-DR, and Fas. After anti-CD3 stimulation, induction of CD27 hi CD28 hi expression was independent of CD4 + T cell counts, but lower in HIV patients than in healthy controls. Induction of CD27 hi CD28 hi expression correlated with induction of Ki67 expression in total, naïve, and CD31 + naïve CD4 + T cells from patients. In HIV patients responding to ART, impaired induction of CD27 and CD28 on CD4 + T cells after stimulation with anti-CD3 is associated with poor proliferative responses as well as greater CD4 + T cell activation and immunosenescence.

  16. Targeting the Hemoglobin Scavenger receptor CD163 in Macrophages Highly Increases the Anti-inflammatory Potency of Dexamethasone

    PubMed Central

    Graversen, Jonas H; Svendsen, Pia; Dagnæs-Hansen, Frederik; Dal, Jakob; Anton, Gabriele; Etzerodt, Anders; Petersen, Mikkel D; Christensen, Peter A; Møller, Holger J; Moestrup, Søren K

    2012-01-01

    Synthetic glucocorticoids are potent anti-inflammatory drugs but serious side effects such as bone mobilization, muscle mass loss, immunosuppression, and metabolic alterations make glucocorticoid therapy a difficult balance. The therapeutic anti-inflammatory effect of glucocorticoids relies largely on the suppressed release of tumor-necrosis factor-α and other cytokines by macrophages at the sites of inflammation. We have now developed a new biodegradable anti-CD163 antibody-drug conjugate that specifically targets the glucocorticoid, dexamethasone to the hemoglobin scavenger receptor CD163 in macrophages. The conjugate, that in average contains four dexamethasone molecules per antibody, exhibits retained high functional affinity for CD163. In vitro studies in rat macrophages and in vivo studies of Lewis rats showed a strong anti-inflammatory effect of the conjugate measured as reduced lipopolysaccharide-induced secretion of tumor-necrosis factor-α. The in vivo potency of conjugated dexamethasone was about 50-fold that of nonconjugated dexamethasone. In contrast to a strong systemic effect of nonconjugated dexamethasone, the equipotent dose of the conjugate had no such effect, measured as thymus lymphocytes apoptosis, body weight loss, and suppression of endogenous cortisol levels. In conclusion, the study shows antibody-drug conjugates as a future approach in anti-inflammatory macrophage-directed therapy. Furthermore, the data demonstrate CD163 as an excellent macrophage target for anti-inflammatory drug delivery. PMID:22643864

  17. Depletion of CD20 B cells fails to inhibit relapsing mouse experimental autoimmune encephalomyelitis.

    PubMed

    Sefia, Eseberuo; Pryce, Gareth; Meier, Ute-Christiane; Giovannoni, Gavin; Baker, David

    2017-05-01

    Multiple sclerosis (MS) is often considered to be a CD4, T cell-mediated disease. This is largely based on the capacity of CD4 T cells to induce relapsing experimental autoimmune encephalomyelitis (EAE) in rodents. However, CD4-depletion using a monoclonal antibody was considered unsuccessful and relapsing MS responds well to B cell depletion via CD20 B cell depleting antibodies. The influence of CD20 B cell depletion in relapsing EAE was assessed. Relapsing EAE was induced in Biozzi ABH mice. These were treated with CD20-specific (18B12) antibody and the influence on CD45RA-B220 B cell depletion and clinical course was analysed. Relapsing EAE in Biozzi ABH failed to respond to the marked B cell depletion induced with a CD20-specific antibody. In contrast to CD20 and CD8-specific antibodies, CD4 T cell depletion inhibited EAE. Spinal cord antigen-induced disease in ABH mice is CD4 T cell-dependent. The lack of influence of CD20 B cell depletion in relapsing EAE, coupled with the relatively marginal and inconsistent results obtained in other mouse studies, suggests that rodents may have limited value in understanding the mechanism occurring following CD20 B cell depletion in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Evaluation of Liver Biomarkers as Prognostic Factors for Outcomes to Yttrium-90 Radioembolization of Primary and Secondary Liver Malignancies.

    PubMed

    Henrie, Adam M; Wittstrom, Kristina; Delu, Adam; Deming, Paulina

    2015-09-01

    The objective of this study was to examine indicators of liver function and inflammation for prognostic value in predicting outcomes to yttrium-90 radioembolization (RE). In a retrospective analysis, markers of liver function and inflammation, biomarkers required to stage liver function and inflammation, and data regarding survival, tumor response, and progression after RE were recorded. Univariate regression models were used to investigate the prognostic value of liver biomarkers in predicting outcome to RE as measured by survival, tumor progression, and radiographic and biochemical tumor response. Markers from all malignancy types were analyzed together. A subgroup analysis was performed on markers from patients with metastatic colorectal cancer. A total of 31 patients received RE from 2004 to 2014. Median survival after RE for all malignancies combined was 13.6 months (95% CI: 6.7-17.6 months). Results from an exploratory analysis of patient data suggest that liver biomarkers, including albumin concentrations, international normalized ratio, bilirubin concentrations, and the model for end-stage liver disease score, possess prognostic value in predicting outcomes to RE.

  19. Establishment of CMab-43, a Sensitive and Specific Anti-CD133 Monoclonal Antibody, for Immunohistochemistry.

    PubMed

    Itai, Shunsuke; Fujii, Yuki; Nakamura, Takuro; Chang, Yao-Wen; Yanaka, Miyuki; Saidoh, Noriko; Handa, Saori; Suzuki, Hiroyoshi; Harada, Hiroyuki; Yamada, Shinji; Kaneko, Mika K; Kato, Yukinari

    2017-10-01

    CD133, also known as prominin-1, was first described as a cell surface marker on early progenitor and hematopoietic stem cells. It is a five-domain transmembrane protein composed of an N-terminal extracellular tail, two small cytoplasmic loops, two large extracellular loops containing seven potential glycosylation sites, and a short C-terminal intracellular tail. CD133 has been used as a marker to identify cancer stem cells derived from primary solid tumors and as a prognostic marker of gliomas. Herein, we developed novel anti-CD133 monoclonal antibodies (mAbs) and characterized their efficacy in flow cytometry, Western blot, and immunohistochemical analyses. We expressed the full length of CD133 in LN229 glioblastoma cells, immunized mice with LN229/CD133 cells, and performed the first screening using flow cytometry. After limiting dilution, we established 100 anti-CD133 mAbs, reacting with LN229/CD133 cells but not with LN229 cells. Subsequently, we performed the second and third screening with Western blot and immunohistochemical analyses, respectively. Among 100 mAbs, 11 strongly reacted with CD133 in Western blot analysis. One of 11 clones, CMab-43 (IgG 2a , kappa), showed a sensitive and specific reaction against colon cancer cells, warranting the use of CMab-43 in detecting CD133 in pathological analyses of CD133-expressing cancers.

  20. Human CD62Ldim neutrophils identified as a separate subset by proteome profiling and in vivo pulse-chase labeling.

    PubMed

    Tak, Tamar; Wijten, Patrick; Heeres, Marjolein; Pickkers, Peter; Scholten, Arjen; Heck, Albert J R; Vrisekoop, Nienke; Leenen, Luke P; Borghans, José A M; Tesselaar, Kiki; Koenderman, Leo

    2017-06-29

    During acute inflammation, 3 neutrophil subsets are found in the blood: neutrophils with a conventional segmented nucleus, neutrophils with a banded nucleus, and T-cell-suppressing CD62L dim neutrophils with a high number of nuclear lobes. In this study, we compared the in vivo kinetics and proteomes of banded, mature, and hypersegmented neutrophils to determine whether these cell types represent truly different neutrophil subsets or reflect changes induced by lipopolysaccharide (LPS) activation. Using in vivo pulse-chase labeling of neutrophil DNA with 6,6- 2 H 2 -glucose, we found that 2 H-labeled banded neutrophils appeared much earlier in blood than labeled CD62L dim and segmented neutrophils, which shared similar label kinetics. Comparison of the proteomes by cluster analysis revealed that CD62L dim neutrophils were clearly separate from conventional segmented neutrophils despite having similar kinetics in peripheral blood. Interestingly, the conventional segmented cells were more related at a proteome level to banded cells despite a 2-day difference in maturation time. The differences between CD62L dim and mature neutrophils are unlikely to have been a direct result of LPS-induced activation, because of the extremely low transcriptional capacity of CD62L dim neutrophils and the fact that neutrophils do not directly respond to the low dose of LPS used in the study (2 ng/kg body weight). Therefore, we propose CD62L dim neutrophils are a truly separate neutrophil subset that is recruited to the bloodstream in response to acute inflammation. This trial was registered at www.clinicaltrials.gov as #NCT01766414. © 2017 by The American Society of Hematology.

  1. CD20-Positive nodal natural killer/T-cell lymphoma with cutaneous involvement.

    PubMed

    Tsai, Yi-Chiun; Chen, Chi-Kuan; Wu, Yu-Hung

    2015-09-01

    CD20-positive natural killer (NK)/T-cell lymphoma is extremely rare. We describe a case of a CD20-positive nodal NK/T-cell lymphoma with cutaneous involvement in a 32-year-old man. The patient presented with fever, night sweats, right inguinal lymphadenopathy and multiple violaceous to erythematous nodules and plaques on the back and bilateral legs. Immunohistochemical analysis showed diffusely and strongly positive staining for CD3, CD3 epsilon, CD43, CD56, TIA-1 and CD20 but negative staining for other B-cell markers, including CD79a and PAX-5 and T-cell markers CD5 and CD7. The tumor cell nuclei were diffusely positive for Epstein-Barr virus-encoded RNA in situ hybridization. A partial clinical response was observed after chemotherapy, indicated by the decreased size of the lymph nodes and skin lesions. It is a diagnostic challenge to deal with lymphoma cells that present with the surface proteins of both T- and B-cells. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. CD20+ T cell numbers are decreased in untreated HIV-1 patients and recover after HAART.

    PubMed

    Förster, Friederike; Singla, Anuj; Arora, Sunil K; Schmidt, Reinhold E; Jacobs, Roland

    2012-08-30

    To elucidate if CD20(+) T cells are affected by HIV-1 infection and may have a prognostic value for the course of disease, numbers of CD20(+) T cells were determined in healthy controls, untreated and HAART-treated HIV-1 patients. Coexpression patterns of CD4, CD8, and CD38 were analysed on CD3(+)CD20(+) and CD3(+)CD20(-) T cells. We found a significant decrease of CD20(+) T cell numbers in untreated HIV-1 patients (1.4%) as compared to healthy controls (2.5%) which recovered under HAART (1.9%). Particularly, the CD8(+) T cell compartment was affected revealing significant differences between healthy controls (3.4%) and both treated (1.7%) and untreated (1.1%) patients. CD38 was expressed on a few CD20(+) T cells but preferentially on CD20(-) cells in all three groups. IFN-γ production was measured upon cell activation using PMA alone or in combination with ionomycin in order to assess functional capacities of the cells. PMA alone was much more effective in CD20(+) cells regardless of CD38 coexpression, indicating a supportive role of CD20 but not CD38 in T cell activation. Here we present data showing that CD3(+)CD20(+) T cells are decreased in untreated HIV-1 patients and normal numbers are restored under HAART. Expression of CD20 and CD38 is independently regulated on T cells. Contrary to CD38, CD20 can substitute ionophores for Ca(2+) flux in early T cell activation and also strongly amplify cell stimulation in the presence of Ca(2+) ionophores, indicating that CD20 contributes to T cell activation. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Safety and bleeding profile of continuous levonorgestrel 90 mcg/ethinyl estradiol 20 mcg based on 2 years of clinical trial data in Canada.

    PubMed

    Reid, Robert L; Fortier, Michel P; Smith, Lynne; Mirkin, Sebastian; Grubb, Gary S; Constantine, Ginger D

    2010-12-01

    The study was conducted to evaluate bleeding profile and safety of continuous oral contraceptive (OC) containing levonorgestrel (LNG) 90 mcg/ethinyl estradiol (EE) 20 mcg. Healthy women who participated at seven Canadian sites in 1-year open-label study of LNG 90 mcg/EE 20 mcg daily were eligible for this second-year extension study. Primary end points included bleeding profile and adverse events. Seventy-nine women enrolled without interrupting pill taking; 62 (78.5%) completed. Adverse events were comparable to cyclic OC regimens, except unscheduled vaginal bleeding. Amenorrhea and absence of bleeding increased to about 80% and 90%, respectively, by Pill Pack 18. Mean (median) number of bleeding days for the last two 90-day intervals was 1.1 (0) and 0.7 (0) days, respectively. Continuous LNG 90 mcg/EE 20 mcg had a safety profile similar to low-dose cyclic OCs. Short-term safety profile remained excellent, with increasing rates of amenorrhea and decreasing incidence of unscheduled bleeding and/or spotting. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Anti-CD40 antibody-mediated costimulation blockade promotes long-term survival of deep-lamellar porcine corneal grafts in non-human primates.

    PubMed

    Kim, Jaeyoung; Kim, Dong Hyun; Choi, Hyuk Jin; Lee, Hyun Ju; Kang, Hee Jung; Park, Chung-Gyu; Hwang, Eung-Soo; Kim, Mee Kum; Wee, Won Ryang

    2017-05-01

    Corneal xenotransplantation is an effective solution for the shortage of human donor corneas, and the porcine cornea may be a suitable candidate for the donor cornea because of its optical similarity with humans. However, it is necessary to administer additional immunosuppressants to overcome antigenic differences. We aimed to investigate the feasibility of porcine corneas with anti-CD40 antibody-mediated costimulation blockade in a clinically applicable pig-to-non-human primate corneal xenotransplantation model. Five Chinese rhesus macaques underwent deep-lamellar corneal transplantation using clinically acceptable sized (7.5 mm diameter) porcine corneal grafts. The anti-CD40 antibody was intravenously administered on a programmed schedule. Graft survival, central corneal thickness, and intraocular pressure were evaluated. Changes in effector and memory T and B cell subsets and anti-αGal and donor-specific antibodies were investigated in the blood, and the changes in complement levels in the aqueous humor and blood were evaluated. Memory cell profiles in the anti-CD40 antibody-treated group were compared with those from the anti-CD154 antibody-treated group or rejected controls presented in our previous report. The changes in anti-αGal, non-αGal, and donor-specific antibodies after 6 months were compared with baseline values. Anti-CD40 antibody-mediated costimulation blockade resulted in the successful survival of xenocorneal grafts (>389, >382, >236, >201, and >61 days), with 80% reaching 6 months of survival. Injection of anti-CD40 antibody considerably reduced the infiltration of inflammatory cells into the grafts and significantly blocked the complement response in the aqueous humor (P=.0159, Mann-Whitney U test). Systemic expansion of central or effector memory T cells was abrogated in the anti-CD40 antibody-treated primates compared with those in the rejected controls (P<.05, Mann-Whitney U test) or those in the anti-CD154 antibody-treated primates (P

  5. Anti-inflammatory activity of the essential oil obtained from Ocimum basilicum complexed with β-cyclodextrin (β-CD) in mice.

    PubMed

    Rodrigues, Lindaiane Bezerra; Martins, Anita Oliveira Brito Pereira Bezerra; Ribeiro-Filho, Jaime; Cesário, Francisco Rafael Alves Santana; E Castro, Fyama Ferreira; de Albuquerque, Thaís Rodrigues; Fernandes, Maria Neyze Martins; da Silva, Bruno Anderson Fernandes; Quintans Júnior, Lucindo José; Araújo, Adriano Antunes de Sousa; Menezes, Paula Dos Passos; Nunes, Paula Santos; Matos, Isabella Gonçalves; Coutinho, Henrique Douglas Melo; Goncalves Wanderley, Almir; de Menezes, Irwin Rose Alencar

    2017-11-01

    Cyclodextrins (CDs) are cyclic oligosaccharides can enhance the bioavailability of drugs. Ocimum basilicum is an aromatic plant found in Brazil used in culinary. The essential oil of this plant presents anti-edematogenic and anti-inflammatory activities in acute and chronic inflammation. The aim of this study was to investigate the anti-inflammatory effects of the essential oil obtained from O. basilicum complexed with β - cyclodextrin (OBEO/β-CD) in mice. The complexation with β-cyclodextrin (β-CD) was performed by different methods and analyzed by differential scanning calorimetry (DSC), thermogravimetry (TG) and scanning electron microscopy (SEM). The anti-inflammatory activity was evaluated using mice models of paw edema induced by carrageenan, dextran, histamine and arachidonic acid (AA); vascular permeability and peritonitis induced by carrageenan and granuloma induced by cotton block introduction. The DSC, TG and SEM analysis indicated that the OBEO was successfully complexed with β-CD. The oral administration of OEOB/β-CD prevented paw edema formation by decreasing vascular permeability in vivo, inhibited leukocyte recruitment to the peritoneal cavity, and inhibited granuloma formation in mice. Our results indicate that conjugation with β-CD improves the anti-inflammatory effects of OBEO in mice models of acute and chronic inflammation, indicating that this complex can be used in anti-inflammatory drug development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Anti-CD3 clinical trials in type 1 diabetes mellitus.

    PubMed

    Daifotis, Anastasia G; Koenig, Scott; Chatenoud, Lucienne; Herold, Kevan C

    2013-12-01

    Two humanized, anti-CD3 mAbs with reduced FcR binding, teplizumab and otelixizumab, have been evaluated in over 1500 subjects, ages 7-45, with new and recently diagnosed T1D with a range of intravenous doses (3-48mg) and regimens (6-14 days, single or repeat courses). In general, studies that used adequate dosing demonstrated improvement in stimulated C-peptide responses and reduced need for exogenous insulin for two years and even longer after diagnosis. Drug treatment causes a transient reduction in circulating T cells, but the available data suggest that the mechanism of action may involve induction of regulatory mechanisms. The adverse effects of anti-CD3 treatment are infusion-related and transient. The studies have identified significant differences in efficacy among patient groups suggesting that a key aspect for development of this immune therapy is identification of the demographic, metabolic, and immunologic features that distinguish subjects who are most likely to show beneficial clinical responses. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Spin-labelling study of interactions of ovalbumin with multilamellar liposomes and specific anti-ovalbumin antibodies.

    PubMed

    Brgles, Marija; Mirosavljević, Krunoslav; Noethig-Laslo, Vesna; Frkanec, Ruza; Tomasić, Jelka

    2007-03-10

    Ovalbumin (OVA) has been used continuously as the model antigen in numerous studies of immune reactions and antigen processing, very often encapsulated into liposomes. The purpose of this work was to study the possible interactions of spin-labelled OVA and lipids in liposomal membranes using electron spin resonance (ESR) spectroscopy. OVA was covalently spin-labelled with 4-maleimido-2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO-maleimide), characterized and encapsulated into multilamellar, negatively charged liposomes. ESR spectra of this liposomal preparation gave evidence for the interaction of OVA with the lipid bilayers. Such an interaction was also evidenced by the ESR spectra of liposomal preparation containing OVA, where liposomes were spin-labelled with n-doxyl stearic acids. The spin-labelled OVA retains its property to bind specific anti-OVA antibodies, as shown by ESR spectroscopy, but also in ELISA for specific anti-OVA IgG.

  8. Interluekin-12 enhances the function and anti-tumor activity in murine and human CD8+ T cells

    PubMed Central

    Rubinstein, Mark P.; Su, Ee Wern; Suriano, Samantha; Cloud, Colleen A.; Andrijauskaite, Kristina; Kesarwani, Pravin; Schwartz, Kristina M.; Williams, Katelyn; Johnson, C. Bryce; Li, Mingli; Scurti, Gina M.; Salem, Mohamed L.; Paulos, Chrystal M.; Garrett-Mayer, Elizabeth; Mehrotra, Shikhar; Cole, David J.

    2016-01-01

    Mouse CD8+ T cells conditioned with Interleukin (IL)-12 ex vivo mediate the potent regression of established melanoma when transferred into lymphodepleted mice. However, the quantitative and qualitative changes induced by IL-12 in the responding mouse CD8+ T cells have not been well defined. Moreover, the mechanisms by which IL-12-conditioning impacts human CD8+ T cells, and how such cells might be expanded prior to infusion into patients is not known. We found that ex vivo IL-12-conditioning of mouse CD8+ T cells led to a 10- to 100-fold increase in persistence and anti-tumor efficacy upon adoptive transfer into lymphodepleted mice. The enhancing effect of IL-12 was associated with maintenance of functional avidity. Importantly, in the context of ongoing ACT clinical trials, human CD8+ T cells genetically modified with a tyrosinase-specific T-cell receptor exhibited significantly enhanced functional activity when conditioned with IL-12 as indicated by heightened granzyme B expression and elevated peptide-specific CD107a degranulation. This effect was sustainable despite the 20 days of in vitro cellular expansion required to expand cells over 1,000-fold allowing adequate cell numbers for administration to cancer patients. Overall, these findings support the efficacy and feasibility of ex vivo IL-12-conditioning of TCR-modified human CD8+ T cells for adoptive transfer and cancer therapy. PMID:25676709

  9. Lung Shunt Fraction prior to Yttrium-90 Radioembolization Predicts Survival in Patients with Neuroendocrine Liver Metastases: Single-Center Prospective Analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ludwig, Johannes M.; Ambinder, Emily McIntosh; Ghodadra, Anish

    ObjectiveTo investigate survival outcomes following radioembolization with Yttrium-90 (Y90) for neuroendocrine tumor liver metastases (NETLMs). This study was designed to assess the efficacy of Y90 radioembolization and to evaluate lung shunt fraction (LSF) as a predictor for survival.MethodsA single-center, prospective study of 44 consecutive patients (median age: 58.5 years, 29.5 % male) diagnosed with pancreatic (52.3 %) or carcinoid (47.7 %) NETLMs from 2006 to 2012 who underwent Y90 radioembolization was performed. Patients’ baseline characteristics, including LSF and median overall survival (OS) from first Y90 radioembolization, were recorded and compared between patients with high (≥10 %) and low (<10 %) LSF. Baseline comparisons were performed usingmore » Fisher’s exact tests for categorical and Mann–Whitney U test for continuous variables. Survival was calculated using the Kaplan–Meier method. Univariate (Wilcoxon rank-sum test) and multivariate analyses (Cox Proportional Hazard Model) for risk factor analysis were performed.ResultsThere was no statistically significant difference in age, gender, race, tumor properties, or previous treatments between patients with high (n = 15) and low (n = 29) LSF. The median OS was 27.4 months (95 %CI 12.73–55.23), with 4.77 months (95 %CI 2.87–26.73) for high and 42.77 months (95 %CI 18.47–59.73) for low LSF (p = 0.003). Multivariate analysis identified high LSF (p = 0.001), total serum bilirubin >1.2 mg (p = 0.016), and lack of pretreatment with octreotide (p = 0.01) as independent prognostic factors for poorer survival. Tumor type and total radiation dose did not predict survival.ConclusionsLSF ≥10 %, elevated bilirubin levels, and lack of pretreatment with octreotide were found to be independent prognostic factors for poorer survival in patients with NETLMs.« less

  10. 10 CFR 20.1905 - Exemptions to labeling requirements.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Exemptions to labeling requirements. 20.1905 Section 20.1905 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary... have sufficient instruction to minimize radiation exposure while handling or working in the vicinity of...

  11. 10 CFR 20.1905 - Exemptions to labeling requirements.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Exemptions to labeling requirements. 20.1905 Section 20.1905 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary... have sufficient instruction to minimize radiation exposure while handling or working in the vicinity of...

  12. 10 CFR 20.1905 - Exemptions to labeling requirements.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Exemptions to labeling requirements. 20.1905 Section 20.1905 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary... have sufficient instruction to minimize radiation exposure while handling or working in the vicinity of...

  13. 10 CFR 20.1905 - Exemptions to labeling requirements.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Exemptions to labeling requirements. 20.1905 Section 20.1905 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary... have sufficient instruction to minimize radiation exposure while handling or working in the vicinity of...

  14. 10 CFR 20.1905 - Exemptions to labeling requirements.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Exemptions to labeling requirements. 20.1905 Section 20.1905 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Precautionary... have sufficient instruction to minimize radiation exposure while handling or working in the vicinity of...

  15. sCD30, interleukin-1beta-converting enzyme and anti-Annexin V autoantibodies concentrations in heart transplant recipients.

    PubMed

    Zeglen, Sławomir; Zakliczyński, Michał; Nozyński, Jerzy; Rogala, Barbara; Zembala, Marian

    2006-11-01

    sCD30 and ICE/caspase-1 as apoptosis-regulating factors are suspected to be involved in the survival rate of immunocompetent cells during immunosuppression after allotransplantation. Serum CD30 and ICE/caspase-1 concentrations were estimated and associated with unspecific serum apoptosis marker--anti-Annexin V antibodies and myocardial biopsies results. 28 clinically stabile patients--heart transplant recipients at least 3 months after cardiac transplantation performed due to heart failure caused by ischaemic and/or congestive cardiomyopathy or/and primary valvular heart disease (26 men and 2 women, mean age=36.8 years, S.D.=7.6) with normal heart function assessed by use of ultrasound scan--were involved in the trial. The patients were divided and analyzed in two ways: first according to the results of elective endomyocardial biopsies and second to main immunosuppressive agent used. The enzyme immunoassay (CD30, Dako; interleukin-1beta-converting enzyme (ICE)/Caspase-1 ELISA and anti-Annexin V BENDER MedSystem) for soluble CD30, caspase-1 and anti-Annexin V autoantibodies serum levels was used. sCD30 and caspase-1 concentrations were non-significantly up-regulated in all analysed groups--with or without rejection signs or immunosuppressed with cyclosporine or especially tacrolimus. In contrast anti-Annexin V autoantibodies concentration was non-significantly down-regulated also in all studied groups. Moreover in the group with signs of transplant rejection, strong negative correlation between anti-Annexin antibodies and rejection grade was observed (-0.65, p<0.05). Biopsy results were comparable in groups treated with tacrolimus and cyclosporine A. The increasing tendency of sCD30 and caspase-1 as well as the decrease in anti-Annexin V autoantibodies concentrations in heart recipients could be the result of post-transplant apoptosis disturbances. This tendency seems to be inhibited in a greater degree by tacrolimus than by cyclosporine. Anti-Annexin V

  16. Inflammation-induced synergetic enhancement of nanoparticle treatments with DOXIL® and 90Y-Lactosome for orthotopic mammary tumor

    NASA Astrophysics Data System (ADS)

    Kurihara, Kensuke; Ueda, Motoki; Hara, Isao; Hara, Eri; Sano, Kohei; Makino, Akira; Ozeki, Eiichi; Yamamoto, Fumihiko; Saji, Hideo; Togashi, Kaori; Kimura, Shunsaku

    2016-05-01

    Polymeric micelles (Lactosome) in the size of 20-30 nm were labeled with radionuclides of 111In (111In-DOTA-Lactosome) for SPECT imaging and 90Y (90Y-DOTA-Lactosome) for β-ray irradiation for mammary tumor in mice. The tumor site at the femoral right leg grafted with 4T1 cells was clearly imaged at 24 h after the intravenous injection. Biodistribution revealed that the half-life time of 111In-DOTA-Lactosome was 11 h, which enabled the nanoparticle selectively accumulated in tumor site due to the enhanced permeability and retention (EPR) effect. The anti-tumor therapeutic effect of 90Y-DOTA-Lactosome was observed depending on the dose frequency and amount. Under the condition of the percutaneous ethanol injection treatment, the therapeutic effect of 90Y-DOTA-Lactosome was enhanced due to the super EPR effect. Owing to the super EPR effect, co-administration of 90Y-DOTA-Lactosome and DOXIL® inhibited the tumor growth during 15 days with their administrations.

  17. Complex upper arm reconstruction using an antero-lateral thigh free flap after an extravasation of Yttrium-90-ibritumomab Tiuxetan: A case report and literature review.

    PubMed

    Baus, A; Keilani, C; Bich, C-S; Entine, F; Brachet, M; Duhamel, P; Amabile, J-C; Malfuson, J V; Bey, E

    2018-04-01

    Yttrium-90-Ibritumomab Tiuxetan (Zevalin ® ) is used in the treatment of non- Hodgkin's lymphoma. Extravasation is an iatrogenic complication that is fortunately rare. However, the treatment of this complication is often complex due to the risk of extensive skin necrosis and unpredictable evolution of localized irradiation. This vesicant drug requires emergency management when extravasation occured. Radiations burns have specificities. Therefore, wound coverage involves specific plastic surgical techniques. Here, we report the case of a man presenting a chronic and extensive skin necrosis of upper arm treated with an antero-lateral thigh free flap. Moreover, we compare our experience of Zevalin ® extravasation management to other past publications and propose recommendations to prevent this unacceptable complication. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture.

    PubMed

    Krawetz, Roman J; Wu, Yiru Elizabeth; Martin, Liam; Rattner, Jerome B; Matyas, John R; Hart, David A

    2012-01-01

    Mesenchymal progenitor cells (MPCs) can differentiate into osteoblasts, adipocytes, and chondrocytes, and are in part responsible for maintaining tissue integrity. Recently, a progenitor cell population has been found within the synovial fluid that shares many similarities with bone marrow MPCs. These synovial fluid MPCs (sfMPCs) share the ability to differentiate into bone and fat, with a bias for cartilage differentiation. In this study, sfMPCs were isolated from human and canine synovial fluid collected from normal individuals and those with osteoarthritis (human: clinician-diagnosed, canine: experimental) to compare the differentiation potential of CD90+ vs. CD90- sfMPCs, and to determine if CD90 (Thy-1) is a predictive marker of synovial fluid progenitors with chondrogenic capacity in vitro. sfMPCs were derived from synovial fluid from normal and OA knee joints. These cells were induced to differentiate into chondrocytes and analyzed using quantitative PCR, immunofluorescence, and electron microscopy. The CD90+ subpopulation of sfMPCs had increased chondrogenic potential compared to the CD90- population. Furthermore, sfMPCs derived from healthy joints did not require a micro-mass step for efficient chondrogenesis. Whereas sfMPCs from OA synovial fluid retain the ability to undergo chondrogenic differentiation, they require micro-mass culture conditions. Overall, this study has demonstrated an increased chondrogenic potential within the CD90+ fraction of human and canine sfMPCs and that this population of cells derived from healthy normal joints do not require a micro-mass step for efficient chondrogenesis, while sfMPCs obtained from OA knee joints do not differentiate efficiently into chondrocytes without the micro-mass procedure. These results reveal a fundamental shift in the chondrogenic ability of cells isolated from arthritic joint fluids, and we speculate that the mechanism behind this change of cell behavior is exposure to the altered milieu of the OA

  19. Predicting the response to CTLA-4 blockade by longitudinal noninvasive monitoring of CD8 T cells

    PubMed Central

    Whang, Katherine A.; LeGall, Camille; Cragnolini, Juan J.; Bierie, Brian; Gostissa, Monica; Grotenbreg, Gijsbert M.; Bhan, Atul; Weinberg, Robert A.

    2017-01-01

    Immunotherapy using checkpoint-blocking antibodies against targets such as CTLA-4 and PD-1 can cure melanoma and non–small cell lung cancer in a subset of patients. The presence of CD8 T cells in the tumor correlates with improved survival. We show that immuno–positron emission tomography (immuno-PET) can visualize tumors by detecting infiltrating lymphocytes and, through longitudinal observation of individual animals, distinguish responding tumors from those that do not respond to therapy. We used 89Zr-labeled PEGylated single-domain antibody fragments (VHHs) specific for CD8 to track the presence of intratumoral CD8+ T cells in the immunotherapy-susceptible B16 melanoma model in response to checkpoint blockade. A 89Zr-labeled PEGylated anti-CD8 VHH detected thymus and secondary lymphoid structures as well as intratumoral CD8 T cells. Animals that responded to CTLA-4 therapy showed a homogeneous distribution of the anti-CD8 PET signal throughout the tumor, whereas more heterogeneous infiltration of CD8 T cells correlated with faster tumor growth and worse responses. To support the validity of these observations, we used two different transplantable breast cancer models, yielding results that conformed with predictions based on the antimelanoma response. It may thus be possible to use immuno-PET and monitor antitumor immune responses as a prognostic tool to predict patient responses to checkpoint therapies. PMID:28666979

  20. Anti-inflammatory drugs interacting with Zn(II), Cd(II) and Pt(II) metal ions.

    PubMed

    Dendrinou-Samara, C; Tsotsou, G; Ekateriniadou, L V; Kortsaris, A H; Raptopoulou, C P; Terzis, A; Kyriakidis, D A; Kessissoglou, D P

    1998-09-01

    Complexes of Zn(II), Cd(II) and Pt(II) metal ions with the anti-inflammatory drugs, 1-methyl-5-(p-toluoyl)-1H-pyrrole-2-acetic acid (Tolmetin), alpha-methyl-4-(2-methylpropyl)benzeneacetic acid (Ibuprofen), 6-methoxy-alpha-methylnaphthalene-2-acetic acid (Naproxen) and 1-(4-chlorobenzoyl)-5-methoxy-2-methyl-1H-indole-3-acetic acid (indomethacin) have been synthesized and characterized. In the structurally characterized Cd(naproxen)2 complex the anti-inflammatory drugs acts as bidentate chelate ligand coordinatively bound to metal ions through the deprotonated carboxylate group. Crystal data for 1: [C32H26O8Cd], orthorhombic, space group P22(1)2(1), a = 5.693(2) (A), b = 8.760(3) (A), c = 30.74(1) (A), V = 1533(1) A3, Z = 2. Antibacterial and growth inhibitory activity is higher than that of the parent ligands or the platinum(II) diamine compounds.

  1. A novel antibody-drug conjugate anti-CD19(Fab)-LDM in the treatment of B-cell non-Hodgkin lymphoma xenografts with enhanced anticancer activity.

    PubMed

    Jiang, Linlin; Yang, Ming; Zhang, Xiaoyun; Bao, Shiqi; Ma, Li; Fan, Dongmei; Zhou, Yuan; Xiong, Dongsheng; Zhen, Yongsu

    2016-01-01

    Rituximab is widely used in clinical setting for the treatment of B malignant lymphoma and has achieved remarkable success. However, in most patients, the disease ultimately relapses and become resistant to rituximab. To overcome the limitation, there is still a need to find novel strategy for improving therapeutic efficacy. To construct genetically engineered antibody anti-CD19(Fab)-LDM, and verify the anticancer activity targeted toward B-lymphoma. The anticancer activity of anti-CD19(Fab)-LDM in vitro and in vivo was examined. In vitro, the binding activity and internalization of anti-CD19(Fab)-LDP were measured. Using comet assay and apoptosis, the cytotoxicity of energized fusion proteins was observed. From in vivo experiments, targeting of therapeutic effect and anticancer efficacy bythe fusion protein was verified. Data showed that anti-CD19(Fab)-LDM does not only binding the cell surface but is also internalized into the cell. The energized fusion proteins anti-CD19(Fab)-LDM can induce DNA damage. Furthermore, significant in vivo therapeutic efficacy was observed. The present study demonstrated that the genetically engineered antibody anti-CD19(Fab)-LDM exhibited enhanced cytotoxicity compared to LDM alone. One of the most powerful advantages of anti-CD19(Fab)-LDM, however, is that it can be internalized within the cells and carry out cytotoxic effects. Therefore, anti-CD19(Fab)-LDM may be as a useful targeted therapy for B-cell lymphoma.

  2. IL-4 and IL-13 mediated down-regulation of CD8 expression levels can dampen anti-viral CD8⁺ T cell avidity following HIV-1 recombinant pox viral vaccination.

    PubMed

    Wijesundara, Danushka K; Jackson, Ronald J; Tscharke, David C; Ranasinghe, Charani

    2013-09-23

    We have shown that mucosal HIV-1 recombinant pox viral vaccination can induce high, avidity HIV-specific CD8(+) T cells with reduced interleukin (IL)-4 and IL-13 expression compared to, systemic vaccine delivery. In the current study how these cytokines act to regulate anti-viral CD8(+) T, cell avidity following HIV-1 recombinant pox viral prime-boost vaccination was investigated. Out of a panel of T cell avidity markers tested, only CD8 expression levels were found to be enhanced on, KdGag197-205 (HIV)-specific CD8(+) T cells obtained from IL-13(-/-), IL-4(-/-) and signal transducer and, activator of transcription of 6 (STAT6)(-/-) mice compared to wild-type (WT) controls following, vaccination. Elevated CD8 expression levels in this instance also correlated with polyfunctionality, (interferon (IFN)-γ, tumour necorsis factor (TNF)-α and IL-2 production) and the avidity of HIVspecific CD8(+) T cells. Furthermore, mucosal vaccination and vaccination with the novel adjuvanted IL-13 inhibitor (i.e. IL-13Rα2) vaccines significantly enhanced CD8 expression levels on HIV-specific CD8(+), T cells, which correlated with avidity. Using anti-CD8 antibodies that blocked CD8 availability on CD8(+), T cells, it was established that CD8 played an important role in increasing HIV-specific CD8(+) T cell avidity and polyfunctionality in IL-4(-/-), IL-13(-/-) and STAT6(-/-) mice compared to WT controls, following vaccination. Collectively, our data demonstrate that IL-4 and IL-13 dampen CD8 expression levels on anti-viral CD8(+) T cells, which can down-regulate anti-viral CD8(+) T cell avidity and, polyfunctionality following HIV-1 recombinant pox viral vaccination. These findings can be exploited to, design more efficacious vaccines not only against HIV-1, but many chronic infections where high, avidity CD8(+) T cells help protection. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. New CD20 alternative splice variants: molecular identification and differential expression within hematological B cell malignancies.

    PubMed

    Gamonet, Clémentine; Bole-Richard, Elodie; Delherme, Aurélia; Aubin, François; Toussirot, Eric; Garnache-Ottou, Francine; Godet, Yann; Ysebaert, Loïc; Tournilhac, Olivier; Caroline, Dartigeas; Larosa, Fabrice; Deconinck, Eric; Saas, Philippe; Borg, Christophe; Deschamps, Marina; Ferrand, Christophe

    2015-01-01

    CD20 is a B cell lineage-specific marker expressed by normal and leukemic B cells and targeted by several antibody immunotherapies. We have previously shown that the protein from a CD20 mRNA splice variant (D393-CD20) is expressed at various levels in leukemic B cells or lymphoma B cells but not in resting, sorted B cells from the peripheral blood of healthy donors. Western blot (WB) analysis of B malignancy primary samples showed additional CD20 signals. Deep molecular PCR analysis revealed four new sequences corresponding to in-frame CD20 splice variants (D657-CD20, D618-CD20, D480-CD20, and D177-CD20) matching the length of WB signals. We demonstrated that the cell spliceosome machinery can process ex vivo D480-, D657-, and D618-CD20 transcript variants by involving canonical sites associated with cryptic splice sites. Results of specific and quantitative RT-PCR assays showed that these CD20 splice variants are differentially expressed in B malignancies. Moreover, Epstein-Barr virus (EBV) transformation modified the CD20 splicing profile and mainly increased the D393-CD20 variant transcripts. Finally, investigation of three cohorts of chronic lymphocytic leukemia (CLL) patients showed that the total CD20 splice variant expression was higher in a stage B and C sample collection compared to routinely collected CLL samples or relapsed refractory stage A, B, or C CLL. The involvement of these newly discovered alternative CD20 transcript variants in EBV transformation makes them interesting molecular indicators, as does their association with oncogenesis rather than non-oncogenic B cell diseases, differential expression in B cell malignancies, and correlation with CLL stage and some predictive CLL markers. This potential should be investigated in further studies.

  4. Cloning and expression of canine CD25 for validation of an anti-human CD25 antibody to compare T regulatory lymphocytes in healthy dogs and dogs with osteosarcoma.

    PubMed

    Rissetto, K C; Rindt, H; Selting, K A; Villamil, J A; Henry, C J; Reinero, C R

    2010-05-15

    T regulatory cells (Tregs) are a unique subset of T helper cells that serve to modify/inhibit effector cells of the immune system and thus are essential to prevent autoimmunity. Overzealous Treg activity may contribute to impaired immune responses to cancer. Tregs can be phenotypically identified by proteins expressed on the cell surface (CD4 and CD25) and inside the cell (forkhead box3 (FoxP3)), although in dogs, no anti-canine CD25 antibody exists. We hypothesized that a mouse anti-human CD25 antibody definitively recognizes the canine protein and can be used to identify Tregs in dogs. We describe cloning and transfection of the canine CD25 gene into human HeLa cells with subsequent expression of the canine protein on the cell surface detected using an anti-human CD25 antibody in a flow cytometric assay. Validation of this antibody was used to identify CD4+CD25+FoxP3+ Tregs in 39 healthy dogs and 16 dogs with osteosarcoma (OSA). Results were expressed in five different ways and showed significantly fewer %CD4+CD25+ T lymphocytes expressing FoxP3 in blood of older dogs (>/=7 years) compared with the other two age groups (<2 and 2-6 years) (p<0.001) and fewer %CD4+CD25+FoxP3+ Tregs in the tumor draining lymph nodes of OSA patients compared to the unrelated lymph node (p=0.049). However, there was no significant difference in % Tregs in the peripheral blood or lymph nodes between the control dogs and those with OSA. While the CD25 antibody can be successfully used in a flow cytometric assay to identify Tregs, this study does not support clinical utility of phenotypic recognition of Tregs in dogs with OSA. Copyright 2010 Elsevier B.V. All rights reserved.

  5. Absolute measurements of fast neutrons using yttrium.

    PubMed

    Roshan, M V; Springham, S V; Rawat, R S; Lee, P; Krishnan, M

    2010-08-01

    Yttrium is presented as an absolute neutron detector for pulsed neutron sources. It has high sensitivity for detecting fast neutrons. Yttrium has the property of generating a monoenergetic secondary radiation in the form of a 909 keV gamma-ray caused by inelastic neutron interaction. It was calibrated numerically using MCNPX and does not need periodic recalibration. The total yttrium efficiency for detecting 2.45 MeV neutrons was determined to be f(n) approximately 4.1x10(-4) with an uncertainty of about 0.27%. The yttrium detector was employed in the NX2 plasma focus experiments and showed the neutron yield of the order of 10(8) neutrons per discharge.

  6. Biocompatibility of quantum dots (CdSe/ZnS ) in human amniotic membrane-derived mesenchymal stem cells in vitro.

    PubMed

    Wang, Gongping; Zeng, Guangwei; Wang, Caie; Wang, Huasheng; Yang, Bo; Guan, Fangxia; Li, Dongpeng; Feng, Xiaoshan

    2015-06-01

    Amniotic membrane-derived mesenchymal stem cells (hAM-dMSCs) are a potential source of mesenchymal stem cells which could be used to repair skin damage. The use of mesenchymal stem cells to repair skin damage requires safe, effective and biocompatible agents to evaluate the effectiveness of the result. Quantum dots (QDs) composed of CdSe/ZnS are semiconductor nanocrystals with broad excitation and narrow emission spectra, which have been considered as a new chemical and fluorescent substance for non-invasively labeling different cells in vitro and in vivo. This study investigated the cytotoxic effects of QDs on hAM-dMSCs at different times following labeling. Using 0.75, 1.5 and 3.0 μL between quantum dots, labeled human amniotic mesenchymal stem cells were collected on days 1, 2 and 4 and observed morphological changes, performed an MTT cell growth assay and flow cytometry for mesenchymal stem cells molecular markers. Quantum dot concentration 0.75 μg/mL labeled under a fluorescence microscope, cell morphology was observed, The MTT assay showed cells in the proliferative phase. Flow cytometry expression CD29, CD31, CD34, CD44, CD90, CD105 and CD106. Within a certain range of concentrations between quantum dots labeled human amniotic mesenchymal stem cells has good biocompatibility.

  7. Comparative study of CD4 and CD45RO T cells and CD20 B cells in cerebrospinal fluid of syphilitic meningitis and tuberculous meningitis patients.

    PubMed

    Yu, Nian; Zhang, Qiao-Quan; Zhang, Kang; Xie, Yuan; Zhu, Hai-Qing; Lin, Xing-Jian; Di, Qing

    2016-09-01

    This study was to investigate the differences of lymphocyte in the cerebrospinal fluid (CSF) of patients with syphilis meningitis (SM) and tuberculous meningitis (TBM) for new diagnostic insights. Totally, 79 cases of SM and 45 cases of TBM were enrolled. In the CSF, the CD4, CD45RO or CD20 positive lymphocytes were detected by immunohistochemistry. The proportion of CD4 T cells in the CSF lymphocytes in patients with SM was significantly higher than that in patients with TBM (p < 0.05). After medical therapy, there was a significantly decline trend of the CD4 T-cell proportion in both groups (p < 0.05). The proportion of CD45RO T cells in CSF lymphocytes of patients with SM was less than that of patients with TBM (p < 0.05). After medical therapy, the positive ratio of CD45RO T cells was increased in the CSF of both group patients (p < 0.05). The proportion of CD20B cells in the CSF lymphocytes was not obviously different between the two groups during every stage. In conclusion, there are strong differences of CD4 and CD45RO T-cell ratio, but not the CD20 B cells in the meningitis. CD4 and CD45RO T cells in CSF are a useful complement in differentially diagnosing SM and TBM; it contributes to further understand the pathogenesis and prognosis of SM and TBM. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  8. Reduced CD5(+) CD24(hi) CD38(hi) and interleukin-10(+) regulatory B cells in active anti-neutrophil cytoplasmic autoantibody-associated vasculitis permit increased circulating autoantibodies.

    PubMed

    Aybar, L T; McGregor, J G; Hogan, S L; Hu, Y; Mendoza, C E; Brant, E J; Poulton, C J; Henderson, C D; Falk, R J; Bunch, D O

    2015-05-01

    Pathogenesis of anti-neutrophil cytoplasmic autoantibody (ANCA)-associated vasculitis is B cell-dependent, although how particular B cell subsets modulate immunopathogenesis remains unknown. Although their phenotype remains controversial, regulatory B cells (Bregs ), play a role in immunological tolerance via interleukin (IL)-10. Putative CD19(+) CD24(hi) CD38(hi) and CD19(+) CD24(hi) CD27(+) Bregs were evaluated in addition to their CD5(+) subsets in 69 patients with ANCA-associated vasculitis (AAV). B cell IL-10 was verified by flow cytometry following culture with CD40 ligand and cytosine-phosphate-guanosine (CpG) DNA. Patients with active disease had decreased levels of CD5(+) CD24(hi) CD38(hi) B cells and IL-10(+) B cells compared to patients in remission and healthy controls (HCs). As IL-10(+) and CD5(+) CD24(hi) CD38(hi) B cells normalized in remission within an individual, ANCA titres decreased. The CD5(+) subset of CD24(hi) CD38(hi) B cells decreases in active disease and rebounds during remission similarly to IL-10-producing B cells. Moreover, CD5(+) B cells are enriched in the ability to produce IL-10 compared to CD5(neg) B cells. Together these results suggest that CD5 may identify functional IL-10-producing Bregs . The malfunction of Bregs during active disease due to reduced IL-10 expression may thus permit ANCA production. © 2014 British Society for Immunology.

  9. Influence of CD94 and NKG2A variants on susceptibility to rheumatoid arthritis and efficacy of anti-TNF treatment.

    PubMed

    Iwaszko, Milena; Świerkot, Jerzy; Kolossa, Katarzyna; Jeka, Sławomir; Wiland, Piotr; Bogunia-Kubik, Katarzyna

    2016-01-01

    The present study aimed to investigate relationships between the CD94 and NKG2A gene polymorphisms and the risk of rheumatoid arthritis (RA) development as well as their association with the response to anti-TNF therapy. A total of 284 patients with RA receiving anti-TNF therapy and 124 healthy subjects were enrolled to the study. Genotypings for CD94 (rs2302489) and NKG2A (rs7301582, rs2734440, rs2734414) polymorphisms were performed using a polymerase chain reaction (PCR) amplification employing LightSNiP assays (TIB-MolBiol, Berlin, Germany). Clinical response was evaluated at 12th and 24th week after initiation of the therapy according to the EULAR response criteria. The frequency of the CD94 AA genotype was significantly decreased in RA patients compared to controls (OR=0.44; P=0.016). The CD94 AA homozygotes were also more common among patients negative to anti-cyclic citrullinated peptide (anti-CCP) antibodies (OR=11.28; P=0.001) as compared to anti-CCP-positive patients and the presence of the CD94 allele A was associated with lack of anti-CCP antibodies (OR=5.00; P=0.0005). The CD94 rs2302489 TT genotype was over-represented in patients exhibiting worse EULAR response at 12th week (OR=3.33; P=0.017). Furthermore, the lack of response after 12 weeks was more frequent among patients carrying the NKG2A rs7301582C allele (OR=3.68; P=0.019) or the CC genotype (OR=3.58; P=0.035) in comparison to allele T or CT/TT genotypes, respectively. These results indicate that CD94 and NKG2A polymorphisms may contribute to genetic susceptibility to RA or affect the response to anti-TNF therapy in patients of Caucasian origin. Copyright © 2015 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

  10. CD4+ CD25high Foxp3+ regulatory T cells downregulate human Vδ2+ T-lymphocyte function triggered by anti-CD3 or phosphoantigen

    PubMed Central

    Mahan, C Scott; Thomas, Jeremy J; Boom, W Henry; Rojas, Roxana E

    2009-01-01

    Vδ2+ T cells, the major circulating T-cell receptor-γδ-positive (TCR-γδ+) T-cell subset in healthy adults, are involved in immunity against many microbial pathogens including Mycobacterium tuberculosis. Vδ2+ T cells recognize small phosphorylated metabolites (phosphoantigens), expand in response to whole M. tuberculosis bacilli, and complement the protective functions of CD4+ T cells. CD4+ CD25high Foxp3+ T cells (Tregs) comprise 5–10% of circulating T cells and are increased in patients with active tuberculosis (TB). We investigated whether, in addition to their known role in suppressing TCR-αβ+ lymphocytes, Tregs suppress Vδ2+ T-cell function. We found that depletion of Tregs from peripheral blood mononuclear cells increased Vδ2+ T-cell expansion in response to M. tuberculosis (H37Ra) in tuberculin-skin-test-positive donors. We developed a suppression assay with fluorescence-activated cell sorting-purified Tregs and Vδ2+ T cells by coincubating the two cell types at a 1 : 1 ratio. The Tregs partially suppressed interferon-γ secretion by Vδ2+ T cells in response to anti-CD3 monoclonal antibody plus interleukin-2 (IL-2). In addition, Tregs downregulated the Vδ2+ T-cell interferon-γ responses induced by phosphoantigen (BrHPP) and IL-2. Under the latter conditions there was no TCR stimulus for Tregs and therefore IL-2 probably triggered suppressor activity. Addition of purified protein derivative (PPD) increased the suppression of Vδ2+ T cells, suggesting that PPD activated antigen-specific Tregs. Our study provides evidence that Tregs suppress both anti-CD3 and antigen-driven Vδ2+ T-cell activation. Antigen-specific Tregs may therefore contribute to the Vδ2+ T-cell functional deficiencies observed in TB. PMID:19019089

  11. Blockade of CD354 (TREM-1) Ameliorates Anti-GBM-Induced Nephritis.

    PubMed

    Du, Yong; Wu, Tianfu; Zhou, Xin J; Davis, Laurie S; Mohan, Chandra

    2016-06-01

    CD354, Triggering Receptor of Myeloid Cells-1 (TREM-1), is a potent amplifier of myeloid immune responses. Our goal was to determine the expression and function of TREM-1 in immune-mediated nephritis. An anti-glomerular basement membrane antibody (anti-GBM)-induced nephritis model was employed, where mice were sensitized with rabbit IgG followed by anti-GBM serum to induce disease. Anti-GBM-treated 129x1/svJ mice developed severe nephritis whereas C57BL/6 (B6) mice were resistant to disease. Anti-GBM disease resulted in elevated renal TREM-1 messenger RNA (mRNA) and protein levels and increased urine TREM-1 levels in 129x1/svJ. TREM-1 blockade with an inhibitory peptide, LP17, inhibited proteinuria and renal disease as measured by glomerulonephritis class, severity of tubulointerstitial disease, crescent formation, and inflammatory cell infiltrates. In sum, TREM-1 is upregulated in renal inflammation and plays a vital role in driving disease. Thus, TREM-1 blockade emerges as a potential therapeutic avenue for immune-mediated renal diseases such as lupus nephritis.

  12. Recovery of yttrium from fluorescent powder of cathode ray tube, CRT: Zn removal by sulphide precipitation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Innocenzi, Valentina, E-mail: valentina.innocenzi1@univaq.it; De Michelis, Ida; Ferella, Francesco

    2013-11-15

    Highlights: • Treatment of fluorescent powder of CRT waste. • Factorial experimental designs to study acid leaching of fluorescent powder and the purification of leach liquors. • Recover of yttrium by precipitation using oxalic acid. • Suitable flowsheet to recover yttrium from fluorescent powder. - Abstract: This work is focused on the recovery of yttrium and zinc from fluorescent powder of cathode ray tube (CRT). Metals are extracted by sulphuric acid in the presence of hydrogen peroxide. Leaching tests are carried out according to a 2{sup 2} full factorial plan and the highest extraction yields for yttrium and zinc equalmore » to 100% are observed under the following conditions: 3 M of sulphuric acid, 10% v/v of H{sub 2}O{sub 2} concentrated solution at 30% v/v, 10% w/w pulp density, 70 °C and 3 h of reaction. Two series of precipitation tests for zinc are carried out: a 2{sup 2} full factorial design and a completely randomized factorial design. In these series the factors investigated are pH of solution during the precipitation and the amount of sodium sulphide added to precipitate zinc sulphide. The data of these tests are used to describe two empirical mathematical models for zinc and yttrium precipitation yields by regression analysis. The highest precipitation yields for zinc are obtained under the following conditions: pH equal to 2–2.5% and 10–12% v/v of Na{sub 2}S concentrated solution at 10% w/v. In these conditions the coprecipitation of yttrium is of 15–20%. Finally further yttrium precipitation experiments by oxalic acid on the residual solutions, after removing of zinc, show that yttrium could be recovered and calcined to obtain the final product as yttrium oxide. The achieved results allow to propose a CRT recycling process based on leaching of fluorescent powder from cathode ray tube and recovery of yttrium oxide after removing of zinc by precipitation. The final recovery of yttrium is 75–80%.« less

  13. Potent neutralizing anti-CD1d antibody reduces lung cytokine release in primate asthma model.

    PubMed

    Nambiar, Jonathan; Clarke, Adam W; Shim, Doris; Mabon, David; Tian, Chen; Windloch, Karolina; Buhmann, Chris; Corazon, Beau; Lindgren, Matilda; Pollard, Matthew; Domagala, Teresa; Poulton, Lynn; Doyle, Anthony G

    2015-01-01

    CD1d is a receptor on antigen-presenting cells involved in triggering cell populations, particularly natural killer T (NKT) cells, to release high levels of cytokines. NKT cells are implicated in asthma pathology and blockade of the CD1d/NKT cell pathway may have therapeutic potential. We developed a potent anti-human CD1d antibody (NIB.2) that possesses high affinity for human and cynomolgus macaque CD1d (KD ∼100 pM) and strong neutralizing activity in human primary cell-based assays (IC50 typically <100 pM). By epitope mapping experiments, we showed that NIB.2 binds to CD1d in close proximity to the interface of CD1d and the Type 1 NKT cell receptor β-chain. Together with data showing that NIB.2 inhibited stimulation via CD1d loaded with different glycolipids, this supports a mechanism whereby NIB.2 inhibits NKT cell activation by inhibiting Type 1 NKT cell receptor β-chain interactions with CD1d, independent of the lipid antigen in the CD1d antigen-binding cleft. The strong in vitro potency of NIB.2 was reflected in vivo in an Ascaris suum cynomolgus macaque asthma model. Compared with vehicle control, NIB.2 treatment significantly reduced bronchoalveolar lavage (BAL) levels of Ascaris-induced cytokines IL-5, IL-8 and IL-1 receptor antagonist, and significantly reduced baseline levels of GM-CSF, IL-6, IL-15, IL-12/23p40, MIP-1α, MIP-1β, and VEGF. At a cellular population level NIB.2 also reduced numbers of BAL lymphocytes and macrophages, and blood eosinophils and basophils. We demonstrate that anti-CD1d antibody blockade of the CD1d/NKT pathway modulates inflammatory parameters in vivo in a primate inflammation model, with therapeutic potential for diseases where the local cytokine milieu is critical.

  14. Selective liquid chromatographic separation of yttrium from heavier rare earth elements using acetic acid as a novel eluent.

    PubMed

    Kifle, Dejene; Wibetoe, Grethe

    2013-09-13

    One of the major difficulties in the rare earth elements separation is purification of yttrium from heavy rare earth elements. Thus, an HPLC method using acetic acid as novel eluent was explored for selective separation of yttrium form the heavy rare earth elements. When acetic acid is used as a mobile phase yttrium eluted with the lighter lanthanides. This is contrary to its relative position amongst heavier lanthanides when eluents commonly used for separation of rare earth elements were employed. The shift in elution position of yttrium with acetic acid as eluent may reflect a relatively lower stability constant of the yttrium-AcOH complex (in the same order as for the lighter lanthanides) compared to the corresponding AcOH complexes with heavy lanthanides, enabling selective separation of yttrium from the latter. The method was successfully used for selective separation of yttrium in mixed rare earth sample containing about 80% of yttrium and about 20% of heavy rare earth oxides. Thus, the use of AcOH as eluent is an effective approach for separating and determining the trace amounts of heavy rare earth elements in large amounts of yttrium matrix. Separation was performed on C18 column by running appropriate elution programs. The effluent from the column was monitored with diode array detector at absorbance wavelength of 658nm after post column derivatization with Arsenazo III. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. 16 CFR 309.20 - Labeling requirements for new covered vehicles.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ACTS OF CONGRESS LABELING REQUIREMENTS FOR ALTERNATIVE FUELS AND ALTERNATIVE FUELED VEHICLES Requirements for Alternative Fueled Vehicles § 309.20 Labeling requirements for new covered vehicles. (a... printed in process black ink on Hammermill Offset Opaque Vellum/S.70 Sky Blue (or equivalent) paper. (e...

  16. Targeting CD22 in B-cell malignancies: current status and clinical outlook.

    PubMed

    Sullivan-Chang, Loretta; O'Donnell, Robert T; Tuscano, Joseph M

    2013-08-01

    CD22 is a B-cell-specific transmembrane glycoprotein found on the surface of most B cells; it modulates B-cell function, survival and apoptosis. CD22 has emerged as an ideal target for monoclonal antibody (mAb)-based therapy of B-cell malignancies including most lymphomas and many leukemias. Epratuzumab, an anti-CD22 mAb, has been developed in various forms, including as an unlabeled (naked) mAb, as a radioimmunotherapeutic, as an antibody drug conjugate (ADC), and as a vehicle for CD22-targeted nanoparticles. While clinical trials with unlabeled epratuzumab have demonstrated modest results, its combination with rituximab in phase II studies has been more encouraging. Based on the potential for CD22 to become internalized, CD22-targeted constructs carrying radioisotopes or toxins have generated promising results. Radioimmunotherapy, utilizing ⁹⁰Y-labeled epratuzumab, was shown to be highly effective in patients with follicular lymphoma, generating a complete response (CR) rate of 92 % and progression-free survival of more than 2 years. ADC therapy is a promising therapeutic approach to B-cell malignancies which includes the direct conjugation of mAbs with cytotoxic agents. Phase II studies of inotuzumab ozogamicin, an ADC which combines anti-CD22 mAb with calicheamicin, an enediyne antibiotic which mediates apoptosis, in patients with acute lymphoblastic leukemia have produced an overall response rate (ORR) of greater than 50 % in treatment-refractory patients. Phase I trials of moxetumomab pasudotox, an ADC which combines anti-CD22 with PE38, a fragment of Pseudomonas exotoxin A, have been completed in hairy cell leukemia with a ORR of 86 %. Finally, a review of CD22-targeted nanoparticles, that include a doxorubicin-containing lipid complex that uses synthetic high-affinity CD22 ligand mimetics as well as anti-CD22 mAb-coated pegylated liposomas doxorubin (PLD), has demonstrated promising results in pre-clinical models of human lymphoma. Moreover, novel anti-CD

  17. 21 CFR 20.90 - Disclosure to contractors.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... INFORMATION Limitations on Exemptions § 20.90 Disclosure to contractors. (a) Data and information otherwise... of such data and information as Food and Drug Administration employees. (b) A written agreement between the Food and Drug Administration and any contractor shall be entered into before data and...

  18. 21 CFR 20.90 - Disclosure to contractors.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... INFORMATION Limitations on Exemptions § 20.90 Disclosure to contractors. (a) Data and information otherwise... of such data and information as Food and Drug Administration employees. (b) A written agreement between the Food and Drug Administration and any contractor shall be entered into before data and...

  19. Inhibition of VEGF-dependent angiogenesis by the anti-CD82 monoclonal antibody 4F9 through regulation of lipid raft microdomains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nomura, Sayaka; Iwata, Satoshi; Hatano, Ryo

    CD82 (also known as KAI1) belongs to the tetraspanin superfamily of type III transmembrane proteins, and is involved in regulating cell adhesion, migration and proliferation. In contrast to these well-established roles of CD82 in tumor biology, its function in endothelial cell (EC) activity and tumor angiogenesis is yet to be determined. In this study, we show that suppression of CD82 negatively regulates vascular endothelial growth factor (VEGF)-induced angiogenesis. Moreover, we demonstrate that the anti-CD82 mAb 4F9 effectively inhibits phosphorylation of VEGF receptor 2 (VEGFR2), which is the principal mediator of the VEGF-induced angiogenic signaling process in tumor angiogenesis, by regulatingmore » the organization of the lipid raft microdomain signaling platform in human EC. Our present work therefore suggests that CD82 on EC is a potential target for anti-angiogenic therapy in VEGFR2-dependent tumor angiogenesis. -- Highlights: •Knockdown of CD82 decreases EC migration, proliferation and angiogenesis. •Anti-CD82 mAb 4F9 inhibits EC migration, proliferation and angiogenesis. •4F9 inhibits VEGFR2 phosphorylation via control of CD82 distribution in lipid rafts.« less

  20. Uncovering the dual role of RHAMM as an HA receptor and a regulator of CD44 expression in RHAMM-expressing mesenchymal progenitor cells.

    PubMed

    Veiseh, Mandana; Leith, Sean J; Tolg, Cornelia; Elhayek, Sallie S; Bahrami, S Bahram; Collis, Lisa; Hamilton, Sara; McCarthy, James B; Bissell, Mina J; Turley, Eva

    2015-01-01

    The interaction of hyaluronan (HA) with mesenchymal progenitor cells impacts trafficking and fate after tissue colonization during wound repair and these events contribute to diseases such as cancer. How this interaction occurs is poorly understood. Using 10T½ cells as a mesenchymal progenitor model and fluorescent (F-HA) or gold-labeled HA (G-HA) polymers, we studied the role of two HA receptors, RHAMM and CD44, in HA binding and uptake in non-adherent and adherent mesenchymal progenitor (10T½) cells to mimic aspects of cell trafficking and tissue colonization. We show that fluorescent labeled HA (F-HA) binding/uptake was high in non-adherent cells but dropped over time as cells became increasingly adherent. Non-adherent cells displayed both CD44 and RHAMM but only function-blocking anti-RHAMM and not anti-CD44 antibodies significantly reduced F-HA binding/uptake. Adherent cells, which also expressed CD44 and RHAMM, primarily utilized CD44 to bind to F-HA since anti-CD44 but not anti-RHAMM antibodies blocked F-HA uptake. RHAMM overexpression in adherent 10T½ cells led to increased F-HA uptake but this increased binding remained CD44 dependent. Further studies showed that RHAMM-transfection increased CD44 mRNA and protein expression while blocking RHAMM function reduced expression. Collectively, these results suggest that cellular microenvironments in which these receptors function as HA binding proteins differ significantly, and that RHAMM plays at least two roles in F-HA binding by acting as an HA receptor in non-attached cells and by regulating CD44 expression and display in attached cells. Our findings demonstrate adhesion-dependent mechanisms governing HA binding/ uptake that may impact development of new mesenchymal cell-based therapies.

  1. Uncovering the dual role of RHAMM as an HA receptor and a regulator of CD44 expression in RHAMM-expressing mesenchymal progenitor cells

    PubMed Central

    Veiseh, Mandana; Leith, Sean J.; Tolg, Cornelia; Elhayek, Sallie S.; Bahrami, S. Bahram; Collis, Lisa; Hamilton, Sara; McCarthy, James B.; Bissell, Mina J.; Turley, Eva

    2015-01-01

    The interaction of hyaluronan (HA) with mesenchymal progenitor cells impacts trafficking and fate after tissue colonization during wound repair and these events contribute to diseases such as cancer. How this interaction occurs is poorly understood. Using 10T½ cells as a mesenchymal progenitor model and fluorescent (F-HA) or gold-labeled HA (G-HA) polymers, we studied the role of two HA receptors, RHAMM and CD44, in HA binding and uptake in non-adherent and adherent mesenchymal progenitor (10T½) cells to mimic aspects of cell trafficking and tissue colonization. We show that fluorescent labeled HA (F-HA) binding/uptake was high in non-adherent cells but dropped over time as cells became increasingly adherent. Non-adherent cells displayed both CD44 and RHAMM but only function-blocking anti-RHAMM and not anti-CD44 antibodies significantly reduced F-HA binding/uptake. Adherent cells, which also expressed CD44 and RHAMM, primarily utilized CD44 to bind to F-HA since anti-CD44 but not anti-RHAMM antibodies blocked F-HA uptake. RHAMM overexpression in adherent 10T½ cells led to increased F-HA uptake but this increased binding remained CD44 dependent. Further studies showed that RHAMM-transfection increased CD44 mRNA and protein expression while blocking RHAMM function reduced expression. Collectively, these results suggest that cellular microenvironments in which these receptors function as HA binding proteins differ significantly, and that RHAMM plays at least two roles in F-HA binding by acting as an HA receptor in non-attached cells and by regulating CD44 expression and display in attached cells. Our findings demonstrate adhesion-dependent mechanisms governing HA binding/ uptake that may impact development of new mesenchymal cell-based therapies. PMID:26528478

  2. Primary Central Nervous System T-Cell Lymphoma With Aberrant Expression of CD20 and CD79a: A Diagnostic Pitfall.

    PubMed

    Gupta, Neha; Nasim, Mansoor; Spitzer, Silvia G; Zhang, Xinmin

    2017-10-01

    Primary central nervous system T-cell lymphoma (PCNSTCL) is rare, accounting for 2% of CNS lymphomas. We report the first case of PCNSTCL with aberrant expression of CD20 and CD79a in an 81-year-old man with a left periventricular brain mass. A biopsy revealed dense lymphoid infiltrate consisting of medium-sized cells in a background of gliosis and many histiocytes. The lymphoid cells were positive for CD2, CD3, CD7, CD8, T-cell intracellular antigen-1, granzyme B, CD20, and CD79a and negative for CD4, CD5, PAX-5, OCT-2, BOB-1, human herpes virus-8, and Epstein-Barr virus-encoded small RNAs. Molecular studies revealed clonal TCR-β and TCR-γ gene rearrangements and negative immunoglobulin gene rearrangements. The patient was treated with chemotherapy (vincristine and methotrexate) and rituximab, but he died 1 month after the diagnosis. This is a unique case that emphasizes the use of a multimodal approach, including a broad immunohistochemical panel and molecular studies in lineage determination for lymphomas with ambiguous phenotype.

  3. Ex Vivo Expansion of CD34+CD90+CD49f+ Hematopoietic Stem and Progenitor Cells from Non‐Enriched Umbilical Cord Blood with Azole Compounds

    PubMed Central

    Bari, Sudipto; Zhong, Qixing; Fan, Xiubo; Poon, Zhiyong; Lim, Alvin Soon Tiong; Lim, Tse Hui; Dighe, Niraja; Li, Shang; Chiu, Gigi Ngar Chee; Chai, Christina Li Lin

    2018-01-01

    Abstract Umbilical cord blood (UCB) transplants in adults have slower hematopoietic recovery compared to bone marrow (BM) or peripheral blood (PB) stem cells mainly due to low number of total nucleated cells and hematopoietic stem and progenitor cells (HSPC). As such in this study, we aimed to perform ex vivo expansion of UCB HSPC from non‐enriched mononucleated cells (MNC) using novel azole‐based small molecules. Freshly‐thawed UCB–MNC were cultured in expansion medium supplemented with small molecules and basal cytokine cocktail. The effects of the expansion protocol were measured based on in vitro and in vivo assays. The proprietary library of >50 small molecules were developed using structure‐activity‐relationship studies of SB203580, a known p38‐MAPK inhibitor. A particular analog, C7, resulted in 1,554.1 ± 27.8‐fold increase of absolute viable CD45+CD34+CD38–CD45RA– progenitors which was at least 3.7‐fold higher than control cultures (p < .001). In depth phenotypic analysis revealed >600‐fold expansion of CD34+/CD90+/CD49f+ rare HSPCs coupled with significant (p < .01) increase of functional colonies from C7 treated cells. Transplantation of C7 expanded UCB grafts to immunodeficient mice resulted in significantly (p < .001) higher engraftment of human CD45+ and CD45+CD34+ cells in the PB and BM by day 21 compared to non‐expanded and cytokine expanded grafts. The C7 expanded grafts maintained long‐term human multilineage chimerism in the BM of primary recipients with sustained human CD45 cell engraftment in secondary recipients. In conclusion, a small molecule, C7, could allow for clinical development of expanded UCB grafts without pre‐culture stem cell enrichment that maintains in vitro and in vivo functionality. Stem Cells Translational Medicine 2018;7:376–393 PMID:29392885

  4. A Quantitative Comparison of Anti-HIV Gene Therapy Delivered to Hematopoietic Stem Cells versus CD4+ T Cells

    PubMed Central

    Savkovic, Borislav; Nichols, James; Birkett, Donald; Applegate, Tanya; Ledger, Scott; Symonds, Geoff; Murray, John M.

    2014-01-01

    Gene therapy represents an alternative and promising anti-HIV modality to highly active antiretroviral therapy. It involves the introduction of a protective gene into a cell, thereby conferring protection against HIV. While clinical trials to date have delivered gene therapy to CD4+T cells or to CD34+ hematopoietic stem cells (HSC), the relative benefits of each of these two cellular targets have not been conclusively determined. In the present analysis, we investigated the relative merits of delivering a dual construct (CCR5 entry inhibitor + C46 fusion inhibitor) to either CD4+T cells or to CD34+ HSC. Using mathematical modelling, we determined the impact of each scenario in terms of total CD4+T cell counts over a 10 year period, and also in terms of inhibition of CCR5 and CXCR4 tropic virus. Our modelling determined that therapy delivery to CD34+ HSC generally resulted in better outcomes than delivery to CD4+T cells. An early one-off therapy delivery to CD34+ HSC, assuming that 20% of CD34+ HSC in the bone marrow were gene-modified (G+), resulted in total CD4+T cell counts ≥180 cells/ µL in peripheral blood after 10 years. If the uninfected G+ CD4+T cells (in addition to exhibiting lower likelihood of becoming productively infected) also exhibited reduced levels of bystander apoptosis (92.5% reduction) over non gene-modified (G-) CD4+T cells, then total CD4+T cell counts of ≥350 cells/ µL were observed after 10 years, even if initially only 10% of CD34+ HSC in the bone marrow received the protective gene. Taken together our results indicate that: 1.) therapy delivery to CD34+ HSC will result in better outcomes than delivery to CD4+T cells, and 2.) a greater impact of gene therapy will be observed if G+ CD4+T cells exhibit reduced levels of bystander apoptosis over G- CD4+T cells. PMID:24945407

  5. A novel anti-CD22 scFv-apoptin fusion protein induces apoptosis in malignant B-cells.

    PubMed

    Agha Amiri, Solmaz; Shahhosseini, Soraya; Zarei, Najmeh; Khorasanizadeh, Dorsa; Aminollahi, Elahe; Rezaie, Faegheh; Zargari, Mehryar; Azizi, Mohammad; Khalaj, Vahid

    2017-12-01

    CD22 marker is a highly internalizing antigen which is located on the surface of B-cells and is being used as a promising target for treatment of B cell malignancies. Monoclonal antibodies targeting CD22 have been introduced and some are currently under investigation in clinical trials. Building on the success of antibody drug conjugates, we developed a fusion protein consisting of a novel anti-CD22 scFv and apoptin and tested binding and therapeutic effects in lymphoma cells. The recombinant protein was expressed in E. coli and successfully purified and refolded. In vitro binding analysis by immunofluorescence and flow cytometry demonstrated that the recombinant protein specifically binds to CD22 positive Raji cells but not to CD22 negative Jurkat cells. The cytotoxic properties of scFv-apoptin were assessed by an MTT assay and Annexin V/PI flow cytometry analysis and showed that the recombinant protein induced apoptosis preferentially in Raji cells with no detectable effects in Jurkat cells. Our findings indicated that the recombinant anti-CD22 scFv-apoptin fusion protein could successfully cross the cell membrane and induce apoptosis with high specificity, make it as a promising molecule for immunotherapy of B-cell malignancies.

  6. Differential cross-reactivity of monoclonal antibody OPD4 (anti-CD45RO) in macaques.

    PubMed

    Wang, Xiaolei; Pahar, Bapi; Rasmussen, Terri; Alvarez, Xavier; Dufour, Jason; Rasmussen, Kelsi; Lackner, Andrew A; Veazey, Ronald S

    2008-01-01

    Immunologic research in nonhuman primates is occasionally limited by the availability of reagents that cross-react in nonhuman primates. One major limitation has been the lack of a monoclonal antibody to CD45RO. Although the monoclonal antibody UCHL-1 is used to detect CD45RO isoforms in humans, it does not react with nonhuman primates, mandating the use of alternative strategies to define "memory" T cell responses in nonhuman primates. The current study examined the reactivity and specificity of another antibody against CD45RO, clone OPD4, in macaques. Here we demonstrate that OPD4 specifically labels memory CD4+ T cells in approximately 44% of rhesus macaques (Macaca mulatta) of Indian but not Chinese origin. In contrast, tissues from pigtail macaques (Macaca nemestrina) react with this clone, indicating that OPD4 may be useful for examining memory CD4+ T cells in certain macaques, but its utility may be limited in other species or even among individual macaques.

  7. Differential cross-reactivity of monoclonal antibody OPD4 (anti-CD45RO) in macaques

    PubMed Central

    Wang, Xiaolei; Pahar, Bapi; Rasmussen, Terri; Alvarez, Xavier; Dufour, Jason; Rasmussen, Kelsi; Lackner, Andrew A.; Veazey, Ronald S.

    2008-01-01

    Immunologic research in nonhuman primates is occasionally limited by the availability of reagents that cross react in nonhuman primates. One major limitation has been the lack of a monoclonal antibody to CD45RO. Although the monoclonal antibody UCHL-1 is used to detect CD45RO isoforms in humans, it does not react with nonhuman primates, mandating the use of alternative strategies to define “memory” T cell responses in nonhuman primates. The current study examined the reactivity and specificity of another antibody against CD45RO, clone OPD4, in macaques. Here we demonstrate that OPD4 specifically labels memory CD4+ T cells in ~44% of rhesus macaques (Macaca mulatta) of Indian, but not Chinese origin. In contrast, tissues from pigtail macaques (Macaca nemestrina) react with this clone, indicating that OPD4 may be useful for examining memory CD4+ T cells in certain macaques, but its utility may be limited in other species or even among individual macaques. PMID:18304631

  8. CD40 ligand blockade induces CD4+ T cell tolerance and linked suppression.

    PubMed

    Honey, K; Cobbold, S P; Waldmann, H

    1999-11-01

    The CD40-CD40 ligand (CD40L) interaction is a key event in the initiation of an adaptive immune response, and as such the therapeutic value of CD40L blockade has been studied in many experimental models of tissue transplantation and autoimmune disease. In rodents, transplantation of allogeneic tissues under the cover of anti-CD40L Abs has resulted in prolonged graft survival but not tolerance. In this report, we show that failure to induce tolerance probably results from the inability of anti-CD40L Abs to prevent graft rejection elicited by the CD8+ T cell subset. When the CD8+ T cell population is controlled independently, using anti-CD8 Abs, then tolerance is possible. Transplantation tolerance induced by anti-CD4 mAbs can often be associated with dominant regulation, manifested as infectious tolerance and linked suppression, both of which are mediated by CD4+ T cells. We show here that CD4+ T cells rendered tolerant using anti-CD40L therapy exhibit the same regulatory property of linked suppression, as demonstrated by their ability to accept grafts expressing third party Ags only if they are expressed in conjunction with the tolerated Ags. This observation of linked suppression reveals a hitherto undocumented consequence of CD40L blockade that suggests the tolerant state is maintained by a dominant regulatory mechanism. Our results suggest that, although anti-CD40L Abs are attractive clinical immunotherapeutic agents, additional therapies to control aggressive CD8+ T cell responses may be required.

  9. 27 CFR 20.136 - Labeling regulations of other agencies.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Labeling regulations of other agencies. 20.136 Section 20.136 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM...

  10. 27 CFR 20.136 - Labeling regulations of other agencies.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Labeling regulations of other agencies. 20.136 Section 20.136 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM...

  11. 27 CFR 20.136 - Labeling regulations of other agencies.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Labeling regulations of other agencies. 20.136 Section 20.136 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM...

  12. 27 CFR 20.136 - Labeling regulations of other agencies.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Labeling regulations of other agencies. 20.136 Section 20.136 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM...

  13. 27 CFR 20.136 - Labeling regulations of other agencies.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Labeling regulations of other agencies. 20.136 Section 20.136 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM...

  14. Reduced numbers of mucosal DR(int) macrophages and increased numbers of CD103(+) dendritic cells during anti-TNF-α treatment in patients with Crohn's disease.

    PubMed

    Dige, Anders; Magnusson, Maria K; Öhman, Lena; Hvas, Christian Lodberg; Kelsen, Jens; Wick, Mary Jo; Agnholt, Jørgen

    2016-01-01

    Anti-TNF-α treatment constitutes a mainstay in the treatment of Crohn's disease (CD), but its mechanisms of action are not fully understood. We aimed to investigate the effects of adalimumab, a human monoclonal TNF-α antibody, on macrophage (MQ) and dendritic cell (DC) subsets in mucosal biopsies and peripheral blood. Intestinal biopsies and blood samples were obtained from 12 different CD patients both before and 4 weeks after the initiation of the induction of adalimumab treatment. Endoscopic disease activity was estimated by the Simple Endoscopic Score for Crohn's Disease. Biopsies were obtained from inflamed and non-inflamed areas. The numbers of lamina propria CD14 (+) DR(int) and CD14 (+) DR(hi) MQs, CD141(+), CD141(-) and CD103(+) DCs subsets, and circulating monocytes and DCs were analyzed using flow cytometry. At baseline, we observed higher numbers of DR(int) MQs and lower numbers of CD103(+) DCs in inflamed versus non-inflamed mucosa [843 vs. 391/10(5) lamina propria mononuclear cells (LPMCs) (p < 0.05) and 9 vs. 19 × 10(5) LPMCs (p = 0.01), respectively]. After four weeks of adalimumab treatment, the numbers of DR(int) MQs decreased [843 to 379/10(5) LPMCs (p = 0.03)], whereas the numbers of CD103(+) DCs increased [9-20 × 10(5) LPMCs (p = 0.003)] compared with baseline. In peripheral blood, no alterations were observed in monocyte or DC numbers between baseline and week 4. In CD, mucosal inflammation is associated with high numbers of DR(int) MQs and low numbers of CD103(+) DCs. This composition of intestinal myeloid subsets is reversed by anti-TNF-α treatment. These results suggest that DR(int) MQs play a pivotal role in CD inflammation.

  15. DC vaccination with anti-CD25 treatment leads to long-term immunity against experimental glioma

    PubMed Central

    Maes, Wim; Rosas, Georgina Galicia; Verbinnen, Bert; Boon, Louis; De Vleeschouwer, Steven; Ceuppens, Jan L.; Van Gool, Stefaan W.

    2009-01-01

    We studied the feasibility, efficacy, and mechanisms of dendritic cell (DC) immunotherapy against murine malignant glioma in the experimental GL261 intracranial (IC) tumor model. When administered prophylactically, mature DCs (DCm) ex vivo loaded with GL261 RNA (DCm-GL261-RNA) protected half of the vaccinated mice against IC glioma, whereas treatment with mock-loaded DCm or DCm loaded with irrelevant antigens did not result in tumor protection. In DCm-GL261-RNA–vaccinated mice, a tumor-specific cellular immune response was observed ex vivo in the spleen and tumor-draining lymph node cells. Specificity was also shown in vivo on the level of tumor challenge. Depletion of CD8+ T-cells by anti-CD8 treatment at the time of tumor challenge demonstrated their essential role in vaccine- mediated antitumor immunity. Depletion of CD25+ regulatory T-cells (Tregs) by anti-CD25 (aCD25) treatment strongly enhanced the efficacy of DC vaccination and was itself also protective, independently of DC vaccination. However, DC vaccination was essential to protect the animals from IC tumor rechallenge. No long-term protection was observed in animals that initially received aCD25 treatment only. In mice that received DC and/or aCD25 treatment, we retrieved tumor-specific brain-infiltrating cytotoxic T-lymphocytes. These data clearly demonstrate the effectiveness of DC vaccination for the induction of long-lasting immunological protection against IC glioma. They also show the beneficial effect of Treg depletion in this kind of glioma immunotherapy, even combined with DC vaccination. PMID:19336528

  16. Monoclonal antibody anti-MPO is useful in recognizing minimally differentiated acute myeloid leukaemia.

    PubMed

    Praxedes, M K; De Oliveira, L Z; Pereira, W da V; Quintana, I Z; Tabak, D G; De Oliveira, M S

    1994-01-01

    The enzyme myeloperoxidase (MPO) is the most specific marker of myeloid lineage. The recognition of acute myeloid leukaemia (AML) with minimally differentiation (AML-M0) is established with methods that include myeloid markers CD13/CD33 and detection of MPO in blast cells by immunological techniques or electron microscopy cytochemistry (EM). We have analysed the presence of MPO in leukaemic blast cells by conventional cytochemistry and immunological methods using a monoclonal antibody anti-MPO (CLB-MPO1) in 121 cases of acute leukaemia. The aim of the study was to investigate the sensitivity of this McAb to identify AML-M0, as CD13/CD33 can be expressed in some cases of acute lymphoblastic leukaemia (ALL) and EM cytochemistry is not always available in many laboratories. Anti-MPO was positive in all cases of AML (M1-M5) which were positive by Sudan Black B reaction in similar or higher percentage ratio for each case, although in some of them did not label with CD13/CD33 tested by IF and IPc techniques. Based on the anti-MPO positivity, 5 out of 10 cases called undifferentiated leukaemia (AUL) were reclassified as AML-M0, though 4 cases were CD13/CD33 negative. Furthermore, after analysing the anti-MPO expression among 32 cases of ALL, we had to reclassify four of them as acute biphenotypic leukaemia. We conclude that anti-MPO is a very sensitive and reliable tool in AML diagnosis and has an important role in distinguishing minimally differentiated AML and biphenotypic acute leukaemia from AUL and ALL.

  17. Ectopic expression of anti-HIV-1 shRNAs protects CD8{sup +} T cells modified with CD4ζ CAR from HIV-1 infection and alleviates impairment of cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamata, Masakazu, E-mail: masa3k@ucla.edu; Kim, Patrick Y.; Ng, Hwee L.

    Chimeric antigen receptors (CARs) are artificially engineered receptors that confer a desired specificity to immune effector T cells. As an HIV-1-specific CAR, CD4ζ CAR has been extensively tested in vitro as well as in clinical trials. T cells modified with this CAR mediated highly potent anti-HIV-1 activities in vitro and were well-tolerated in vivo, but exerted limited effects on viral load and reservoir size due to poor survival and/or functionality of the transduced cells in patients. We hypothesize that ectopic expression of CD4ζ on CD8{sup +} T cells renders them susceptible to HIV-1 infection, resulting in poor survival of those cells. To testmore » this possibility, highly purified CD8{sup +} T cells were genetically modified with a CD4ζ-encoding lentiviral vector and infected with HIV-1. CD8{sup +} T cells were vulnerable to HIV-1 infection upon expression of CD4ζ as evidenced by elevated levels of p24{sup Gag} in cells and culture supernatants. Concurrently, the number of CD4ζ-modified CD8{sup +} T cells was reduced relative to control cells upon HIV-1 infection. To protect these cells from HIV-1 infection, we co-expressed two anti-HIV-1 shRNAs previously developed by our group together with CD4ζ. This combination vector was able to suppress HIV-1 infection without impairing HIV-1-dependent effector activities of CD4ζ. In addition, the number of CD4ζ-modified CD8{sup +} T cells maintained similar levels to that of the control even under HIV-1 infection. These results suggest that protecting CD4ζ-modified CD8{sup +} T cells from HIV-1 infection is required for prolonged HIV-1-specific immune surveillance. - Highlights: • Ectopic expression of CD4ζ CAR in CD8{sup +} T cells renders them susceptible to HIV-1 infection. • Co-expression of two anti-HIV-1 shRNAs protects CD4ζ CAR-modified CD8{sup +} T cells from HIV-1 infection. • Protecting CD4ζ CAR-modified CD8{sup +} T cells from HIV-1 infection suppresses its cytopathic effect.« less

  18. The in vivo mechanism of action of CD20 monoclonal antibodies depends on local tumor burden

    PubMed Central

    Boross, Peter; Jansen, J.H. Marco; de Haij, Simone; Beurskens, Frank J.; van der Poel, Cees E.; Bevaart, Lisette; Nederend, Maaike; Golay, Josée; van de Winkel, Jan G.J.; Parren, Paul W.H.I.; Leusen, Jeanette H.W.

    2011-01-01

    Background CD20 monoclonal antibodies are widely used in clinical practice. Antibody-dependent cellular cytotoxicity, complement-dependent cytotoxicity and direct cell death have been suggested to be important effector functions for CD20 antibodies. However, their specific contributions to the in vivo mechanism of action of CD20 immunotherapy have not been well defined. Design and Methods Here we studied the in vivo mechanism of action of type I (rituximab and ofatumumab) and type II (HuMab-11B8) CD20 antibodies in a peritoneal, syngeneic, mouse model with EL4-CD20 cells using low and high tumor burden. Results Interestingly, we observed striking differences in the in vivo mechanism of action of CD20 antibodies dependent on tumor load. In conditions of low tumor burden, complement was sufficient for tumor killing both for type I and type II CD20 antibodies. In contrast, in conditions of high tumor burden, activating FcγR (specifically FcγRIII), active complement and complement receptor 3 were all essential for tumor killing. Our data suggest that complement-enhanced antibody-dependent cellular cytotoxicity may critically affect tumor killing by CD20 antibodies in vivo. The type II CD20 antibody 11B8, which is a poor inducer of complement activation, was ineffective against high tumor burden. Conclusions Tumor burden affects the in vivo mechanism of action of CD20 antibodies. Low tumor load can be eliminated by complement alone, whereas elimination of high tumor load requires multiple effector mechanisms. PMID:21880632

  19. Label Review Training: Module 1: Label Basics, Page 20

    EPA Pesticide Factsheets

    This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. This section focuses on supplemental labeling.

  20. Investigation of magnetic order in SmTr2Zn20 (Tr=Fe ,Co,Ru) and SmTr2Cd20 (Tr=Ni ,Pd)

    NASA Astrophysics Data System (ADS)

    Yazici, D.; White, B. D.; Ho, P.-C.; Kanchanavatee, N.; Huang, K.; Friedman, A. J.; Wong, A. S.; Burnett, V. W.; Dilley, N. R.; Maple, M. B.

    2014-10-01

    Single crystals of the "cage compounds" SmTr2Zn20 (Tr=Fe, Co, Ru) and SmTr2Cd20 (Tr=Ni, Pd) have been investigated by means of electrical resistivity, magnetization, and specific-heat measurements. The compounds SmFe2Zn20,SmRu2Zn20, and SmNi2Cd20 exhibit ferromagnetic order with Curie temperatures of TC=47.4, 7.6, and 7.5 K, respectively, whereas SmPd2Cd20 is an antiferromagnet with a Néel temperature of TN=3.4 K. No evidence for magnetic order is observed in SmCo2Zn20 down to 110 mK. The Sommerfeld coefficients γ are found to be 57 mJ /molK2 for SmFe2Zn20,79.5 mJ /molK2 for SmCo2Zn20,258 mJ /molK2 for SmRu2Zn20,165 mJ /molK2 for SmNi2Cd20, and 208 mJ /molK2 for SmPd2Cd20. Enhanced values of γ and a quadratic temperature dependence of the electrical resistivity at low temperature for SmRu2Zn20 and SmPd2Cd20 suggest an enhancement of the quasiparticle masses due to hybridization between localized 4f and conduction electron states.

  1. Immuno-PET Imaging of CD30-Positive Lymphoma Using 89Zr-Desferrioxamine-Labeled CD30-Specific AC-10 Antibody.

    PubMed

    Rylova, Svetlana N; Del Pozzo, Luigi; Klingeberg, Cathrin; Tönnesmann, Roswitha; Illert, Anna L; Meyer, Philipp T; Maecke, Helmut R; Holland, Jason P

    2016-01-01

    The CD30-specific antibody-drug conjugate, brentuximab vedotin, is approved for the treatment of relapsed, refractory Hodgkin lymphomas and systemic anaplastic large T-cell lymphomas. Multiple ongoing clinical trials are investigating brentuximab vedotin efficacy in other CD30-positive hematologic malignancies. Because CD30 expression varies among different types of lymphoma and can also change during the course of treatment, companion diagnostic imaging of CD30 could be a valuable tool in optimizing patient-specific brentuximab vedotin treatment regimens. The mouse antihuman CD30 antibody AC-10 was radiolabeled with the positron-emitting radionuclide (89)Zr. The stability and specificity of (89)Zr-desferrioxamine (DFO)-labeled CD30-specific AC-10 antibody ((89)Zr-DFO-AC-10) was evaluated in vitro. The pharmacokinetics of (89)Zr-DFO-AC-10 was studied in BALB/c nude mice bearing subcutaneous human Karpas 299 tumors (CD30-positive model) or A-431 tumors (CD30-negative model) using PET/CT imaging, biodistribution studies, and autoradiography. AC-10 was conjugated with a DFO B chelator and radiolabeled with (89)Zr to give formulated (89)Zr-DFO-AC-10 with a radiochemical yield of 80%, radiochemical purity greater than 99%, and specific activity of 111-148 MBq/mg. (89)Zr-DFO-AC-10 was stable in mouse and human sera and preserved the immunoreactivity toward CD30. Biodistribution data showed the highest tissue accumulation of (89)Zr-DFO-AC-10 in CD30-positive tumors, with 37.9% ± 8.2% injected activity per gram of tissue at 72 h after injection, whereas uptake in CD30-negative tumors was 11.0% ± 0.4%. The specificity of (89)Zr-DFO-AC-10 binding to CD30 in vivo was confirmed by blocking studies. Time-activity curves showed that between 24 and 144 h after injection, tumor-to-muscle ratios increased from 18.9 to 51.8 in the CD30-positive model and from 4.8 to 8.7 in the CD30-negative model. Tumor-to-blood ratios also increased, from 3.2 to 13.6 and from 1 to 2 in the CD30

  2. Potent neutralizing anti-CD1d antibody reduces lung cytokine release in primate asthma model

    PubMed Central

    Nambiar, Jonathan; Clarke, Adam W; Shim, Doris; Mabon, David; Tian, Chen; Windloch, Karolina; Buhmann, Chris; Corazon, Beau; Lindgren, Matilda; Pollard, Matthew; Domagala, Teresa; Poulton, Lynn; Doyle, Anthony G

    2015-01-01

    CD1d is a receptor on antigen-presenting cells involved in triggering cell populations, particularly natural killer T (NKT) cells, to release high levels of cytokines. NKT cells are implicated in asthma pathology and blockade of the CD1d/NKT cell pathway may have therapeutic potential. We developed a potent anti-human CD1d antibody (NIB.2) that possesses high affinity for human and cynomolgus macaque CD1d (KD ∼100 pM) and strong neutralizing activity in human primary cell-based assays (IC50 typically <100 pM). By epitope mapping experiments, we showed that NIB.2 binds to CD1d in close proximity to the interface of CD1d and the Type 1 NKT cell receptor β-chain. Together with data showing that NIB.2 inhibited stimulation via CD1d loaded with different glycolipids, this supports a mechanism whereby NIB.2 inhibits NKT cell activation by inhibiting Type 1 NKT cell receptor β-chain interactions with CD1d, independent of the lipid antigen in the CD1d antigen-binding cleft. The strong in vitro potency of NIB.2 was reflected in vivo in an Ascaris suum cynomolgus macaque asthma model. Compared with vehicle control, NIB.2 treatment significantly reduced bronchoalveolar lavage (BAL) levels of Ascaris-induced cytokines IL-5, IL-8 and IL-1 receptor antagonist, and significantly reduced baseline levels of GM-CSF, IL-6, IL-15, IL-12/23p40, MIP-1α, MIP-1β, and VEGF. At a cellular population level NIB.2 also reduced numbers of BAL lymphocytes and macrophages, and blood eosinophils and basophils. We demonstrate that anti-CD1d antibody blockade of the CD1d/NKT pathway modulates inflammatory parameters in vivo in a primate inflammation model, with therapeutic potential for diseases where the local cytokine milieu is critical. PMID:25751125

  3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  4. Measurement of basophil-activating capacity of grass pollen allergens, allergoids and hypoallergenic recombinant derivatives by flow cytometry using anti-CD203c.

    PubMed

    Kahlert, H; Cromwell, O; Fiebig, H

    2003-09-01

    The assessment of the basophil-activating potential is an important aspect in the development of improved preparations for specific immunotherapy. The aim of the study was to evaluate the suitability of CD203c expression as a measure of basophil activation to compare allergoids with original allergen extracts, and recombinant hypoallergenic allergen derivatives with recombinant wild-type and natural allergens. Heparinized whole blood samples from grass pollen allergic subjects were stimulated with grass pollen allergens and allergen derivatives followed by labelling of the basophils with PE-conjugated anti-CD203c. After lysis of the erythrocytes and fixation, the basophils were detected by flow cytometry. In some experiments, histamine release was determined simultaneously. Grass pollen allergoids revealed a 10-10 000-fold reduction of basophil-activating capacity measured by CD203c expression. The deletion mutant DM4 of rPhl p 5b showed stronger hypoallergenic characteristics in a range of 50-10 000-fold reduction, whereas a combination mutant of rPhl p 5b and Phl p 6 revealed less hypoallergenic features. Histamine release experiments led to a similar outcome as CD203c measurement. The measurement of CD203c expression on basophils by flow cytometry provides a rapid and sensitive method for the estimation of the allergic or hypoallergenic features of allergen preparations. The results demonstrated the hypoallergenicity of grass pollen allergoids and of the rPhl p 5b variant DM4, which may be a candidate in future preparations for specific immunotherapy.

  5. CdSe/ZnS Quantum Dots-Labeled Mesenchymal Stem Cells for Targeted Fluorescence Imaging of Pancreas Tissues and Therapy of Type 1 Diabetic Rats.

    PubMed

    Liu, Haoqi; Tang, Wei; Li, Chao; Lv, Pinlei; Wang, Zheng; Liu, Yanlei; Zhang, Cunlei; Bao, Yi; Chen, Haiyan; Meng, Xiangying; Song, Yan; Xia, Xiaoling; Pan, Fei; Cui, Daxiang; Shi, Yongquan

    2015-12-01

    Mesenchymal stem cells (MSCs) have been used for therapy of type 1 diabetes mellitus. However, the in vivo distribution and therapeutic effects of transplanted MSCs are not clarified well. Herein, we reported that CdSe/ZnS quantum dots-labeled MSCs were prepared for targeted fluorescence imaging and therapy of pancreas tissues in rat models with type 1 diabetes. CdSe/ZnS quantum dots were synthesized, their biocompatibility was evaluated, and then, the appropriate concentration of quantum dots was selected to label MSCs. CdSe/ZnS quantum dots-labeled MSCs were injected into mouse models with type 1 diabetes via tail vessel and then were observed by using the Bruker In-Vivo F PRO system, and the blood glucose levels were monitored for 8 weeks. Results showed that prepared CdSe/ZnS quantum dots owned good biocompatibility. Significant differences existed in distribution of quantum dots-labeled MSCs between normal control rats and diabetic rats (p < 0.05). The ratios of the fluorescence intensity (RFI) analysis showed an accumulation rate of MSCs in the pancreas of rats in the diabetes group which was about 32 %, while that in the normal control group rats was about 18 %. The blood glucose levels were also monitored for 8 weeks after quantum dots-labeled MSC injection. Statistical differences existed between the blood glucose levels of the diabetic rat control group and MSC-injected diabetic rat group (p < 0.01), and the MSC-injected diabetic rat group displayed lower blood glucose levels. In conclusion, CdSe/ZnS-labeled MSCs can target in vivo pancreas tissues in diabetic rats, and significantly reduce the blood glucose levels in diabetic rats, and own potential application in therapy of diabetic patients in the near future.

  6. CdSe/ZnS Quantum Dots-Labeled Mesenchymal Stem Cells for Targeted Fluorescence Imaging of Pancreas Tissues and Therapy of Type 1 Diabetic Rats

    NASA Astrophysics Data System (ADS)

    Liu, Haoqi; Tang, Wei; Li, Chao; Lv, Pinlei; Wang, Zheng; Liu, Yanlei; Zhang, Cunlei; Bao, Yi; Chen, Haiyan; Meng, Xiangying; Song, Yan; Xia, Xiaoling; Pan, Fei; Cui, Daxiang; Shi, Yongquan

    2015-06-01

    Mesenchymal stem cells (MSCs) have been used for therapy of type 1 diabetes mellitus. However, the in vivo distribution and therapeutic effects of transplanted MSCs are not clarified well. Herein, we reported that CdSe/ZnS quantum dots-labeled MSCs were prepared for targeted fluorescence imaging and therapy of pancreas tissues in rat models with type 1 diabetes. CdSe/ZnS quantum dots were synthesized, their biocompatibility was evaluated, and then, the appropriate concentration of quantum dots was selected to label MSCs. CdSe/ZnS quantum dots-labeled MSCs were injected into mouse models with type 1 diabetes via tail vessel and then were observed by using the Bruker In-Vivo F PRO system, and the blood glucose levels were monitored for 8 weeks. Results showed that prepared CdSe/ZnS quantum dots owned good biocompatibility. Significant differences existed in distribution of quantum dots-labeled MSCs between normal control rats and diabetic rats ( p < 0.05). The ratios of the fluorescence intensity (RFI) analysis showed an accumulation rate of MSCs in the pancreas of rats in the diabetes group, and was about 32 %, while that in the normal control group rats was about 18 %. The blood glucose levels were also monitored for 8 weeks after quantum dots-labeled MSC injection. Statistical differences existed between the blood glucose levels of the diabetic rat control group and MSC-injected diabetic rat group ( p < 0.01), and the MSC-injected diabetic rat group displayed lower blood glucose levels. In conclusion, CdSe/ZnS-labeled MSCs can target in vivo pancreas tissues in diabetic rats, and significantly reduce the blood glucose levels in diabetic rats, and own potential application in therapy of diabetic patients in the near future.

  7. Early post-transplant immune monitoring can predict long-term kidney graft survival: soluble CD30 levels, anti-HLA antibodies and IgA-anti-Fab autoantibodies.

    PubMed

    Amirzargar, Mohammad Ali; Amirzargar, Aliakbar; Basiri, Abbas; Hajilooi, Mehrdad; Roshanaei, Ghodratollah; Rajabi, Gholamreza; Mohammadiazar, Sina; Solgi, Ghasem

    2014-01-01

    This study aimed to investigate the predictive power of anti-HLA antibodies, sCD30 levels and IgA-anti-Fab autoantibody before and early after transplantation in relation to long-term kidney allograft survival. Pre- and post-transplant sera samples of 59 living-unrelated donor kidney recipients were tested for above risk factors by enzyme-linked immunoabsorbent assay. 15 out of 59 cases experienced rejection episodes (failure group). Pre- and post-transplant high sCD30 levels were significantly associated with graft failure (P=0.02 and P=0.004) and decreased 4 year graft survival (P = 0.009 and P = 0.001). Higher frequency of post-transplant HLA class-II antibody in the absence of class-I antibody was observed in failure group (P=0.007). Patients with post-transplant HLA class-I and class-II antibodies either alone or in combination showed significant lower 4 year graft survival. Recipients with high sCD30 levels in the presence of HLA class-I or class-II antibodies within 2 weeks post-transplant had poor graft survival (P = 0.004 and P = 0.002, respectively). High levels of post-transplant IgA-anti-Fab antibody was more frequent in functioning-graft patients (P = 0.00001), correlated with decreased serum creatinine levels (P = 0.01) and associated with improved graft survival (P = 0.008). Our findings indicate the deleterious effect of early post-transplant HLA antibodies and increased sCD30 levels dependently and protective effect of IgA-anti-Fab antibodies on long-term renal graft outcomes. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  8. Successful construction and stable expression of an anti-CD45RA scFv-EGFP fusion protein in Chinese hamster ovary cells.

    PubMed

    Wang, Zhujun; Chen, Yuanyuan; Li, Sisi; Cheng, Yuping; Zhao, Haizhao; Jia, Ming; Luo, Zebin; Tang, Yongmin

    2014-02-01

    CD45RA has been found highly expressed on leukemia cells and may be a potential target of the disease. In this study, an anti-CD45RA single-chain antibody fragment (scFv3A4) was genetically linked to the N terminus of the enhanced green fluorescent protein (EGFP) to generate a scFv3A4-EGFP fusion protein. The scFv3A4-EGFP with a molecular weight of 57kDa was stably expressed and secreted from the transfected CHO cells through the ER/Golgi-dependent pathway. The fusion protein was soluble in the culture supernatant and the yield was 1350μg/L. Flow cytometry analysis showed that the scFv3A4-EGFP had the same binding site and a very similar reactivity pattern with its parental murine monoclonal antibody (mAb) 3A4. Furthermore, comparing to conventional labeled 3A4-FITC antibody, the scFv3A4-EGFP was more resistant to illumination and more suitable for immunofluorescence histology (IFH) detection. Therefore, the scFv3A4-EGFP fusion protein can be a powerful tool to investigate the targeting of CD45RA on leukemia cells, biological activity of the target and possibly for the genetic manipulation of the antibody. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Sequential CD34 cell fractionation by magnetophoresis in a magnetic dipole flow sorter.

    PubMed

    Schneider, Thomas; Karl, Stephan; Moore, Lee R; Chalmers, Jeffrey J; Williams, P Stephen; Zborowski, Maciej

    2010-01-01

    Cell separation and fractionation based on fluorescent and magnetic labeling procedures are common tools in contemporary research. These techniques rely on binding of fluorophores or magnetic particles conjugated to antibodies to target cells. Cell surface marker expression levels within cell populations vary with progression through the cell cycle. In an earlier work we showed the reproducible magnetic fractionation (single pass) of the Jurkat cell line based on the population distribution of CD45 surface marker expression. Here we present a study on magnetic fractionation of a stem and progenitor cell (SPC) population using the established acute myelogenous leukemia cell line KG-1a as a cell model. The cells express a CD34 cell surface marker associated with the hematopoietic progenitor cell activity and the progenitor cell lineage commitment. The CD34 expression level is approximately an order of magnitude lower than that of the CD45 marker, which required further improvements of the magnetic fractionation apparatus. The cells were immunomagnetically labeled using a sandwich of anti-CD34 antibody-phycoerythrin (PE) conjugate and anti-PE magnetic nanobead and fractionated into eight components using a continuous flow dipole magnetophoresis apparatus. The CD34 marker expression distribution between sorted fractions was measured by quantitative PE flow cytometry (using QuantiBRITE PE calibration beads), and it was shown to be correlated with the cell magnetophoretic mobility distribution. A flow outlet addressing scheme based on the concept of the transport lamina thickness was used to control cell distribution between the eight outlet ports. The fractional cell distributions showed good agreement with numerical simulations of the fractionation based on the cell magnetophoretic mobility distribution in the unsorted sample.

  10. Bone Engineering of Maxillary Sinus Bone Deficiencies Using Enriched CD90+ Stem Cell Therapy: A Randomized Clinical Trial.

    PubMed

    Kaigler, Darnell; Avila-Ortiz, Gustavo; Travan, Suncica; Taut, Andrei D; Padial-Molina, Miguel; Rudek, Ivan; Wang, Feng; Lanis, Alejandro; Giannobile, William V

    2015-07-01

    Bone engineering of localized craniofacial osseous defects or deficiencies by stem cell therapy offers strong prospects to improve treatment predictability for patient care. The aim of this phase 1/2 randomized, controlled clinical trial was to evaluate reconstruction of bone deficiencies of the maxillary sinus with transplantation of autologous cells enriched with CD90+ stem cells and CD14+ monocytes. Thirty human participants requiring bone augmentation of the maxillary sinus were enrolled. Patients presenting with 50% to 80% bone deficiencies of the maxillary sinus were randomized to receive either stem cells delivered onto a β-tricalcium phosphate scaffold or scaffold alone. Four months after treatment, clinical, radiographic, and histologic analyses were performed to evaluate de novo engineered bone. At the time of alveolar bone core harvest, oral implants were installed in the engineered bone and later functionally restored with dental tooth prostheses. Radiographic analyses showed no difference in the total bone volume gained between treatment groups; however, density of the engineered bone was higher in patients receiving stem cells. Bone core biopsies showed that stem cell therapy provided the greatest benefit in the most severe deficiencies, yielding better bone quality than control patients, as evidenced by higher bone volume fraction (BVF; 0.5 versus 0.4; p = 0.04). Assessment of the relation between degree of CD90+ stem cell enrichment and BVF showed that the higher the CD90 composition of transplanted cells, the greater the BVF of regenerated bone (r = 0.56; p = 0.05). Oral implants were placed and restored with functionally loaded dental restorations in all patients and no treatment-related adverse events were reported at the 1-year follow-up. These results provide evidence that cell-based therapy using enriched CD90+ stem cell populations is safe for maxillary sinus floor reconstruction and offers potential to accelerate and enhance

  11. CD44 standard and CD44v10 isoform expression on leukemia cells distinctly influences niche embedding of hematopoietic stem cells.

    PubMed

    Erb, Ulrike; Megaptche, Amelie Pajip; Gu, Xiaoyu; Büchler, Markus W; Zöller, Margot

    2014-03-31

    A blockade of CD44 is considered a therapeutic option for the elimination of leukemia initiating cells. However, anti-panCD44 can interfere with hematopoiesis. Therefore we explored, whether a CD44 variant isoform (CD44v)-specific antibody can inhibit leukemia growth without attacking hematopoiesis. As a model we used CD44v10 transfected EL4 thymoma cells (EL4-v10). The therapeutic efficacy of anti-panCD44 and anti-CD44v10 was evaluated after intravenous application of EL4/EL4-v10. Ex vivo and in vitro studies evaluated the impact of anti-panCD44 and anti-CD44v10 as well as of EL4 and EL4-v10 on hematopoietic stem cells (HSC) in cocultures with bone marrow stroma cells with a focus on adhesion, migration, cell cycle progression and apoptosis resistance. Intravenously injected EL4-v10 grow in bone marrow and spleen. Anti-panCD44 and, more pronounced anti-CD44v10 prolong the survival time. The higher efficacy of anti-CD44v10 compared to anti-panCD44 does not rely on stronger antibody-dependent cellular cytotoxicity or on promoting EL4-v10 apoptosis. Instead, EL4 compete with HSC niche embedding. This has consequences on quiescence and apoptosis-protecting signals provided by the stroma. Anti-panCD44, too, more efficiently affected embedding of HSC than of EL4 in the bone marrow stroma. EL4-v10, by catching osteopontin, migrated on bone marrow stroma and did not or weakly interfere with HSC adhesion. Anti-CD44v10, too, did not affect the HSC--bone marrow stroma crosstalk. The therapeutic effect of anti-panCD44 and anti-CD44v10 is based on stimulation of antibody-dependent cellular cytotoxicity. The superiority of anti-CD44v10 is partly due to blocking CD44v10-stimulated osteopontin expression that could drive HSC out of the niche. However, the main reason for the superiority of anti-CD44v10 relies on neither EL4-v10 nor anti-CD44v10 severely interfering with HSC--stroma cell interactions that, on the other hand, are affected by EL4 and anti-panCD44. Anti-panCD44

  12. CD44 standard and CD44v10 isoform expression on leukemia cells distinctly influences niche embedding of hematopoietic stem cells

    PubMed Central

    2014-01-01

    Background A blockade of CD44 is considered a therapeutic option for the elimination of leukemia initiating cells. However, anti-panCD44 can interfere with hematopoiesis. Therefore we explored, whether a CD44 variant isoform (CD44v)-specific antibody can inhibit leukemia growth without attacking hematopoiesis. As a model we used CD44v10 transfected EL4 thymoma cells (EL4-v10). Methods The therapeutic efficacy of anti-panCD44 and anti-CD44v10 was evaluated after intravenous application of EL4/EL4-v10. Ex vivo and in vitro studies evaluated the impact of anti-panCD44 and anti-CD44v10 as well as of EL4 and EL4-v10 on hematopoietic stem cells (HSC) in cocultures with bone marrow stroma cells with a focus on adhesion, migration, cell cycle progression and apoptosis resistance. Results Intravenously injected EL4-v10 grow in bone marrow and spleen. Anti-panCD44 and, more pronounced anti-CD44v10 prolong the survival time. The higher efficacy of anti-CD44v10 compared to anti-panCD44 does not rely on stronger antibody-dependent cellular cytotoxicity or on promoting EL4-v10 apoptosis. Instead, EL4 compete with HSC niche embedding. This has consequences on quiescence and apoptosis-protecting signals provided by the stroma. Anti-panCD44, too, more efficiently affected embedding of HSC than of EL4 in the bone marrow stroma. EL4-v10, by catching osteopontin, migrated on bone marrow stroma and did not or weakly interfere with HSC adhesion. Anti-CD44v10, too, did not affect the HSC – bone marrow stroma crosstalk. Conclusion The therapeutic effect of anti-panCD44 and anti-CD44v10 is based on stimulation of antibody-dependent cellular cytotoxicity. The superiority of anti-CD44v10 is partly due to blocking CD44v10-stimulated osteopontin expression that could drive HSC out of the niche. However, the main reason for the superiority of anti-CD44v10 relies on neither EL4-v10 nor anti-CD44v10 severely interfering with HSC – stroma cell interactions that, on the other hand, are affected

  13. Biokinetics of yttrium and comparison with its geochemical twin holmium

    DOE PAGES

    Leggett, Rich

    2017-06-01

    The transition metal yttrium (Y, atomic number 39) is chemically similar to elements in the lanthanide family (atomic numbers 57-71, lanthanum through lutetium) and is always present with the lanthanides in rare earth ores. Yttrium and the lanthanide holmium are particularly close chemical and physical analogues and are referred to as geochemical twins because they typically show little fractionation in geological material. Extensive measurements on rocks, soils, and meteorites indicate that the Y/Ho mass concentration ratio rarely falls far from the “chondritic” or “solar system” ratio of ~26. Our paper presents a new biokinetic model for yttrium in adult humansmore » and examines whether yttrium and holmium may be biological as well as geochemical twins. Collected data on yttrium and holmium in plants and human tissues do not allow precise derivations of Y/Ho concentration ratios but with occasional exceptions yield ratios that are reasonably consistent with chondritic values. Predictions of the time-dependent behavior of yttrium in adult humans based on the yttrium model presented here closely approximate predictions of the behavior of holmium based on a previously developed model for holmium. We know that yttrium and holmium are close biological analogues, but the available comparative data are too limited and imprecise to reveal whether there are any significant differences in their biological behavior.« less

  14. Treatment of non-Hodgkin's lymphoma xenografts with the HB22.7 anti-CD22 monoclonal antibody and phosphatase inhibitors improves efficacy.

    PubMed

    O'Donnell, Robert T; Pearson, David; McKnight, Hayes C; Ma, Ya Peng; Tuscano, Joseph M

    2009-10-01

    To examine the role of phosphatase inhibition on anti-CD22, HB22.7-mediated lymphomacidal effects. CD22 is a cell-surface molecule expressed on most B cell lymphomas (NHL). HB22.7 is an anti-CD22 monoclonal antibody that binds a unique CD22-epitope, blocks ligand binding, initiates signaling, and has demonstrated lymphomacidal activity. The SHP-1 tyrosine phosphatase is associated with the cytoplasmic domain of CD22. Sodium orthovanadate (NaV) is a phosphatase inhibitor. The SHP-1-CD22 interaction presents an opportunity to manipulate CD22-mediated signaling effects. In vitro cell culture assays and in vivo human NHL xenograft studies were used to assess the effects of phosphatase inhibition. NaV caused dose dependent killing of NHL cells in vitro; when HB22.7 was given with NaV, antibody-mediated cell death was augmented. Flow cytometry showed that NaV-pretreatment resulted in less CD22 internalization after ligation with HB22.7 than did control cells. Studies in mice bearing Raji NHL xenografts showed that the combination of NaV and HB22.7 shrank NHL tumors more rapidly, had a higher complete response rate (80%), and produced the best survival compared to controls; no toxicity was detected. Studies using Raji cells stably transfected with SHP-1DN confirmed that these observations were due to SHP-1 inhibition. The relatively specific association of SHP-1 with CD22 suggests that CD22-specific signal augmentation by phosphatase inhibitors can improve the clinical outcome of anti-CD22 based immunotherapy.

  15. Rat brain xenografts reverse hypogonadism in mice immunosuppressed with anti-CD4 monoclonal antibody.

    PubMed

    Honey, C R; Charlton, H M; Wood, K J

    1991-01-01

    This study examines the effect of immunosuppression with monoclonal antibodies (MAb) against the murine CD4 (L3T4), a cell surface glycoprotein expressed primarily on helper T-lymphocytes, on the viability and function of rat neural xenografts placed in the third ventricle of hypogonadal (hpg) mice. The hpg mouse fails to synthesize hypothalamic gonadotrophin releasing hormone (GnRH) and consequently there is a drastic reduction in pituitary gonadotrophic hormone content and a failure of postnatal gonadal development (Cattanach et al. 1977). Three groups of male hpg mice received xenografts of day 1 post natal rat preoptic area (POA) tissue, a source of GnRH neurons, to their third ventricle. Those immunosuppressed with anti-CD4 MAb all showed surviving graft tissue thirty days post-transplant and half of this group had enlarged testes with all stages of spermatogenesis. In those hpg mice which were injected with saline alone, or with an anti-CD8 (Lyt-2) antibody there was no xenograft survival. These results suggest that the injection of monoclonal antibodies against the T-helper subset may provide an alternative means of immunosuppression aimed at the enhancement of survival of tissue grafts in the CNS.

  16. 16 CFR 309.20 - Labeling requirements for new covered vehicles.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... numbers, bar codes, and vehicle identification numbers consistent with Figures 4, 5, and 5.1. (c) Type... vehicles. 309.20 Section 309.20 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS LABELING REQUIREMENTS FOR ALTERNATIVE FUELS AND ALTERNATIVE FUELED VEHICLES...

  17. 16 CFR 309.20 - Labeling requirements for new covered vehicles.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... numbers, bar codes, and vehicle identification numbers consistent with Figures 4, 5, and 5.1. (c) Type... vehicles. 309.20 Section 309.20 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS LABELING REQUIREMENTS FOR ALTERNATIVE FUELS AND ALTERNATIVE FUELED VEHICLES...

  18. AFM force measurements of the gp120-sCD4 and gp120 or CD4 antigen-antibody interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Yong, E-mail: dr_yongchen@hotmail.com; Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612; Zeng, Gucheng

    2011-04-08

    Highlights: {yields} The unbinding force of sCD4-gp120 interaction was 25.45 {+-} 20.46 pN. {yields} The unbinding force of CD4 antigen-antibody interaction was 51.22 {+-} 34.64 pN. {yields} The unbinding force of gp120 antigen-antibody interaction was 89.87 {+-} 44.63 pN. {yields} The interaction forces between various HIV inhibitors and the target molecules are significantly different. {yields} Functionalizing on AFM tip or substrate of an interaction pair caused different results. -- Abstract: Soluble CD4 (sCD4), anti-CD4 antibody, and anti-gp120 antibody have long been regarded as entry inhibitors in human immunodeficiency virus (HIV) therapy. However, the interactions between these HIV entry inhibitors andmore » corresponding target molecules are still poorly understood. In this study, atomic force microscopy (AFM) was utilized to investigate the interaction forces among them. We found that the unbinding forces of sCD4-gp120 interaction, CD4 antigen-antibody interaction, and gp120 antigen-antibody interaction were 25.45 {+-} 20.46, 51.22 {+-} 34.64, and 89.87 {+-} 44.63 pN, respectively, which may provide important mechanical information for understanding the effects of viral entry inhibitors on HIV infection. Moreover, we found that the functionalization of an interaction pair on AFM tip or substrate significantly influenced the results, implying that we must perform AFM force measurement and analyze the data with more caution.« less

  19. Ber-H2 (CD30) immunohistochemical staining in malignant melanoma.

    PubMed

    Polski, J M; Janney, C G

    1999-09-01

    Malignant melanoma can be included in the differential diagnosis of Hodgkin's disease, anaplastic large cell lymphoma, or embryonal carcinoma These malignancies express CD30, a marker of diagnostic value. A retrospective immunohistochemical study was undertaken to determine the frequency of immunoreactivity of Ber-H2 (anti-CD30 monoclonal antibody) in malignant melanoma Archival paraffin-embedded tissue from 24 primary and metastatic lesions was used. No Ber-H2 labeling was observed in the majority of the studied cases. Variable weak cytoplasmic staining was present in only one case. The findings are compared with the previous reports claiming frequent CD30 expression in malignant melanoma. We discuss issues pertaining to the interpretation of the Ber-H2 IHC staining in formalin-fixed, paraffin-embedded tissue.

  20. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Quantities 1 of Licensed Material Requiring Labeling C Appendix C to Part 20 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Pt. 20, App. C Appendix C to Part 20—Quantities 1 of Licensed Material Requiring Labeling Radionuclide...

  1. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Quantities 1 of Licensed Material Requiring Labeling C Appendix C to Part 20 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Pt. 20, App. C Appendix C to Part 20—Quantities 1 of Licensed Material Requiring Labeling Radionuclide...

  2. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Quantities 1 of Licensed Material Requiring Labeling C Appendix C to Part 20 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Pt. 20, App. C Appendix C to Part 20—Quantities 1 of Licensed Material Requiring Labeling Radionuclide...

  3. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Quantities 1 of Licensed Material Requiring Labeling C Appendix C to Part 20 Energy NUCLEAR REGULATORY COMMISSION STANDARDS FOR PROTECTION AGAINST RADIATION Pt. 20, App. C Appendix C to Part 20—Quantities 1 of Licensed Material Requiring Labeling Radionuclide...

  4. Rare earths, the lanthanides, yttrium and scandium

    USGS Publications Warehouse

    Hedrick, J.B.

    2006-01-01

    In 2005, rare earths were not mined in the United States. The major supplier, Molycorp, continued to maintain a large stockpile of rare-earth concentrates and compounds. Consumption decreased of refined rare-earth products. The United States remained a major importer and exporter of rare earths in 2005. During the same period, yttrium was not mined or refined in the US. Hence, supply of yttrium compounds for refined yttrium products came from China, France and Japan. Scandium was not also mined. World production was primarily in China, Russia and Ukraine. Demand for rare earths in 2006 is expected to be closely tied to economic conditions in the US.

  5. Survey of Thai Commercial Food Products That Have Been Reported to Contain No Wheat, Rye, Barley, or Gluten According to Their Labels.

    PubMed

    Surojanametakul, Vipa; Srikulnath, Sirinrat; Chamnansin, Pailin; Shoji, Masahiro; Tamura, Hirotoshi

    2017-01-01

    Celiac disease (CD) and gluten-related disorders are significant health and social issues in Western countries, and CD individuals need to exclude gluten from their diets. The adverse health impacts of CD have extended to Asian countries in which CD was not a problem previously. Thai commercial food products that do not contain wheat, rye, barley, or gluten on their labels were surveyed as to whether they were suitable for CD individuals by examining the absence of gluten or the presence of gluten <20 ppm. In Thailand, ELISA tested for gluten content in 129 commercial food products that contained neither wheat, rye, barley, nor gluten on their labels. One hundred nineteen of these 129 products included <20 ppm gluten, and 10 products contained >20 ppm gluten. Surprisingly, four products showed gluten levels >1%. In these 10 products, wheat presence was confirmed by PCR analysis. Our survey suggests that CD individuals can consume most of the examined Thai food products, and the survey showed the potential of these Thai products as new diets for CD patients so as to expand the limited food choices from different food cultures, and ultimately to improve the quality of life for all CD individuals globally. The appropriate gluten management strategies need to be implemented by Thai food manufacturers to ensure accurate labeling and to protect the safety of consumers with CD.

  6. Growth on poly(L-lactic acid) porous scaffold preserves CD73 and CD90 immunophenotype markers of rat bone marrow mesenchymal stromal cells.

    PubMed

    Zamparelli, Alessandra; Zini, Nicoletta; Cattini, Luca; Spaletta, Giulia; Dallatana, Davide; Bassi, Elena; Barbaro, Fulvio; Iafisco, Michele; Mosca, Salvatore; Parrilli, Annapaola; Fini, Milena; Giardino, Roberto; Sandri, Monica; Sprio, Simone; Tampieri, Anna; Maraldi, Nadir M; Toni, Roberto

    2014-10-01

    Few data are available on the effect of biomaterials on surface antigens of mammalian bone marrow-derived, adult mesenchymal stromal cells (MSCs). Since poly(L-lactic acid) or PLLA is largely used in tissue engineering of human bones, and we are developing a reverse engineering program to prototype with biomaterials the vascular architecture of bones for their bioartificial reconstruction, both in humans and animal models, we have studied the effect of porous, flat and smooth PLLA scaffolds on the immunophenotype of in vitro grown, rat MSCs in the absence of any coating, co-polymeric enrichment, and differentiation stimuli. Similar to controls on plastic, we show that our PLLA scaffold does not modify the distribution of some surface markers in rat MSCs. In particular, the maintained expression of CD73 and CD90 on two different subpopulations (small and large cells) is consistent with their adhesion to the PLLA scaffold through specialized appendages, and to their prominent content in actin. In addition, our PLLA scaffold favours retention of the intermediate filament desmin, believed a putative marker of undifferentiated state. Finally, it preserves all rat MSCs morphotypes, and allows for their survival, adhesion to the substrate, and replication. Remarkably, a subpopulation of rat MSCs grown on our PLLA scaffold exhibited formation of membrane protrusions of uncertain significance, although in a size range and morphology compatible with either motility blebs or shedding vesicles. In summary, our PLLA scaffold has no detrimental effect on a number of features of rat MSCs, primarily the expression of CD73 and CD90.

  7. Structural phase transitions in yttrium under ultrahigh pressures

    NASA Astrophysics Data System (ADS)

    Samudrala, Gopi K.; Tsoi, Georgiy M.; Vohra, Yogesh K.

    2012-09-01

    X-ray diffraction studies were carried out on the rare earth metal yttrium up to 177 GPa in a diamond anvil cell at room temperature. Yttrium was compressed to 37% of its initial volume at the highest pressure. The rare earth crystal structure sequence hcp → Sm type → dhcp → mixed(dhcp + fcc) → distorted fcc (dfcc) is observed in yttrium below 50 GPa. The dfcc (hR24) phase has been observed to persist in the pressure range of 50-95 GPa. A structural transition from dfcc to a low symmetry phase has been observed in yttrium at 99 ± 4 GPa with a volume change of - 2.6%. This low symmetry phase has been identified as a monoclinic C2/m phase, which has also been observed in other rare earth elements under high pressures. The appearance of this low symmetry monoclinic phase in yttrium shows that its electronic structure under extreme conditions resembles that of heavy rare earth metals, with a significant increase in d-band character of the valence electrons and possibly some f-electron states near the Fermi level.

  8. Structural phase transitions in yttrium under ultrahigh pressures.

    PubMed

    Samudrala, Gopi K; Tsoi, Georgiy M; Vohra, Yogesh K

    2012-09-12

    X-ray diffraction studies were carried out on the rare earth metal yttrium up to 177 GPa in a diamond anvil cell at room temperature. Yttrium was compressed to 37% of its initial volume at the highest pressure. The rare earth crystal structure sequence hcp → Sm type → dhcp → mixed(dhcp + fcc) → distorted fcc (dfcc) is observed in yttrium below 50 GPa. The dfcc (hR24) phase has been observed to persist in the pressure range of 50-95 GPa. A structural transition from dfcc to a low symmetry phase has been observed in yttrium at 99 ± 4 GPa with a volume change of - 2.6%. This low symmetry phase has been identified as a monoclinic C2/m phase, which has also been observed in other rare earth elements under high pressures. The appearance of this low symmetry monoclinic phase in yttrium shows that its electronic structure under extreme conditions resembles that of heavy rare earth metals, with a significant increase in d-band character of the valence electrons and possibly some f-electron states near the Fermi level.

  9. Investigation of magnetic order in SmTr2Zn20 (Tr = Fe, Co, Ru) and SmTr2Cd20 (Tr = Ni, Pd)

    NASA Astrophysics Data System (ADS)

    Yazici, Duygu; White, B. D.; Ho, P.-C.; Kanchanavatee, N.; Huang, K.; Dilley, N. R.; Maple, M. B.

    2015-03-01

    Single crystals of the cage compounds Sm Tr 2Zn20 (Tr = Fe, Co, Ru) and Sm Tr 2Cd20 (Tr = Ni, Pd) have been investigated by means of electrical resistivity, magnetization, and specific heat measurements. The compounds SmFe2Zn20, SmRu2Zn20,andSmNi2Cd20 exhibit ferromagnetic order with Curie temperatures of TC = 47.4 K, 7.6 K, and 7.5 K, respectively, whereas SmPd2Cd20 is an antiferromagnet with a Néel temperature of TN = 3.4 K. No evidence for magnetic order is observed in SmCo2Zn20 down to 110 mK. The Sommerfeld coefficients γ are found to be 57 mJ/mol-K2 for SmFe2Zn20, 79.5 mJ/mol-K2 for SmCo2Zn20, 258 mJ/mol-K2 for SmRu2Zn20, 165 mJ/mol-K2 for SmNi2Cd20, and 208 mJ/mol-K2 for SmPd2Cd20. Enhanced values of Sommerfeld coefficients γ and a quadratic temperature dependence of the electrical resistivity at low temperature for SmRu2Zn20andSmPd2Cd20 suggest an enhancement of the quasiparticle masses due to hybridization between localized 4 f and conduction electron states. Research at UCSD was supported by the U.S. DOE under Grant No. DE-FG02-04-ER46105 and the U.S. NSF under Award Grant No. DMR 1206553. Research at California State University, Fresno was supported by the U.S. NSF under Grant No. DMR 1104544.

  10. CD103+ intraepithelial T cells in high-grade serous ovarian cancer are phenotypically diverse TCRαβ+ CD8αβ+ T cells that can be targeted for cancer immunotherapy

    PubMed Central

    Workel, Hagma H.; Tijans, Aline M.; Terwindt, Anouk L.J.; Brunekreeft, Kim L.; Plat, Annechien; Klip, Harry G.; Eggink, Florine A.; Leffers, Ninke; Helfrich, Wijnand; Samplonius, Douwe F.; Bremer, Edwin; Wisman, G. Bea A.; Daemen, Toos; Duiker, Evelien W.; Hollema, Harry; Nijman, Hans W.; de Bruyn, Marco

    2016-01-01

    CD103+ tumor-infiltrating lymphocytes (TIL) have been linked to specific epithelial infiltration and a prolonged survival in high-grade serous epithelial ovarian cancer (HGSC). However, whether these cells are induced as part of an ongoing anti-HGSC immune response or represent non-specifically expanded resident or mucosal lymphocytes remains largely unknown. In this study, we first confirmed that CD103+ TIL from HGSC were predominantly localized in the cancer epithelium and were strongly correlated with an improved prognosis. We further demonstrate that CD103+ TIL were almost exclusively CD3+ TCRαβ+ CD8αβ+ CD4- T cells, but heterogeneously expressed T cell memory and differentiation markers. Activation of peripheral T cells in the presence of HGSC was sufficient to trigger induction of CD103 in over 90% of all CD8+ cells in a T cell receptor (TCR)- and TGFβR1-dependent manner. Finally, CD103+ TIL isolated from primary HGSC showed signs of recent activation and dominantly co-expressed key immunotherapeutic targets PD-1 and CD27. Taken together, our data indicate CD103+ TIL in HGSC are formed as the result of an adaptive anti-tumor immune response that might be reactivated by (dual) checkpoint inhibition. PMID:27650547

  11. HSP27, 70 and 90, anti-apoptotic proteins, in clinical cancer therapy (Review).

    PubMed

    Wang, Xiaoxia; Chen, Meijuan; Zhou, Jing; Zhang, Xu

    2014-07-01

    Among the heat shock proteins (HSP), HSP27, HSP70 and HSP90 are the most studied stress-inducible HSPs, and are induced in response to a wide variety of physiological and environmental insults, thus allowing cells to survive to lethal conditions based on their powerful cytoprotective functions. Different functions of HSPs have been described to explain their cytoprotective functions, including their most basic role as molecular chaperones, that is to regulate protein folding, transport, translocation and assembly, especially helping in the refolding of misfolded proteins, as well as their anti-apoptotic properties. In cancer cells, the expression and/or activity of the three HSPs is abnormally high, and is associated with increased tumorigenicity, metastatic potential of cancer cells and resistance to chemotherapy. Associating with key apoptotic factors, they are powerful anti-apoptotic proteins, having the capacity to block the cell death process at different levels. Altogether, the properties suggest that HSP27, HSP70 and HSP90 are appropriate targets for modulating cell death pathways. In this review, we summarize the role of HSP90, HSP70 and HSP27 in apoptosis and the emerging strategies that have been developed for cancer therapy based on the inhibition of the three HSPs.

  12. Technical note: The calibration of {sup 90}Y-labeled SIR-Spheresusing a nondestructive spectroscopic assay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Selwyn, R.; Micka, J.; DeWerd, L.

    2008-04-15

    {sup 90}Y-labeled SIR-Spheres are currently used to treat patients with hepatic metastases secondary to colorectal adenocarcinoma. In general, the prescribed activity is based on empirical data collected during clinical trials. The activity of the source vial is labeled by the manufacturer as 3.0 GBq{+-}10% and is not independently verified by the end user. This technical note shows that the results of a nondestructive spectroscopic assay of a SIR-Spheressample was 26% higher than the activity stated by the manufacturer. This difference should not impact the current empirical prescription method but may be problematic for patient-specific dosimetry applications, such as image-based dosimetry.

  13. Novel anti-CD3 chimeric antigen receptor targeting of aggressive T cell malignancies

    PubMed Central

    Firor, Amelia E.; Pinz, Kevin G.; Jares, Alexander; Liu, Hua; Salman, Huda; Golightly, Marc; Lan, Fengshuo; Jiang, Xun; Ma, Yupo

    2016-01-01

    Peripheral T-cell lymphomas (PTCLS) comprise a diverse group of difficult to treat, very aggressive non-Hodgkin's lymphomas (NHLS) with poor prognoses and dismal patient outlook. Despite the fact that PTCLs comprise the majority of T-cell malignancies, the standard of care is poorly established. Chimeric antigen receptor (CAR) immunotherapy has shown in B-cell malignancies to be an effective curative option and this extends promise into treating T-cell malignancies. Because PTCLS frequently develop from mature T-cells, CD3 is similarly strongly and uniformly expressed in many PTCL malignancies, with expression specific to the hematological compartment thus making it an attractive target for CAR design. We engineered a robust 3rd generation anti-CD3 CAR construct (CD3CAR) into an NK cell line (NK-92). We found that CD3CAR NK-92 cells specifically and potently lysed diverse CD3+ human PTCL primary samples as well as T-cell leukemia cells lines ex vivo. Furthermore, CD3CAR NK-92 cells effectively controlled and suppressed Jurkat tumor cell growth in vivo and significantly prolonged survival. In this study, we present the CAR directed targeting of a novel target - CD3 using CAR modified NK-92 cells with an emphasis on efficacy, specificity, and potential for new therapeutic approaches that could improve the current standard of care for PTCLs. PMID:27494836

  14. Histochemistry of nerve fibres double labelled with anti-TRPV2 antibodies and sensory nerve marker AM1-43 in the dental pulp of rat molars.

    PubMed

    Nishikawa, Sumio

    2008-09-01

    AM1-43 can label sensory nerve fibres and sensory neurons. Permeation of non-selective cation channels of the nerve cell membrane is suggested to be the mechanism responsible for labelling. To identify these channels, two candidates, TRPV1 and TRPV2 were examined by immunocytochemistry in the dental pulp and trigeminal ganglion of rats injected with AM1-43. A part of AM1-43-labelled nerve fibres was also positive for anti-TRPV2 antibody but negative for anti-TRPV1 antibody in the dental pulp. In the trigeminal ganglion, a part of the neuron showed both bright AM1-43 labelling and anti-TRPV2 immunolabelling, but neurons double labelled with AM1-43 and TRPV1 were rare. These results suggest that TRPV2 channels, but not TRPV1 channels, contribute to the fluorescent labelling of AM1-43 in the dental pulp.

  15. Immunization of chickens with an agonistic monoclonal anti-chicken CD40 antibody-hapten complex: rapid and robust IgG response induced by a single subcutaneous injection.

    PubMed

    Chen, Chang-Hsin; Abi-Ghanem, Daad; Waghela, Suryakant D; Chou, Wen-Ko; Farnell, Morgan B; Mwangi, Waithaka; Berghman, Luc R

    2012-04-30

    Producing diagnostic antibodies in chicken egg yolk represents an alternate animal system that offers many advantages including high productivity at low cost. Despite being an excellent counterpart to mammalian antibodies, chicken IgG from yolk still represents an underused resource. The potential of agonistic monoclonal anti-CD40 antibodies (mAb) as a powerful immunological adjuvant has been demonstrated in mammals, but not in chickens. We recently reported an agonistic anti-chicken CD40 mAb (designated mAb 2C5) and showed that it may have potential as an immunological adjuvant. In this study, we examined the efficacy of targeting a short peptide to chicken CD40 [expressed by the antigen-presenting cells (APCs)] in enhancing an effective IgG response in chickens. For this purpose, an immune complex consisting of one streptavidin molecule, two directionally biotinylated mAb 2C5 molecules, and two biotinylated peptide molecules was produced. Chickens were immunized subcutaneously with doses of this complex ranging from 10 to 90 μg per injection once, and relative quantification of the peptide-specific IgG response showed that the mAb 2C5-based complex was able to elicit a strong IgG response as early as four days post-immunization. This demonstrates that CD40-targeting antigen to chicken APCs can significantly enhance antibody responses and induce immunoglobulin isotype-switching. This immunization strategy holds promise for rapid production of hapten-specific IgG in chickens. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. 16 CFR 1500.20 - Labeling requirement for advertising toys and games.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... and games. 1500.20 Section 1500.20 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.20 Labeling requirement for advertising toys and games. (a) Scope. This section applies to..., that is used in various children's games, generally as a playing piece or marker. The term “marble...

  17. 16 CFR 1500.20 - Labeling requirement for advertising toys and games.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... and games. 1500.20 Section 1500.20 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.20 Labeling requirement for advertising toys and games. (a) Scope. This section applies to..., that is used in various children's games, generally as a playing piece or marker. The term “marble...

  18. 16 CFR 1500.20 - Labeling requirement for advertising toys and games.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... and games. 1500.20 Section 1500.20 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.20 Labeling requirement for advertising toys and games. (a) Scope. This section applies to..., that is used in various children's games, generally as a playing piece or marker. The term “marble...

  19. 16 CFR 1500.20 - Labeling requirement for advertising toys and games.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... and games. 1500.20 Section 1500.20 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.20 Labeling requirement for advertising toys and games. (a) Scope. This section applies to..., that is used in various children's games, generally as a playing piece or marker. The term “marble...

  20. Protection of xenografts by a combination of immunoisolation and a single dose of anti-CD4 antibody.

    PubMed

    Mckenzie, A W; Georgiou, H M; Zhan, Y; Brady, J L; Lew, A M

    2001-01-01

    Immunoisolation is the separation of transplanted cells from cells of the immune system using a semipermeable membrane. Using one such immunoisolation capsule-the TheraCyte device-we have assessed the survival of encapsulated xenogeneic tissue in vivo as well as the contribution of CD4+ve T cells to encapsulated xenograft rejection. The foreign body reaction to the TheraCyte capsule in vivo was assessed by transplanting empty capsules into normal mice. These capsules elicit a foreign body response by the host animal. Encapsulated CHO, NIT-1, and PK-15 cells were placed in culture and in immunodeficient mice to investigate their growth characteristics in the TheraCyte device. These cell lines survive both in culture and in immunodeficient SCID mice. Xenogeneic PK cells were also transplanted into normal C57BL/6 mice. These cells do not survive in normal mice despite the absence of direct contact between infiltrating and encapsulated cells. In addition, the survival of encapsulated cells in mice treated with a single dose of anti-CD4 antibody was examined. This was assessed using two systems: 1) histological analysis of capsule sections; 2) a quantitative luciferase reporter system using PK cells transfected to express luciferase. In both cases, anti-CD4 antibody contributed to prolonged encapsulated xenogeneic cell survival. Encapsulated xenogeneic cells survive in immunodeficient mice but not normal mice. Treatment of normal mice with anti-CD4 antibody results in prolonged survival of xenogeneic cells that can be measured using a luciferase reporter system. These results highlight the contribution of CD4+ve T cells to encapsulated xenograft rejection.

  1. CD44v10, osteopontin and lymphoma growth retardation by a CD44v10-specific antibody.

    PubMed

    Megaptche, Amelie Pajip; Erb, Ulrike; Büchler, Markus Wolfgang; Zöller, Margot

    2014-09-01

    Blockade of CD44 is considered a therapeutic option for the elimination of leukemia-initiating cells. However, the application of anti-panCD44 can be burdened by severe side effects. We determined whether these side effects could be avoided by replacing anti-panCD44 with CD44 variant isoform (CD44v)-specific antibodies in CD44v-positive hematological malignancies using the EL4 thymoma and CD44v10-transfected EL4 (EL4-v10) as models. Subcutaneous growth of EL4 and EL4-v10 was equally well inhibited by the anti-panCD44 and anti-CD44v10 antibodies, respectively. Ex vivo analysis indicated that natural killer cytotoxicity and antibody-dependent cellular cytotoxicity were the main effector mechanisms. Under local inflammation, the efficacy of anti-CD44v10 prolonged the survival time twofold compared with untreated, EL4-v10 tumor-bearing mice, and this was due to inflammation-induced expression of osteopontin (OPN). A high level of OPN in EL4-v10 tumors supported leukocyte recruitment and tumor-infiltrating T-cell activation. Taken together, in hematological malignancies expressing CD44v, anti-panCD44 can be replaced by CD44v-specific antibodies without a loss in efficacy. Furthermore, CD44v10-specific antibodies appear particularly advantageous in cutaneous leukemia therapy, as CD44v10 binding of OPN drives leukocyte recruitment and activation.

  2. Combined radiochemical procedure for determination of plutonium, americium and strontium-90 in the soil samples from SNTS

    NASA Astrophysics Data System (ADS)

    Kazachevskii, I. V.; Lukashenko, S. N.; Chumikov, G. N.; Chakrova, E. T.; Smirin, L. N.; Solodukhin, V. P.; Khayekber, S.; Berdinova, N. M.; Ryazanova, L. A.; Bannyh, V. I.; Muratova, V. M.

    1999-01-01

    The results of combined radiochemical procedure for the determination of plutonium, americium and90Sr (via measurement of90Y) in the soil samples from SNTS are presented. The processes of co-precipitation of these nuclides with calcium fluoride in the strong acid solutions have been investigated. The conditions for simultaneous separation of americium and yttrium using extraction chromatography have been studied. It follows from analyses of real soil samples that the procedure developed provides the chemical recovery of plutonium and yttrium in the range of 50-95% and 60-95%, respectively. The execution of the procedure requires 3.5 working days including a sample decomposition study.

  3. Expression of FOXP3, CD68, and CD20 at Diagnosis in the Microenvironment of Classical Hodgkin Lymphoma Is Predictive of Outcome

    PubMed Central

    Greaves, Paul; Clear, Andrew; Coutinho, Rita; Wilson, Andrew; Matthews, Janet; Owen, Andrew; Shanyinde, Milensu; Lister, T. Andrew; Calaminici, Maria; Gribben, John G.

    2013-01-01

    Purpose The immune microenvironment is key to the pathophysiology of classical Hodgkin lymphoma (CHL). Twenty percent of patients experience failure of their initial treatment, and others receive excessively toxic treatment. Prognostic scores and biomarkers have yet to influence outcomes significantly. Previous biomarker studies have been limited by the extent of tissue analyzed, statistical inconsistencies, and failure to validate findings. We aimed to overcome these limitations by validating recently identified microenvironment biomarkers (CD68, FOXP3, and CD20) in a new patient cohort with a greater extent of tissue and by using rigorous statistical methodology. Patients and Methods Diagnostic tissue from 122 patients with CHL was microarrayed and stained, and positive cells were counted across 10 to 20 high-powered fields per patient by using an automated system. Two statistical analyses were performed: a categorical analysis with test/validation set-defined cut points and Kaplan-Meier estimated outcome measures of 5-year overall survival (OS), disease-specific survival (DSS), and freedom from first-line treatment failure (FFTF) and an independent multivariate analysis of absolute uncategorized counts. Results Increased CD20 expression confers superior OS. Increased FOXP3 expression confers superior OS, and increased CD68 confers inferior FFTF and OS. FOXP3 varies independently of CD68 expression and retains significance when analyzed as a continuous variable in multivariate analysis. A simple score combining FOXP3 and CD68 discriminates three groups: FFTF 93%, 62%, and 47% (P < .001), DSS 93%, 82%, and 63% (P = .03), and OS 93%, 82%, and 59% (P = .002). Conclusion We have independently validated CD68, FOXP3, and CD20 as prognostic biomarkers in CHL, and we demonstrate, to the best of our knowledge for the first time, that combining FOXP3 and CD68 may further improve prognostic stratification. PMID:23045593

  4. 40 CFR 90.114 - Requirement of certification-engine information label.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) AIR PROGRAMS (CONTINUED) CONTROL OF EMISSIONS FROM NONROAD SPARK-IGNITION ENGINES AT OR BELOW 19 KILOWATTS Emission Standards and Certification Provisions § 90.114 Requirement of certification—engine... 40 Protection of Environment 20 2011-07-01 2011-07-01 false Requirement of certification-engine...

  5. 40 CFR 90.114 - Requirement of certification-engine information label.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...) AIR PROGRAMS (CONTINUED) CONTROL OF EMISSIONS FROM NONROAD SPARK-IGNITION ENGINES AT OR BELOW 19 KILOWATTS Emission Standards and Certification Provisions § 90.114 Requirement of certification—engine... 40 Protection of Environment 20 2014-07-01 2013-07-01 true Requirement of certification-engine...

  6. Inhibition of anti-CD3 monoclonal antibody-induced T-cell proliferation and interleukin-2 secretion by physiologic combinations of dexamethasone and prostaglandin E2.

    PubMed

    Elliott, L; Brooks, W; Roszman, T

    1993-12-01

    1. The purpose of these studies was to characterize further previous observations from our laboratory indicating that physiologic concentrations of dexamethasone (DEX) and prostaglandin E2 (PGE2) added together result in synergistic inhibition of the proliferative response of T cells stimulated via the T-cell receptor CD3 signaling complex (TCR/CD3). 2. Various physiologic concentrations of DEX and PGE2 were added to T cells stimulated with immobilized anti-CD3 monoclonal antibody (mAb) and cultured at optimal and suboptimal cell densities. The results demonstrate that the proliferative response of anti-CD3 mAb-stimulated T cells cultured at a suboptimal cell density is more suppressed than that of T cells cultured at optimal concentrations. 3. The proliferative response of CD4+ T cells to immobilized anti-CD3 mAb was also determined in the presence of PGE2 and DEX. The data indicate that the CD4+ subset of T cells is more sensitive to the synergistic antiproliferative effects of DEX and PGE2 compared to whole T-cell populations. 4. Various concentrations of DEX and/or PGE2 were added to T cells stimulated with anti-CD3 mAb and the secretion of interleukin-2 (IL-2) was determined. The results demonstrate that concentrations of DEX and PGE2 which individually do not significantly suppress IL-2 synthesis act together to inhibit the synthesis of IL-2 synergistically. 5. The addition of an exogenous source of recombinant IL-2 (rIL-2) to T cells stimulated in the presence of DEX and PGE2 completely reversed the synergistic antiproliferative effect of these two compounds. This reversal was even more pronounced with T cells cultured at a suboptimal cell density. Additionally, PGE2 and DEX did not affect expression of the IL-2 receptor (IL-2R), as measured by upregulation of the alpha chain, on anti-CD3 mAb stimulated T cells. 6. Collectively these data indicate that physiologic concentrations of PGE2 and DEX, which alone have no effect on anti-CD3 mAb-induced T

  7. GFP Labeling and Hepatic Differentiation Potential of Human Placenta-Derived Mesenchymal Stem Cells.

    PubMed

    Yu, Jiong; Su, Xiaoru; Zhu, Chengxing; Pan, Qiaoling; Yang, Jinfeng; Ma, Jing; Shen, Leyao; Cao, Hongcui; Li, Lanjuan

    2015-01-01

    Stem cell-based therapy in liver diseases has received increasing interest over the past decade, but direct evidence of the homing and implantation of transplanted cells is conflicting. Reliable labeling and tracking techniques are essential but lacking. The purpose of this study was to establish human placenta-derived mesenchymal stem cells (hPMSCs) expressing green fluorescent protein (GFP) and to assay their hepatic functional differentiation in vitro. The GFP gene was transduced into hPMSCs using a lentivirus to establish GFP(+) hPMSCs. GFP(+) hPMSCs were analyzed for their phenotypic profile, viability and adipogenic, osteogenic and hepatic differentiation. The derived GFP(+) hepatocyte-like cells were evaluated for their metabolic, synthetic and secretory functions, respectively. GFP(+) hPMSCs expressed high levels of HLA I, CD13, CD105, CD73, CD90, CD44 and CD29, but were negative for HLA II, CD45, CD31, CD34, CD133, CD271 and CD79. They possessed adipogenic, osteogenic and hepatic differentiation potential. Hepatocyte-like cells derived from GFP(+) hPMSCs showed typical hepatic phenotypes. GFP gene transduction has no adverse influences on the cellular or biochemical properties of hPMSCs or markers. GFP gene transduction using lentiviral vectors is a reliable labeling and tracking method. GFP(+) hPMSCs can therefore serve as a tool to investigate the mechanisms of MSC-based therapy, including hepatic disease therapy. © 2015 S. Karger AG, Basel.

  8. Target-mediated drug disposition and prolonged liver accumulation of a novel humanized anti-CD81 monoclonal antibody in cynomolgus monkeys

    PubMed Central

    Vexler, Vladimir; Yu, Li; Pamulapati, Chandrasena; Garrido, Rosario; Grimm, Hans Peter; Sriraman, Priya; Bohini, Sandhya; Schraeml, Michael; Singh, Usha; Brandt, Michael; Ries, Stefan; Ma, Han; Klumpp, Klaus; Ji, Changhua

    2013-01-01

    CD81 is an essential receptor for hepatitis C virus (HCV). K21 is a novel high affinity anti-CD81 antibody with potent broad spectrum anti-HCV activity in vitro. The pharmacokinetics (PK), pharmacodynamics and liver distribution of K21 were characterized in cynomolgus monkeys after intravenous (i.v.) administration of K21. Characteristic target-mediated drug disposition (TMDD) was shown based on the PK profile of K21 and a semi-mechanistic TMDD model was used to analyze the data. From the TMDD model, the estimated size of the total target pool at baseline (Vc • Rbase) is 16 nmol/kg and the estimated apparent Michaelis-Menten constant (KM) is 4.01 nM. A simulation using estimated TMDD parameters indicated that the number of free receptors remains below 1% for at least 3 h after an i.v. bolus of 7 mg/kg. Experimentally, the availability of free CD81 on peripheral lymphocytes was measured by immunostaining with anti-CD81 antibody JS81. After K21 administration, a dose- and time-dependent reduction in free CD81 on peripheral lymphocytes was observed. Fewer than 3% of B cells could bind JS81 3 h after a 7 mg/kg dose. High concentrations of K21 were found in liver homogenates, and the liver/serum ratio of K21 increased time-dependently and reached ~160 at 168 h post-administration. The presence of K21 bound to hepatocytes was confirmed by immunohistochemistry. The fast serum clearance of K21 and accumulation in the liver are consistent with TMDD. The TMDD-driven liver accumulation of the anti-CD81 antibody K21 supports the further investigation of K21 as a therapeutic inhibitor of HCV entry. PMID:23924796

  9. CdO-NPs; synthesis from 1D new nano Cd coordination polymer, characterization and application as anti-cancer drug for reducing the viability of cancer cells

    NASA Astrophysics Data System (ADS)

    Afzalian Mend, Behnaz; Delavar, Mahmoud; Darroudi, Majid

    2017-04-01

    The hexagonal CdO nano-particles (CdO-NPs) was prepared using new nano Cd coordination polymer, [Cd(NO3)(bipy)(pzca)]n (1) as a precursor, through direct calcination process at 500 °C. The precursor (1) was synthesized by sonochemical method. The new nano compound (1) was characterized by IR spectroscopy, elemental analyses, X-ray powder diffraction (XRD), transmission electron microscopy (TEM) and thermal gravimetric analyses. The structure of nano coordination polymer was determined by comparing the XRD pattern of nano and single-crystal of compound (1). The nano CdO was characterized by scanning electron microscopy (SEM) and X-ray powder diffraction (XRD). In addition, the activity and efficiency of nano CdO as an anti-cancer drug was studied on cancer cells with different concentration. The results shows that the viability of cancer cells reduced above 2 μg/mL of CdO-NPs concentration.

  10. Plasma Hsp90 Level as a Marker of Early Acute Lymphoblastic Leukemia Engraftment and Progression in Mice

    PubMed Central

    de Vasconcellos, Jaíra Ferreira; Brandalise, Silvia Regina; Nowill, Alexandre Eduardo; Yunes, José Andrés

    2015-01-01

    Current monitoring of acute lymphoblastic leukemia (ALL) in living mice is based on FACS analysis of blood hCD45+ cells. In this work, we evaluated the use of human IGFBP2, B2M or Hsp90 as soluble markers of leukemia. ELISA for B2M and IGFBP2 resulted in high background levels in healthy animals, precluding its use. Conversely, plasma levels of Hsp90 showed low background and linear correlation to FACS results. In another experiment, we compared Hsp90 levels with percentage of hCD45+ cells in blood, bone marrow, liver and spleen of animals weekly sacrificed. Hsp90 levels proved to be a superior method for the earlier detection of ALL engraftment and correlated linearly to ALL burden and progression in all compartments, even at minimal residual disease levels. Importantly, the Hsp90/hCD45+ ratio was not altered when animals were treated with dexamethasone or a PI3K inhibitor, indicating that chemotherapy does not directly interfere with leukemia production of Hsp90. In conclusion, plasma Hsp90 was validated as a soluble biomarker of ALL, useful for earlier detection of leukemia engraftment, monitoring leukemia kinetics at residual disease levels, and pre-clinical or mouse avatar evaluations of anti-leukemic drugs. PMID:26068922

  11. 131I-Anti-CD45 Antibody Plus Busulfan and Cyclophosphamide before Allogeneic Hematophoietic Cell Transplantation for Treatment of Acute Myeloid Leukemia in First Remission

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pagel, John M.; Appelbaum, Frederick R.; Eary, Janet F.

    2006-03-01

    In an attempt to improve outcomes for patients with acute myeloid leukemia (AML) after allogeneic hematopoietic cell transplantation (HCT), we conducted a Phase I/II study in which targeted irradiation delivered by 131I-anti-CD45 antibody was combined with targeted busulfan (BU; area-under-curve, 600-900 ng/ml) and cyclophosphamide (CY; 120 mg/kg). Fifty-two of 59 patients (88%) receiving a trace 131I-labeled dose of 0.5 mg/kg anti-CD45 murine antibody had higher estimated absorbed radiation in bone marrow and spleen than in any other organ. Forty-six patients were treated with 102-298 mCi 131I delivering an estimated 5.3-19 (mean 11.3) Gy to marrow, 17-72 (mean 29.7) Gy tomore » spleen, and 3.5 Gy (n=4) to 5.25 Gy (n=42) to the liver. The estimated 3-year non-relapse mortality and disease-free survival (DFS) were 21% and 61%, respectively. These results were compared to those from 509 similar International Bone Marrow Transplant Registry patients transplanted using BU/CY alone. After adjusting for differences in age and cytogenetics-risk, the hazard of mortality among all antibody-treated patients was 0.65 times that of the Registry patients (95% CI 0.39-1.08; p=.09). The addition of targeted hematopoietic irradiation to conventional BU/CY is feasible and well tolerated, and Phase II results are sufficiently encouraging to warrant further study.« less

  12. Anti-inflammatory activity of Jatropha curcas Linn. latex in cream formulation on CD68 expression in mice skin wound

    PubMed Central

    Salim, Muhammad Nur; Masyitha, Dian; Harris, Abdul; Balqis, Ummu; Iskandar, Cut Dahlia; Hambal, Muhammad; Darmawi

    2018-01-01

    Aim: The purpose of the present study was to determine the potential of Jatropha curcas latex in the cream formulation on CD68 immune expression (macrophages) during inflammatory phase wound healing process in mice skin. Materials and Methods: Amount of 12 two-months-old male mice were used between 30 and 40 g. To surgical procedures, wound skin incision was performed 2.0 cm in length until subcutaneous on the paravertebral of each animal. The treatment was carried under locally anesthetized with procaine cream. The mice were allotted into four groups of each, entire surface of each group wound covered by base cream control, sulfadiazine 0.1% cream, J. curcas latex cream 10% and, 15%, respectively. All experiments were performed twice a day for 3 days. The wound healing was assayed in stained histological sections in immunohistochemical of the wounds. CD68 expression was investigated under a microscope. Results: The results showed that the cream from the 10% and 15% latex of J. curcas revealed moderate immune reaction to CD68 on wound healing. Conclusion: We concluded that the latex cream of J. curcas possesses anti-inflammatory activity in wound healing process of mice skin. PMID:29657387

  13. Histone deacetylase inhibition enhances the lymphomacidal activity of the anti-CD22 monoclonal antibody HB22.7.

    PubMed

    Kong, YanGuo; Barisone, Gustavo A; Abuhay, Mastewal; O'Donnell, Robert T; Buksh, Zaneb; Yousefian, Faraz; Tuscano, Joseph M

    2014-11-01

    HB22.7, an anti-CD22 monoclonal antibody has shown consistent preclinical activity against non-Hodgkin lymphoma (NHL). Histone deacetylase inhibitors (HDACi) have demonstrated efficacy in lymphoma and can modulate cell surface receptor expression. To augment the lymphomacidal activity of HB22.7 we examined the combination of AR42 (an HDACi) and HB22.7 in vitro and in vivo. The combination resulted in 10-fold increased potency in 6 NHL cell lines when compared to either drug alone. Both drugs reduced tumor progression in xenografts, but the combination was significantly more efficacious and resulted in regression of established tumors, without toxicity. AR42 inhibited HB22.7-mediated CD22 internalization, suggesting that increased efficacy could be due to higher availability of CD22. Overall, the synergistic effects of HB22.7 and AR42 on in vitro cytotoxicity and in vivo anti-tumor activity make this combination an attractive option for further pre-clinical and clinical evaluation. Published by Elsevier Ltd.

  14. Liposome-encapsulated EF24-HPβCD inclusion complex: a preformulation study and biodistribution in a rat model

    NASA Astrophysics Data System (ADS)

    Agashe, H.; Lagisetty, P.; Sahoo, K.; Bourne, D.; Grady, B.; Awasthi, V.

    2011-06-01

    3,5-Bis(2-fluorobenzylidene)-4-piperidone (EF24) is an anti-proliferative diphenyldifluoroketone analog of curcumin with more potent activity. The authors describe a liposome preparation of EF24 using a "drug-in-CD-in liposome" approach. An aqueous solution of EF24 and hydroxypropyl-β-cyclodextrin (HPβCD) inclusion complex (IC) was used to prepare EF24 liposomes. The liposome size was reduced by a combination of multiple freeze-thaw cycles. Co-encapsulation of glutathione inside the liposomes conferred them with the capability of labeling with imageable radionuclide Tc-99m. Phase solubility analysis of EF24-HPβCD mixture provided k 1:1 value of 9.9 M-1. The enhanced aqueous solubility of EF24 (from 1.64 to 13.8 mg/mL) due to the presence of HPβCD helped in the liposome preparation. About 19% of the EF24 IC was encapsulated inside the liposomes (320.5 ± 2.6 nm) by dehydration-rehydration technique. With extrusion technique, the size of 177 ± 6.5 nm was obtained without any effect on encapsulation efficiency. The EF24-liposomes were evaluated for anti-proliferative activity in lung adenocarcinoma H441 and prostate cancer PC-3 cells. The EF24-liposomes demonstrated anti-proliferative activity superior to that of plain EF24 at 10 μM dose. When injected in rats, the Tc-99m-labeled EF24-liposomes cleared from blood with an α- t 1/2 of 21.4 min and β- t 1/2 of 397 min. Tissue radioactivity counting upon necropsy showed that the majority of clearance was due to the uptake in liver and spleen. The results suggest that using "drug-in-CD-in liposome" approach is a feasible strategy to formulate an effective parenteral preparation of EF24. In vitro studies show that the liposomal EF24 remains anti-proliferative, while presenting an opportunity to image its biodistribution.

  15. Liposome-encapsulated EF24-HPβCD inclusion complex: a preformulation study and biodistribution in a rat model

    PubMed Central

    Agashe, H.; Lagisetty, P.; Sahoo, K.; Bourne, D.; Grady, B.

    2011-01-01

    3,5-Bis(2-fluorobenzylidene)-4-piperidone (EF24) is an anti-proliferative diphenyldifluoroketone analog of curcumin with more potent activity. The authors describe a liposome preparation of EF24 using a “drug-in-CD-in liposome” approach. An aqueous solution of EF24 and hydroxypropyl-β-cyclodextrin (HPβCD) inclusion complex (IC) was used to prepare EF24 liposomes. The liposome size was reduced by a combination of multiple freeze–thaw cycles. Co-encapsulation of glutathione inside the liposomes conferred them with the capability of labeling with imageable radionuclide Tc-99m. Phase solubility analysis of EF24-HPβCD mixture provided k1:1 value of 9.9 M−1. The enhanced aqueous solubility of EF24 (from 1.64 to 13.8 mg/mL) due to the presence of HPβCD helped in the liposome preparation. About 19% of the EF24 IC was encapsulated inside the liposomes (320.5 ± 2.6 nm) by dehydration–rehydration technique. With extrusion technique, the size of 177 ± 6.5 nm was obtained without any effect on encapsulation efficiency. The EF24-liposomes were evaluated for anti-proliferative activity in lung adenocarcinoma H441 and prostate cancer PC-3 cells. The EF24-liposomes demonstrated anti-proliferative activity superior to that of plain EF24 at 10 μM dose. When injected in rats, the Tc-99m-labeled EF24-liposomes cleared from blood with an α-t1/2 of 21.4 min and β-t1/2 of 397 min. Tissue radioactivity counting upon necropsy showed that the majority of clearance was due to the uptake in liver and spleen. The results suggest that using “drug-in-CD-in liposome” approach is a feasible strategy to formulate an effective parenteral preparation of EF24. In vitro studies show that the liposomal EF24 remains anti-proliferative, while presenting an opportunity to image its biodistribution. PMID:21779150

  16. Liposome-encapsulated EF24-HPβCD inclusion complex: a preformulation study and biodistribution in a rat model.

    PubMed

    Agashe, H; Lagisetty, P; Sahoo, K; Bourne, D; Grady, B; Awasthi, V

    2011-06-01

    3,5-Bis(2-fluorobenzylidene)-4-piperidone (EF24) is an anti-proliferative diphenyldifluoroketone analog of curcumin with more potent activity. The authors describe a liposome preparation of EF24 using a "drug-in-CD-in liposome" approach. An aqueous solution of EF24 and hydroxypropyl-β-cyclodextrin (HPβCD) inclusion complex (IC) was used to prepare EF24 liposomes. The liposome size was reduced by a combination of multiple freeze-thaw cycles. Co-encapsulation of glutathione inside the liposomes conferred them with the capability of labeling with imageable radionuclide Tc-99m. Phase solubility analysis of EF24-HPβCD mixture provided k(1:1) value of 9.9 M(-1). The enhanced aqueous solubility of EF24 (from 1.64 to 13.8 mg/mL) due to the presence of HPβCD helped in the liposome preparation. About 19% of the EF24 IC was encapsulated inside the liposomes (320.5 ± 2.6 nm) by dehydration-rehydration technique. With extrusion technique, the size of 177 ± 6.5 nm was obtained without any effect on encapsulation efficiency. The EF24-liposomes were evaluated for anti-proliferative activity in lung adenocarcinoma H441 and prostate cancer PC-3 cells. The EF24-liposomes demonstrated anti-proliferative activity superior to that of plain EF24 at 10 μM dose. When injected in rats, the Tc-99m-labeled EF24-liposomes cleared from blood with an α-t(1/2) of 21.4 min and β-t(1/2) of 397 min. Tissue radioactivity counting upon necropsy showed that the majority of clearance was due to the uptake in liver and spleen. The results suggest that using "drug-in-CD-in liposome" approach is a feasible strategy to formulate an effective parenteral preparation of EF24. In vitro studies show that the liposomal EF24 remains anti-proliferative, while presenting an opportunity to image its biodistribution.

  17. Systematic review with meta-analysis: the efficacy of a second anti-TNF in patients with inflammatory bowel disease whose previous anti-TNF treatment has failed.

    PubMed

    Gisbert, J P; Marín, A C; McNicholl, A G; Chaparro, M

    2015-04-01

    One-third of patients with Crohn's disease (CD) or ulcerative colitis (UC) receiving anti-TNFs do not respond to treatment, and a relevant proportion experience loss of response or intolerance. To investigate the efficacy and safety of a second anti-TNF agent after primary/secondary failure or intolerance to a first drug. studies evaluating the efficacy of infliximab (IFX), adalimumab (ADA) and certolizumab-pegol (CZP) as the second anti-TNF in CD or UC. Bibliographical searches (PubMed/Embase). percentage of response/remission; the meta-analysis was performed using the inverse variance method. We included 46 studies (37 CD, 8 UC, 1 pouchitis). The CD studies comprised 32 switching IFX→ADA, 4 IFX→CZP and 1 ADA→IFX. Overall, the second anti-TNF after the failure of IFX in CD induced remission in 43% and response in 63% of patients. The remission rate was higher when the reason to withdraw the first anti-TNF was intolerance (61%) than after secondary (45%) or primary failure (30%); response rates were, respectively, 72%, 62% and 53%. All UC studies switched IFX→ADA, six of them reporting remission rates ranging from 0% to 50%. Adverse events rate ranged from 0% to 81% in CD, most of them mild (serious adverse event 0-21%, discontinuation rate <20%). The efficacy of a second anti-TNF in CD patients largely depends on the cause for switching. The remission rate is higher when the reason to withdraw the first anti-TNF is intolerance (61%), compared with secondary (45%) or primary failure (30%). Further studies of switch ADA→IFX are needed to evaluate this strategy. PROSPERO-registry-number: CRD42014012943. © 2015 John Wiley & Sons Ltd.

  18. SU-C-204-01: A Dosimetric Investigation Into the Effects of Yttrium-90 Radioembolization On the GI Tract: In-Vivo and Histological Analysis in An Animal Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pasciak, A; The University of Tennessee Graduate School of Medicine, Knoxville, TN; Nodit, L

    Purpose: In Yttrium-90 (90Y) radioembolization, non-target embolization (NTE) to the stomach or small bowel can result in ulceration, a rare but difficult to manage clinical complication. However, dosimetric thresholds for toxicity to these tissues from radioembolization have never been evaluated in a controlled setting. We performed an analysis of the effect of 90Y radioembolization in a porcine model at different absorbed-dose endpoints. Methods: Under approval of the University of Tennessee IACUC, 6 female pigs were included in this study. Animals underwent transfemoral angiography and infusion of calibrated dosages of 90Y resin microspheres into arteries supplying part of the gastric wall.more » A 99mTc-MAA simulation study was performed first to determine perfused tissue volume for treatment planning along with contrast-enhanced CT. The pigs were monitored for side effects for 9 weeks, after which time they were euthanized and their upper gastrointestinal tracts were harvested for analysis. Results: 90Y radioembolization was infused resulting in average absorbed doses of between 35.5 and 91.9 Gy to the gastric wall. No animal exhibited any signs of pain or gastrointestinal distress through the duration of the study. Excised tissue showed 1–2 small (<3.0 cm2) healed or healing superficial gastric lesions in 5 out of 6 animals. Histologic analysis demonstrated that lesion location was superficial to areas of abnormally high microsphere deposition. An analysis of microsphere deposition patterns within the gastric wall indicated a high preference for submucosal deposition. Dosimetric evaluation at the luminal mucosa performed based on microsphere deposition patterns confirmed that 90Y dosimetry techniques conventionally used in hepatic dosimetry provide a reasonable estimate of absorbed dose. Conclusion: The upper gastrointestinal tract may be less sensitive to 90Y radioembolization than previously thought. Lack of charged-particle equilibrium at the luminal

  19. Double electron capture of {sup 106}Cd in the TGV-2 experiment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rukhadze, N. I.; Egorov, V. G.; Kovalik, A.

    2015-10-28

    A new experimental run of searching for EC/EC decay of {sup 106}Cd was performed at the Modane underground laboratory (4800 m w.e.) using the TGV-2 spectrometer and ∼23.2 g {sup 106}Cd with enrichment of 99.57%. The limit on 2νEC/EC decay of {sup 106}Cd - T{sub 1/2}(2νEC/EC) > 3.1×10{sup 20} y, at 90% C.L was obtained from the preliminary calculation of experimental data accumulated for 7018 h of measurement. The limits on the resonance neutrino-less double electron capture decay of {sup 106}Cd were obtained from the measurement of ∼23.2 g of {sup 106}Cd with the low-background HPGe spectrometer OBELIX lasted 395more » h - T{sub 1/2}(KL, 2741 keV) > 0.9×10{sup 20} y and T{sub 1/2}(KK, 2718 keV) > 1.4×10{sup 20} y at 90% C.L.« less

  20. Coengagement of CD16 and CD94 receptors mediates secretion of chemokines and induces apoptotic death of naive natural killer cells.

    PubMed

    Jewett, Anahid; Cacalano, Nicholas A; Head, Christian; Teruel, Antonia

    2006-04-01

    Down-modulation of CD16 (FcgammaRIII) receptors and loss of natural killer (NK) cell function have been observed in oral cancer patients. However, neither the mechanisms nor the significance of the decrease in CD16 receptors have been fully understood. The cytotoxic activity and survival of NK cells are negatively regulated by antibodies directed against CD16 surface receptor. The addition of anti-CD94 antibody in combination with either F(ab')(2) fragment or intact anti-CD16 antibody to NK cells resulted in significant inhibition of NK cell cytotoxic function and induction of apoptosis in resting human peripheral blood NK cells. Addition of interleukin-2 to anti-CD16 and/or anti-CD94 antibody-treated NK cells significantly inhibited apoptosis and increased the function of NK cells. There was a significant increase in tumor necrosis factor-alpha (TNF-alpha) but not IFN-gamma secretion in NK cells treated either with anti-CD16 antibody alone or in combination with anti-CD94 antibodies. Consequently, the addition of anti-TNF-alpha antibody partially inhibited apoptosis of NK cells mediated by the combination of anti-CD94 and anti-CD16 antibodies. Increase in apoptotic death of NK cells also correlated with an increase in type 2 inflammatory cytokines and in the induction of chemokines. Thus, we conclude that binding of antibodies to CD16 and CD94 NK cell receptors induces death of the NK cells and signals for the release of chemokines.

  1. 46 CFR 34.20-90 - Installations contracted for prior to January 1, 1970-T/ALL.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Installations contracted for prior to January 1, 1970-T/ALL. 34.20-90 Section 34.20-90 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY TANK VESSELS FIREFIGHTING EQUIPMENT Deck Foam System, Details § 34.20-90 Installations contracted for prior to January 1...

  2. 46 CFR 34.20-90 - Installations contracted for prior to January 1, 1970-T/ALL.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Installations contracted for prior to January 1, 1970-T/ALL. 34.20-90 Section 34.20-90 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY TANK VESSELS FIREFIGHTING EQUIPMENT Deck Foam System, Details § 34.20-90 Installations contracted for prior to January 1...

  3. Anti-CD22 immunotoxin RFB4(dsFv)-PE38 (BL22) for CD22-positive hematologic malignancies of childhood: preclinical studies and phase I clinical trial.

    PubMed

    Wayne, Alan S; Kreitman, Robert J; Findley, Harry W; Lew, Glen; Delbrook, Cynthia; Steinberg, Seth M; Stetler-Stevenson, Maryalice; Fitzgerald, David J; Pastan, Ira

    2010-03-15

    Although most children with B-lineage acute lymphoblastic leukemia (ALL) and non-Hodgkin lymphoma are cured, new agents are needed to overcome drug resistance and reduce toxicities of chemotherapy. We hypothesized that the novel anti-CD22 immunotoxin, RFB4(dsFv)-PE38 (BL22, CAT-3888), would be active and have limited nonspecific side effects in children with CD22-expressing hematologic malignancies. We conducted the first preclinical and phase I clinical studies of BL22 in that setting. Lymphoblasts from children with B-lineage ALL were assessed for CD22 expression by flow cytometry and for BL22 sensitivity by in vitro cytotoxicity assay. BL22 was evaluated in a human ALL murine xenograft model. A phase I clinical trial was conducted for pediatric subjects with CD22+ ALL and non-Hodgkin lymphoma. All samples screened were CD22+. BL22 was cytotoxic to blasts in vitro (median IC(50), 9.8 ng/mL) and prolonged the leukemia-free survival of murine xenografts. Phase I trial cohorts were treated at escalating doses and schedules ranging from 10 to 40 microg/kg every other day for three or six doses repeated every 21 or 28 days. Treatment was associated with an acceptable safety profile, adverse events were rapidly reversible, and no maximum tolerated dose was defined. Pharmacokinetics were influenced by disease burden consistent with rapid drug binding by CD22+ blasts. Although no responses were observed, transient clinical activity was seen in most subjects. CD22 represents an excellent target and anti-CD22 immunotoxins offer therapeutic promise in B-lineage hematologic malignancies of childhood.

  4. Gallium-68-labeled anti-HER2 single-chain Fv fragment: development and in vivo monitoring of HER2 expression.

    PubMed

    Ueda, Masashi; Hisada, Hayato; Temma, Takashi; Shimizu, Yoichi; Kimura, Hiroyuki; Ono, Masahiro; Nakamoto, Yuji; Togashi, Kaori; Saji, Hideo

    2015-02-01

    We aimed to develop a gallium-68 (Ga-68)-labeled single-chain variable fragment (scFv) targeting the human epidermal growth factor receptor 2 (HER2) to rapidly and noninvasively evaluate the status of HER2 expression. Anti-HER2 scFv was labeled with Ga-68 by using deferoxamine (Df) as a bifunctional chelate. Biodistribution of [(68)Ga]Df-anti-HER2 scFv was examined with tumor-bearing mice and positron emission tomography (PET) imaging was performed. The changes in HER2 expression after anti-HER2 therapy were monitored by PET imaging. [(68)Ga]Df-anti-HER2 scFv was obtained with high radiochemical yield after only a 5-min reaction at room temperature. The probe showed high accumulation in HER2-positive xenografts and the intratumoral distribution of radioactivity coincided with HER2-positive regions. Furthermore, [(68)Ga]Df-anti-HER2 scFv helped visualize HER2-positive xenografts and monitor the changes in HER2 expression after anti-HER2 therapy. [(68)Ga]Df-anti-HER2 scFv could be a promising probe to evaluate HER2 status by in vivo PET imaging, unless trastuzumab is prescribed as part of the therapy.

  5. A Preclinical Population Pharmacokinetic Model for Anti‐CD20/CD3 T‐Cell‐Dependent Bispecific Antibodies

    PubMed Central

    Reyes, Arthur; Sun, Liping L.; Cheu, Melissa; Oldendorp, Amy; Ramanujan, Saroja; Stefanich, Eric G.

    2018-01-01

    Abstract CD20 is a cell‐surface receptor expressed by healthy and neoplastic B cells and is a well‐established target for biologics used to treat B‐cell malignancies. Pharmacokinetic (PK) and pharmacodynamic (PD) data for the anti‐CD20/CD3 T‐cell‐dependent bispecific antibody BTCT4465A were collected in transgenic mouse and nonhuman primate (NHP) studies. Pronounced nonlinearity in drug elimination was observed in the murine studies, and time‐varying, nonlinear PK was observed in NHPs, where three empirical drug elimination terms were identified using a mixed‐effects modeling approach: i) a constant nonsaturable linear clearance term (7 mL/day/kg); ii) a rapidly decaying time‐varying, linear clearance term (t½ = 1.6 h); and iii) a slowly decaying time‐varying, nonlinear clearance term (t½ = 4.8 days). The two time‐varying drug elimination terms approximately track with time scales of B‐cell depletion and T‐cell migration/expansion within the central blood compartment. The mixed‐effects NHP model was scaled to human and prospective clinical simulations were generated. PMID:29351372

  6. The novel HSP90 inhibitor NVP-AUY922 shows synergistic anti-leukemic activity with cytarabine in vivo.

    PubMed

    Wendel, Torunn; Zhen, Yan; Suo, Zenhe; Bruheim, Skjalg; Wiedlocha, Antoni

    2016-01-15

    HSP90 is a molecular chaperone essential for stability, activity and intracellular sorting of many proteins, including oncoproteins, such as tyrosine kinases, transcription factors and cell cycle regulatory proteins. Therefore, inhibitors of HSP90 are being investigated for their potential as anti-cancer drugs. Here we show that the HSP90 inhibitor NVP-AUY922 induced degradation of the fusion oncoprotein FOP2-FGFR1 in a human acute myeloid leukemia (AML) cell line, KG-1a. Concordantly, downstream signaling cascades, such as STAT1, STAT3 and PLCγ were abrogated. At concentrations that caused FOP2-FGFR1 degradation and signaling abrogation, NVP-AUY922 treatment caused significant cell death and inhibition of proliferation of KG-1a cells in vitro. In an animal model for AML, NVP-AUY922 administrated alone showed no anti-leukemic activity. However, when NVP-AUY922 was administered in combination with cytarabine, the two compounds showed significant synergistic anti-leukemic activity in vivo. Thus NVP-AUY922 and cytarabine combination therapy might be a prospective strategy for AML treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Rare earths, the lanthanides, yttrium and scandium

    USGS Publications Warehouse

    Bedinger, G.; Bleiwas, D.

    2012-01-01

    In 2011, rare earths were recovered from bastnasite concentrates at the Mountain Pass Mine in California. Consumption of refined rare-earth products decreased in 2011 from 2010. U.S. rare-earth imports originated primarily from China, with lesser amounts from Austria, Estonia, France and Japan. The United States imported all of its demand for yttrium metal and yttrium compounds, with most of it originating from China. Scandium was imported in various forms and processed domestically.

  8. CD19 chimeric antigen receptor (CD19 CAR)-redirected adoptive T-cell immunotherapy for the treatment of relapsed or refractory B-cell Non-Hodgkin's Lymphomas.

    PubMed

    Onea, Alexandra S; Jazirehi, Ali R

    2016-01-01

    Recovery rates for B-cell Non-Hodgkin's Lymphoma (NHL) are up to 70% with current standard-of-care treatments including rituximab (chimeric anti-CD20 monoclonal antibody) in combination with chemotherapy (R-CHOP). However, patients who do not respond to first-line treatment or develop resistance have a very poor prognosis. This signifies the need for the development of an optimal treatment approach for relapsed/refractory B-NHL. Novel CD19- chimeric antigen receptor (CAR) T-cell redirected immunotherapy is an attractive option for this subset of patients. Anti-CD19 CAR T-cell therapy has already had remarkable efficacy in various leukemias as well as encouraging outcomes in phase I clinical trials of relapsed/refractory NHL. In going forward with additional clinical trials, complementary treatments that may circumvent potential resistance mechanisms should be used alongside anti-CD19 T-cells in order to prevent relapse with resistant strains of disease. Some such supplementary tactics include conditioning with lymphodepletion agents, sensitizing with kinase inhibitors and Bcl-2 inhibitors, enhancing function with multispecific CAR T-cells and CD40 ligand-expressing CAR T-cells, and safeguarding with lymphoma stem cell-targeted treatments. A therapy regimen involving anti-CD19 CAR T-cells and one or more auxiliary treatments could dramatically improve prognoses for patients with relapsed/refractory B-cell NHL. This approach has the potential to revolutionize B-NHL salvage therapy in much the same way rituximab did for first-line treatments.

  9. Use of CdS quantum dot-functionalized cellulose nanocrystal films for anti-counterfeiting applications

    NASA Astrophysics Data System (ADS)

    Chen, L.; Lai, C.; Marchewka, R.; Berry, R. M.; Tam, K. C.

    2016-07-01

    Structural colors and photoluminescence have been widely used for anti-counterfeiting and security applications. We report for the first time the use of CdS quantum dot (QD)-functionalized cellulose nanocrystals (CNCs) as building blocks to fabricate nanothin films via layer-by-layer (LBL) self-assembly for anti-counterfeiting applications. Both negatively- and positively-charged CNC/QD nanohybrids with a high colloidal stability and a narrow particle size distribution were prepared. The controllable LBL coating process was characterized by scanning electron microscopy and ellipsometry. The rigid structure of CNCs leads to nanoporous structured films on poly(ethylene terephthalate) (PET) substrates with high transmittance (above 70%) over the entire range of visible light and also resulted in increased hydrophilicity (contact angles of ~40 degrees). Nanothin films on PET substrates showed good flexibility and enhanced stability in both water and ethanol. The modified PET films with structural colors from thin-film interference and photoluminescence from QDs can be used in anti-counterfeiting applications.Structural colors and photoluminescence have been widely used for anti-counterfeiting and security applications. We report for the first time the use of CdS quantum dot (QD)-functionalized cellulose nanocrystals (CNCs) as building blocks to fabricate nanothin films via layer-by-layer (LBL) self-assembly for anti-counterfeiting applications. Both negatively- and positively-charged CNC/QD nanohybrids with a high colloidal stability and a narrow particle size distribution were prepared. The controllable LBL coating process was characterized by scanning electron microscopy and ellipsometry. The rigid structure of CNCs leads to nanoporous structured films on poly(ethylene terephthalate) (PET) substrates with high transmittance (above 70%) over the entire range of visible light and also resulted in increased hydrophilicity (contact angles of ~40 degrees). Nanothin films

  10. In Vivo Defection of Thrombi with Indium-111-Labeled Platelets

    NASA Astrophysics Data System (ADS)

    Price, David C.; Lipton, Martin J.; Lusby, Robert J.; Engelstad, Barry L.; Stoney, Ronald J.; Prager, Robert J.; Hartmeyer, James A.; Holly, Anne S.

    1982-06-01

    The use of Indium-111-oxine labeled autologous platelets has been explored in a dog-catheter model, as well as in a variety of clinical disorders in man. Newly forming experimental thrombi in dogs label well during the first 45-90 minutes, then lose both label and thrombus mass in a manner consistent with fibrinolysis. Thrombus weight is linearly related to In-111 activity, so that in vivo scintigraphy will be a practical method to evaluate various thrombotic stimuli and anti-thrombotic interventions experimentally. Preformed thrombus, however, labels poorly and cannot be detected by imaging in this dog model. Initial clinical experience with a variety of arterial, venous and cardiac thrombotic states is reviewed, indicating some of the strengths and same of the potential weaknesses of this new scintigraphic technique.

  11. THE TREATMENT OF CHILDRENS' HEMANGIOMA AND NEVUS FLAMMEUS WITH Sr$sup 90$ AND Y$sup 9$$sup 0$ (in German)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lossl, H.; Jakob, A.

    The authors report the excellent results obtained in the radiotherapy of the hemangioma of the child and of the nevus flammeus by means of strontium-90 and yttrium-90. The method is preferred to others as it reduces the charge of rays on the growing skeleton of the child ami on the gonads. In case of smaller lesions the application of strontium-90 (total dose 3000 to 5000 rep) and surface irradiation by means of yttrium-90 foils (total dose 3000 to 4000 rep) produce good results. The single dose should be around 1OOO rep. The dosage has to be fixed according to themore » erythema which appears with medium intensity. To judge from the gathered experiences the results of this therapy are equivalent to those of radium treatment or Chaoul's close irradiation. (auth)« less

  12. Intratumoral delivery of low doses of anti-CD40 mAb combined with monophosphoryl lipid A induces local and systemic antitumor effects in immunocompetent and T cell-deficient mice

    PubMed Central

    Van De Voort, Tyler J.; Felder, Mildred A. R.; Yang, Richard K.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2012-01-01

    In this study, an agonistic anti-CD40 monoclonal antibody was combined with monophosphoryl lipid A (MPL), a nontoxic derivative of LPS and agonist of toll-like receptor 4, to assess the immunomodulatory and antitumor synergy between the two agents in mice. Anti-CD40 was capable of priming macrophages to subsequent ex vivo activation by MPL in immunocompetent and T cell-depleted mice. Intraperitoneal injections of anti-CD40+MPL induced additive to synergistic suppression of poorly immunogenic B16-F10 melanoma growing subcutaneously in syngeneic mice. When anti-CD40+MPL were injected directly into the subcutaneous tumor, the combination treatment was more effective, even with a 25-fold reduction in dose. Low-dose intratumoral treatment also slowed the growth of a secondary tumor growing simultaneously at a distant, untreated site. Antitumor effects were also induced in immunodeficient SCID mice and in T cell-depleted C57BL/6 mice. Taken together, our results show that the antitumor effects of anti-CD40 are enhanced by subsequent treatment with MPL, even in T cell-deficient hosts. These preclinical data suggest that an anti-CD40+MPL combined regimen is appropriate for clinical testing in human patients, including cancer patients that may be immunosuppressed from prior chemotherapy. PMID:23211623

  13. 21 CFR 660.28 - Labeling.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... STANDARDS FOR DIAGNOSTIC SUBSTANCES FOR LABORATORY TESTS Blood Grouping Reagent § 660.28 Labeling. In... white, except that all or a portion of the final container label of the following Blood Grouping... panel. Blood grouping reagent Color of label paper Anti-A Blue. Anti-B Yellow. Slide and rapid tube test...

  14. 21 CFR 660.28 - Labeling.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... STANDARDS FOR DIAGNOSTIC SUBSTANCES FOR LABORATORY TESTS Blood Grouping Reagent § 660.28 Labeling. In... white, except that all or a portion of the final container label of the following Blood Grouping... panel. Blood grouping reagent Color of label paper Anti-A Blue. Anti-B Yellow. Slide and rapid tube test...

  15. 21 CFR 660.28 - Labeling.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... STANDARDS FOR DIAGNOSTIC SUBSTANCES FOR LABORATORY TESTS Blood Grouping Reagent § 660.28 Labeling. In... white, except that all or a portion of the final container label of the following Blood Grouping... panel. Blood grouping reagent Color of label paper Anti-A Blue. Anti-B Yellow. Slide and rapid tube test...

  16. 21 CFR 660.28 - Labeling.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... STANDARDS FOR DIAGNOSTIC SUBSTANCES FOR LABORATORY TESTS Blood Grouping Reagent § 660.28 Labeling. In... white, except that all or a portion of the final container label of the following Blood Grouping... panel. Blood grouping reagent Color of label paper Anti-A Blue. Anti-B Yellow. Slide and rapid tube test...

  17. Fluorescent humanized anti-CEA antibody specifically labels metastatic pancreatic cancer in a patient-derived orthotopic xenograft (PDOX) mouse model

    NASA Astrophysics Data System (ADS)

    Lwin, Thinzar M.; Miyake, Kentaro; Murakami, Takashi; DeLong, Jonathan C.; Yazaki, Paul J.; Shivley, John E.; Clary, Bryan; Hoffman, Robert M.; Bouvet, Michael

    2018-03-01

    Specific tumor targeting can result in selective labeling of cancer in vivo for surgical navigation. In the present study, we show that the use of an anti-CEA antibody conjugated to the near-infrared (NIR) fluorescent dye, IRDye800CW, can selectively target and label pancreatic cancer and its metastases in a clinically relevant patient derived xenograft mouse model.

  18. Serum BAFF and APRIL Levels, T-Lymphocyte Subsets, and Immunoglobulins after B-Cell Depletion Using the Monoclonal Anti-CD20 Antibody Rituximab in Myalgic Encephalopathy/Chronic Fatigue Syndrome.

    PubMed

    Lunde, Sigrid; Kristoffersen, Einar K; Sapkota, Dipak; Risa, Kristin; Dahl, Olav; Bruland, Ove; Mella, Olav; Fluge, Øystein

    2016-01-01

    Myalgic Encephalopathy/Chronic Fatigue Syndrome (ME/CFS) is a disease of unknown etiology. We have previously suggested clinical benefit from B-cell depletion using the monoclonal anti-CD20 antibody rituximab in a randomized and placebo-controlled study. Prolonged responses were then demonstrated in an open-label phase-II study with maintenance rituximab treatment. Using blood samples from patients in the previous two clinical trials, we investigated quantitative changes in T-lymphocyte subsets, in immunoglobulins, and in serum levels of two B-cell regulating cytokines during follow-up. B-lymphocyte activating factor of the tumor necrosis family (BAFF) in baseline serum samples was elevated in 70 ME/CFS patients as compared to 56 healthy controls (p = 0.011). There were no significant differences in baseline serum BAFF levels between patients with mild, moderate, or severe ME/CFS, or between responders and non-responders to rituximab. A proliferation-inducing ligand (APRIL) serum levels were not significantly different in ME/CFS patients compared to healthy controls at baseline, and no changes in serum levels were seen during follow-up. Immunophenotyping of peripheral blood T-lymphocyte subsets and T-cell activation markers at multiple time points during follow-up showed no significant differences over time, between rituximab and placebo groups, or between responders and non-responders to rituximab. Baseline serum IgG levels were significantly lower in patients with subsequent response after rituximab therapy compared to non-responders (p = 0.03). In the maintenance study, slight but significant reductions in mean serum immunoglobulin levels were observed at 24 months compared to baseline; IgG 10.6-9.5 g/L, IgA 1.8-1.5 g/L, and IgM 0.97-0.70 g/L. Although no functional assays were performed, the lack of significant associations of T- and NK-cell subset numbers with B-cell depletion, as well as the lack of associations to clinical responses, suggest that B

  19. Bulgarian singer Dyana presents PA Director Dickinson with her new CD on STS-90 launch day

    NASA Technical Reports Server (NTRS)

    1998-01-01

    David Dickinson, the acting director of the National Aeronautics and Space Administration (NASA) Public Affairs Office at Kennedy Space Center, accepts a copy of Bulgarian singer Dyana Dafova's latest compact disc (CD) from her on behalf of NASA. The 525-foot tall Vehicle Assembly Building, where Space Shuttle orbiters are mated to their external tank/solid rocket booster stacks, looms in the background. Dyana is touring the United States to promote her CD, entitled 'Sounds of the Earth,' and was an invited guest of NASA for the launch of Columbia on STS-90, the Neurolab mission, earlier in the day. Columbia lifted off from Launch Pad 39B at 2:19 p.m. EDT. Dyana characterized the music on her CD as a new sound, incorporating jazz and new age classics, sung in a newly created language comprised of Bulgarian, English, Sanskrit, Aramski and Hebrew.

  20. CD90-positive cells, an additional cell population, produce laminin {alpha}2 upon transplantation to dy{sup 3k}/dy{sup 3k} mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukada, So-ichiro; Yamamoto, Yukiko; Segawa, Masashi

    2008-01-01

    Laminin {alpha}2 is a component of skeletal and cardiac muscle basal lamina. A defect of the laminin {alpha}2 chain leads to severe congenital muscular dystrophy (MDC1A) in humans and dy/dy mice. Myogenic cells including myoblasts, myotubes, and myofibers in skeletal muscle are a possible source of the laminin {alpha}2 chain, and myogenic cells are thus proposed as a cell source for congenital muscular dystrophy therapy. However, we observed production of laminin {alpha}2 in non-myogenic cells of normal mice, and we could enrich these laminin {alpha}2-producing cells in CD90{sup +} cell fractions. Intriguingly, the number of CD90{sup +} cells increased dramaticallymore » during skeletal muscle regeneration in mice. This fraction did not include myogenic cells but exhibited a fibroblast-like phenotype. Moreover, these cells were resident in skeletal muscle, not derived from bone marrow. Finally, the production of laminin {alpha}2 in CD90{sup +} cells was not dependent on fusion with myogenic cells. Thus, CD90{sup +} cells are a newly identified additional cell fraction that increased during skeletal muscle regeneration in vivo and could be another cell source for therapy for lama2-deficient muscular dystrophy.« less

  1. In Vitro Pre-Clinical Validation of Suicide Gene Modified Anti-CD33 Redirected Chimeric Antigen Receptor T-Cells for Acute Myeloid Leukemia

    PubMed Central

    Minagawa, Kentaro; Jamil, Muhammad O.; AL-Obaidi, Mustafa; Pereboeva, Larisa; Salzman, Donna; Erba, Harry P.; Lamb, Lawrence S.; Bhatia, Ravi; Mineishi, Shin

    2016-01-01

    non-therapeutic dimerizer to activate the suicide gene resulted in the elimination of only 76.4±2.0% gene modified cells in vitro, we found that co-administration of the dimerizer with either the BCL-2 inhibitor ABT-199, the pan-BCL inhibitor ABT-737, or mafosfamide, resulted in an additive effect up to complete cell elimination. Conclusions This strategy could be investigated for the safety of CAR T-cell applications, and targeting CD33 could be used as a ‘bridge” therapy for patients coming to allogeneic hematopoietic stem cell transplant, as anti-leukemia activity from infusing CAR.CD33 T-cells has been demonstrated in an ongoing clinical trial. Albeit never performed in the clinical setting, our future plan is to investigate the utility of iC9-CAR.CD33 T-cells as part of the conditioning therapy for an allogeneic hematopoietic stem cell transplant for acute myeloid leukemia, together with other myelosuppressive agents, whilst the activation of the inducible Caspase9 suicide gene would grant elimination of the infused gene modified T-cells prior to stem cell infusion to reduce the risk of engraftment failure as the CD33 is also expressed on a proportion of the donor stem cell graft. PMID:27907031

  2. CD19 chimeric antigen receptor (CD19 CAR)-redirected adoptive T-cell immunotherapy for the treatment of relapsed or refractory B-cell Non-Hodgkin’s Lymphomas

    PubMed Central

    Onea, Alexandra S; Jazirehi, Ali R

    2016-01-01

    Recovery rates for B-cell Non-Hodgkin’s Lymphoma (NHL) are up to 70% with current standard-of-care treatments including rituximab (chimeric anti-CD20 monoclonal antibody) in combination with chemotherapy (R-CHOP). However, patients who do not respond to first-line treatment or develop resistance have a very poor prognosis. This signifies the need for the development of an optimal treatment approach for relapsed/refractory B-NHL. Novel CD19- chimeric antigen receptor (CAR) T-cell redirected immunotherapy is an attractive option for this subset of patients. Anti-CD19 CAR T-cell therapy has already had remarkable efficacy in various leukemias as well as encouraging outcomes in phase I clinical trials of relapsed/refractory NHL. In going forward with additional clinical trials, complementary treatments that may circumvent potential resistance mechanisms should be used alongside anti-CD19 T-cells in order to prevent relapse with resistant strains of disease. Some such supplementary tactics include conditioning with lymphodepletion agents, sensitizing with kinase inhibitors and Bcl-2 inhibitors, enhancing function with multispecific CAR T-cells and CD40 ligand-expressing CAR T-cells, and safeguarding with lymphoma stem cell-targeted treatments. A therapy regimen involving anti-CD19 CAR T-cells and one or more auxiliary treatments could dramatically improve prognoses for patients with relapsed/refractory B-cell NHL. This approach has the potential to revolutionize B-NHL salvage therapy in much the same way rituximab did for first-line treatments. PMID:27186412

  3. Resveratrol analog, HS-1793 enhance anti-tumor immunity by reducing the CD4+CD25+ regulatory T cells in FM3A tumor bearing mice.

    PubMed

    Jeong, Min Ho; Yang, Kwang Mo; Choi, Yoo Jin; Kim, Sung Dae; Yoo, Young Hyun; Seo, Su Yeong; Lee, Sang Hwa; Ryu, Seong Ryul; Lee, Chang Min; Suh, Hong suk; Jo, Wol Soon

    2012-11-01

    Natural agents with the immunomodulating property have been gaining traction to be employed in the complementary therapy of cancer because the ineffectiveness of numerous therapeutic strategies may be related in part to the tumor-induced immunosuppressive phenotypes, especially regulatory T (Treg) cells found in the tumor microenvironment. The present study was undertaken to examine whether HS-1793, synthetic resvertrol analog free from the restriction of metabolic instability and high dose requirement of resveratrol, induces an in vivo anti-tumor effect in FM3A tumor bearing mice through the suppression of Treg cells, which contribute to an increase in tumor specific cytotoxic T cell responses. Intraperitoneal injections of HS-1793 showed not only therapeutic benefits on established tumors, but also preventive anti-tumor effects. Treg cells (CD4+CD25+Foxp3+ cells) were significantly reduced in the total splenocytes as well as tumor tissues from HS-1793-administered mice, and the production of TGF-β inducing Treg showed a similar pattern. On the contrary, the administration of HS-1793 increased IFN-γ-expressing CD8+ T cells, upregulated IFN-γ production, and enhanced the cytotoxicity of splenocytes against FM3A tumor cells both in therapeutic and preventive experimental animals. These results demonstrated the suppressive role of HS-1793 on the function of Treg cells contributing to tumor specific cytotoxic T lymphocyte responses in tumor-bearing mice, which explained the underlying mechanism of the anti-tumor immunity of HS-1793. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. 16 CFR § 1500.20 - Labeling requirement for advertising toys and games.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... and games. § 1500.20 Section § 1500.20 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION... ENFORCEMENT REGULATIONS § 1500.20 Labeling requirement for advertising toys and games. (a) Scope. This section..., that is used in various children's games, generally as a playing piece or marker. The term “marble...

  5. DropArray™, a wall-less 96-well plate for uptake and immunofluorescence microscopy, confirms CD22 recycles.

    PubMed

    Ingle, Gladys S; Scales, Suzie J

    2014-03-01

    CD22 is a cell surface glycoprotein restricted to normal and malignant B-cells and is the target of several anti-CD22 antibody-based cancer therapies. For therapeutic antibody-payload conjugates, it is important to understand the subcellular trafficking of anti-CD22 antibodies to optimize antibody and/or linker-drug properties to maximize antitumor efficacy. It is agreed that anti-CD22 antibodies rapidly internalize, but controversial whether they recycle or are degraded in lysosomes, and it is unclear if trafficking is antibody or cell-type dependent. No studies examined anti-CD22 trafficking to either pathway in B-cells over time by dual immunofluorescence microscopy, likely partly because multiple samples of suspension cells are tedious to stain. We overcame this by using DropArray™, a novel wall-less 96-well plate technology allowing rapid simultaneous staining of suspension or adherent cells in small (10-20 μL) volumes. We examined the time-course of trafficking of five different anti-CD22 antibodies in eight B-cell lines representing four B-cell cancer types and show that in all cases antibodies internalize within 5 min and recycle, with only small amounts eventually trafficking to lysosomes. CD22 also localizes to recycling endosomes at steady state in the absence of antibody. Our data may help explain the differential efficacies of anti-CD22 antibodies conjugated to different therapeutic payloads. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Peculiar enhancement of the excitonic emission of CdSe/ZnSe quantum wells at ˜ 90 K when excited with a HeCd laser

    NASA Astrophysics Data System (ADS)

    Alfaro-Martínez, Adrián; Hernández-Calderón, Isaac

    2018-02-01

    The close coincidence at low temperatures of the HeCd blue laser line (442 nm, Elaser = 2.808 eV) with the ZnSe bandgap, Eg = 2.821 eV, and with the excitonic emission at ˜2.80 eV, allows the observation of peculiar effects during photoluminescence studies of CdSe/ZnSe quantum wells with a typical experimental setup. One effect is the enhancement of the excitonic emission at ˜ 90 - 100 K; the second effect is the presence of strong longitudinal optical (LO) phonon lines (in a broad temperature range) due to resonant Raman scattering. Here, we will show that the enhancement of the excitonic emission, that can be misinterpreted as caused by an intrinsic temperature dependent behavior of the quantum wells, is due to the high absorption of the blue laser light by the barriers when the ZnSe bandgap coincides with Elaser at ˜ 90 K, electron and holes produced in the barriers diffuse to the quantum wells enhancing their excitonic emission.

  7. Automated four color CD4/CD8 analysis of leukocytes by scanning fluorescence microscopy using Quantum dots

    NASA Astrophysics Data System (ADS)

    Bocsi, Jozsef; Mittag, Anja; Varga, Viktor S.; Molnar, Bela; Tulassay, Zsolt; Sack, Ulrich; Lenz, Dominik; Tarnok, Attila

    2006-02-01

    Scanning Fluorescence Microscope (SFM) is a new technique for automated motorized microscopes to measure multiple fluorochrome labeled cells (Bocsi et al. Cytometry 2004, 61A:1). The ratio of CD4+/CD8+ cells is an important in immune diagnostics in immunodeficiency and HIV. Therefor a four-color staining protocol (DNA, CD3, CD4 and CD8) for automated SFM analysis of lymphocytes was developed. EDTA uncoagulated blood was stained with organic and inorganic (Quantum dots) fluorochromes in different combinations. Aliquots of samples were measured by Flow Cytometry (FCM) and SFM. By SFM specimens were scanned and digitized using four fluorescence filter sets. Automated cell detection (based on Hoechst 33342 fluorescence), CD3, CD4 and CD8 detection were performed, CD4/CD8 ratio was calculated. Fluorescence signals were well separable on SFM and FCM. Passing and Bablok regression of all CD4/CD8 ratios obtained by FCM and SFM (F(X)=0.0577+0.9378x) are in the 95% confidence interval. Cusum test did not show significant deviation from linearity (P>0.10). This comparison indicates that there is no systemic bias between the two different methods. In SFM analyses the inorganic Quantum dot staining was very stable in PBS in contrast to the organic fluorescent dyes, but bleached shortly after mounting with antioxidant and free radical scavenger mounting media. This shows the difficulty of combinations of organic dyes and Quantum dots. Slide based multi-fluorescence labeling system and automated SFM are applicable tools for the CD4/CD8 ratio determination in peripheral blood samples. Quantum Dots are stable inorganic fluorescence labels that may be used as reliable high resolution dyes for cell labeling.

  8. Size-dependent cytotoxicity of yttrium oxide nanoparticles on primary osteoblasts in vitro

    NASA Astrophysics Data System (ADS)

    Zhou, Guoqiang; Li, Yunfei; Ma, Yanyan; Liu, Zhu; Cao, Lili; Wang, Da; Liu, Sudan; Xu, Wenshi; Wang, Wenying

    2016-05-01

    Yttrium oxide nanoparticles are an excellent host material for the rare earth metals and have high luminescence efficiency providing a potential application in photodynamic therapy and biological imaging. In this study, the effects of yttrium oxide nanoparticles with four different sizes were investigated using primary osteoblasts in vitro. The results demonstrated that the cytotoxicity generated by yttrium oxide nanoparticles depended on the particle size, and smaller particles possessed higher toxicological effects. For the purpose to elucidate the relationship between reactive oxygen species generation and cell damage, cytomembrane integrity, intracellular reactive oxygen species level, mitochondrial membrane potential, cell apoptosis rate, and activity of caspase-3 in cells were then measured. Increased reactive oxygen species level was also observed in a size-dependent way. Thus, our data demonstrated that exposure to yttrium oxide nanoparticles resulted in a size-dependent cytotoxicity in cultured primary osteoblasts, and reactive oxygen species generation should be one possible damage pathway for the toxicological effects produced by yttrium oxide particles. The results may provide useful information for more rational applications of yttrium oxide nanoparticles in the future.

  9. Insufficient interleukin-2 production from splenic CD4+ T cells causes impaired cell proliferation and early apoptosis in SAMP1, a strain of senescence-accelerated mouse

    PubMed Central

    Nishimura, Yasumitsu; Hosokawa, Tomohide; Hosono, Masamichi; Baba, Mitsuo; Hosokawa, Masanori

    2002-01-01

    We examined the proliferative and cytokine-producing activities of CD4+ T cells from young mice of the senescence-accelerated mouse strain SAMP1, which had shown markedly low T-dependent antibody-producing responses. When splenic T cells were cultured with concanavalin A (Con A), the percentage of CD4+ cells decreased earlier in SAMP1 than in C3H/He mice. At 40 hr of culture, the percentage of BrdU-labelled proliferating CD4+ cells increased strongly in C3H/He, but only slightly in SAMP1. When purified CD4+ T cells were cultured with Con A, the percentage of 5-bromo-2′-deoxyuridine (BrdU)-labelled cells peaked at around 48 hr of culture in both strains, but decreased significantly at 64 hr in SAMP1. The production of interleukin (IL)-2 but not IL-4 or interferon-γ (IFN-γ) was significantly lower in SAMP1 than in C3H/He at 48 hr of culture. IL-2 production was also markedly low in SAMP1, even under the stimulation of anti-CD3 with anti-CD28 antibodies. The frequency of cells producing IL-2 was significantly lower in SAMP1 than in C3H/He at 6–24 hr of culture with Con A. The percentage of annexin-positive and propidium iodide (PI)-negative apoptotic cells was significantly higher in SAMP1 than in C3H/He at 96 hr of culture. Exogenous IL-2 prevented the decrease in BrdU-labelled cells and the increase in apoptotic cells in the SAMP1 cell culture. These results indicate that SAMP1 CD4+ T cells cannot produce IL-2 at levels sufficient to support cell proliferation and survival. This may account for the weak T-dependent antibody response in SAMP1 mice. PMID:12383198

  10. Development of 2024 AA-Yttrium composites by Spark Plasma Sintering

    NASA Astrophysics Data System (ADS)

    Vidyasagar, CH S.; Karunakar, D. B.

    2018-04-01

    The method of fabrication of MMNCs is quite a challenge, which includes advanced processing techniques like Spark Plasma Sintering (SPS), etc. The objective of the present work is to fabricate aluminium based MMNCs with the addition of small amounts of yttrium using Spark Plasma Sintering and to evaluate their mechanical and microstructure properties. Samples of 2024 AA with yttrium ranging from 0.1% to 0.5 wt% are fabricated by Spark Plasma Sintering (SPS). Hardness of the samples is determined using Vickers hardness testing machine. The metallurgical characterization of the samples is evaluated by Optical Microscopy (OM), Field Emission Scanning Electron Microscopy (FE-SEM). Unreinforced 2024 AA sample is also fabricated as a benchmark to compare its properties with those of the composite developed. It is found that the yttrium addition increases the above mentioned properties by altering the precipitation kinetics and intermetallic formation to some extent and then decreases gradually when yttrium wt% increases beyond 0.3 wt%. High density (˂ 99.75) is achieved in the samples and highest hardness achieved is 114 Hv, fabricated by spark plasma sintering and uniform distribution of yttrium is observed.

  11. Performance of two commercial ELISAs for detecting IgA anti-human and anti-guinea pig tissue transglutaminase antibodies.

    PubMed

    Abrantes-Lemos, Clarice Pires; Nakhle, Maria Cristina; Damiao, Aderson Omar Mourao Cintra; Sipahi, Aytan Miranda; Carrilho, Flair José; Cancado, Eduardo Luiz R

    2010-01-01

    Sensitivity and specificity of anti-human tissue transglutaminase antibodies (anti-htTGA) seem to be superior to those of anti-tissue transglutaminase of guinea pig (anti-gptTGA) for screening patients with celiac disease (CD), but there are still controversies. The aim of this study was to evaluate the performance of two INOVA ELISA kits to detect IgA anti-htTGA and anti-gptTGA in patients with and without CD. The study groups were comprised of 49 anti-endomysial antibody (EMA)-positive untreated-CD, and 123 controls (EMA-negative treated CD, EMA-negative chronic diarrhea, autoimmune hepatitis, inflammatory bowel disease and healthy people). The agreement between the two ELISAs was statistically significant in all study groups and there was no significant difference between them (92.7% agreement; kappa = 0.70; kappa p = 0.001; McNemar p = 1). All patients with serum reactivity of more than 100 units had histologic diagnosis of CD. In seven of 10 patients with treated-CD who had control biopsies, villous atrophy was still present in four who tested positive by both kits. Two of three celiacs with histologic remission tested positive for both anti-tTGA. the anti-gptTGA and anti-htTGA determination were equally efficient in identifying patients with untreated-CD with high titers of EMA. Whatever the anti-tTGA ELISA used, the reactivity above 100 units was always related to active CD diagnosed by histologic alterations in intestinal biopsies. The anti-tTGA reactivity by both kits was not only similar in determining histologic activity in the follow-up of CD after a gluten free diet, but also in identifying positive sera from the control groups, regardless if CD has been confirmed by duodenal biopsies.

  12. Anti-CMV-IgG Positivity of Donors Is Beneficial for alloHSCT Recipients with Respect to the Better Short-Term Immunological Recovery and High Level of CD4+CD25high Lymphocytes

    PubMed Central

    Jaskula, Emilia; Dlubek, Dorota; Tarnowska, Agnieszka; Lange, Janusz; Mordak-Domagala, Monika; Suchnicki, Krzysztof; Sedzimirska, Mariola; Borowik, Agata; Mizia, Sylwia; Lange, Andrzej

    2015-01-01

    Hematopoietic stem cell transplantation from anti-cytomegalovirus immunoglobulin G (anti-CMV-IgG) positive donors facilitated immunological recovery post-transplant, which may indicate that chronic CMV infection has an effect on the immune system. This can be seen in the recipients after reconstitution with donor lymphocytes. We evaluated the composition of lymphocytes at hematologic recovery in 99 patients with hematologic malignancies post hematopoietic stem cell transplantation (HSCT). Anti-CMV-IgG seropositivity of the donor was associated with higher proportions of CD4+ (227.963 ± 304.858 × 106 vs. 102.050 ± 17.247 × 106 cells/L, p = 0.009) and CD4+CD25high (3.456 ± 0.436 × 106 vs. 1.589 ± 0.218 × 106 cells/L, p = 0.003) lymphocytes in the blood at hematologic recovery. The latter parameter exerted a diverse influence on the risk of acute graft-versus-host disease (GvHD) if low (1.483 ± 0.360 × 106 vs. 3.778 ± 0.484 × 106 cells/L, p < 0.001) and de novo chronic GvHD (cGvHD) if high (3.778 ± 0.780 × 106 vs. 2.042 ± 0.261 × 106 cells/L, p = 0.041). Higher values of CD4+ lymphocytes in patients who received transplants from anti-CMV-IgG-positive donors translated into a reduced demand for IgG support (23/63 vs. 19/33, p = 0.048), and these patients also exhibited reduced susceptibility to cytomegalovirus (CMV), Epstein–Barr virus (EBV) and/or human herpes 6 virus (HHV6) infection/reactivation (12/50 vs. 21/47, p = 0.032). Finally, high levels (≥0.4%) of CD4+CD25high lymphocytes were significantly associated with better post-transplant survival (56% vs. 38%, four-year survival, p = 0.040). Donors who experience CMV infection/reactivation provide the recipients with lymphocytes, which readily reinforce the recovery of the transplanted patients’ immune system. PMID:25807050

  13. Regulatory function of cytomegalovirus-specific CD4{sup +}CD27{sup -}CD28{sup -} T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tovar-Salazar, Adriana; Patterson-Bartlett, Julie; Jesser, Renee

    2010-03-15

    CMV infection is characterized by high of frequencies of CD27{sup -}CD28{sup -} T cells. Here we demonstrate that CMV-specific CD4{sup +}CD27{sup -}CD28{sup -} cells are regulatory T cells (T{sub R}). CD4{sup +}CD27{sup -}CD28{sup -} cells sorted from CMV-stimulated PBMC of CMV-seropositive donors inhibited de novo CMV-specific proliferation of autologous PBMC in a dose-dependent fashion. Compared with the entire CMV-stimulated CD4{sup +} T-cell population, higher proportions of CD4{sup +}CD27{sup -}CD28{sup -} T{sub R} expressed FoxP3, TGFbeta, granzyme B, perforin, GITR and PD-1, lower proportions expressed CD127 and PD1-L and similar proportions expressed CD25, CTLA4, Fas-L and GITR-L. CMV-CD4{sup +}CD27{sup -}CD28{sup -}more » T{sub R} expanded in response to IL-2, but not to CMV antigenic restimulation. The anti-proliferative effect of CMV-CD4{sup +}CD27{sup -}CD28{sup -} T{sub R} significantly decreased after granzyme B or TGFbeta inhibition. The CMV-CD4{sup +}CD27{sup -}CD28{sup -} T{sub R} of HIV-infected and uninfected donors had similar phenotypes and anti-proliferative potency, but HIV-infected individuals had higher proportions of CMV-CD4{sup +}CD27{sup -}CD28{sup -} T{sub R}. The CMV-CD4{sup +}CD27{sup -}CD28{sup -} T{sub R} may contribute to the downregulation of CMV-specific and nonspecific immune responses of CMV-infected individuals.« less

  14. HLA Class Ia and Ib Polyreactive Anti-HLA-E IgG2a Monoclonal Antibodies (TFL-006 and TFL-007) Suppress Anti-HLA IgG Production by CD19+ B Cells and Proliferation of CD4+ T Cells While Upregulating Tregs

    PubMed Central

    2017-01-01

    The anti-HLA-E IgG2a mAbs, TFL-006 and TFL-007, reacted with all HLA-I antigens, similar to the therapeutic preparations of IVIg. Indeed, IVIg lost its HLA reactivity, when its HLA-E reactivity was adsorbed out. US-FDA approved IVIg to reduce antibodies in autoimmune diseases. But the mechanism underlying IVIg-mediated antibody reduction could not be ascertained due to the presence of other polyclonal antibodies. In spite of it, the cost prohibitive high or low IVIg is administered to patients waiting for donor organ and for allograft recipients for lowering antiallograft antibodies. A mAb that could mimic IVIg in lowering Abs, with defined mechanism of action, would be highly beneficial for patients. Demonstrably, the anti-HLA-E mAbs mimicked several functions of IVIg relevant to suppressing the antiallograft Abs. The mAbs suppressed activated T cells and anti-HLA antibody production by activated B cells, which were dose-wise superior to IVIg. The anti-HLA-E mAb expanded CD4+, CD25+, and Foxp3+ Tregs, which are known to suppress T and B cells involved in antibody production. These defined functions of the anti-HLA-E IgG2a mAbs at a level superior to IVIg encourage developing their humanized version to lower antibodies in allograft recipients, to promote graft survival, and to control autoimmune diseases. PMID:28634589

  15. Recombinant anti-tenascin antibody constructs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    ZALUTSKY, MICHAEL R

    2006-08-29

    The general objective of this research is to combine genetically derived molecular constructs reactive with tenascin, with appropriate radionuclides and labeling methods in order to generate more effective diagnostic and therapeutic reagents for oncologic nuclear medicine. Tenascin, a polymorphic extracellular matrix glycoprotein, is of interest because of its high expression on glioma, melanoma, as well as prostate and breast carcinoma. Recently, we have also documented high levels of tenascin in lymphomas, particularly those of higher grade, making the potential clinical impact of tenascin-specific radiodiagnostics and therapeutics even greater. An essential feature of our work plan is the ability to exploitmore » our extensive clinical experience in order to design second-generation constructs with properties which could improve clinical efficacy. To date, we have treated over 150 brain tumor patients with 131I-labeled murine 81C6, an antibody which binds specifically to the alternatively spliced fibronectin type III repeats CD of the tenascin molecule. During the current grant period, we have made several observations which form the basis for our proposed specific aims. First, tissue distribution and catabolism experiments in animal models have demonstrated enhanced stability for a chimeric construct composed of murine variable regions and human IgG2 constant domains. Furthermore, pharmacokinetic studies in patients with 131I-labeled chimeric 81C6 have shown significantly longer retention in glioma tumor resection cavities compared with its murine parent. Second, we have initiated the first clinical trial of an endoradiotherapeutic labeled with the 7.2-hr -particle emitter 211At. Twelve glioma patients have received 211At-labeled chimeric 81C6 directly into their brain tumor resection cavity, and very encouraging results have been obtained. Now that the feasibility of human studies with 211At, has been demonstrated, the development and evaluation of anti

  16. Altered status of CD4(+)CD25(+) regulatory T cells in patients with acute coronary syndromes.

    PubMed

    Mor, Adi; Luboshits, Galia; Planer, David; Keren, Gad; George, Jacob

    2006-11-01

    Considerable evidence supports the role of innate and adaptive immunity in the progression and destabilization of the atheromatous plaque. Naturally occurring CD4(+)CD25(+) regulatory T cells (Tregs) are a subpopulation of lymphocytes that are capable of suppressing the progression of experimental autoimmune disorders. We have hypothesized that peripheral numbers and function of Tregs would be deranged in patients with acute coronary syndromes (ACS). Peripheral numbers of Tregs were evaluated by FACS employing labelled antibodies to CD4 and CD25. Functional suppressive properties of Tregs were assayed by establishing a triple-cell culture in which purified Tregs were incubated with irradiated antigen-presenting cells and anti-CD3-activated responder T cells. Proliferation in the presence or absence of oxidized LDL (oxLDL) was evaluated by thymidine incorporation. mRNA and protein content of foxp3, a master transcriptional regulator of Tregs, were determined for all subjects. Patients with ACS exhibited significantly reduced numbers of peripheral Tregs as compared with patients with stable angina and normal coronary artery subjects. Moreover, oxLDL induced a more profound reduction in Treg numbers in patients with ACS. Tregs in ACS patients were significantly compromised as their ability to suppress responder CD4(+)CD25(-) T-cell proliferation was attenuated. mRNA and protein content of foxp3 were significantly reduced in purified Tregs obtained from patients with ACS. In patients with ACS, naturally occurring CD4(+)CD25(+) Treg numbers are reduced and their functional properties compromised. These findings may aid in understanding the mechanisms leading to culprit plaque associated T-cell activation in patients with ACS.

  17. CD4+CD28null T Cells are related to previous cytomegalovirus infection but not to accelerated atherosclerosis in ANCA-associated vasculitis.

    PubMed

    Slot, Marjan C; Kroon, Abraham A; Damoiseaux, Jan G M C; Theunissen, Ruud; Houben, Alfons J H M; de Leeuw, Peter W; Tervaert, Jan Willem Cohen

    2017-05-01

    Previous studies have suggested an increased risk for cardiovascular events in antineutrophil cytoplasmic antibodies (ANCA)-associated vasculitis (AAV). We analyzed the presence of atherosclerotic damage in patients with AAV in relation to the presence of CD4 + CD28 null T cells and antibodies against cytomegalovirus (CMV) and human Heat-Shock Protein 60 (hHSP60). In this cross-sectional study, patients with inactive AAV were compared with healthy controls (HC). Carotid intima-media thickness (IMT) and aortic pulse-wave velocity (PWV) were measured. In addition, CD4 + CD28 null T cells, anti-CMV, and anti-hHSP60 levels were determined. Forty patients with AAV were included. Patients' spouses were recruited as HC (N = 38). CD4 + CD28 null T cells are present in patients with AAV in a higher percentage (median 3.1, range 0.01-85) than in HC (0.28, 0-36, P < 0.0001). No significant difference in IMT (mm) between patients and controls was detected (mean 0.77 ± standard deviation 0.15 and 0.73 ± 0.11, respectively, P = 0.20). PWV standardized for MAP was increased in AAV patients (9.80 ± 2.50 m/s, compared to 8.72 ± 1.68 in HC, P = 0.04). There was a strong association between a previous CMV infection and the presence and percentage of CD4 + CD28 null T cells (0.33 vs 13.8, P < 0.001). There was no relationship between CD4 + CD28 null T cells and/or a previous CMV infection and IMT or PWV. There was no relation between anti-hHSP60 and CD4 + CD28 null T cells. Increased PWV values suggest atherosclerotic damage in patients with AAV. Plaque size, as determined by IMT, did not differ. CD4 + CD28 null T cells are increased in AAV and related to the previous CMV infection.

  18. Chemotherapy-Refractory Diffuse Large B-Cell Lymphoma and Indolent B-Cell Malignancies Can Be Effectively Treated With Autologous T Cells Expressing an Anti-CD19 Chimeric Antigen Receptor

    PubMed Central

    Kochenderfer, James N.; Dudley, Mark E.; Kassim, Sadik H.; Somerville, Robert P.T.; Carpenter, Robert O.; Stetler-Stevenson, Maryalice; Yang, James C.; Phan, Giao Q.; Hughes, Marybeth S.; Sherry, Richard M.; Raffeld, Mark; Feldman, Steven; Lu, Lily; Li, Yong F.; Ngo, Lien T.; Goy, Andre; Feldman, Tatyana; Spaner, David E.; Wang, Michael L.; Chen, Clara C.; Kranick, Sarah M.; Nath, Avindra; Nathan, Debbie-Ann N.; Morton, Kathleen E.; Toomey, Mary Ann; Rosenberg, Steven A.

    2015-01-01

    Purpose T cells can be genetically modified to express an anti-CD19 chimeric antigen receptor (CAR). We assessed the safety and efficacy of administering autologous anti-CD19 CAR T cells to patients with advanced CD19+ B-cell malignancies. Patients and Methods We treated 15 patients with advanced B-cell malignancies. Nine patients had diffuse large B-cell lymphoma (DLBCL), two had indolent lymphomas, and four had chronic lymphocytic leukemia. Patients received a conditioning chemotherapy regimen of cyclophosphamide and fludarabine followed by a single infusion of anti-CD19 CAR T cells. Results Of 15 patients, eight achieved complete remissions (CRs), four achieved partial remissions, one had stable lymphoma, and two were not evaluable for response. CRs were obtained by four of seven evaluable patients with chemotherapy-refractory DLBCL; three of these four CRs are ongoing, with durations ranging from 9 to 22 months. Acute toxicities including fever, hypotension, delirium, and other neurologic toxicities occurred in some patients after infusion of anti-CD19 CAR T cells; these toxicities resolved within 3 weeks after cell infusion. One patient died suddenly as a result of an unknown cause 16 days after cell infusion. CAR T cells were detected in the blood of patients at peak levels, ranging from nine to 777 CAR-positive T cells/μL. Conclusion This is the first report to our knowledge of successful treatment of DLBCL with anti-CD19 CAR T cells. These results demonstrate the feasibility and effectiveness of treating chemotherapy-refractory B-cell malignancies with anti-CD19 CAR T cells. The numerous remissions obtained provide strong support for further development of this approach. PMID:25154820

  19. Epstein-Barr virus is related with 5-aminosalicylic acid, tonsillectomy, and CD19(+) cells in Crohn's disease.

    PubMed

    Andreu-Ballester, Juan C; Gil-Borrás, Rafael; García-Ballesteros, Carlos; Catalán-Serra, Ignacio; Amigo, Victoria; Fernández-Fígares, Virgina; Cuéllar, Carmen

    2015-04-21

    To study anti-Epstein-Barr virus (EBV) IgG antibodies in Crohn's disease in relation to treatment, immune cells, and prior tonsillectomy/appendectomy. This study included 36 CD patients and 36 healthy individuals (controls), and evaluated different clinical scenarios (new patient, remission and active disease), previous mucosa-associated lymphoid tissue removal (tonsillectomy and appendectomy) and therapeutic regimens (5-aminosalicylic acid, azathioprine, anti-tumor necrosis factor, antibiotics, and corticosteroids). T and B cells subsets in peripheral blood were analyzed by flow cytometry (markers included: CD45, CD4, CD8, CD3, CD19, CD56, CD2, CD3, TCRαβ and TCRγδ) to relate with the levels of anti-EBV IgG antibodies, determined by enzyme-linked immunosorbent assay. The lowest anti-EBV IgG levels were observed in the group of patients that were not in a specific treatment (95.4 ± 53.9 U/mL vs 131.5 ± 46.2 U/mL, P = 0.038). The patients that were treated with 5-aminosalicylic acid showed the highest anti-EBV IgG values (144.3 U/mL vs 102.6 U/mL, P = 0.045). CD19(+) cells had the largest decrease in the group of CD patients that received treatment (138.6 vs 223.9, P = 0.022). The analysis of anti-EBV IgG with respect to the presence or absence of tonsillectomy showed the highest values in the tonsillectomy group of CD patients (169.2 ± 20.7 U/mL vs 106.1 ± 50.3 U/mL, P = 0.002). However, in the group of healthy controls, no differences were seen between those who had been tonsillectomized and subjects who had not been operated on (134.0 ± 52.5 U/mL vs 127.7 ± 48.1 U/mL, P = 0.523). High anti-EBV IgG levels in CD are associated with 5-aminosalicylic acid treatment, tonsillectomy, and decrease of CD19(+) cells.

  20. Adoptive immunotherapy utilizing anti-CD19 chimeric antigen receptor T-cells for B-cell malignancies.

    PubMed

    Oh, Iekuni; Oh, Yukiko; Ohmine, Ken

    2016-01-01

    Genetically modified T-cells with forced expression of anti-CD19 chimeric antigen receptor (CD19 CAR) have demonstrated promising clinical results for relapsed and refractory B cell malignancies in early clinical trial settings. The first beneficial tumor regressions were identified among approximately half of CLL patients in 2011. Similarly, CD19 CAR T-cells achieved remissions in about 80% of aggressive B-cell lymphomas in 2012. Furthermore, in 2013 this cellular therapy showed an extremely high rate of efficacy against refractory CD19 positive acute lymphoid leukemia, which had been regarded as the most difficult to treat hematologic disease. Recently, despite the absence of CD19 expression by neoplastic plasma cells, patients with refractory multiple myeloma achieved stringent complete remission after this therapy coupled with high dose chemotherapy and autologous stem cell transplantation. However, there are significant toxicities. Cytokine releasing syndrome and neurotoxicity are recognized as life-threatening adverse events. Although phase I/II clinical trials have just started in Japan, given the exciting results obtained to date, this cellular therapy is expected to be a novel breakthrough immunotherapy for treating refractory B-cell malignancies.

  1. Effects of waterborne Cu and Cd on anti-oxidative response, lipid peroxidation and heavy metals accumulation in abalone Haliotis discus hannai ino

    NASA Astrophysics Data System (ADS)

    Lei, Yanju; Zhang, Wenbing; Xu, Wei; Zhang, Yanjiao; Zhou, Huihui; Mai, Kangsen

    2015-06-01

    The aim of this study was to compare the effects of waterborne copper (Cu) and cadmium (Cd) on survival, anti-oxidative response, lipid peroxidation and metal accumulation in abalone Haliotis discus hannai. Experimental animals (initial weight: 7.49 g ± 0.01 g) were exposed to graded concentrations of waterborne Cu (0.02, 0.04, 0.06, 0.08 mg L-1) or Cd (0.025, 0.05, 0.25, 0.5 mg L-1) for 28 days, respectively. Activities of the anti-oxidative enzymes (catalase, CAT; superoxide dismutase, SOD; glutathione peroxidases, GPx; glutathione S-transferase, GST), contents of the reduced glutathione (GSH) and malondiadehyde (MDA) in the hepatopancreas, and metal accumulation in hepatopancreas and muscles were analyzed after 0, 1, 3, 6, 10, 15, 21, 28 days of metal exposure, respectively. Results showed that 0.04 mg L-1, 0.06 mg L--1 and 0.08 mg L-1 Cu caused 100% death of abalone on the 21st, 10th and 6th day, respectively. However, no dead abalone was found during the 28-day waterborne Cd exposure at all experimental concentrations. Generally, activities of SOD and GST in hepatopancreas under all Cu concentrations followed a decrease trend as the exposure time prolonged. However, these activities were firstly increased and then decreased to the control level and increased again during Cd exposure. Activities of CAT in all Cu exposure treatments were higher than those in the control. These activities were firstly increased and then decreased to the control level and increased again during Cd exposure. Contents of MDA in hepatopancreas in all Cu treatments significantly increased first and then decreased to the control level. However, the MDA contents in hepatopancreas were not significantly changed during the 28-day Cd exposure. The metals accumulation in both hepatopancreas and muscles of abalone significantly increased with the increase of waterborne metals concentration and exposure time. These results indicated that H. discus hannai has a positive anti-oxidative defense

  2. Chimeric Antigen Receptor (CAR)-Specific Monoclonal Antibody to Detect CD19-Specific T Cells in Clinical Trials

    PubMed Central

    Jena, Bipulendu; Maiti, Sourindra; Huls, Helen; Singh, Harjeet; Lee, Dean A.; Champlin, Richard E.; Cooper, Laurence J. N.

    2013-01-01

    Clinical trials targeting CD19 on B-cell malignancies are underway with encouraging anti-tumor responses. Most infuse T cells genetically modified to express a chimeric antigen receptor (CAR) with specificity derived from the scFv region of a CD19-specific mouse monoclonal antibody (mAb, clone FMC63). We describe a novel anti-idiotype monoclonal antibody (mAb) to detect CD19-specific CAR+ T cells before and after their adoptive transfer. This mouse mAb was generated by immunizing with a cellular vaccine expressing the antigen-recognition domain of FMC63. The specificity of the mAb (clone no. 136.20.1) was confined to the scFv region of the CAR as validated by inhibiting CAR-dependent lysis of CD19+ tumor targets. This clone can be used to detect CD19-specific CAR+ T cells in peripheral blood mononuclear cells at a sensitivity of 1∶1,000. In clinical settings the mAb is used to inform on the immunophenotype and persistence of administered CD19-specific T cells. Thus, our CD19-specific CAR mAb (clone no. 136.20.1) will be useful to investigators implementing CD19-specific CAR+ T cells to treat B-lineage malignancies. The methodology described to develop a CAR-specific anti-idiotypic mAb could be extended to other gene therapy trials targeting different tumor associated antigens in the context of CAR-based adoptive T-cell therapy. PMID:23469246

  3. Association of Anti-glycan Antibodies and Inflammatory Bowel Disease Course.

    PubMed

    Paul, S; Boschetti, G; Rinaudo-Gaujous, M; Moreau, A; Del Tedesco, E; Bonneau, J; Presles, E; Mounsef, F; Clavel, L; Genin, C; Flourié, B; Phelip, J-M; Nancey, S; Roblin, X

    2015-06-01

    The usefulness of anti-glycan antibodies alone or combined with anti-Saccharomyces cerevisiae [ASCA] or perinuclear antineutrophil cytoplasmic [pANCA] antibodies for diagnosis of inflammatory bowel disease [IBD], differentiation between Crohn's disease [CD] and ulcerative colitis [UC], disease stratification including IBD phenotype, and also for determination of the course of the disease, remain unclear. A large panel of serological anti-glycan carbohydrate antibodies, including anti-mannobioside IgG antibodies [AMCA], anti-chitobioside IgA [ACCA], anti-laminaribioside IgG antibodies [ALCA], anti-laminarin [anti-L] and anti-chitine [anti-C] were measured in the serum from a cohort of 195 patients with IBD] [107 CD and 88 UC]. The respective accuracy of isolated or combined markers for diagnosis, disease differentiation, stratification disease phenotype, and severity of the disease course, defined by a wide panel of criteria obtained from the past medical history, was assessed. The positivity of at least one anti-glycan antibody was detected in a significant higher proportion of CD and UC compared with healthy controls [p < 0.0001 and p < 0.0007, respectively]. Whereas ASCA and ANCA antibody status had the highest efficacy to be associated with CD in comparison with UC (area under receiver operating characteristic curve [AUROC] = 0.70 for each], the adjunction of anti-laminarin antibody substantially improved the differentiation between CD and UC [AUROC = 0.77]. Titres of ACCA [> 51U/ml] and anti-laminarin [> 31U/ml] were significantly linked with a higher association with steroid dependency (odds ratio [OR] =2.0 [1.0-4.0], p = 0.03 and OR = 2.4 [1.1-5.2], p = 0.02, respectively]. We further defined the respective performance of anti-glycan antibodies to discriminate between patients with severe or not severe CD and UC course and determined the associated optimal cut-off values: severe CD course was significantly more likely in case of AMCA > 77U/ml [OR = 4.3; p = 0

  4. A novel method to generate and culture human mast cells: Peripheral CD34+ stem cell-derived mast cells (PSCMCs).

    PubMed

    Schmetzer, Oliver; Valentin, Patricia; Smorodchenko, Anna; Domenis, Rossana; Gri, Giorgia; Siebenhaar, Frank; Metz, Martin; Maurer, Marcus

    2014-11-01

    The identification and characterization of human mast cell (MC) functions are hindered by the shortage of MC populations suitable for investigation. Here, we present a novel technique for generating large numbers of well differentiated and functional human MCs from peripheral stem cells (=peripheral stem cell-derived MCs, PSCMCs). Innovative and key features of this technique include 1) the use of stem cell concentrates, which are routinely discarded by blood banks, as the source of CD34+ stem cells, 2) cell culture in serum-free medium and 3) the addition of LDL as well as selected cytokines. In contrast to established and published protocols that use CD34+ or CD133+ progenitor cells from full blood, we used a pre-enriched cell population obtained from stem cell concentrates, which yielded up to 10(8) differentiated human MCs per batch after only three weeks of culture starting with 10(6) total CD34+ cells. The total purity on MCs (CD117+, FcεR1+) generated by this method varied between 55 and 90%, of which 4-20% were mature MCs that contain tryptase and chymase and show expression of FcεRI and CD117 in immunohistochemistry. PSCMCs showed robust histamine release in response to stimulation with anti-FcεR1 or IgE/anti-IgE, and increased proliferation and differentiation in response to IL-1β or IFN-γ. Taken together, this new protocol of the generation of large numbers of human MCs provides for an innovative and suitable option to investigate the biology of human MCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. B-lymphoma cells escape rituximab-triggered elimination by NK cells through increased HLA class I expression.

    PubMed

    Borgerding, Andrea; Hasenkamp, Justin; Engelke, Michael; Burkhart, Nina; Trümper, Lorenz; Wienands, Jürgen; Glass, Bertram

    2010-03-01

    Antibody-dependent cellular cytotoxicity (ADCC) by natural killer (NK) cells is a major effector mechanism of the monoclonal anti-CD20 antibody rituximab in eliminating B-cell lymphomas. Resistance to this treatment occurs, although CD20 antigen is expressed on the tumor cells. A model of ADCC was established by stimulating human bulk NK cells and inhibitory killer immunoglobulin receptor (KIR)-defined NK cells from human leukocyte antigen (HLA)-typed donors. NK-cell activation was triggered via stimulation of the Fc receptor with immunoglobulin G aggregates, rituximab-labeled HLA-defined CD20-positive B-lymphoblast cell lines or CD20-positive B-lymphoma cell lines. The effect of KIR ligation by anti-KIR antibodies and HLA, the HLA expression density and rituximab concentrations on the efficacy of ADCC were analyzed in granzyme B ELISPOT measuring NK-cell activation and fluorescein-activated cell sorting cytotoxicity assay. HLA, but not CD20 expression density correlated with NK-cell activity against rituximab-labeled targets. ADCC was increased or decreased following HLA shielding or KIR activation by anti-KIR antibodies, respectively. Herein we show that rituximab-induced ADCC is attenuated upon ligation of KIR by HLA molecules expressed on human B-lymphoma target cells. Moreover, anti-KIR antibodies do not only block KIR/HLA interactions, but display agonistic effects at the KIR, which has to be considered for therapeutical applications. KIR activation and HLA expression density are critical determinants for the efficacy of rituximab treatment. An explanation for the failure of rituximab treatment may be the protection of the tumor cells from ADCC by inhibiting NK-cell function with their surface HLA. Copyright 2010 ISEH - Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

  6. A phase 1/2 trial of ublituximab, a novel anti-CD20 monoclonal antibody, in patients with B-cell non-Hodgkin lymphoma or chronic lymphocytic leukaemia previously exposed to rituximab.

    PubMed

    Sawas, Ahmed; Farber, Charles M; Schreeder, Marshall T; Khalil, Mazen Y; Mahadevan, Daruka; Deng, Changchun; Amengual, Jennifer E; Nikolinakos, Petros G; Kolesar, Jill M; Kuhn, John G; Sportelli, Peter; Miskin, Hari P; O'Connor, Owen A

    2017-04-01

    This phase 1/2 study evaluated the safety, pharmacokinetic behavior and anti-tumour activity of ublituximab, a unique type I, chimeric, glycoengineered anti-CD20 monoclonal antibody, in rituximab-relapsed or -refractory patients with B-cell non-Hodgkin lymphoma (B-NHL) or chronic lymphocytic leukaemia (CLL). Induction therapy (doses of 450-1200 mg) consisted of 4 weekly infusions in cycle 1 for NHL and 3 weekly infusions in cycles 1 and 2 for CLL. Patients received ublituximab maintenance monthly during cycles 3-5, then once every 3 months for up to 2 years. Enrolled patients with B-NHL (n = 27) and CLL (n = 8) had a median of 3 prior therapies. No dose-limiting toxicities or unexpected adverse events (AEs) occurred. The most common AEs were infusion-related reactions (40%; grade 3/4, 0%); fatigue (37%; grade 3/4, 3%); pyrexia (29%; grade 3/4, 0%); and diarrhoea (26%; grade 3/4, 0%). Common haematological AEs were neutropenia (14%; grade 3/4, 14%) and anaemia (11%; grade 3/4, 6%). The overall response rate for evaluable patients (n = 31) was 45% (13% complete responses, 32% partial responses). Median duration of response and progression-free survival were 9·2 months and 7·7 months, respectively. Ublituximab was well-tolerated and efficacious in a heterogeneous and highly rituximab-pre-treated patient population. © 2017 The Authors. British Journal of Haematology published by John Wiley & Sons Ltd.

  7. Immunosuppression With CD40 Costimulatory Blockade Plus Rapamycin for Simultaneous Islet-Kidney Transplantation in Nonhuman Primates.

    PubMed

    Oura, T; Hotta, K; Lei, J; Markmann, J; Rosales, I; Dehnadi, A; Kawai, K; Ndishabandi, D; Smith, R-N; Cosimi, A B; Kawai, T

    2017-03-01

    The lack of a reliable immunosuppressive regimen that effectively suppresses both renal and islet allograft rejection without islet toxicity hampers a wider clinical application of simultaneous islet-kidney transplantation (SIK). Seven MHC-mismatched SIKs were performed in diabetic cynomolgus monkeys. Two recipients received rabbit antithymocyte globulin (ATG) induction followed by daily tacrolimus and rapamycin (ATG/Tac/Rapa), and five recipients were treated with anti-CD40 monoclonal antibody (mAb) and rapamycin (aCD40/Rapa). Anti-inflammatory therapy, including anti-interleukin-6 receptor mAb and anti-tumor necrosis factor-α mAb, was given in both groups. The ATG/Tac/Rapa recipients failed to achieve long-term islet allograft survival (19 and 26 days) due to poor islet engraftment and cytomegalovirus pneumonia. In contrast, the aCD40/Rapa regimen provided long-term islet and kidney allograft survival (90, 94, >120, >120, and >120 days), with only one recipient developing evidence of allograft rejection. The aCD40/Rapa regimen was also tested in four kidney-alone transplant recipients. All four recipients achieved long-term renal allograft survival (100% at day 120), which was superior to renal allograft survival (62.9% at day 120) with triple immunosuppressive regimen (tacrolimus, mycophenolate mofetil, and steroids). The combination of anti-CD40 mAb and rapamycin is an effective and nontoxic immunosuppressive regimen that uses only clinically available agents for kidney and islet recipients. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  8. 46 CFR 190.20-90 - Vessels contracted for prior to March 1, 1968.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Section 190.20-90 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS CONSTRUCTION AND ARRANGEMENT Accomodations for Officers, Crew, and Scientific Personnel § 190.20... departure from the standards of §§ 190.20-5 through 190.20-55 be permitted than presently exists. ...

  9. 46 CFR 190.20-90 - Vessels contracted for prior to March 1, 1968.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... Section 190.20-90 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS CONSTRUCTION AND ARRANGEMENT Accomodations for Officers, Crew, and Scientific Personnel § 190.20... departure from the standards of §§ 190.20-5 through 190.20-55 be permitted than presently exists. ...

  10. Response, survival, and long-term toxicity after therapy with the radiolabeled somatostatin analogue [90Y-DOTA]-TOC in metastasized neuroendocrine cancers.

    PubMed

    Imhof, Anna; Brunner, Philippe; Marincek, Nicolas; Briel, Matthias; Schindler, Christian; Rasch, Helmut; Mäcke, Helmut R; Rochlitz, Christoph; Müller-Brand, Jan; Walter, Martin A

    2011-06-10

    To investigate response, survival, and safety profile of the somatostatin-based radiopeptide (90)yttrium-labeled tetraazacyclododecane-tetraacetic acid modified Tyr-octreotide ([(90)Y-DOTA]-TOC) in neuroendocrine cancers. In a clinical phase II single-center open-label trial, patients with neuroendocrine cancers were treated with repeated cycles of [(90)Y-DOTA]-TOC. Each cycle consisted of a single intravenous injection of 3.7GBq/m(2) body-surface [(90)Y-DOTA]-TOC. Additional cycles were withheld in case of tumor progression and/or permanent toxicity. Overall, 1,109 patients received 2,472 cycles of [(90)Y-DOTA]-TOC (median, two; range, one to 10 cycles per patient). Of the 1,109 patients, 378 (34.1%) experienced morphologic response; 172 (15.5%), biochemical response; and 329 (29.7%), clinical response. During a median follow-up of 23 months, 491 patients (44.3%) died. Longer survival was correlated with each: morphologic (hazard ratio [HR], 0.46; 95% CI, 0.38 to 0.56; median survival, 44.7 v 18.3 months; P < .001), biochemical (HR, 0.75; 95% CI, 0.59 to 0.96; 35.3 v 25.7 months; P = .023), and clinical response (HR, 0.68; 95% CI, 0.56 to 0.82; 36.8 v 23.5 months; P < .001). Overall, 142 patients (12.8%) developed grade 3 to 4 transient hematologic toxicities, and 103 patients (9.2%) experienced grade 4 to 5 permanent renal toxicity. Multivariable regression revealed that tumoral uptake in the initial imaging study was predictive for overall survival (HR, 0.45; 95% CI, 0.29 to 0.69; P < .001), whereas the initial kidney uptake was predictive for severe renal toxicity (HR, 1.59; 95% CI, 1.17 to 2.17; P = .003). This study documents the long-term outcome of [(90)Y-DOTA]-TOC treatment in a large cohort. Response to [(90)Y-DOTA]-TOC is associated with longer survival. Somatostatin receptor imaging is predictive for both survival after [(90)Y-DOTA]-TOC treatment and occurrence of renal toxicity.

  11. Mucosal immunization in macaques upregulates the innate APOBEC 3G anti-viral factor in CD4(+) memory T cells.

    PubMed

    Wang, Yufei; Bergmeier, Lesley A; Stebbings, Richard; Seidl, Thomas; Whittall, Trevor; Singh, Mahavir; Berry, Neil; Almond, Neil; Lehner, Thomas

    2009-02-05

    APOBEC3G is an innate intracellular anti-viral factor which deaminates retroviral cytidine to uridine. In vivo studies of APOBEC3G (A3G) were carried out in rhesus macaques, following mucosal immunization with SIV antigens and CCR5 peptides, linked to the 70kDa heat shock protein. A progressive increase in A3G mRNA was elicited in PBMC after each immunization (p<0.0002 to p< or =0.02), which was maintained for at least 17 weeks. Analysis of memory T cells showed a significant increase in A3G mRNA and protein in CD4(+)CCR5(+) memory T cells in circulating (p=0.0001), splenic (p=0.0001), iliac lymph nodes (p=0.002) and rectal (p=0.01) cells of the immunized compared with unimmunized macaques. Mucosal challenge with SIVmac 251 showed a significant increase in A3G mRNA in the CD4(+)CCR5(+) circulating cells (p<0.01) and the draining iliac lymph node cells (p<0.05) in the immunized uninfected macaques, consistent with a protective effect exerted by A3G. The results suggest that mucosal immunization in a non-human primate can induce features of a memory response to an innate anti-viral factor in CCR5(+)CD4(+) memory and CD4(+)CD95(+)CCR7(-) effector memory T cells.

  12. Inactivated probiotic Bacillus coagulans GBI-30 induces complex immune activating, anti-inflammatory, and regenerative markers in vitro

    PubMed Central

    Jensen, Gitte S; Cash, Howard A; Farmer, Sean; Keller, David

    2017-01-01

    Objective The aim of this study was to document the immune activating and anti-inflammatory effects of inactivated probiotic Bacillus coagulans GBI-30, 6086 (Staimune™) cells on human immune cells in vitro. Methods In vitro cultures of human peripheral blood mononuclear cells (PBMC) from healthy blood donors were treated with inactivated B. coagulans GBI-30, 6086 cells for 24 hours. After incubation, the PBMC were stained with fluorochrome-labeled monoclonal antibodies for CD3, CD56, and CD69 to monitor cellular activation by flow cytometry. The culture supernatants were tested for cytokine profile using a 27-plex Luminex array, including pro- and anti-inflammatory cytokines, chemokines, and growth factors. Results Inactivated B. coagulans GBI-30, 6086 cells induced the CD69 early activation marker on CD3+ CD56− T lymphocytes, CD3+ CD56+ NKT cells, CD3−CD56+ NK cells, and also some cells within the CD3−CD56− non-T non-NK cell subset. Culture supernatants showed robust increases in the immune-activating cytokines IL-1β, IL-6, IL-17A, and TNF-α. IFN-γ levels were increased, along with three chemokines, MCP-1, MIP-1α, and MIP-1β. The two anti-inflammatory cytokines IL-1ra and IL-10 showed increases, as well as the G-CSF growth factor involved in repair and stem cell biology. In contrast, GM-CSF levels showed a mild decrease, showing a highly selective growth factor response. Conclusion The inactivated B. coagulans GBI-30, 6086 cells activated human immune cells and altered the production of both immune activating and anti-inflammatory cytokines and chemokines. Of special importance is the novel demonstration of a selective upregulation of the G-CSF growth factor involved in postinjury and postinflammation repair and regeneration. This suggests that important immunogenic cell wall components, such as lipoteichoic acid, are undamaged after the inactivation and retain the complex beneficial biological activities previously demonstrated for the cell walls

  13. Inactivated probiotic Bacillus coagulans GBI-30 induces complex immune activating, anti-inflammatory, and regenerative markers in vitro.

    PubMed

    Jensen, Gitte S; Cash, Howard A; Farmer, Sean; Keller, David

    2017-01-01

    The aim of this study was to document the immune activating and anti-inflammatory effects of inactivated probiotic Bacillus coagulans GBI-30, 6086 (Staimune™) cells on human immune cells in vitro. In vitro cultures of human peripheral blood mononuclear cells (PBMC) from healthy blood donors were treated with inactivated B. coagulans GBI-30, 6086 cells for 24 hours. After incubation, the PBMC were stained with fluorochrome-labeled monoclonal antibodies for CD3, CD56, and CD69 to monitor cellular activation by flow cytometry. The culture supernatants were tested for cytokine profile using a 27-plex Luminex array, including pro- and anti-inflammatory cytokines, chemokines, and growth factors. Inactivated B. coagulans GBI-30, 6086 cells induced the CD69 early activation marker on CD3 + CD56 - T lymphocytes, CD3 + CD56 + NKT cells, CD3 - CD56 + NK cells, and also some cells within the CD3 - CD56 - non-T non-NK cell subset. Culture supernatants showed robust increases in the immune-activating cytokines IL-1β, IL-6, IL-17A, and TNF-α. IFN-γ levels were increased, along with three chemokines, MCP-1, MIP-1α, and MIP-1β. The two anti-inflammatory cytokines IL-1ra and IL-10 showed increases, as well as the G-CSF growth factor involved in repair and stem cell biology. In contrast, GM-CSF levels showed a mild decrease, showing a highly selective growth factor response. The inactivated B. coagulans GBI-30, 6086 cells activated human immune cells and altered the production of both immune activating and anti-inflammatory cytokines and chemokines. Of special importance is the novel demonstration of a selective upregulation of the G-CSF growth factor involved in postinjury and postinflammation repair and regeneration. This suggests that important immunogenic cell wall components, such as lipoteichoic acid, are undamaged after the inactivation and retain the complex beneficial biological activities previously demonstrated for the cell walls from live B. coagulans GBI-30, 6086

  14. Fluorine-19 Labeling of Stromal Vascular Fraction Cells for Clinical Imaging Applications

    PubMed Central

    Rose, Laura C.; Kadayakkara, Deepak K.; Wang, Guan; Bar-Shir, Amnon; Helfer, Brooke M.; O’Hanlon, Charles F.; Kraitchman, Dara L.; Rodriguez, Ricardo L.

    2015-01-01

    Stromal vascular fraction (SVF) cells are used clinically for various therapeutic targets. The location and persistence of engrafted SVF cells are important parameters for determining treatment failure versus success. We used the GID SVF-1 platform and a clinical protocol to harvest and label SVF cells with the fluorinated (19F) agent CS-1000 as part of a first-in-human phase I trial (clinicaltrials.gov identifier NCT02035085) to track SVF cells with magnetic resonance imaging during treatment of radiation-induced fibrosis in breast cancer patients. Flow cytometry revealed that SVF cells consisted of 25.0% ± 15.8% CD45+, 24.6% ± 12.5% CD34+, and 7.5% ± 3.3% CD31+ cells, with 2.1 ± 0.7 × 105 cells per cubic centimeter of adipose tissue obtained. Fluorescent CS-1000 (CS-ATM DM Green) labeled 87.0% ± 13.5% of CD34+ progenitor cells compared with 47.8% ± 18.5% of hematopoietic CD45+ cells, with an average of 2.8 ± 2.0 × 1012 19F atoms per cell, determined using nuclear magnetic resonance spectroscopy. The vast majority (92.7% ± 5.0%) of CD31+ cells were also labeled, although most coexpressed CD34. Only 16% ± 22.3% of CD45−/CD31−/CD34− (triple-negative) cells were labeled with CS-ATM DM Green. After induction of cell death by either apoptosis or necrosis, >95% of 19F was released from the cells, indicating that fluorine retention can be used as a surrogate marker for cell survival. Labeled-SVF cells engrafted in a silicone breast phantom could be visualized with a clinical 3-Tesla magnetic resonance imaging scanner at a sensitivity of approximately 2 × 106 cells at a depth of 5 mm. The current protocol can be used to image transplanted SVF cells at clinically relevant cell concentrations in patients. Significance Stromal vascular fraction (SVF) cells harvested from adipose tissue offer great promise in regenerative medicine, but methods to track such cell therapies are needed to ensure correct administration and monitor survival. A clinical protocol

  15. Distinctive effects of CD34- and CD133-specific antibody-coated stents on re-endothelialization and in-stent restenosis at the early phase of vascular injury

    PubMed Central

    Wu, Xue; Yin, Tieying; Tian, Jie; Tang, Chaojun; Huang, Junli; Zhao, Yinping; Zhang, Xiaojuan; Deng, Xiaoyan; Fan, Yubo; Yu, Donghong; Wang, Guixue

    2015-01-01

    It is not clear what effects of CD34- and CD133-specific antibody-coated stents have on re-endothelialization and in-stent restenosis (ISR) at the early phase of vascular injury. This study aims at determining the capabilities of different coatings on stents (e.g. gelatin, anti-CD133 and anti-CD34 antibodies) to promote adhesion and proliferation of endothelial progenitor cells (EPCs). The in vitro study revealed that the adhesion force enabled the EPCs coated on glass slides to withstand flow-induced shear stress, so that allowing for the growth of the cells on the slides for 48 h. The in vivo experiment using a rabbit model in which the coated stents with different substrates were implanted showed that anti-CD34 and anti-CD133 antibody-coated stents markedly reduced the intima area and restenosis than bare mental stents (BMS) and gelatin-coated stents. Compared with the anti-CD34 antibody-coated stents, the time of cells adhesion was longer and earlier present in the anti-CD133 antibody-coated stents and anti-CD133 antibody-coated stents have superiority in re-endothelialization and inhibition of ISR. In conclusion, this study demonstrated that anti-CD133 antibody as a stent coating for capturing EPCs is better than anti-CD34 antibody in promoting endothelialization and reducing ISR. PMID:26813006

  16. Formation of Yttrium Oxysulfide Phosphor at Room Temperature

    NASA Astrophysics Data System (ADS)

    Shoji, Masahiko; Sakurai, Kenji

    2005-12-01

    Europium-doped yttrium oxysulfide (Y2O2S:Eu) phosphor was successfully synthesized at room temperature from yttrium oxide, europium oxide, and sulfur. The method employs high-energy ball milling to enable a substitution reaction between oxygen and sulfur, unlike conventional methods, such as heating in a sulfurizing atmosphere. It was found that the material is fluorescent through X-ray irradiation, and the luminescence spectra exhibit four peaks in the wavelength region from 500 to 800 nm.

  17. Dental hard tissue ablation using mid-infrared tunable nanosecond pulsed Cr:CdSe laser.

    PubMed

    Lin, Taichen; Aoki, Akira; Saito, Norihito; Yumoto, Masaki; Nakajima, Sadahiro; Nagasaka, Keigo; Ichinose, Shizuko; Mizutani, Koji; Wada, Satoshi; Izumi, Yuichi

    2016-12-01

    Mid-infrared erbium: yttrium-aluminum-garnet (Er:YAG) and erbium, chromium: yttrium-scandium-gallium-garnet (Er,Cr:YSGG) lasers (2.94- and 2.78-μm, respectively) are utilized for effective dental hard tissue treatment because of their high absorption in water, hydroxide ion, or both. Recently, a mid-infrared tunable, nanosecond pulsed, all-solid-state chromium-doped: cadmium-selenide (Cr:CdSe) laser system was developed, which enables laser oscillation in the broad spectral range around 2.9 μm. The purpose of this study was to evaluate the ablation of dental hard tissue by the nanosecond pulsed Cr:CdSe laser at a wavelength range of 2.76-3.00 μm. Enamel, dentin, and cementum tissue were irradiated at a spot or line at a fluence of 0-11.20 J/cm 2 /pulse (energy output: 0-2.00 mJ/pulse) with a repetition rate of 10 Hz and beam diameter of ∼150 μm on the target (pulse width ∼250 ns). After irradiation, morphological changes, ablation threshold, depth, and efficiency, and thickness of the structurally and thermally affected layer of irradiated surfaces were analyzed using stereomicroscopy, scanning electron microscopy (SEM), and light microscopy of non-decalcified histological sections. The nanosecond pulsed irradiation without water spray effectively ablated dental hard tissue with no visible thermal damage such as carbonization. The SEM analysis revealed characteristic micro-irregularities without major melting and cracks in the lased tissue. The ablation threshold of dentin was the lowest at 2.76 μm and the highest at 3.00 μm. The histological analysis revealed minimal thermal and structural changes ∼20 μm wide on the irradiated dentin surfaces with no significant differences between wavelengths. The efficiency of dentin ablation gradually increased from 3.00 to 2.76 μm, at which point the highest ablation efficiency was observed. The nanosecond pulsed Cr:CdSe laser demonstrated an effective ablation ability of hard dental tissues

  18. Cooperativity of CD44 and CD49d in leukemia cell homing, migration, and survival offers a means for therapeutic attack.

    PubMed

    Singh, Vibuthi; Erb, Ulrike; Zöller, Margot

    2013-11-15

    A CD44 blockade drives leukemic cells into differentiation and apoptosis by dislodging from the osteogenic niche. Because anti-CD49d also supports hematopoietic stem cell mobilization, we sought to determine the therapeutic efficacy of a joint CD49d/CD44 blockade. To unravel the underlying mechanism, the CD49d(-) EL4 lymphoma was transfected with CD49d or point-mutated CD49d, prohibiting phosphorylation and FAK binding; additionally, a CD44(-) Jurkat subline was transfected with murine CD44, CD44 with a point mutation in the ezrin binding site, or with cytoplasmic tail-truncated CD44. Parental and transfected EL4 and Jurkat cells were evaluated for adhesion, migration, and apoptosis susceptibility in vitro and in vivo. Ligand-binding and Ab-blocking studies revealed CD44-CD49d cooperation in vitro and in vivo in adhesion, migration, and apoptosis resistance. The cooperation depends on ligand-induced proximity such that both CD44 and CD49d get access to src, FAK, and paxillin and via lck to the MAPK pathway, with the latter also supporting antiapoptotic molecule liberation. Accordingly, synergisms were only seen in leukemia cells expressing wild-type CD44 and CD49d. Anti-CD44 together with anti-CD49d efficiently dislodged EL4-CD49d/Jurkat-CD44 in bone marrow and spleen. Dislodging was accompanied by increased apoptosis susceptibility that strengthened low-dose chemotherapy, the combined treatment most strongly interfering with metastatic settlement and being partly curative. Ab treatment also promoted NK and Ab-dependent cellular cytotoxicity activation, which affected leukemia cells independent of CD44/CD49d tail mutations. Thus, mostly owing to a blockade of joint signaling, anti-CD44 and anti-CD49d hamper leukemic cell settlement and break apoptosis resistance, which strongly supports low-dose chemotherapy.

  19. Preclinical development of a bispecific antibody that safely and effectively targets CD19 and CD47 for the treatment of B cell lymphoma and leukemia.

    PubMed

    Buatois, Vanessa; Johnson, Zoë; Salgado-Pires, Susana; Papaïoannou, Anne; Hatterer, Eric; Chauchet, Xavier; Richard, Françoise; Barba, Leticia; Daubeuf, Bruno; Cons, Laura; Broyer, Lucile; D'Asaro, Matilde; Matthes, Thomas; LeGallou, Simon; Fest, Thierry; Tarte, Karin; Clarke Hinojosa, Robert K; Genescà Ferrer, Eulàlia; Ribera, José María; Dey, Aditi; Bailey, Katharine; Fielding, Adele K; Eissenberg, Linda; Ritchey, Julie; Rettig, Michael; DiPersio, John F; Kosco-Vilbois, Marie H; Masternak, Krzysztof; Fischer, Nicolas; Shang, Limin; Ferlin, Walter G

    2018-05-09

    CD47, a ubiquitously expressed innate immune checkpoint receptor that serves as a universal "don't eat me" signal of phagocytosis, is often up-regulated by hematological and solid cancers to evade immune surveillance. Development of CD47-targeted modalities is hindered by the ubiquitous expression of the target, often leading to rapid drug elimination and hemotoxicity including anemia. To overcome such liabilities, we have developed a fully human bispecific antibody, NI-1701, designed to co-engage CD47 and CD19 selectively on B cells. NI-1701 demonstrates favorable elimination kinetics with no deleterious effects seen on hematological parameters following single or multiple administrations to non-human primates. Potent in vitro and in vivo activity is induced by NI-1701 to kill cancer cells across a plethora of B cell malignancies and control tumor growth in xenograft mouse models. The mechanism affording maximal tumor growth inhibition by NI-1701 is dependent on the co-engagement of CD47/CD19 on B cells inducing potent antibody dependent cellular phagocytosis of the targeted cells. NI-1701-induced control of tumor growth in immunodeficient NOD/SCID mice was more effective than that achieved with the anti-CD20 targeted antibody, rituximab. Interestingly, a synergistic effect was seen when tumor-implanted mice were co-administered NI-1701 and rituximab leading to significantly improved tumor growth inhibition and regression in some animals. We describe herein, a novel bispecific antibody approach aimed at sensitizing B cells to become more readily phagocytosed and eliminated thus offering an alternative or adjunct therapeutic option to patients with B cell malignancies refractory/resistant to anti-CD20 targeted therapy. Copyright ©2018, American Association for Cancer Research.

  20. Structural considerations for functional anti-EGFR × anti-CD3 bispecific diabodies in light of domain order and binding affinity.

    PubMed

    Asano, Ryutaro; Nagai, Keisuke; Makabe, Koki; Takahashi, Kento; Kumagai, Takashi; Kawaguchi, Hiroko; Ogata, Hiromi; Arai, Kyoko; Umetsu, Mitsuo; Kumagai, Izumi

    2018-03-02

    We previously reported a functional humanized bispecific diabody (bsDb) that targeted EGFR and CD3 (hEx3-Db) and enhancement of its cytotoxicity by rearranging the domain order in the V domain. Here, we further dissected the effect of domain order in bsDbs on their cross-linking ability and binding kinetics to elucidate general rules regarding the design of functional bsDbs. Using Ex3-Db as a model system, we first classified the four possible domain orders as anti-parallel (where both chimeric single-chain components are variable heavy domain (VH)-variable light domain (VL) or VL-VH order) and parallel types (both chimeric single-chain components are mixed with VH-VL and VL-VH order). Although anti-parallel Ex3-Dbs could cross-link the soluble target antigens, their cross-linking ability between soluble targets had no correlation with their growth inhibitory effects. In contrast, the binding affinity of one of the two constructs with a parallel-arrangement V domain was particularly low, and structural modeling supported this phenomenon. Similar results were observed with E2x3-Dbs, in which the V region of the anti-EGFR antibody clone in hEx3 was replaced with that of another anti-EGFR clone. Only anti-parallel types showed affinity-dependent cancer inhibitory effects in each molecule, and E2x3-LH (both components in VL-VH order) showed the most intense anti-tumor activity in vitro and in vivo . Our results showed that, in addition to rearranging the domain order of bsDbs, increasing their binding affinity may be an ideal strategy for enhancing the cytotoxicity of anti-parallel constructs and that E2x3-LH is particularly attractive as a candidate next-generation anti-cancer drug.