Sample records for yutb mutant encoding

  1. LEE-encoded regulator (Ler) mutants elicit serotype-specific protection, but not cross protection, against attaching and effacing E. coli strains.

    PubMed

    Zhu, C; Feng, S; Yang, Z; Davis, K; Rios, H; Kaper, J B; Boedeker, E C

    2007-02-26

    We previously showed that single dose orogastric immunization with an attenuated regulatory Lee-encoded regulator (ler) mutant of the rabbit enteropathogenic Escherichia coli (REPEC) strain E22 (O103:H2) protected rabbits from fatal infection with the highly virulent parent strain. In the current study we assessed the degree of homologous (serotype-specific) and heterologous (cross-serotype) protection induced by immunization with REPEC ler mutant strains of differing serotypes, or with a prototype strain RDEC-1 (O15:H-) which expresses a full array of ler up-regulated proteins. We constructed an additional ler mutant using RDEC-1 thus, permitting immunization with a ler mutant of either serotype, O15 or O103, followed by challenge with a virulent REPEC strain of the same or different serotypes. Consistent with our previous data, the current study demonstrated that rabbits immunized with a RDEC-1 ler mutant were protected from challenge with virulent RDEC-H19A (RDEC-1 transduced with Shiga toxin-producing phage H19A) of the same serotype. Rabbits immunized with RDEC-1 or E22 derivative ler mutants demonstrated significant increase in serum antibody titers to the respective whole bacterial cells expressing O antigen but not to the LEE-encoded proteins. However, immunization with the ler mutants of either E22 or RDEC-1 failed to protect rabbits from infections with virulent organisms belonging to different serotypes. In contrast, rabbits immunized with the prototype RDEC-1 were cross protected against challenge with the heterologous E22 strain as shown by normal weight gain, and the absence of clinical signs of disease or characteristic attaching and effacing (A/E) lesions. Immunization with RDEC-1 induced significantly elevated serum IgG titers to LEE-encoded proteins. We thus, demonstrated homologous protection induced by the REPEC ler mutants and heterologous protection by RDEC-1. The observed correlation between elevated immune responses to the LEE-encoded proteins and the protection against challenge with heterologous virulent REPEC strain suggests that serotype-non-specific cross protection requires the expression of, and induction of antibody to, LEE-encoded virulence factors.

  2. The Streptococcus mutans Serine/Threonine Kinase, PknB, Regulates Competence Development, Bacteriocin Production, and Cell Wall Metabolism ▿

    PubMed Central

    Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R.

    2010-01-01

    Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB. PMID:20231406

  3. The Streptococcus mutans serine/threonine kinase, PknB, regulates competence development, bacteriocin production, and cell wall metabolism.

    PubMed

    Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R

    2010-05-01

    Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB.

  4. Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

    DOEpatents

    Oda, Michael N [Benicia, CA; Forte, Trudy M [Berkeley, CA

    2007-05-29

    Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

  5. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    PubMed

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  6. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes

    PubMed Central

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-01-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404

  7. Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

    PubMed

    Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

    2010-05-01

    Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

  8. Identification and Characterization of Non-Cellulose-Producing Mutants of Gluconacetobacter hansenii Generated by Tn5 Transposon Mutagenesis

    PubMed Central

    Deng, Ying; Nagachar, Nivedita; Xiao, Chaowen; Tien, Ming

    2013-01-01

    The acs operon of Gluconacetobacter is thought to encode AcsA, AcsB, AcsC, and AcsD proteins that constitute the cellulose synthase complex, required for the synthesis and secretion of crystalline cellulose microfibrils. A few other genes have been shown to be involved in this process, but their precise role is unclear. We report here the use of Tn5 transposon insertion mutagenesis to identify and characterize six non-cellulose-producing (Cel−) mutants of Gluconacetobacter hansenii ATCC 23769. The genes disrupted were acsA, acsC, ccpAx (encoding cellulose-complementing protein [the subscript “Ax” indicates genes from organisms formerly classified as Acetobacter xylinum]), dgc1 (encoding guanylate dicyclase), and crp-fnr (encoding a cyclic AMP receptor protein/fumarate nitrate reductase transcriptional regulator). Protein blot analysis revealed that (i) AcsB and AcsC were absent in the acsA mutant, (ii) the levels of AcsB and AcsC were significantly reduced in the ccpAx mutant, and (iii) the level of AcsD was not affected in any of the Cel− mutants. Promoter analysis showed that the acs operon does not include acsD, unlike the organization of the acs operon of several strains of closely related Gluconacetobacter xylinus. Complementation experiments confirmed that the gene disrupted in each Cel− mutant was responsible for the phenotype. Quantitative real-time PCR and protein blotting results suggest that the transcription of bglAx (encoding β-glucosidase and located immediately downstream from acsD) was strongly dependent on Crp/Fnr. A bglAx knockout mutant, generated via homologous recombination, produced only ∼16% of the wild-type cellulose level. Since the crp-fnr mutant did not produce any cellulose, Crp/Fnr may regulate the expression of other gene(s) involved in cellulose biosynthesis. PMID:24013627

  9. Creation, characterization and utilization of Cryptococcus neoformans mutants sensitive to micafungin.

    PubMed

    Toh-E, Akio; Ohkusu, Misako; Shimizu, Kiminori; Yamaguchi, Masashi; Ishiwada, Naruhiko; Watanabe, Akira; Kamei, Katsuhiko

    2017-12-01

    We constructed deletion mutants of Cryptococcus neoformans var neoformans (serotype D) genes encoding late ergosterol biosynthetic pathway enzymes and found that the mutations enhanced susceptibility to various drugs including micafungin, one of the echinocandins, to which wild-type Cryptococcus strains show no susceptibility. Furthermore, through isolation of a mutant resistant to micafungin from a micafungin-sensitive erg mutant and genetic analysis of it, we found that the responsible mutation occurred in the hotspot 2 of FKS1 encoding β-1, 3-glucan synthase, indicating that micafungin inhibited the growth of the erg mutant via inhibiting Fks1 activity. Addition of ergosterol to the culture of the erg mutants recovered the resistance to micafungin, suggesting that the presence of ergosterol in membrane inhibits the accession of micafungin to its target. We found that a loss of one of genes encoding subunits of v-ATPase, VPH1, made Cryptococcus cells sensitive to micafungin. Our observation that the erg2 vph1 double mutant was more sensitive to micafungin than either single mutant suggests that these two genes act differently in becoming resistant to micafungin. The erg mutants allowed us to study the physiological significance of β-1, 3-glucan synthesis in C. neoformans; the inhibition of β-1, 3-glucan synthesis induced cell death and changes in cellular morphology. By observing the erg mutant cells recovering from the growth inhibition imposed by micafungin, we recognized β-1, 3-glucan synthesis would suppress filamentous growth in C. neoformans.

  10. Evaluation of hha and hha sepB mutant strains of Escherichia coli O157:H7 as bacterins for reducing E. coli O157:H7 shedding in cattle.

    PubMed

    Sharma, Vijay K; Dean-Nystrom, Evelyn A; Casey, Thomas A

    2011-07-12

    Escherichia coli O157:H7 colonizes cattle intestines by using the locus of enterocyte effacement (LEE)-encoded proteins. The induction of systemic immune response against LEE-encoded proteins, therefore, will prove effective in reducing E. coli O157:H7 colonization in cattle. The previous studies have demonstrated that a hha (encodes for a hemolysin expression modulating protein) deletion enhances expression of LEE-encoded proteins and a sepB (encodes an ATPase required for the secretion of LEE-encoded proteins) deletion results in intracellular accumulation of LEE proteins. In this study, we demonstrate the efficacy of the hha and hha sepB deletion mutants as bacterins for reducing fecal shedding of E. coli O157:H7 in experimentally inoculated weaned calves. The weaned calves were injected intramuscularly with the bacterins containing 10(9) heat-killed cells of the hha(+) wild-type or hha or hha sepB isogenic mutants, and boosted with the same doses 2- and 4-weeks later. The evaluation of the immune response two weeks after the last booster immunization revealed that the calves vaccinated with the hha mutant bacterin had higher antibody titers against LEE proteins compared to the titers for these antibodies in the calves vaccinated with the hha sepB mutant or hha(+) wild-type bacterins. Following oral inoculations with 10(10) CFU of the wild-type E. coli O157:H7, the greater numbers of calves in the group vaccinated with the hha or hha sepB mutant bacterins stopped shedding the inoculum strain within a few days after the inoculations compared to the group of calves vaccinated with the hha(+) wild-type bacterin or PBS sham vaccine. Thus, the use of bacterins prepared from the hha and hha sepB mutants for reducing colonization of E. coli O157:H7 in cattle could represent a potentially important pre-harvest strategy to enhance post-harvest safety of bovine food products, water and produce. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction

    PubMed Central

    Mochizuki, Nobuyoshi; Brusslan, Judy A.; Larkin, Robert; Nagatani, Akira; Chory, Joanne

    2001-01-01

    A plastid-derived signal plays an important role in the coordinated expression of both nuclear- and chloroplast-localized genes that encode photosynthesis-related proteins. Arabidopsis GUN (genomes uncoupled) loci have been identified as components of plastid-to-nucleus signal transduction. Unlike wild-type plants, gun mutants have nuclear Lhcb1 expression in the absence of chloroplast development. We observed a synergistic phenotype in some gun double-mutant combinations, suggesting there are at least two independent pathways in plastid-to-nucleus signal transduction. There is a reduction of chlorophyll accumulation in gun4 and gun5 mutant plants, and a gun4gun5 double mutant shows an albino phenotype. We cloned the GUN5 gene, which encodes the ChlH subunit of Mg-chelatase. We also show that gun2 and gun3 are alleles of the known photomorphogenic mutants, hy1 and hy2, which are required for phytochromobilin synthesis from heme. These findings suggest that certain perturbations of the tetrapyrrole biosynthetic pathway generate a signal from chloroplasts that causes transcriptional repression of nuclear genes encoding plastid-localized proteins. The comparison of mutant phenotypes of gun5 and another Mg-chelatase subunit (ChlI) mutant suggests a specific function for ChlH protein in the plastid-signaling pathway. PMID:11172074

  12. Transcript Profiling Reveals New Insights into the Acclimation of the Mesophilic Fresh-Water Cyanobacterium Synechococcus elongatus PCC 7942 to Iron Starvation1[W

    PubMed Central

    Nodop, Anke; Pietsch, Daniel; Höcker, Ralf; Becker, Anke; Pistorius, Elfriede K.; Forchhammer, Karl; Michel, Klaus-Peter

    2008-01-01

    The regulatory network for acclimation of the obligate photoautotrophic fresh water cyanobacterium Synechococcus elongatus PCC 7942 to iron (Fe) limitation was studied by transcript profiling with an oligonucleotide whole genome DNA microarray. Six regions on the chromosome with several Fe-regulated genes each were identified. The irpAB and fut region encode putative Fe uptake systems, the suf region participates in [Fe-sulfur] cluster assembly under oxidative stress and Fe limitation, the isiAB region encodes CP43′ and flavodoxin, the idiCB region encodes the NuoE-like electron transport associated protein IdiC and the transcriptional activator IdiB, and the ackA/pgam region encodes an acetate kinase and a phosphoglycerate mutase. We also investigated the response of two S. elongatus PCC 7942 mutants to Fe starvation. These were mutant K10, lacking IdiB but containing IdiC, and mutant MuD, representing a idiC-merodiploid mutant with a strongly reduced amount of IdiC as well as IdiB. The absence of IdiB in mutant K10 or the strongly reduced amount of IdiB in mutant MuD allowed for the identification of additional members of the Fe-responsive IdiB regulon. Besides idiA and the irpAB operon somB(1), somA(2), ftr1, ackA, pgam, and nat also seem to be regulated by IdiB. In addition to the reduced amount of IdiB in MuD, the low concentration of IdiC may be responsible for a number of additional changes in the abundance of mainly photosynthesis-related transcripts as compared to the wild type and mutant K10. This fact may explain why it has been impossible to obtain a fully segregated IdiC-free mutant, whereas it was possible to obtain a fully segregated IdiB-free mutant. PMID:18424627

  13. Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

    PubMed

    Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

    2007-05-01

    The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

  14. Characterization of a wheat mutant missing low-molecular-weight glutenin subunits encoded by the B-genome

    USDA-ARS?s Scientific Manuscript database

    DH20, a new wheat mutant missing low-molecular weight glutenin subunits encoded by the Glu-B3 locus, was discovered among double haploid lines obtained from a cross between the Korean wheat cultivars Keumkang and Olgeuru. Absence of the Glu-B3 LMW-GS proteins was determined by one-dimensional gel e...

  15. Bearded-Ear Encodes a MADS-box Transcription Factor Critical for Maize Floral Development

    USDA-ARS?s Scientific Manuscript database

    We cloned bde by positional cloning and found that it encodes zag3, a MADS-box transcription factor in the conserved AGL6 clade. Mutants in the maize homolog of AGAMOUS, zag1, have a subset of bde floral defects. bde; zag1 double mutants have a severe ear phenotype, not observed in either single m...

  16. Structure of adenovirus bound to cellular receptor car

    DOEpatents

    Freimuth, Paul I.

    2004-05-18

    Disclosed is a mutant adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have significantly weakened binding affinity for CARD1 relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type. In the method, residues of the adenovirus fiber protein knob domain which are predicted to alter D1 binding when mutated, are identified from the crystal structure coordinates of the AD12knob:CAR-D1 complex. A mutation which alters one or more of the identified residues is introduced into the genome of the adenovirus to generate a mutant adenovirus. Whether or not the mutant produced exhibits altered adenovirus-CAR binding properties is then determined.

  17. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    PubMed

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  18. Functional Angucycline-Like Antibiotic Gene Cluster in the Terminal Inverted Repeats of the Streptomyces ambofaciens Linear Chromosome

    PubMed Central

    Pang, Xiuhua; Aigle, Bertrand; Girardet, Jean-Michel; Mangenot, Sophie; Pernodet, Jean-Luc; Decaris, Bernard; Leblond, Pierre

    2004-01-01

    Streptomyces ambofaciens has an 8-Mb linear chromosome ending in 200-kb terminal inverted repeats. Analysis of the F6 cosmid overlapping the terminal inverted repeats revealed a locus similar to type II polyketide synthase (PKS) gene clusters. Sequence analysis identified 26 open reading frames, including genes encoding the β-ketoacyl synthase (KS), chain length factor (CLF), and acyl carrier protein (ACP) that make up the minimal PKS. These KS, CLF, and ACP subunits are highly homologous to minimal PKS subunits involved in the biosynthesis of angucycline antibiotics. The genes encoding the KS and ACP subunits are transcribed constitutively but show a remarkable increase in expression after entering transition phase. Five genes, including those encoding the minimal PKS, were replaced by resistance markers to generate single and double mutants (replacement in one and both terminal inverted repeats). Double mutants were unable to produce either diffusible orange pigment or antibacterial activity against Bacillus subtilis. Single mutants showed an intermediate phenotype, suggesting that each copy of the cluster was functional. Transformation of double mutants with a conjugative and integrative form of F6 partially restored both phenotypes. The pigmented and antibacterial compounds were shown to be two distinct molecules produced from the same biosynthetic pathway. High-pressure liquid chromatography analysis of culture extracts from wild-type and double mutants revealed a peak with an associated bioactivity that was absent from the mutants. Two additional genes encoding KS and CLF were present in the cluster. However, disruption of the second KS gene had no effect on either pigment or antibiotic production. PMID:14742212

  19. Two Closely Related Genes of Arabidopsis Encode Plastidial Cytidinediphosphate Diacylglycerol Synthases Essential for Photoautotrophic Growth1[C

    PubMed Central

    Haselier, André; Akbari, Hana; Weth, Agnes; Baumgartner, Werner; Frentzen, Margrit

    2010-01-01

    Cytidinediphosphate diacylglycerol synthase (CDS) catalyzes the formation of cytidinediphosphate diacylglycerol, an essential precursor of anionic phosphoglycerolipids like phosphatidylglycerol or -inositol. In plant cells, CDS isozymes are located in plastids, mitochondria, and microsomes. Here, we show that these isozymes are encoded by five genes in Arabidopsis (Arabidopsis thaliana). Alternative translation initiation or alternative splicing of CDS2 and CDS4 transcripts can result in up to 10 isoforms. Most of the cDNAs encoding the various plant isoforms were functionally expressed in yeast and rescued the nonviable phenotype of the mutant strain lacking CDS activity. The closely related genes CDS4 and CDS5 were found to encode plastidial isozymes with similar catalytic properties. Inactivation of both genes was required to obtain Arabidopsis mutant lines with a visible phenotype, suggesting that the genes have redundant functions. Analysis of these Arabidopsis mutants provided further independent evidence for the importance of plastidial phosphatidylglycerol for structure and function of thylakoid membranes and, hence, for photoautotrophic growth. PMID:20442275

  20. Trehalose synthesis in Aspergillus niger: characterization of six homologous genes, all with conserved orthologs in related species

    PubMed Central

    2014-01-01

    Background The disaccharide trehalose is a major component of fungal spores and is released upon germination. Moreover, the sugar is well known for is protective functions, e.g. against thermal stress and dehydration. The properties and synthesis of trehalose have been well investigated in the bakers’ yeast Saccharomyces cerevisiae. In filamentous fungi, such knowledge is limited, although several gene products have been identified. Results Using Aspergillus niger as a model fungus, the aim of this study was to provide an overview of all genes involved in trehalose synthesis. This fungus has three potential trehalose-6-phosphate synthase encoding genes, tpsA-C, and three putative trehalose phosphate phosphatase encoding genes, tppA-C, of which two have not previously been identified. Expression of all six genes was confirmed using real-time PCR, and conserved orthologs could be identified in related Aspergilli. Using a two-hybrid approach, there is a strong indication that four of the proteins physically interact, as has previously been shown in S. cerevisiae. When creating null mutants of all the six genes, three of them, ΔtpsA, ΔtppA and ΔtppB, had lower internal trehalose contents. The only mutant with a pronounced morphological difference was ΔtppA, in which sporulation was severely reduced with abnormal conidiophores. This was also the only mutant with accumulated levels of trehalose-6-phosphate, indicating that the encoded protein is the main phosphatase under normal conditions. Besides ΔtppA, the most studied deletion mutant in this work was ΔtppB. This gene encodes a protein conserved in filamentous Ascomycota. The ΔtppB mutant displayed a low, but not depleted, internal trehalose content, and conidia were more susceptible to thermal stress. Conclusion A. niger contains at least 6 genes putatively involved in trehalose synthesis. Gene expressions related to germination have been quantified and deletion mutants characterized: Mutants lacking tpsA, tppA or tppB have reduced internal trehalose contents. Furthermore, tppA, under normal conditions, encodes the functional trehalose-6-phosphate-phosphatase. PMID:24725382

  1. Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

    PubMed Central

    Cole, C N; Tornow, J; Clark, R; Tjian, R

    1986-01-01

    The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional domains. Images PMID:3003386

  2. Altered gene regulation and synaptic morphology in Drosophila learning and memory mutants

    PubMed Central

    Guan, Zhuo; Buhl, Lauren K.; Quinn, William G.; Littleton, J. Troy

    2011-01-01

    Genetic studies in Drosophila have revealed two separable long-term memory pathways defined as anesthesia-resistant memory (ARM) and long-lasting long-term memory (LLTM). ARM is disrupted in radish (rsh) mutants, whereas LLTM requires CREB-dependent protein synthesis. Although the downstream effectors of ARM and LLTM are distinct, pathways leading to these forms of memory may share the cAMP cascade critical for associative learning. Dunce, which encodes a cAMP-specific phosphodiesterase, and rutabaga, which encodes an adenylyl cyclase, both disrupt short-term memory. Amnesiac encodes a pituitary adenylyl cyclase-activating peptide homolog and is required for middle-term memory. Here, we demonstrate that the Radish protein localizes to the cytoplasm and nucleus and is a PKA phosphorylation target in vitro. To characterize how these plasticity pathways may manifest at the synaptic level, we assayed synaptic connectivity and performed an expression analysis to detect altered transcriptional networks in rutabaga, dunce, amnesiac, and radish mutants. All four mutants disrupt specific aspects of synaptic connectivity at larval neuromuscular junctions (NMJs). Genome-wide DNA microarray analysis revealed ∼375 transcripts that are altered in these mutants, suggesting defects in multiple neuronal signaling pathways. In particular, the transcriptional target Lapsyn, which encodes a leucine-rich repeat cell adhesion protein, localizes to synapses and regulates synaptic growth. This analysis provides insights into the Radish-dependent ARM pathway and novel transcriptional targets that may contribute to memory processing in Drosophila. PMID:21422168

  3. Structure of adenovirus bound to cellular receptor car

    DOEpatents

    Freimuth, Paul I.

    2007-01-02

    Disclosed is a mutant CAR-DI-binding adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have a significantly weakened binding affinity for CAR-DI relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type.

  4. Transcriptome analysis of the epidermis of the purple quail-like (q-lp) mutant of silkworm, Bombyx mori.

    PubMed

    Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling

    2017-01-01

    A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.

  5. WHITE STRIPE LEAF4 Encodes a Novel P-Type PPR Protein Required for Chloroplast Biogenesis during Early Leaf Development

    PubMed Central

    Wang, Ying; Ren, Yulong; Zhou, Kunneng; Liu, Linglong; Wang, Jiulin; Xu, Yang; Zhang, Huan; Zhang, Long; Feng, Zhiming; Wang, Liwei; Ma, Weiwei; Wang, Yunlong; Guo, Xiuping; Zhang, Xin; Lei, Cailin; Cheng, Zhijun; Wan, Jianmin

    2017-01-01

    Pentatricopeptide repeat (PPR) proteins comprise a large family in higher plants and perform diverse functions in organellar RNA metabolism. Despite the rice genome encodes 477 PRR proteins, the regulatory effects of PRR proteins on chloroplast development remains unknown. In this study, we report the functional characterization of the rice white stripe leaf4 (wsl4) mutant. The wsl4 mutant develops white-striped leaves during early leaf development, characterized by decreased chlorophyll content and malformed chloroplasts. Positional cloning of the WSL4 gene, together with complementation and RNA-interference tests, reveal that it encodes a novel P-family PPR protein with 12 PPR motifs, and is localized to chloroplast nucleoids. Quantitative RT-PCR analyses demonstrate that WSL4 is a low temperature response gene abundantly expressed in young leaves. Further expression analyses show that many nuclear- and plastid-encoded genes in the wsl4 mutant are significantly affected at the RNA and protein levels. Notably, the wsl4 mutant causes defects in the splicing of atpF, ndhA, rpl2, and rps12. Our findings identify WSL4 as a novel P-family PPR protein essential for chloroplast RNA group II intron splicing during early leaf development in rice. PMID:28694820

  6. The MET13 Methylenetetrahydrofolate Reductase Gene Is Essential for Infection-Related Morphogenesis in the Rice Blast Fungus Magnaporthe oryzae

    PubMed Central

    Wang, Hong; Wang, Congcong; Li, Ya; Yue, Xiaofeng; Ma, Zhonghua; Talbot, Nicholas J.; Wang, Zhengyi

    2013-01-01

    Methylenetetrahydrofolate reductases (MTHFRs) play a key role in the biosynthesis of methionine in both prokaryotic and eukaryotic organisms. In this study, we report the identification of a novel T-DNA-tagged mutant WH672 in the rice blast fungus Magnaporthe oryzae, which was defective in vegetative growth, conidiation and pathogenicity. Analysis of the mutation confirmed a single T-DNA insertion upstream of MET13, which encodes a 626-amino-acid protein encoding a MTHFR. Targeted gene deletion of MET13 resulted in mutants that were non-pathogenic and significantly impaired in aerial growth and melanin pigmentation. All phenotypes associated with Δmet13 mutants could be overcome by addition of exogenous methionine. The M. oryzae genome contains a second predicted MTHFR-encoding gene, MET12. The deduced amino acid sequences of Met13 and Met12 share 32% identity. Interestingly, Δmet12 mutants produced significantly less conidia compared with the isogenic wild-type strain and grew very poorly in the absence of methionine, but were fully pathogenic. Deletion of both genes resulted in Δmet13Δmet12 mutants that showed similar phenotypes to single Δmet13 mutants. Taken together, we conclude that the MTHFR gene, MET13, is essential for infection-related morphogenesis by the rice blast fungus M. oryzae. PMID:24116181

  7. Analysis and Manipulation of Aspartate Pathway Genes for l-Lysine Overproduction from Methanol by Bacillus methanolicus▿

    PubMed Central

    Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E.; Brautaset, Trygve

    2011-01-01

    We investigated the regulation and roles of six aspartate pathway genes in l-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by l-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the l-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has—in addition to a hom-1 mutation—chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for l-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased l-lysine production levels. PMID:21724876

  8. Analysis and manipulation of aspartate pathway genes for L-lysine overproduction from methanol by Bacillus methanolicus.

    PubMed

    Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E; Brautaset, Trygve

    2011-09-01

    We investigated the regulation and roles of six aspartate pathway genes in L-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by L-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the L-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has-in addition to a hom-1 mutation-chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for L-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased L-lysine production levels.

  9. Plasmid-borne Tn5 insertion mutation resulting in accumulation of gentisate from salicylate.

    PubMed Central

    Monticello, D J; Bakker, D; Schell, M; Finnerty, W R

    1985-01-01

    Plasmid-borne Tn5 insertion mutants of a Pseudomonas species which accumulated 2,5-dihydroxybenzoate (gentisate) following growth on 2-hydroxybenzoate (salicylate) were obtained from a pool of mutants that were unable to grow on naphthalene. One such mutant was characterized further. The ability of this mutant to oxidize gentisate was 100-fold less than the ability of a Nah+ Sal+ strain harboring the unmutagenized plasmid, although both strains oxidized and grew on salicylate. These bacteria were presumably able to metabolize salicylate via catechol, since they possessed an inducible, plasmid-encoded catechol 2,3-dioxygenase. Our results suggest that there is an alternate, plasmid-encoded route of salicylate degradation via gentisate and that some plasmid-associated relationship between this pathway and naphthalene oxidation exists. PMID:2988437

  10. Seven functional classes of Barth syndrome mutation.

    PubMed

    Whited, Kevin; Baile, Matthew G; Currier, Pamela; Claypool, Steven M

    2013-02-01

    Patients with Barth syndrome (BTHS), a rare X-linked disease, suffer from skeletal and cardiomyopathy and bouts of cyclic neutropenia. The causative gene encodes tafazzin, a transacylase, which is the major determinant of the final acyl chain composition of the mitochondrial-specific phospholipid, CL. In addition to numerous frame shift and splice-site mutations, 36 missense mutations have been associated with BTHS. Previously, we established a BTHS-mutant panel in the yeast Saccharomyces cerevisiae that successfully models 18/21 conserved pathogenic missense mutations and defined the loss-of-function mechanism associated with a subset of the mutant tafazzins. Here, we report the biochemical and cell biological characterization of the rest of the yeast BTHS-mutant panel and in so doing identify three additional modes of tafazzin dysfunction. The largest group of mutant tafazzins is catalytically null, two mutants encode hypomorphic alleles, and another two mutants are temperature sensitive. Additionally, we have expanded the defects associated with previously characterized matrix-mislocalized-mutant tafazzins to include the rapid degradation of aggregation-prone polypeptides that correctly localize to the mitochondrial IMS. In sum, our in-depth characterization of the yeast BTHS-mutant panel has identified seven functional classes of BTHS mutation.

  11. The inactivation of RNase G reduces the Stenotrophomonas maltophilia susceptibility to quinolones by triggering the heat shock response.

    PubMed

    Bernardini, Alejandra; Corona, Fernando; Dias, Ricardo; Sánchez, Maria B; Martínez, Jose L

    2015-01-01

    Quinolone resistance is usually due to mutations in the genes encoding bacterial topoisomerases. However, different reports have shown that neither clinical quinolone resistant isolates nor in vitro obtained Stenotrophomonas maltophilia mutants present mutations in such genes. The mechanisms so far described consist on efflux pumps' overexpression. Our objective is to get information on novel mechanisms of S. maltophilia quinolone resistance. For this purpose, a transposon-insertion mutant library was obtained in S. maltophilia D457. One mutant presenting reduced susceptibility to nalidixic acid was selected. Inverse PCR showed that the inactivated gene encodes RNase G. Complementation of the mutant with wild-type RNase G allele restored the susceptibility to quinolones. Transcriptomic and real-time RT-PCR analyses showed that several genes encoding heat-shock response proteins were expressed at higher levels in the RNase defective mutant than in the wild-type strain. In agreement with this situation, heat-shock reduces the S. maltophilia susceptibility to quinolone. We can then conclude that the inactivation of the RNase G reduces the susceptibility of S. maltophilia to quinolones, most likely by regulating the expression of heat-shock response genes. Heat-shock induces a transient phenotype of quinolone resistance in S. maltophilia.

  12. Identification and characterization of a gene product that regulates type 1 piliation in Escherichia coli.

    PubMed Central

    Orndorff, P E; Falkow, S

    1984-01-01

    The recombinant plasmid pSH2 confers type 1 piliation (Pil+) on a nonpiliated (Pil-) strain of Escherichia coli K-12. At least four plasmid-encoded gene products are involved in pilus biosynthesis and expression. We present evidence which indicates that one gene encodes an inhibitor of piliation. Hyperpiliated (Hyp) mutants were isolated after Tn5 insertion mutagenesis of pSH2 and introduction of the plasmid DNA into a Pil- strain of E. coli as unique small, compact colonies. Also, Hyp mutants clumped during growth in static broth and were piliated under several cultural conditions that normally suppressed piliation. Electron microscopic examination of Hyp mutants associated an observed 40-fold increase in pilin antigen with an increase in the number and length of pili per cell. All Hyp mutants examined failed to produce a 23-kilodalton protein that was encoded by a gene adjacent to the structural (pilin) gene for type 1 pili, and all Tn5 insertion mutations that produced the Hyp phenotype mapped in this region (hyp). Piliation in Hyp mutants could be reduced to near parental levels by introducing a second plasmid containing a parental hyp gene. Thus the 23-kilodalton (hyp) protein appears to act in trans to regulate the level of piliation. Images PMID:6148338

  13. The C. elegans ceh-36 gene encodes a putative homemodomain transcription factor involved in chemosensory functions of ASE and AWC neurons.

    PubMed

    Koga, Makoto; Ohshima, Yasumi

    2004-02-20

    Chemotaxis to water-soluble chemicals such as sodium ion is an important behavior of Caenorhabditis elegans for seeking food, and ASE chemosensory neurons have a major role in this behavior. We isolated mutants defective in chemotaxis to sodium acetate. We show here that among them ks86 had a mutation in the ceh-36 gene. ceh-36 :: gfp reporter constructs were expressed in ASE and AWC neurons. In a mutant of the che-1 gene, which encodes another transcription factor and is required for specification of ASE neurons, expression of the ceh-36 :: gfp reporter in ASE is lost. This indicates that the ceh-36 gene functions downstream of the che-1 gene in ASE. In the ceh-36(ks86) mutant, expression of the tax-2 gene encoding a cyclic nucleotide-gated channel was reduced in ASE and AWC. This affords an explanation for defects of the ceh-36 mutant in the chemotaxis mediated by ASE and AWC. When a ceh-36 cDNA was expressed in an adult ceh-36 mutant by a heat shock promoter, chemotaxis to sodium acetate was recovered. These results suggest that ceh-36 is required for functions, and not for development, of ASE.

  14. Impaired Photosynthesis in Phosphatidylglycerol-Deficient Mutant of Cyanobacterium Anabaena sp. PCC7120 with a Disrupted Gene Encoding a Putative Phosphatidylglycerophosphatase1

    PubMed Central

    Wu, Feng; Yang, Zhenle; Kuang, Tingyun

    2006-01-01

    Phosphatidylglycerol (PG) is a ubiquitous phospholipid in thylakoid membranes of cyanobacteria and chloroplasts and plays an important role in the structure and function of photosynthetic membranes. The last step of the PG biosynthesis is dephosphorylation of phosphatidylglycerophosphate (PGP) catalyzed by PGP phosphatase. However, the gene-encoding PGP phosphatase has not been identified and cloned from cyanobacteria or higher plants. In this study, we constructed a PG-deficient mutant from cyanobacterium Anabaena sp. PCC7120 with a disrupted gene (alr1715, a gene for Alr1715 protein, GenBank accession no. BAB78081) encoding a putative PGP phosphatase. The obtained mutant showed an approximately 30% reduction in the cellular content of PG. Following the reduction in the PG content, the photoautotrophical growth of the mutant was restrained, and the cellular content of chlorophyll was decreased. The decreases in net photosynthetic and photosystem II (PSII) activities on a cell basis also occurred in this mutant. Simultaneously, the photochemical efficiency of PSII was considerably declined, and less excitation energy was transferred toward PSII. These findings demonstrate that the alr1715 gene of Anabaena sp. PCC7120 is involved in the biosynthesis of PG and essential for photosynthesis. PMID:16815953

  15. Map-based cloning and characterization of the novel yellow-green leaf gene ys83 in rice (Oryza sativa).

    PubMed

    Ma, Xiaozhi; Sun, Xiaoqiu; Li, Chunmei; Huan, Rui; Sun, Changhui; Wang, Yang; Xiao, Fuliang; Wang, Qian; Chen, Purui; Ma, Furong; Zhang, Kuan; Wang, Pingrong; Deng, Xiaojian

    2017-02-01

    Leaf-color mutants have been extensively studied in rice, and many corresponding genes have been identified up to now. However, leaf-color mutation mechanisms are diverse and still need further research through identification of novel genes. In the present paper, we isolated a leaf-color mutant, ys83, in rice (Oryza sativa). The mutant displayed a yellow-green leaf phenotype at seedling stage, and then slowly turned into light-green leaf from late tillering stage. In its yellow leaves, photosynthetic pigment contents significantly decreased and the chloroplast development was retarded. The mutant phenotype was controlled by a recessive mutation in a nuclear gene on the short arm of rice chromosome 2. Map-based cloning and sequencing analysis suggested that the candidate gene was YS83 (LOC_Os02g05890) encoding a protein containing 165 amino acid residues. Gene YS83 was expressed in a wide range of tissues, and its encoded protein was targeted to the chloroplast. In the mutant, a T-to-A substitution occurred in coding sequence of gene YS83, which caused a premature translation of its encoded product. By introduction of the wild-type gene, the ys83 mutant recovered to normal green-leaf phenotype. Taken together, we successfully identified a novel yellow-green leaf gene YS83. In addition, number of productive panicles per plant and number of spikelets per panicle only reduced by 6.7% and 7.6%, respectively, meanwhile its seed setting rate and 1000-grain weight (seed size) were not significantly affected in the mutant, so leaf-color mutant gene ys83 could be used as a trait marker gene in commercial hybrid rice production. Copyright © 2016. Published by Elsevier Masson SAS.

  16. Transcriptomic and molecular genetic analysis of the cell wall salvage response of Aspergillus niger to the absence of galactofuranose synthesis.

    PubMed

    Park, Joohae; Hulsman, Mark; Arentshorst, Mark; Breeman, Matthijs; Alazi, Ebru; Lagendijk, Ellen L; Rocha, Marina C; Malavazi, Iran; Nitsche, Benjamin M; van den Hondel, Cees A M J J; Meyer, Vera; Ram, Arthur F J

    2016-09-01

    The biosynthesis of cell surface-located galactofuranose (Galf)-containing glycostructures such as galactomannan, N-glycans and O-glycans in filamentous fungi is important to secure the integrity of the cell wall. UgmA encodes an UDP-galactopyranose mutase, which is essential for the formation of Galf. Consequently, the ΔugmA mutant lacks Galf-containing molecules. Our previous work in Aspergillus niger work suggested that loss of function of ugmA results in activation of the cell wall integrity (CWI) pathway which is characterized by increased expression of the agsA gene, encoding an α-glucan synthase. In this study, the transcriptional response of the ΔugmA mutant was further linked to the CWI pathway by showing the induced and constitutive phosphorylation of the CWI-MAP kinase in the ΔugmA mutant. To identify genes involved in cell wall remodelling in response to the absence of galactofuranose biosynthesis, a genome-wide expression analysis was performed using RNAseq. Over 400 genes were higher expressed in the ΔugmA mutant compared to the wild-type. These include genes that encode enzymes involved in chitin (gfaB, gnsA, chsA) and α-glucan synthesis (agsA), and in β-glucan remodelling (bgxA, gelF and dfgC), and also include several glycosylphosphatidylinositol (GPI)-anchored cell wall protein-encoding genes. In silico analysis of the 1-kb promoter regions of the up-regulated genes in the ΔugmA mutant indicated overrepresentation of genes with RlmA, MsnA, PacC and SteA-binding sites. The importance of these transcription factors for survival of the ΔugmA mutant was analysed by constructing the respective double mutants. The ΔugmA/ΔrlmA and ΔugmA/ΔmsnA double mutants showed strong synthetic growth defects, indicating the importance of these transcription factors to maintain cell wall integrity in the absence of Galf biosynthesis. © 2016 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.

  17. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    PubMed

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  18. piRNA-mediated transposon regulation and the germ-line mutation rate in Drosophila melanogaster males.

    PubMed

    Simmons, Michael J; Peterson, Mark P; Thorp, Michael W; Buschette, Jared T; DiPrima, Stephanie N; Harter, Christine L; Skolnick, Matthew J

    2015-03-01

    Transposons, especially retrotransposons, are abundant in the genome of Drosophila melanogaster. These mobile elements are regulated by small RNAs that interact with the Piwi family of proteins-the piwi-interacting or piRNAs. The Piwi proteins are encoded by the genes argonaute3 (ago3), aubergine (aub), and piwi. Heterochromatin Protein 1 (HP1), a chromatin-organizing protein encoded by the Suppressor of variegation 205 [Su(var)205] gene, also plays a role in this regulation. To assess the mutational impact of weakening the system for transposon regulation, we measured the frequency of recessive X-linked lethal mutations occurring in the germ lines of males from stocks that were heterozygous for mutant alleles of the ago3, aub, piwi, or Su(var)205 genes. These mutant alleles are expected to deplete the wild-type proteins encoded by these genes by as much as 50%. The mutant alleles of piwi and Su(var)205 significantly increased the X-linked lethal mutation frequency, whereas the mutant alleles of ago3 did not. An increased mutation frequency was also observed in males from one of two mutant aub stocks, but this increase may not have been due to the aub mutant. The increased mutation frequency caused by depleting Piwi or HP1suggests that chromatin-organizing proteins play important roles in minimizing the germ-line mutation rate, possibly by stabilizing the structure of the heterochromatin in which many transposons are situated. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. The maize brown midrib2 (bm2) gene encodes a methylenetetrahydrofolate reductase that contributes to lignin accumulation

    PubMed Central

    Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

    2014-01-01

    The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468

  20. Investigation of the Role of Genes Encoding Zinc Exporters zntA, zitB, and fieF during Salmonella Typhimurium Infection.

    PubMed

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F; Rensing, Christopher; Olsen, John E; Fresno, Ana H

    2017-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed deletion mutants for genes encoding zinc exporters ( zntA , zitB , and fieF ) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium ( S. Typhimurium) 4/74. The mutants 4/74Δ zntA and 4/74Δ zntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani medium supplemented with 0.25 mM ZnCl 2 or 1.5 mM CuSO 4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected for any of the mutants compared to the WT during infection of amoebae. In natural resistance-associated macrophage protein 1 (Nramp1)-negative J774.1 murine macrophages, significantly higher bacterial counts were observed for the mutant strains 4/74Δ zntA and 4/74Δ zntA/zitB compared to the WT at 4 h post-infection although the fold net replication was similar between all the strains. All four tested mutants (4/74Δ zntA , 4/74Δ zitB , 4/74Δ fieF , and 4/74Δ zntA/zitB ) showed enhanced intracellular survival capacity within the modified Nramp1-positive murine RAW264.7 macrophages at 20 h post-infection. The fold net replication was also significantly higher for 4/74Δ zntA , 4/74Δ zitB , and 4/74Δ zntA/zitB mutants compared to the WT. Intriguingly, the ability to survive and cause infection was significantly impaired in all the three mutants tested (4/74Δ zntA , 4/74Δ zitB , and 4/74Δ zntA/zitB ) in C3H/HeN mice, particularly the double mutant 4/74Δ zntA/zitB was severely attenuated compared to the WT in all the three organs analyzed. These findings suggest that these genes encoding zinc exporters, especially zntA , contribute to the resistance of S. Typhimurium to zinc and copper stresses during infection.

  1. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    PubMed

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

  2. The Lettuce infectious yellows virus (LIYV)-encoded P26 is associated with plasmalemma deposits within LIYV-infected cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Medina, V.; Sudarshana, M.R.; Tian, T.

    2005-03-15

    Cytological, immunological, and mutagenesis approaches were used to identify the viral factors associated with the formation of plasmalemma deposits (PLDs) in whole plants and protoplasts infected by Lettuce infectious yellows virus (LIYV). Transmission electron microscopy and immunogold labeling using polyclonal antibodies to four of the five LIYV RNA 2-encoded large proteins, capsid protein (CP), minor capsid protein (CPm), HSP70 homolog (HSP70h), and P59, showed specific labeling of LIYV virions or virion aggregates around the vesiculated membranous inclusions, but not PLDs in LIYV-infected Nicotiana benthamiana, Nicotiana clevelandii, Lactuca sativa, and Chenopodium murale plants, and Nicotiana tabacum protoplasts. In contrast, antibodies tomore » the RNA 2-encoded P26 showed specific labeling of PLDs but not virions in both LIYV-infected plants and protoplasts. Virion-like particles (VLPs) were seen in protoplasts infected by all LIYV RNA 2 mutants except for the CP (major capsid protein) mutant. PLDs were more difficult to find in protoplasts, but were seen in protoplasts infected by the CP and CPm mutants, but not in protoplasts infected by the P26, HSP70h, or P59 mutants. Interestingly, although the CPm mutant showed VLPs and PLDs, the PLDs did not show associated virions/virion-like particles as was always observed for PLDs seen in protoplasts infected by wild-type LIYV. Immunoblot analyses performed on purified LIYV virions showed that P26 was not detected with purified virions, but was detected in the cell wall, 1000 g and 30,000 g pellet fractions of LIYV-infected plants. These data suggest that P26 is associated with the LIYV-induced PLDs, and in contrast to the other RNA 2-encoded large proteins, P26 is not a virion protein.« less

  3. The Retrovirus pol Gene Encodes a Product Required for DNA Integration: Identification of a Retrovirus int Locus

    NASA Astrophysics Data System (ADS)

    Panganiban, Antonito T.; Temin, Howard M.

    1984-12-01

    We mutagenized cloned spleen necrosis virus DNA to identify a region of the retrovirus genome encoding a polypeptide required for integration of viral DNA. Five plasmids bearing different lesions in the 3' end of the pol gene were examined for the ability to integrate or replicate following transfection of chicken embryo fibroblasts. Transfection with one of these DNAs resulted in the generation of mutant virus incapable of integrating but able to replicate at low levels; this phenotype is identical to that of mutants bearing alterations in the cis-acting region, att. To determine whether the 3' end of the pol gene encodes a protein that interacts with att, we did a complementation experiment. Cells were first infected with an att- virus and then superinfected with the integration-deficient virus containing a lesion in the pol gene and a wild-type att site. The results showed that the att- virus provided a trans-acting function allowing integration of viral DNA derived from the mutant bearing a wild-type att site. Thus, the 3' end of the pol gene serves as an ``int'' locus and encodes a protein mediating integration of retrovirus DNA through interaction with att.

  4. The Moraxella catarrhalis nitric oxide reductase is essential for nitric oxide detoxification.

    PubMed

    Wang, Wei; Kinkel, Traci; Martens-Habbena, Willm; Stahl, David A; Fang, Ferric C; Hansen, Eric J

    2011-06-01

    Moraxella catarrhalis is a Gram-negative obligate aerobe that is an important cause of human respiratory tract infections. The M. catarrhalis genome encodes a predicted truncated denitrification pathway that reduces nitrate to nitrous oxide. We have previously shown that expression of both the M. catarrhalis aniA (encoding a nitrite reductase) and norB (encoding a putative nitric oxide reductase) genes is repressed by the transcriptional regulator NsrR under aerobic conditions and that M. catarrhalis O35E nsrR mutants are unable to grow in the presence of low concentrations of nitrite (W. Wang, et al., J. Bacteriol. 190:7762-7772, 2008). In this study, we constructed an M. catarrhalis norB mutant and showed that planktonic growth of this mutant is inhibited by low levels of nitrite, whether or not an nsrR mutation is present. To determine the importance of NorB in this truncated denitrification pathway, we analyzed the metabolism of nitrogen oxides by norB, aniA norB, and nsrR norB mutants. We found that norB mutants are unable to reduce nitric oxide and produce little or no nitrous oxide from nitrite. Furthermore, nitric oxide produced from nitrite by the AniA protein is bactericidal for a Moraxella catarrhalis O35E norB mutant but not for wild-type O35E bacteria under aerobic growth conditions in vitro, suggesting that nitric oxide catabolism in M. catarrhalis is accomplished primarily by the norB gene product. Measurement of bacterial protein S-nitrosylation directly implicates nitrosative stress resulting from AniA-dependent nitric oxide formation as a cause of the growth inhibition of norB and nsrR mutants by nitrite.

  5. Identification of a two-component signal transduction system involved in fimbriation of Porphyromonas gingivalis.

    PubMed

    Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F

    2000-01-01

    Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.

  6. The maize brown midrib2 (bm2) gene encodes a methylenetetrahydrofolate reductase that contributes to lignin accumulation.

    PubMed

    Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

    2014-02-01

    The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-L-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., ), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  7. Identification of the UDP-glucose-4-epimerase required for galactofuranose biosynthesis and galactose metabolism in A. niger.

    PubMed

    Park, Joohae; Tefsen, Boris; Arentshorst, Mark; Lagendijk, Ellen; van den Hondel, Cees Amjj; van Die, Irma; Ram, Arthur Fj

    2014-01-01

    Galactofuranose (Gal f )-containing glycoconjugates are important to secure the integrity of the cell wall of filamentous fungi. Mutations that prevent the biosynthesis of Gal f -containing molecules compromise cell wall integrity. In response to cell wall weakening, the cell wall integrity (CWI)-pathway is activated to reinforce the strength of the cell wall. Activation of CWI-pathway in Aspergillus niger is characterized by the specific induction of the agsA gene, which encodes a cell wall α-glucan synthase. In this study, we screened a collection of cell wall mutants with an induced expression of agsA for defects in Gal f biosynthesis using a with anti-Gal f antibody (L10). From this collection of mutants, we previously identified mutants in the UDP-galactopyranose mutase encoding gene ( ugmA ). Here, we have identified six additional UDP-galactopyranose mutase ( ugmA ) mutants and one mutant (named mutant #41) in an additional complementation group that displayed strongly reduced Gal f -levels in the cell wall. By using a whole genome sequencing approach, 21 SNPs in coding regions were identified between mutant #41 and its parental strain which changed the amino acid sequence of the encoded proteins. One of these mutations was in gene An14g03820, which codes for a putative UDP-glucose-4-epimerase (UgeA). The A to G mutation in this gene causes an amino acid change of Asn to Asp at position 191 in the UgeA protein. Targeted deletion of ugeA resulted in an even more severe reduction of Gal f in N-linked glucans, indicating that the UgeA protein in mutant #41 is partially active. The ugeA gene is also required for growth on galactose despite the presence of two UgeA homologs in the A. niger genome. By using a classical mutant screen and whole genome sequencing of a new Gal f -deficient mutant, the UDP-glucose-4-epimerase gene ( ugeA ) has been identified. UgeA is required for the biosynthesis of Gal f as well as for galactose metabolism in Aspergillus niger .

  8. Gα proteins Gvm2 and Gvm3 regulate vegetative growth, asexual development, and pathogenicityon apple in Valsa mali.

    PubMed

    Song, Na; Dai, Qingqing; Zhu, Baitao; Wu, Yuxing; Xu, Ming; Voegele, Ralf Thomas; Gao, Xiaoning; Kang, Zhensheng; Huang, Lili

    2017-01-01

    In fungi, heterotrimeric guanine-nucleotide binding proteins (G-proteins) are key elements of signal transduction pathways, which control growth, asexual and sexual development, as well as virulence. In this study, we have identified two genes encoding heterotrimeric G protein alpha subunits, named Gvm2 and Gvm3, from Valsa mali, the causal agent of apple Valsa canker. Characterization of Gvm2 and Gvm3 mutants indicates that Gvm3 may be a crucial regulator of vegetative growth. Deletion of the corresponding gene results in a 20% reduction in growth rate. Besides, Gvm2 and Gvm3 seem to be involved in asexual reproduction, and mutants are hypersensitive to oxidative and cell membrane stresses. Interestingly, both G protein alpha subunits were most probably involved in V. mali virulence. In infection assays using Malus domestica cv. 'Fuji' leaves and twigs, the size of lesions caused by deletion mutants △Gvm2, or △Gvm3 are significantly reduced. Furthermore, many genes encoding hydrolytic enzymes-important virulence factors in V. mali-are expressed at a lower level in these deletion mutants. Our results suggest that Gvm2 and Gvm3 play an important role in virulence probably by regulation of expression of cell wall degrading enzymes. △Gvm2, and △Gvm3 mutants were further analyzed with respect to their impact on the transcript levels of genes in the cAMP/PKA pathway. The expression of the genes encoding adenylate cyclase VmAC, protein kinase A (PKA) regulatory subunit VmPKR, and PKA catalytic subunit VmPKA1 are down-regulated in both mutants. Further analyses indicated that intracellular cAMP level and PKA activity are down-regulated in the △Gvm3 mutant, but are basically unchanged in the △Gvm2 mutant. Overall, our findings indicate that both Gvm2 and Gvm3 play diverse roles in the modulation of vegetative growth, asexual development, and virulence in V. mali.

  9. Metaphase to Anaphase (mat) Transition–Defective Mutants inCaenorhabditis elegans

    PubMed Central

    Golden, Andy; Sadler, Penny L.; Wallenfang, Matthew R.; Schumacher, Jill M.; Hamill, Danielle R.; Bates, Gayle; Bowerman, Bruce; Seydoux, Geraldine; Shakes, Diane C.

    2000-01-01

    The metaphase to anaphase transition is a critical stage of the eukaryotic cell cycle, and, thus, it is highly regulated. Errors during this transition can lead to chromosome segregation defects and death of the organism. In genetic screens for temperature-sensitive maternal effect embryonic lethal (Mel) mutants, we have identified 32 mutants in the nematode Caenorhabditis elegans in which fertilized embryos arrest as one-cell embryos. In these mutant embryos, the oocyte chromosomes arrest in metaphase of meiosis I without transitioning to anaphase or producing polar bodies. An additional block in M phase exit is evidenced by the failure to form pronuclei and the persistence of phosphohistone H3 and MPM-2 antibody staining. Spermatocyte meiosis is also perturbed; primary spermatocytes arrest in metaphase of meiosis I and fail to produce secondary spermatocytes. Analogous mitotic defects cause M phase delays in mitotic germline proliferation. We have named this class of mutants “mat” for metaphase to anaphase transition defective. These mutants, representing six different complementation groups, all map near genes that encode subunits of the anaphase promoting complex or cyclosome, and, here, we show that one of the genes, emb-27, encodes the C. elegans CDC16 ortholog. PMID:11134076

  10. Zebrafish Meis functions to stabilize Pbx proteins and regulate hindbrain patterning.

    PubMed

    Waskiewicz, A J; Rikhof, H A; Hernandez, R E; Moens, C B

    2001-11-01

    Homeodomain-containing Hox proteins regulate segmental identity in Drosophila in concert with two partners known as Extradenticle (Exd) and Homothorax (Hth). These partners are themselves DNA-binding, homeodomain proteins, and probably function by revealing the intrinsic specificity of Hox proteins. Vertebrate orthologs of Exd and Hth, known as Pbx and Meis (named for a myeloid ecotropic leukemia virus integration site), respectively, are encoded by multigene families and are present in multimeric complexes together with vertebrate Hox proteins. Previous results have demonstrated that the zygotically encoded Pbx4/Lazarus (Lzr) protein is required for segmentation of the zebrafish hindbrain and proper expression and function of Hox genes. We demonstrate that Meis functions in the same pathway as Pbx in zebrafish hindbrain development, as expression of a dominant-negative mutant Meis results in phenotypes that are remarkably similar to that of lzr mutants. Surprisingly, expression of Meis protein partially rescues the lzr(-) phenotype. Lzr protein levels are increased in embryos overexpressing Meis and are reduced for lzr mutants that cannot bind to Meis. This implies a mechanism whereby Meis rescues lzr mutants by stabilizing maternally encoded Lzr. Our results define two functions of Meis during zebrafish hindbrain segmentation: that of a DNA-binding partner of Pbx proteins, and that of a post-transcriptional regulator of Pbx protein levels.

  11. Deletion and overexpression studies on DacB2, a putative low molecular mass penicillin binding protein from Mycobacterium tuberculosis H(37)Rv.

    PubMed

    Bourai, Neema; Jacobs, William R; Narayanan, Sujatha

    2012-02-01

    Mycobacterium tuberculosis genome encodes several high and low molecular mass penicillin binding proteins. One such low molecular mass protein is DacB2 encoded by open reading frame Rv2911 of M. tuberculosis which is predicted to play a role in peptidoglycan synthesis. In this study we have tried to gain an insight into the role of this accessory cell division protein in mycobacterial physiology by performing overexpression and deletion studies. The overproduction of DacB2 in non-pathogenic, fast growing mycobacterium Mycobacterium smegmatis mc(2)155 resulted in reduced growth, an altered colony morphology, a defect in sliding motility and biofilm formation. A point mutant of DacB2 was made wherein the active site serine residue was mutated to cysteine to abolish the penicillin binding function of protein. The overexpression of mutant protein showed similar results indicating that the effects produced were independent of protein's penicillin binding function. The gene encoding DacB2 was deleted in M. tuberculosis by specialized transduction method. The deletion mutant showed reduced growth in Sauton's medium under acidic and low oxygen availability. The in vitro infection studies with THP-1 cells showed increased intracellular survival of dacB2 mutant compared to parent and complemented strains. The colony morphology and antibiotic sensitivity of mutant and wild-type strains were similar. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Identification and elucidation of in vivo function of two alanine racemases from Pseudomonas putida KT2440.

    PubMed

    Duque, Estrella; Daddaoua, Abdelali; Cordero, Baldo F; De la Torre, Jesús; Antonia Molina-Henares, Maria; Ramos, Juan-Luis

    2017-10-01

    The genome of Pseudomonas putida KT2440 contains two open reading frames (ORFs), PP_3722 and PP_5269, that encode proteins with a Pyridoxal phosphate binding motif and a high similarity to alanine racemases. Alanine racemases play a key role in the biosynthesis of D-alanine, a crucial amino acid in the peptidoglycan layer. For these ORFs, we generated single and double mutants and found that inactivation of PP_5269 resulted in D-alanine auxotrophy, while inactivation of PP_3722 did not. Furthermore, as expected, the PP_3722/PP_5269 double mutant was a strict auxotroph for D-alanine. These results indicate that PP_5269 is an alr allele and that it is the essential alanine racemase in P. putida. We observed that the PP_5269 mutant grew very slowly, while the double PP_5269/PP_3722 mutant did not grow at all. This suggests that PP_3722 may replace PP_5269 in vivo. In fact, when the ORF encoding PP_3772 was cloned into a wide host range expression vector, ORF PP_3722 successfully complemented P. putida PP_5269 mutants. We purified both proteins to homogeneity and while they exhibit similar K M values, the V max of PP_5269 is fourfold higher than that of PP_3722. Here, we propose that PP_5269 and PP_3722 encode functional alanine racemases and that these genes be named alr-1 and alr-2 respectively. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway

    PubMed Central

    Sato, Yutaka; Morita, Ryouhei; Nishimura, Minoru; Yamaguchi, Hiroyasu; Kusaba, Makoto

    2007-01-01

    Mutants that retain greenness of leaves during senescence are known as “stay-green” mutants. The most famous stay-green mutant is Mendel's green cotyledon pea, one of the mutants used in determining the law of genetics. Pea plants homozygous for this recessive mutation (known as i at present) retain greenness of the cotyledon during seed maturation and of leaves during senescence. We found tight linkage between the I locus and stay-green gene originally found in rice, SGR. Molecular analysis of three i alleles including one with no SGR expression confirmed that the I gene encodes SGR in pea. Functional analysis of sgr mutants in pea and rice further revealed that leaf functionality is lowered despite a high chlorophyll a (Chl a) and chlorophyll b (Chl b) content in the late stage of senescence, suggesting that SGR is primarily involved in Chl degradation. Consistent with this observation, a wide range of Chl–protein complexes, but not the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit, were shown to be more stable in sgr than wild-type plants. The expression of OsCHL and NYC1, which encode the first enzymes in the degrading pathways of Chl a and Chl b, respectively, was not affected by sgr in rice. The results suggest that SGR might be involved in activation of the Chl-degrading pathway during leaf senescence through translational or posttranslational regulation of Chl-degrading enzymes. PMID:17709752

  14. Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway.

    PubMed

    Sato, Yutaka; Morita, Ryouhei; Nishimura, Minoru; Yamaguchi, Hiroyasu; Kusaba, Makoto

    2007-08-28

    Mutants that retain greenness of leaves during senescence are known as "stay-green" mutants. The most famous stay-green mutant is Mendel's green cotyledon pea, one of the mutants used in determining the law of genetics. Pea plants homozygous for this recessive mutation (known as i at present) retain greenness of the cotyledon during seed maturation and of leaves during senescence. We found tight linkage between the I locus and stay-green gene originally found in rice, SGR. Molecular analysis of three i alleles including one with no SGR expression confirmed that the I gene encodes SGR in pea. Functional analysis of sgr mutants in pea and rice further revealed that leaf functionality is lowered despite a high chlorophyll a (Chl a) and chlorophyll b (Chl b) content in the late stage of senescence, suggesting that SGR is primarily involved in Chl degradation. Consistent with this observation, a wide range of Chl-protein complexes, but not the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit, were shown to be more stable in sgr than wild-type plants. The expression of OsCHL and NYC1, which encode the first enzymes in the degrading pathways of Chl a and Chl b, respectively, was not affected by sgr in rice. The results suggest that SGR might be involved in activation of the Chl-degrading pathway during leaf senescence through translational or posttranslational regulation of Chl-degrading enzymes.

  15. Combinational Deletion of Three Membrane Protein-Encoding Genes Highly Attenuates Yersinia pestis while Retaining Immunogenicity in a Mouse Model of Pneumonic Plague

    PubMed Central

    Tiner, Bethany L.; Kirtley, Michelle L.; Erova, Tatiana E.; Popov, Vsevolod L.; Baze, Wallace B.; van Lier, Christina J.; Ponnusamy, Duraisamy; Andersson, Jourdan A.; Motin, Vladimir L.; Chauhan, Sadhana

    2015-01-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a mouse model while retaining the required immunogenicity needed for subsequent protection against infection. PMID:25605764

  16. Combinational deletion of three membrane protein-encoding genes highly attenuates yersinia pestis while retaining immunogenicity in a mouse model of pneumonic plague.

    PubMed

    Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K

    2015-04-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a mouse model while retaining the required immunogenicity needed for subsequent protection against infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Identification of Gold Nanoparticle-Resistant Mutants of Saccharomyces cerevisiae Suggests a Role for Respiratory Metabolism in Mediating Toxicity

    PubMed Central

    Smith, Mark R.; Boenzli, Matthew G.; Hindagolla, Vihangi; Ding, Jun; Miller, John M.; Hutchison, James E.; Greenwood, Jeffrey A.; Abeliovich, Hagai

    2013-01-01

    Positively charged gold nanoparticles (0.8-nm core diameter) reduced yeast survival, but not growth, at a concentration of 10 to 100 μg/ml. Among 17 resistant deletion mutants isolated in a genome-wide screen, highly significant enrichment was observed for respiration-deficient mutants lacking genes encoding proteins associated with the mitochondrion. PMID:23144132

  18. EcpA, an extracellular protease, is a specific virulence factor required by Xanthomonas oryzae pv. oryzicola but not by X. oryzae pv. oryzae in rice

    USDA-ARS?s Scientific Manuscript database

    Previously, twelve protease-deficient mutants of Xanthomonas oryzae pv. oryzicola (Xoc) RS105 strain were recovered from a Tn5-tagged mutant library. In the current study, the Tn5 insertion site in each mutant was mapped. Mutations in genes encoding components of the type II secretion apparatus, cAM...

  19. Transgenic evaluation of activated mutant alleles of SOS2 reveals a critical requirement for its kinase activity and C-terminal regulatory domain for salt tolerance in Arabidopsis thaliana

    DOEpatents

    Zhu, Jian-Kang [Riverside, CA; Quintero-Toscano, Francisco Javier [Sevilla, ES; Pardo-Prieto, Jose Manuel [Sevilla, ES; Qiu, Quansheng [Urbana, IL; Schumaker, Karen Sue [Tucson, AZ; Ohta, Masaru [Tsukuba, JP; Zhang, Changqing [Tucson, AZ; Guo, Yan [Beijing, CN

    2007-09-04

    The present invention provides a method of increasing salt tolerance in a plant by overexpressing a gene encoding a mutant SOS2 protein in at least one cell type in the plant. The present invention also provides for transgenic plants expressing the mutant SOS2 proteins.

  20. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    PubMed Central

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased placental inflammation and decreased infant birth weight among women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) during pregnancy. Methods. Between 2009 and 2011, delivering women without human immunodeficiency virus infection were enrolled in an observational study of IPTp-SP effectiveness in Malawi. Parasites were detected by polymerase chain reaction (PCR); positive samples were sequenced to genotype the dhfr and dhps loci. The presence of K540E in dhps was used as a marker for the quintuple mutant. Results. Samples from 1809 women were analyzed by PCR; 220 (12%) were positive for P. falciparum. A total of 202 specimens were genotyped at codon 581 of dhps; 17 (8.4%) harbored the sextuple mutant. The sextuple mutant was associated with higher risks of patent infection in peripheral blood (adjusted prevalence ratio [aPR], 2.76; 95% confidence interval [CI], 1.82–4.18) and placental blood (aPR 3.28; 95% CI, 1.88–5.78) and higher parasite densities. Recent SP use was not associated with increased parasite densities or placental pathology overall and among women with parasites carrying dhps A581G. Conclusions. IPTp-SP failed to inhibit parasite growth but did not exacerbate pathology among women infected with sextuple-mutant parasites. New interventions to prevent malaria during pregnancy are needed urgently. PMID:25564249

  1. Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

    PubMed Central

    Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

    2012-01-01

    ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

  2. Functional assessment of the Medicago truncatula NIP/LATD protein demonstrates that it is a high-affinity nitrate transporter.

    PubMed

    Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D Janine; Dickstein, Rebecca

    2012-10-01

    The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function.

  3. Functional Assessment of the Medicago truncatula NIP/LATD Protein Demonstrates That It Is a High-Affinity Nitrate Transporter1[W][OA

    PubMed Central

    Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O. Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D. Janine; Dickstein, Rebecca

    2012-01-01

    The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function. PMID:22858636

  4. Both flagella and F4 fimbriae from F4ac+ enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro.

    PubMed

    Zhou, Mingxu; Duan, Qiangde; Zhu, Xiaofang; Guo, Zhiyan; Li, Yinchau; Hardwidge, Philip R; Zhu, Guoqiang

    2013-05-13

    The role of flagella in the pathogenesis of F4ac+ Enterotoxigenic Escherichia coli (ETEC) mediated neonatal and post-weaning diarrhea (PWD) is not currently understood. We targeted the reference C83902 ETEC strain (O8:H19:F4ac+ LT+ STa+ STb+), to construct isogenic mutants in the fliC (encoding the major flagellin protein), motA (encoding the flagella motor), and faeG (encoding the major subunit of F4 fimbriae) genes. Both the ΔfliC and ΔfaeG mutants had a reduced ability to adhere to porcine intestinal epithelial IPEC-J2 cells. F4 fimbriae expression was significantly down-regulated after deleting fliC, which revealed that co-regulation exists between flagella and F4 fimbriae. However, there was no difference in adhesion between the ΔmotA mutant and its parent strain. These data demonstrate that both flagella and F4 fimbriae are required for efficient F4ac+ ETEC adhesion in vitro.

  5. Type 3 fimbriae and biofilm formation are regulated by the transcriptional regulators MrkHI in Klebsiella pneumoniae.

    PubMed

    Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven

    2011-07-01

    Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.

  6. Type 3 Fimbriae and Biofilm Formation Are Regulated by the Transcriptional Regulators MrkHI in Klebsiella pneumoniae▿

    PubMed Central

    Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven

    2011-01-01

    Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997

  7. The Ror receptor tyrosine kinase CAM-1 is required for ACR-16-mediated synaptic transmission at the C. elegans neuromuscular junction.

    PubMed

    Francis, Michael M; Evans, Susan P; Jensen, Michael; Madsen, David M; Mancuso, Joel; Norman, Kenneth R; Maricq, Andres Villu

    2005-05-19

    Nicotinic (cholinergic) neurotransmission plays a critical role in the vertebrate nervous system, underlies nicotine addiction, and nicotinic receptor dysfunction leads to neurological disorders. The C. elegans neuromuscular junction (NMJ) shares many characteristics with neuronal synapses, including multiple classes of postsynaptic currents. Here, we identify two genes required for the major excitatory current found at the C. elegans NMJ: acr-16, which encodes a nicotinic AChR subunit homologous to the vertebrate alpha7 subunit, and cam-1, which encodes a Ror receptor tyrosine kinase. acr-16 mutants lack fast cholinergic current at the NMJ and exhibit synthetic behavioral deficits with other known AChR mutants. In cam-1 mutants, ACR-16 is mislocalized and ACR-16-dependent currents are disrupted. The postsynaptic deficit in cam-1 mutants is accompanied by alterations in the distribution of cholinergic vesicles and associated synaptic proteins. We hypothesize that CAM-1 contributes to the localization or stabilization of postsynaptic ACR-16 receptors and presynaptic release sites.

  8. Quercetin Protects Yeast Saccharomyces cerevisiae pep4 Mutant from Oxidative and Apoptotic Stress and Extends Chronological Lifespan.

    PubMed

    Alugoju, Phaniendra; Janardhanshetty, Sudharshan Setra; Subaramanian, Subasri; Periyasamy, Latha; Dyavaiah, Madhu

    2018-05-01

    The yeast Saccharomyces cerevisiae PEP4 gene encodes vacuolar endopeptidase proteinase A (Pep4p), which is a homolog of the human CTSD gene that encodes cathepsin D. Mutation of CTSD gene in human resulted in a number of neurodegenerative diseases. In this study, we have shown that yeast pep4 mutant cells are highly sensitive to oxidative and apoptotic stress induced by hydrogen peroxide and acetic acid, respectively. pep4∆ cells also showed accumulation of reactive oxygen species (ROS), apoptotic markers, and reduced chronological lifespan. In contrast, quercetin pretreatment protected the pep4 mutant from oxidative and apoptotic stress-induced sensitivity by scavenging ROS and reducing apoptotic markers. The percentage viability of quercetin-treated pep4∆ cells was more pronounced and increased stress resistance against oxidant, apoptotic, and heat stress during chronological aging. From our experimental results, we concluded that quercetin protects yeast pep4 mutant cells from oxidative stress and apoptosis, thereby increasing viability during chronological aging.

  9. Touch responsiveness in zebrafish requires voltage-gated calcium channel 2.1b

    PubMed Central

    Low, Sean E.; Woods, Ian G.; Lachance, Mathieu; Ryan, Joel; Saint-Amant, Louis

    2012-01-01

    The molecular and physiological basis of the touch-unresponsive zebrafish mutant fakir has remained elusive. Here we report that the fakir phenotype is caused by a missense mutation in the gene encoding voltage-gated calcium channel 2.1b (CACNA1Ab). Injection of RNA encoding wild-type CaV2.1 restores touch responsiveness in fakir mutants, whereas knockdown of CACNA1Ab via morpholino oligonucleotides recapitulates the fakir mutant phenotype. Fakir mutants display normal current-evoked synaptic communication at the neuromuscular junction but have attenuated touch-evoked activation of motor neurons. NMDA-evoked fictive swimming is not affected by the loss of CaV2.1b, suggesting that this channel is not required for motor pattern generation. These results, coupled with the expression of CACNA1Ab by sensory neurons, suggest that CaV2.1b channel activity is necessary for touch-evoked activation of the locomotor network in zebrafish. PMID:22490555

  10. phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens.

    PubMed

    Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan

    2015-09-17

    Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.

  11. Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps

    PubMed Central

    Piedade, Ana Paula; Morais, Paula V.

    2015-01-01

    Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification. PMID:26132104

  12. delta. -aminolevulinic acid dehydratase deficiency can cause. delta. -aminolevulinate auxotrophy in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O'Neill, G.P.; Michelsen, U.; Soll, D.

    Ethylmethane sulfonate-induced mutants of several Escherichia coli strains that required {delta}-aminolevulinic acid (ALA) for growth were isolated by penicillin enrichment or by selection for respiratory-defective strains resistant to the aminoglycoside antibiotic kanamycin. Three classes of mutants were obtained. Two-thirds of the strains were mutants in hemA. Representative of a third of the mutations was the hem-201 mutation. This mutation was mapped to min 8.6 to 8.7. Complementation of the auxotrophic phenotype by wild-type DNA from the corresponding phage 8F10 allowed the isolation of the gene. DNA sequence analysis revealed that the hem-201 gene encoded ALA dehydratase and was similar tomore » a known hemB gene of E. coli. Complementation studies of hem-201 and hemB1 mutant strains with various hem-201 gene subfragments showed that hem-201 and the previously reported hemB1 mutation are in the same gene and that no other gene is required to complement the hem-201 mutant. ALA-forming activity from glutamate could not be detected by in vitro or in vivo assays. Extracts of hem-201 cells had drastically reduce ALA dehydratase levels, while cells transformed with the plasmid-encoded wild-type gene possessed highly elevated enzyme levels. The ALA requirement for growth, the lack of any ALA-forming enzymatic activity, and greatly reduced ALA dehydratase activity of the hem-201 strain suggest that a diffusible product of an enzyme in the heme biosynthetic pathway after ALA formation is involved in positive regulation of ALA biosynthesis. Analysis of another class of ALA-requiring mutants showed that the auxotrophy of the hem-205 mutant could be relieved by either methionine or cysteine and that the mutation maps in the cysG gene, which encodes uroporphyrinogen III methylase. The properties of these nonleaky ALA-requiring strains suggest that ALA is involved more extensively in E. coli intermediary metabolism than has been appreciated to date.« less

  13. Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

    PubMed

    Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

    2017-06-01

    Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  14. Transposon mutagenesis of probiotic Lactobacillus casei identifies asnH, an asparagine synthetase gene involved in its immune-activating capacity.

    PubMed

    Ito, Masahiro; Kim, Yun-Gi; Tsuji, Hirokazu; Takahashi, Takuya; Kiwaki, Mayumi; Nomoto, Koji; Danbara, Hirofumi; Okada, Nobuhiko

    2014-01-01

    Lactobacillus casei ATCC 27139 enhances host innate immunity, and the J1 phage-resistant mutants of this strain lose the activity. A transposon insertion mutant library of L. casei ATCC 27139 was constructed, and nine J1 phage-resistant mutants out of them were obtained. Cloning and sequencing analyses identified three independent genes that were disrupted by insertion of the transposon element: asnH, encoding asparagine synthetase, and dnaJ and dnaK, encoding the molecular chaperones DnaJ and DnaK, respectively. Using an in vivo mouse model of Listeria infection, only asnH mutant showed deficiency in their ability to enhance host innate immunity, and complementation of the mutation by introduction of the wild-type asnH in the mutant strain recovered the immuno-augmenting activity. AsnH protein exhibited asparagine synthetase activity when the lysozyme-treated cell wall extracts of L. casei ATCC 27139 was added as substrate. The asnH mutants lost the thick and rigid peptidoglycan features that are characteristic to the wild-type cells, indicating that AsnH of L. casei is involved in peptidoglycan biosynthesis. These results indicate that asnH is required for the construction of the peptidoglycan composition involved in the immune-activating capacity of L. casei ATCC 27139.

  15. Bacillus subtilis Mutants with Knockouts of the Genes Encoding Ribonucleases RNase Y and RNase J1 Are Viable, with Major Defects in Cell Morphology, Sporulation, and Competence

    PubMed Central

    Figaro, Sabine; Durand, Sylvain; Gilet, Laetitia; Cayet, Nadège; Sachse, Martin

    2013-01-01

    The genes encoding the ribonucleases RNase J1 and RNase Y have long been considered essential for Bacillus subtilis cell viability, even before there was concrete knowledge of their function as two of the most important enzymes for RNA turnover in this organism. Here we show that this characterization is incorrect and that ΔrnjA and Δrny mutants are both viable. As expected, both strains grow relatively slowly, with doubling times in the hour range in rich medium. Knockout mutants have major defects in their sporulation and competence development programs. Both mutants are hypersensitive to a wide range of antibiotics and have dramatic alterations to their cell morphologies, suggestive of cell envelope defects. Indeed, RNase Y mutants are significantly smaller in diameter than wild-type strains and have a very disordered peptidoglycan layer. Strains lacking RNase J1 form long filaments in tight spirals, reminiscent of mutants of the actin-like proteins (Mre) involved in cell shape determination. Finally, we combined the rnjA and rny mutations with mutations in other components of the degradation machinery and show that many of these strains are also viable. The implications for the two known RNA degradation pathways of B. subtilis are discussed. PMID:23504012

  16. Gene I mutants of peanut chlorotic streak virus, a caulimovirus, replicate in plants but do not move from cell to cell.

    PubMed Central

    Ducasse, D A; Mushegian, A R; Shepherd, R J

    1995-01-01

    Gene I of peanut chlorotic streak virus (PCISV), a caulimovirus, is homologous to gene I of other caulimoviruses and may encode a protein for virus movement. To evaluate the function of gene I, several mutations were created in this gene of an infectious, partially redundant clone of PCISV. Constructs with an in-frame deletion and a single amino acid substitution in gene I were not infectious. To test for replication of these mutants in primarily infected cells, an immunosorbent PCR technique was devised. Virus particles formed by mutants in plants were recovered by binding to antivirus antibodies on a solid matrix and DNase treated to discriminate against residual inoculum, and DNA of trapped virions was subjected to PCR amplification. Gene I mutants were shown to direct formation of encapsidated DNA as revealed by a PCR product. Control gene V mutants (reverse transcriptase essential for replication) did not yield a PCR product. Quantitative PCR allowed estimation of the proportion of cells initially infected by gene I mutants and the amount of extractable virus per cell. It is concluded that PCISV gene I encodes a movement protein and that the immunoselection-PCR technique is useful in studying subliminal virus infection in plants. PMID:7543587

  17. A mutated ARO4 gene for feedback-resistant DAHP synthase which causes both o-fluoro-DL-phenylalanine resistance and beta-phenethyl-alcohol overproduction in Saccharomyces cerevisiae.

    PubMed

    Fukuda, K; Watanabe, M; Asano, K; Ouchi, K; Takasawa, S

    1991-12-01

    o-Fluoro-DL-phenylalanine (OFP)-resistant mutants which overproduce beta-phenethyl-alcohol were isolated from a laboratory strain of Saccharomyces cerevisiae. Cells of one of the mutants accumulated tyrosine and phenylalanine 1.5-3 fold more than did wild-type cells. Its 3-deoxy-D-arabino-hepturosonate-7-phosphate (DAHP) synthase (EC 4.1.2.15), encoded by ARO4, was free from feedback inhibition by tyrosine. Genetic analysis revealed that the mutation was controlled by a single dominant gene, ARO4-OFP, encoding feedback-resistant DAHP synthase by tyrosine, and that this gene caused both the OFP resistance and beta-phenethyl-alcohol overproduction. This was supported by molecular genetic studies using cloned ARO4 both from the wild-type and its mutant strain.

  18. A second gene for type I signal peptidase in Bradyrhizobium japonicum, sipF, is located near genes involved in RNA processing and cell division.

    PubMed

    Bairl, A; Müller, P

    1998-11-01

    The TnphoA-induced Bradyrhizobium japonicum mutant 184 shows slow growth and aberrant colonization of soybean nodules. Using a DNA fragment adjacent to the transposon insertion site as a probe, a 3.4-kb BglII fragment of B. japonicum 110spc4 DNA was identified and cloned. Sequence analysis indicated that two truncated ORFs and three complete ORFs were encoded on this fragment. A database search revealed homologies to several other prokaryotic proteins: PdxJ (an enzyme involved in vitamin B6 biosynthesis), AcpS (acyl carrier protein synthase), Lep or Sip (prokaryotic type I signal peptidase), RNase III (an endoribonuclease which processes double-stranded rRNA precursors and mRNA) and Era (a GTP-binding protein required for cell division). The mutation in strain 184 was found to lie within the signal peptidase gene, which was designated sipF. Therefore, sipF is located in a region that encodes gene products involved in posttranscriptional and posttranslational processing processes. By complementation of the lep(ts) E. coli mutant strain IT41 it was demonstrated that sipF indeed encodes a functional signal peptidase, and genetic complementation of B. japonicum mutant 184 by a 2.8-kb SalI fragment indicated that sipF is expressed from a promoter located directly upstream of sipF. Using a non-polar kanamycin resistance cassette, a specific sipF mutant was constructed which exhibited defects in symbiosis similar to those of the original mutant 184.

  19. Human Cytomegalovirus UL99-Encoded pp28 Is Required for the Cytoplasmic Envelopment of Tegument-Associated Capsids

    PubMed Central

    Silva, Maria C.; Yu, Qian-Chun; Enquist, Lynn; Shenk, Thomas

    2003-01-01

    The human cytomegalovirus UL99-encoded pp28 is a myristylated phosphoprotein that is a constituent of the virion. The pp28 protein is positioned within the tegument of the virus particle, a protein structure that resides between the capsid and envelope. In the infected cell, pp28 is found in a cytoplasmic compartment derived from the Golgi apparatus, where the virus buds into vesicles to acquire its final membrane. We have constructed two mutants of human cytomegalovirus that fail to produce the pp28 protein, a substitution mutant (BADsubUL99) and a point mutant (BADpmUL99), and we have propagated them by complementation in pp28-expressing fibroblasts. Both mutant viruses are profoundly defective for growth in normal fibroblasts; no infectious virus could be detected after infection. Whereas normal levels of viral DNA and late proteins were observed in mutant virus-infected cells, large numbers of tegument-associated capsids accumulated in the cytoplasm that failed to acquire an envelope. We conclude that pp28 is required for the final envelopment of the human cytomegalovirus virion in the cytoplasm. PMID:12970444

  20. Regulation of sugar transport and metabolism by the Candida albicans Rgt1 transcriptional repressor.

    PubMed

    Sexton, Jessica A; Brown, Victoria; Johnston, Mark

    2007-10-01

    The ability of the fungal pathogen Candida albicans to cause systemic infections depends in part on the function of Hgt4, a cell surface sugar sensor. The orthologues of Hgt4 in Saccharomyces cerevisiae, Snf3 and Rgt2, initiate a signalling cascade that inactivates Rgt1, a transcriptional repressor of genes encoding hexose transporters. To determine whether Hgt4 functions similarly through the C. albicans orthologue of Rgt1, we analysed Cargt1 deletion mutants. We found that Cargt1 mutants are sensitive to the glucose analogue 2-deoxyglucose, a phenotype probably due to uncontrolled expression of genes encoding glucose transporters. Indeed, transcriptional profiling revealed that expression of about two dozen genes, including multiple HGT genes encoding hexose transporters, is increased in the Cargt1 mutant in the absence of sugars, suggesting that CaRgt1 represses expression of several HGT genes under this condition. Some of the HGT genes (probably encoding high-affinity transporters) are also repressed by high levels of glucose, and we show that this repression is mediated by CaMig1, the orthologue of the major glucose-activated repressor in S. cerevisiae, but not by its paralogue CaMig2. Therefore, CaRgt1 and CaMig1 collaborate to control expression of C. albicans hexose transporters in response to different levels of sugars. We were surprised to find that CaRgt1 also regulates expression of GAL1, suggesting that regulation of galactose metabolism in C. albicans is unconventional. Finally, Cargt1 mutations cause cells to hyperfilament, and suppress the hypofilamented phenotype of an hgt4 mutant, indicating that the Hgt4 glucose sensor may affect filamentation by modulating sugar import and metabolism via CaRgt1. Copyright 2007 John Wiley & Sons, Ltd.

  1. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    PubMed

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  2. Functional Analysis of the Lactobacillus casei BL23 Sortases

    PubMed Central

    Muñoz-Provencio, Diego; Rodríguez-Díaz, Jesús; Collado, María Carmen; Langella, Philippe; Bermúdez-Humarán, Luis G.

    2012-01-01

    Sortases are a class of enzymes that anchor surface proteins to the cell wall of Gram-positive bacteria. Lactobacillus casei BL23 harbors four sortase genes, two belonging to class A (srtA1 and srtA2) and two belonging to class C (srtC1 and srtC2). Class C sortases were clustered with genes encoding their putative substrates that were homologous to the SpaEFG and SpaCBA proteins that encode mucus adhesive pili in Lactobacillus rhamnosus GG. Twenty-three genes encoding putative sortase substrates were identified in the L. casei BL23 genome with unknown (35%), enzymatic (30%), or adhesion-related (35%) functions. Strains disrupted in srtA1, srtA2, srtC1, and srtC2 and an srtA1 srtA2 double mutant were constructed. The transcription of all four sortase encoding genes was detected, but only the mutation of srtA1 resulted in a decrease in bacterial surface hydrophobicity. The β-N-acetyl-glucosaminidase and cell wall proteinase activities of whole cells diminished in the srtA1 mutant and, to a greater extent, in the srtA1 srtA2 double mutant. Cell wall anchoring of the staphylococcal NucA reporter protein fused to a cell wall sorting sequence was also affected in the srtA mutants, and the percentages of adhesion to Caco-2 and HT-29 intestinal epithelial cells were reduced for the srtA1 srtA2 strain. Mutations in srtC1 or srtC2 result in an undetectable phenotype. Together, these results suggest that SrtA1 is the housekeeping sortase in L. casei BL23 and SrtA2 would carry out redundant or complementary functions that become evident when SrtA1 activity is absent. PMID:23042174

  3. Arabidopsis cop8 and fus4 mutations define the same gene that encodes subunit 4 of the COP9 signalosome.

    PubMed Central

    Serino, G; Tsuge, T; Kwok, S; Matsui, M; Wei, N; Deng, X W

    1999-01-01

    The pleiotropic constitutive photomorphogenic/deetiolated/fusca (cop/det/fus) mutants of Arabidopsis exhibit features of light-grown seedlings when grown in the dark. Cloning and biochemical analysis of COP9 have revealed that it is a component of a multiprotein complex, the COP9 signalosome (previously known as the COP9 complex). Here, we compare the immunoaffinity and the biochemical purification of the COP9 signalosome from cauliflower and confirm its eight-subunit composition. Molecular cloning of subunit 4 of the complex revealed that it is a proteasome-COP9 complex-eIF3 domain protein encoded by a gene that maps to chromosome 5, near the chromosomal location of the cop8 and fus4 mutations. Genetic complementation tests showed that the cop8 and fus4 mutations define the same locus, now designated as COP8. Molecular analysis of the subunit 4-encoding gene in both cop8 and fus4 mutants identified specific molecular lesions, and overexpression of the subunit 4 cDNA in a cop8 mutant background resulted in complete rescue of the mutant phenotype. Thus, we conclude that COP8 encodes subunit 4 of the COP9 signalosome. Examination of possible molecular interactions by using the yeast two-hybrid assay indicated that COP8 is capable of strong self-association as well as interaction with COP9, FUS6/COP11, FUS5, and Arabidopsis JAB1 homolog 1, the latter four proteins being previously defined subunits of the Arabidopsis COP9 signalosome. A comparative sequence analysis indicated that COP8 is highly conserved among multicellular eukaryotes and is also similar to a subunit of the 19S regulatory particle of the 26S proteasome. PMID:10521526

  4. LMOf2365_0442 Encoding for a Fructose Specific PTS Permease IIA May Be Required for Virulence in L. monocytogenes Strain F2365

    PubMed Central

    Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418

  5. Cloning and sequence analysis of the LEU2 homologue gene from Pichia anomala.

    PubMed

    De la Rosa, J M; Pérez, J A; Gutiérrez, F; González, J M; Ruiz, T; Rodríguez, L

    2001-11-01

    The Pichia anomala LEU2 gene (PaLEU2) was isolated by complementation of a leu2 Saccharomyces cerevisiae mutant. The cloned gene also allowed growth of a Escherichia coli leuB mutant in leucine-lacking medium, indicating that it encodes a product able to complement the beta-isopropylmalate dehydrogenase deficiency of the mutants. The sequenced DNA fragment contains a complete ORF of 1092 bp, and the deduced polypeptide shares significant homologies with the products of the LEU2 genes from S. cerevisiae (84% identity) and other yeast species. A sequence resembling the GC-rich palindrome motif identified in the 5' region of S. cerevisiae LEU2 gene as the binding site for the transcription activating factor encoded by the LEU3 gene was found at the promoter region. In addition, upstream of the PaLEU2 the 3'-terminal half of a gene of the same orientation, encoding a homologue of the S. cerevisiae NFS1/SPL1 gene that encodes a mitochondrial cysteine desulphurase involved in both tRNA processing and mitochondrial metabolism, was found. The genomic organization of the PaNFS1-PaLEU2 gene pair is similar to that found in several other yeast species, including S. cerevisiae and Candida albicans, except that in some of them the LEU2 gene appears in the reverse orientation. Copyright 2001 John Wiley & Sons, Ltd.

  6. Targeted knock-out of a gene encoding sulfite reductase in the moss Physcomitrella patens affects gametophytic and sporophytic development.

    PubMed

    Wiedemann, Gertrud; Hermsen, Corinna; Melzer, Michael; Büttner-Mainik, Annette; Rennenberg, Heinz; Reski, Ralf; Kopriva, Stanislav

    2010-06-03

    A key step in sulfate assimilation into cysteine is the reduction of sulfite to sulfide by sulfite reductase (SiR). This enzyme is encoded by three genes in the moss Physcomitrella patens. To obtain a first insight into the roles of the individual isoforms, we deleted the gene encoding the SiR1 isoform in P. patens by homologous recombination and subsequently analysed the DeltaSiR1 mutants. While DeltaSiR1 mutants showed no obvious alteration in sulfur metabolism, their regeneration from protoplasts and their ability to produce mature spores was significantly affected, highlighting an unexpected link between moss sulfate assimilation and development, that is yet to be characterized. Copyright 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  7. Structure-Function Analysis of Chloroplast Proteins via Random Mutagenesis Using Error-Prone PCR.

    PubMed

    Dumas, Louis; Zito, Francesca; Auroy, Pascaline; Johnson, Xenie; Peltier, Gilles; Alric, Jean

    2018-06-01

    Site-directed mutagenesis of chloroplast genes was developed three decades ago and has greatly advanced the field of photosynthesis research. Here, we describe a new approach for generating random chloroplast gene mutants that combines error-prone polymerase chain reaction of a gene of interest with chloroplast complementation of the knockout Chlamydomonas reinhardtii mutant. As a proof of concept, we targeted a 300-bp sequence of the petD gene that encodes subunit IV of the thylakoid membrane-bound cytochrome b 6 f complex. By sequencing chloroplast transformants, we revealed 149 mutations in the 300-bp target petD sequence that resulted in 92 amino acid substitutions in the 100-residue target subunit IV sequence. Our results show that this method is suited to the study of highly hydrophobic, multisubunit, and chloroplast-encoded proteins containing cofactors such as hemes, iron-sulfur clusters, and chlorophyll pigments. Moreover, we show that mutant screening and sequencing can be used to study photosynthetic mechanisms or to probe the mutational robustness of chloroplast-encoded proteins, and we propose that this method is a valuable tool for the directed evolution of enzymes in the chloroplast. © 2018 American Society of Plant Biologists. All rights reserved.

  8. Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate.

    PubMed

    Ikeda, Kyoko; Ito, Momoyo; Nagasawa, Nobuhiro; Kyozuka, Junko; Nagato, Yasuo

    2007-09-01

    Inflorescence architecture is one of the most important agronomical traits. Characterization of rice aberrant panicle organization 1 (apo1) mutants revealed that APO1 positively controls spikelet number by suppressing the precocious conversion of inflorescence meristems to spikelet meristems. In addition, APO1 is associated with the regulation of the plastchron, floral organ identity, and floral determinacy. Phenotypic analyses of apo1 and floral homeotic double mutants demonstrate that APO1 positively regulates class-C floral homeotic genes, but not class-B genes. Molecular studies revealed that APO1 encodes an F-box protein, an ortholog of Arabidopsis UNUSUAL FLORAL ORGAN (UFO), which is a positive regulator of class-B genes. Overexpression of APO1 caused an increase in inflorescence branches and spikelets. As the mutant inflorescences and flowers differed considerably between apo1 and ufo, the functions of APO1 and UFO appear to have diverged during evolution.

  9. Flagellin and F4 fimbriae have opposite effects on biofilm formation and quorum sensing in F4ac+ enterotoxigenic Escherichia coli.

    PubMed

    Zhou, Mingxu; Guo, Zhiyan; Yang, Yang; Duan, Qiangde; Zhang, Qi; Yao, Fenghua; Zhu, Jun; Zhang, Xinjun; Hardwidge, Philip R; Zhu, Guoqiang

    2014-01-10

    Bacteria that form biofilms are often highly resistant to antibiotics and are capable of evading the host immune system. To evaluate the role of flagellin and F4 fimbriae on biofilm formation by enterotoxigenic Escherichia coli (ETEC), we deleted the fliC (encoding the major flagellin protein) and/or the faeG (encoding the major subunit of F4 fimbriae) genes from ETEC C83902. Biofilm formation was reduced in the fliC mutant but increased in the faeG mutant, as compared with the wild-type strain. The expression of AI-2 quorum sensing associated genes was regulated in the fliC and faeG mutants, consistent with the biofilm formation of these strains. But, deleting fliC and/or faeG also inhibited AI-2 quorum sensing activity. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Quorum sensing is a key regulator for the antifungal and biocontrol activity of chitinase-producing Chromobacterium sp. C61.

    PubMed

    Kim, In Seon; Yang, Si Young; Park, Seur Kee; Kim, Young Cheol

    2017-01-01

    Chromobacterium sp. strain C61 has strong biocontrol activity; however, the genetic and biochemical determinants of its plant disease suppression activity are not well understood. Here, we report the identification and characterization of two new determinants of its biocontrol activity. Transposon mutagenesis was used to identify mutants that were deficient in fungal suppression. One of these mutants had an insertion in a homologue of depD, a structural gene in the dep operon, that encodes a protein involved in non-ribosomal peptide synthesis. In the second mutant, the insertion was in a homologue of the luxI gene, which encodes a homoserine lactone synthase. The luxI - and depD - mutants had no antifungal activity in vitro and a dramatically reduced capacity to suppress various plant diseases in planta. Antifungal production and biocontrol were restored by complementation of the luxI - mutant. Other phenotypes associated with effective biological control, including motility and lytic enzyme secretion, were also affected by the luxI mutation. Biochemical analysis of ethyl acetate extracts of culture filtrates of the mutant and wild-type strains showed that a key antifungal compound, chromobactomycin, was produced by wild-type C61 and the complemented luxI - mutant, but not by the luxI - or depD - mutant. These data suggest that multiple biocontrol-related phenotypes are regulated by homoserine lactones in C61. Thus, quorum sensing plays an essential role in the biological control potential of diverse bacterial lineages. © 2016 BSPP and John Wiley & Sons Ltd.

  11. PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying.

    PubMed

    Meelkop, Ellen; Temmerman, Liesbet; Janssen, Tom; Suetens, Nick; Beets, Isabel; Van Rompay, Liesbeth; Shanmugam, Nilesh; Husson, Steven J; Schoofs, Liliane

    2012-09-25

    In Caenorhabditis elegans, pdfr-1 encodes three receptors of the secretin receptor family. These G protein-coupled receptors are activated by three neuropeptides, pigment dispersing factors 1a, 1b and 2, which are encoded by pdf-1 and pdf-2. We isolated a PDF receptor loss-of-function allele (lst34) by means of a mutagenesis screen and show that the PDF signaling system is involved in locomotion and egg-laying. We demonstrate that the pdfr-1 mutant phenocopies the defective locomotor behavior of the pdf-1 mutant and that pdf-1 and pdf-2 behave antagonistically. All three PDF receptor splice variants are involved in the regulation of locomotor behavior. Cell specific rescue experiments show that this pdf mediated behavior is regulated by neurons rather than body wall muscles. We also show that egg-laying patterns of pdf-1 and pdf-2 mutants are affected, but not those of pdfr-1 mutants, pointing to a novel role for the PDF-system in the regulation of egg-laying. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  12. SGR2, a Phospholipase-Like Protein, and ZIG/SGR4, a SNARE, Are Involved in the Shoot Gravitropism of Arabidopsis

    PubMed Central

    Kato, Takehide; Morita, Miyo Terao; Fukaki, Hidehiro; Yamauchi, Yoshiro; Uehara, Michiko; Niihama, Mitsuru; Tasaka, Masao

    2002-01-01

    In higher plants, the shoot and the root generally show negative and positive gravitropism, respectively. To elucidate the molecular mechanisms involved in gravitropism, we have isolated many shoot gravitropism mutants in Arabidopsis. The sgr2 and zig/sgr4 mutants exhibited abnormal gravitropism in both inflorescence stems and hypocotyls. These genes probably are involved in the early step(s) of the gravitropic response. The sgr2 mutants also had misshapen seed and seedlings, whereas the stem of the zig/sgr4 mutants elongated in a zigzag fashion. The SGR2 gene encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid–preferring phospholipase A1 containing a putative transmembrane domain. This gene family has been reported only in eukaryotes. The ZIG gene was found to encode AtVTI11, a protein that is homologous with yeast VTI1 and is involved in vesicle transport. Our observations suggest that the two genes may be involved in a vacuolar membrane system that affects shoot gravitropism. PMID:11826297

  13. Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

    PubMed

    Adewoye, L O; Worobec, E A

    2000-08-08

    The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

  14. Use of bioluminescence mutant screening for identification of Edwardsiella ictaluri genes involved in channel catfish (Ictalurus punctatus) skin colonization.

    PubMed

    Menanteau-Ledouble, Simon; Lawrence, Mark L

    2013-03-23

    Initial invasion of the host is the first and vital part of any infection process. We have demonstrated that Edwardsiella ictaluri is capable of colonizing and penetrating catfish skin. Therefore, a mutant library was constructed by random insertion of the Mar2xT7 transposon into the chromosome of E. ictaluri harboring the bioluminescence plasmid pAKgfplux1. This library was then screened through a series of three consecutive challenges for mutants showing a decreased ability to colonize the catfish epithelium. Eighteen mutants were identified that have decreased adhesion and virulence. Mutated genes encoded one sensor protein, two transport proteins, five enzymes, two regulatory proteins, and five hypothetical proteins. Among the mutated genes, the first one identified was a gene encoding for RstA/B, which is known to play a role in regulating the expression of invasion genes in Salmonella enterica Typhimurium. Another mutant was lacking a putative ribonuclease similar to a Shigella protein that regulates the expression of adhesin. A third mutant was defective in a protein similar to a Brucella protein that was initially identified as a transporter, but actually is a member of a newly discovered adhesin family. Results from this study could enable development of a new strategy for blocking E. ictaluri invasion at the initial adherence stage. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Biodegradation of the Organic Disulfide 4,4′-Dithiodibutyric Acid by Rhodococcus spp.

    PubMed Central

    Khairy, Heba; Wübbeler, Jan Hendrik

    2015-01-01

    Four Rhodococcus spp. exhibited the ability to use 4,4′-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). PMID:26407888

  16. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women.

    PubMed

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E; Thwai, Kyaw L; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O

    2015-06-15

    The A581 G: mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased placental inflammation and decreased infant birth weight among women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) during pregnancy. Between 2009 and 2011, delivering women without human immunodeficiency virus infection were enrolled in an observational study of IPTp-SP effectiveness in Malawi. Parasites were detected by polymerase chain reaction (PCR); positive samples were sequenced to genotype the dhfr and dhps loci. The presence of K540 E: in dhps was used as a marker for the quintuple mutant. Samples from 1809 women were analyzed by PCR; 220 (12%) were positive for P. falciparum. A total of 202 specimens were genotyped at codon 581 of dhps; 17 (8.4%) harbored the sextuple mutant. The sextuple mutant was associated with higher risks of patent infection in peripheral blood (adjusted prevalence ratio [aPR], 2.76; 95% confidence interval [CI], 1.82-4.18) and placental blood (aPR 3.28; 95% CI, 1.88-5.78) and higher parasite densities. Recent SP use was not associated with increased parasite densities or placental pathology overall and among women with parasites carrying dhps A581 G: . IPTp-SP failed to inhibit parasite growth but did not exacerbate pathology among women infected with sextuple-mutant parasites. New interventions to prevent malaria during pregnancy are needed urgently. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  17. Characterization of Mutants Deficient in the l,d-Carboxypeptidase (DacB) and WalRK (VicRK) Regulon, Involved in Peptidoglycan Maturation of Streptococcus pneumoniae Serotype 2 Strain D39▿†

    PubMed Central

    Barendt, Skye M.; Sham, Lok-To; Winkler, Malcolm E.

    2011-01-01

    Peptidoglycan (PG) hydrolases play critical roles in the remodeling of bacterial cell walls during division. PG hydrolases have been studied extensively in several bacillus species, such as Escherichia coli and Bacillus subtilis, but remain relatively uncharacterized in ovococcus species, such as Streptococcus pneumoniae (pneumococcus). In this work, we identified genes that encode proteins with putative PG hydrolytic domains in the genome of S. pneumoniae strain D39. Knockout mutations in these genes were constructed, and the resulting mutants were characterized in comparison with the parent strain for growth, cell morphology, PG peptide incorporation, and in some cases, PG peptide composition. In addition, we characterized deletion mutations in nonessential genes of unknown function in the WalRKSpn two-component system regulon, which also contains the essential pcsB cell division gene. Several mutants did not show overt phenotypes, which is perhaps indicative of redundancy. In contrast, two new mutants showed distinct defects in PG biosynthesis. One mutation was in a gene designated dacB (spd_0549), which we showed encodes an l,d-carboxypeptidase involved in PG maturation. Notably, dacB mutants, similar to dacA (d,d-carboxypeptidase) mutants, exhibited defects in cell shape and septation, consistent with the idea that the availability of PG peptide precursors is important for proper PG biosynthesis. Epistasis analysis indicated that DacA functions before DacB in d-Ala removal, and immunofluorescence microscopy showed that DacA and DacB are located over the entire surface of pneumococcal cells. The other mutation was in WalRKSpn regulon gene spd_0703, which encodes a putative membrane protein that may function as a type of conserved streptococcal shape, elongation, division, and sporulation (SEDS) protein. PMID:21378199

  18. A nuclear-encoded chloroplast protein harboring a single CRM domain plays an important role in the Arabidopsis growth and stress response.

    PubMed

    Lee, Kwanuk; Lee, Hwa Jung; Kim, Dong Hyun; Jeon, Young; Pai, Hyun-Sook; Kang, Hunseung

    2014-04-16

    Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts.

  19. Export of extracellular polysaccharides modulates adherence of the Cyanobacterium synechocystis.

    PubMed

    Fisher, Michael L; Allen, Rebecca; Luo, Yingqin; Curtiss, Roy

    2013-01-01

    The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter), slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.

  20. A nuclear-encoded chloroplast protein harboring a single CRM domain plays an important role in the Arabidopsis growth and stress response

    PubMed Central

    2014-01-01

    Background Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Results Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. Conclusions These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts. PMID:24739417

  1. Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

    PubMed Central

    Kirkegaard, K; Nelsen, B

    1990-01-01

    Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

  2. Arabidopsis Brassinosteroid-Insensitive dwarf12 Mutants Are Semidominant and Defective in a Glycogen Synthase Kinase 3β-Like Kinase1

    PubMed Central

    Choe, Sunghwa; Schmitz, Robert J.; Fujioka, Shozo; Takatsuto, Suguru; Lee, Mi-Ok; Yoshida, Shigeo; Feldmann, Kenneth A.; Tax, Frans E.

    2002-01-01

    Mutants defective in the biosynthesis or signaling of brassinosteroids (BRs), plant steroid hormones, display dwarfism. Loss-of-function mutants for the gene encoding the plasma membrane-located BR receptor BRI1 are resistant to exogenous application of BRs, and characterization of this protein has contributed significantly to the understanding of BR signaling. We have isolated two new BR-insensitive mutants (dwarf12-1D and dwf12-2D) after screening Arabidopsis ethyl methanesulfonate mutant populations. dwf12 mutants displayed the characteristic morphology of previously reported BR dwarfs including short stature, short round leaves, infertility, and abnormal de-etiolation. In addition, dwf12 mutants exhibited several unique phenotypes, including severe downward curling of the leaves. Genetic analysis indicates that the two mutations are semidominant in that heterozygous plants show a semidwarf phenotype whose height is intermediate between wild-type and homozygous mutant plants. Unlike BR biosynthetic mutants, dwf12 plants were not rescued by high doses of exogenously applied BRs. Like bri1 mutants, dwf12 plants accumulated castasterone and brassinolide, 43- and 15-fold higher, respectively, providing further evidence that DWF12 is a component of the BR signaling pathway that includes BRI1. Map-based cloning of the DWF12 gene revealed that DWF12 belongs to a member of the glycogen synthase kinase 3β family. Unlike human glycogen synthase kinase 3β, DWF12 lacks the conserved serine-9 residue in the auto-inhibitory N terminus. In addition, dwf12-1D and dwf12-2D encode changes in consecutive glutamate residues in a highly conserved TREE domain. Together with previous reports that both bin2 and ucu1 mutants contain mutations in this TREE domain, this provides evidence that the TREE domain is of critical importance for proper function of DWF12/BIN2/UCU1 in BR signal transduction pathways. PMID:12428015

  3. Arabidopsis cpSRP54 regulates carotenoid accumulation in Arabidopsis and Brassica napus

    PubMed Central

    Gruber, Margaret Y.; Hannoufa, Abdelali

    2012-01-01

    An Arabidopsis thaliana mutant, cbd (carotenoid biosynthesis deficient), was recovered from a mutant population based on its yellow cotyledons, yellow-first true leaves, and stunted growth. Seven-day-old seedlings and mature seeds of this mutant had lower chlorophyll and total carotenoids than the wild type (WT). Genetic and molecular characterization revealed that cbd was a recessive mutant caused by a T-DNA insertion in the gene cpSRP54 encoding the 54kDa subunit of the chloroplast signal recognition particle. Transcript levels of most of the main carotenoid biosynthetic genes in cbd were unchanged relative to WT, but expression increased in carotenoid and abscisic acid catabolic genes. The chloroplasts of cbd also had developmental defects that contributed to decreased carotenoid and chlorophyll contents. Transcription of AtGLK1 (Golden 2-like 1), AtGLK2, and GUN4 appeared to be disrupted in the cbd mutant suggesting that the plastid-to-nucleus retrograde signal may be affected, regulating the changes in chloroplast functional and developmental states and carotenoid content flux. Transformation of A. thaliana and Brassica napus with a gDNA encoding the Arabidopsis cpSRP54 showed the utility of this gene in enhancing levels of seed carotenoids without affecting growth or seed yield. PMID:22791829

  4. Ion-beam irradiation, gene identification, and marker-assisted breeding in the development of low-cadmium rice.

    PubMed

    Ishikawa, Satoru; Ishimaru, Yasuhiro; Igura, Masato; Kuramata, Masato; Abe, Tadashi; Senoura, Takeshi; Hase, Yoshihiro; Arao, Tomohito; Nishizawa, Naoko K; Nakanishi, Hiromi

    2012-11-20

    Rice (Oryza sativa L.) grain is a major dietary source of cadmium (Cd), which is toxic to humans, but no practical technique exists to substantially reduce Cd contamination. Carbon ion-beam irradiation produced three rice mutants with <0.05 mg Cd⋅kg(-1) in the grain compared with a mean of 1.73 mg Cd⋅kg(-1) in the parent, Koshihikari. We identified the gene responsible for reduced Cd uptake and developed a strategy for marker-assisted selection of low-Cd cultivars. Sequence analysis revealed that these mutants have different mutations of the same gene (OsNRAMP5), which encodes a natural resistance-associated macrophage protein. Functional analysis revealed that the defective transporter protein encoded by the mutant osnramp5 greatly decreases Cd uptake by roots, resulting in decreased Cd in the straw and grain. In addition, we developed DNA markers to facilitate marker-assisted selection of cultivars carrying osnramp5. When grown in Cd-contaminated paddy fields, the mutants have nearly undetectable Cd in their grains and exhibit no agriculturally or economically adverse traits. Because mutants produced by ion-beam radiation are not transgenic plants, they are likely to be accepted by consumers and thus represent a practical choice for rice production worldwide.

  5. Phenotypic characterization of ten methanol oxidation (Mox) mutant classes in methylobacterium AM1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nunn, D.N.; Lidstrom, M.E.

    Twenty-five methanol oxidation mutants of the facultative methylotroph Methylobacterium strain AM1 have been characterized by complementation analysis and assigned to ten complementation groups, Mox A1,A2,A3 and B-H. We have characterized each of the mutants belonging to the ten Mox complementation groups by PMS-DCPIP dye linked methanol dehydrogenase activity, by methanol-dependent whole cell oxygen consumption, by the presence or absence of methanol dehydrogenase protein by SDS-polyacrylamide gels and Western blotting, by the absorption spectra of purified mutant methanol dehydrogenase proteins and by the presence or absence of the soluble cytochrome c proteins of Methylobacterium AM1. We propose functions for each ofmore » the genes deficient in the mutants of the ten Mox complementation groups. These functions include two linked genes that encode the methanol dehydrogenase structural protein and the soluble cytochrome c/sub L/, a gene encoding a secretion function essential for the synthesis and export of methanol dehydrogenase and cytochrome c/sub L/, three gene functions responsible for the proper association of the PQQ prosthetic group with the methanol dehydrogenase apoprotein and four positive regulatory gene functions controlling the expression of the ability to oxidize methanol. 24 refs., 5 figs., 2 tabs.« less

  6. Systematic mutagenesis of genes encoding predicted autotransported proteins of Burkholderia pseudomallei identifies factors mediating virulence in mice, net intracellular replication and a novel protein conferring serum resistance.

    PubMed

    Lazar Adler, Natalie R; Stevens, Mark P; Dean, Rachel E; Saint, Richard J; Pankhania, Depesh; Prior, Joann L; Atkins, Timothy P; Kessler, Bianca; Nithichanon, Arnone; Lertmemongkolchai, Ganjana; Galyov, Edouard E

    2015-01-01

    Burkholderia pseudomallei is the causative agent of the severe tropical disease melioidosis, which commonly presents as sepsis. The B. pseudomallei K96243 genome encodes eleven predicted autotransporters, a diverse family of secreted and outer membrane proteins often associated with virulence. In a systematic study of these autotransporters, we constructed insertion mutants in each gene predicted to encode an autotransporter and assessed them for three pathogenesis-associated phenotypes: virulence in the BALB/c intra-peritoneal mouse melioidosis model, net intracellular replication in J774.2 murine macrophage-like cells and survival in 45% (v/v) normal human serum. From the complete repertoire of eleven autotransporter mutants, we identified eight mutants which exhibited an increase in median lethal dose of 1 to 2-log10 compared to the isogenic parent strain (bcaA, boaA, boaB, bpaA, bpaC, bpaE, bpaF and bimA). Four mutants, all demonstrating attenuation for virulence, exhibited reduced net intracellular replication in J774.2 macrophage-like cells (bimA, boaB, bpaC and bpaE). A single mutant (bpaC) was identified that exhibited significantly reduced serum survival compared to wild-type. The bpaC mutant, which demonstrated attenuation for virulence and net intracellular replication, was sensitive to complement-mediated killing via the classical and/or lectin pathway. Serum resistance was rescued by in trans complementation. Subsequently, we expressed recombinant proteins of the passenger domain of four predicted autotransporters representing each of the phenotypic groups identified: those attenuated for virulence (BcaA), those attenuated for virulence and net intracellular replication (BpaE), the BpaC mutant with defects in virulence, net intracellular replication and serum resistance and those displaying wild-type phenotypes (BatA). Only BcaA and BpaE elicited a strong IFN-γ response in a restimulation assay using whole blood from seropositive donors and were recognised by seropositive human sera from the endemic area. To conclude, several predicted autotransporters contribute to B. pseudomallei virulence and BpaC may do so by conferring resistance against complement-mediated killing.

  7. Correlating levels of type III secretion and secreted proteins with fecal shedding of Escherichia coli O157:H7 in cattle.

    PubMed

    Sharma, V K; Sacco, R E; Kunkle, R A; Bearson, S M D; Palmquist, D E

    2012-04-01

    The locus of enterocyte effacement (LEE) of Escherichia coli O157:H7 (O157) encodes a type III secretion system (T3SS) for secreting LEE-encoded and non-LEE-encoded virulence proteins that promote the adherence of O157 to intestinal epithelial cells and the persistence of this food-borne human pathogen in bovine intestines. In this study, we compared hha sepB and hha mutants of O157 for LEE transcription, T3SS activity, adherence to HEp-2 cells, persistence in bovine intestines, and the ability to induce changes in the expression of proinflammatory cytokines. LEE transcription was upregulated in the hha sepB and hha mutant strains compared to that in the wild-type strain, but the secretion of virulence proteins in the hha sepB mutant was severely compromised. This reduced secretion resulted in reduced adherence of the hha sepB mutant to Hep-2 cells, correlating with a significantly shorter duration and lower magnitude of fecal shedding in feces of weaned (n = 4 per group) calves inoculated with this mutant strain. The levels of LEE transcription, T3SS activity, and adherence to HEp-2 cells were much lower in the wild-type strain than in the hha mutant, but no significant differences were observed in the duration or the magnitude of fecal shedding in calves inoculated with these strains. Examination of the rectoanal junction (RAJ) tissues from three groups of calves showed no adherent O157 bacteria and similar proinflammatory cytokine gene expression, irrespective of the inoculated strain, with the exception that interleukin-1β was upregulated in calves inoculated with the hha sepB mutant. These results indicate that the T3SS is essential for intestinal colonization and prolonged shedding, but increased secretion of virulence proteins did not enhance the duration and magnitude of fecal shedding of O157 in cattle or have any significant impact on the cytokine gene expression in RAJ tissue compared with that in small intestinal tissue from the same calves.

  8. Chromosomal insertion and excision of a 30 kb unstable genetic element is responsible for phase variation of lipopolysaccharide and other virulence determinants in Legionella pneumophila.

    PubMed

    Lüneberg, E; Mayer, B; Daryab, N; Kooistra, O; Zähringer, U; Rohde, M; Swanson, J; Frosch, M

    2001-03-01

    We recently described the phase-variable expression of a virulence-associated lipopolysaccharide (LPS) epitope in Legionella pneumophila. In this study, the molecular mechanism for phase variation was investigated. We identified a 30 kb unstable genetic element as the molecular origin for LPS phase variation. Thirty putative genes were encoded on the 30 kb sequence, organized in two putative opposite transcription units. Some of the open reading frames (ORFs) shared homologies with bacteriophage genes, suggesting that the 30 kb element was of phage origin. In the virulent wild-type strain, the 30 kb element was located on the chromosome, whereas excision from the chromosome and replication as a high-copy plasmid resulted in the mutant phenotype, which is characterized by alteration of an LPS epitope and loss of virulence. Mapping and sequencing of the insertion site in the genome revealed that the chromosomal attachment site was located in an intergenic region flanked by genes of unknown function. As phage release could not be induced by mitomycin C, it is conceivable that the 30 kb element is a non-functional phage remnant. The protein encoded by ORF T on the 30 kb plasmid could be isolated by an outer membrane preparation, indicating that the genes encoded on the 30 kb element are expressed in the mutant phenotype. Therefore, it is conceivable that the phenotypic alterations seen in the mutant depend on high-copy replication of the 30 kb element and expression of the encoded genes. Excision of the 30 kb element from the chromosome was found to occur in a RecA-independent pathway, presumably by the involvement of RecE, RecT and RusA homologues that are encoded on the 30 kb element.

  9. Edwardsiella ictaluri Encodes an Acid Activated Urease that is Required for Intracellular Replication in Channel Catfish Ictalurus punctatus Macrophages

    USDA-ARS?s Scientific Manuscript database

    Genomic analysis indicated that Edwardsiella ictaluri encodes a putative ureasepathogenicity island containing 9 open reading frames, including urea and ammonium transporters. In vitro studies with the wild-type E. ictaluri and a ureG::kan urease mutant strain indicated that E. ictaluri is significa...

  10. Induction of host defences by Rhizobium during ineffective nodulation of pea (Pisum sativum L.) carrying symbiotically defective mutations sym40 (PsEFD), sym33 (PsIPD3/PsCYCLOPS) and sym42.

    PubMed

    Ivanova, Kira A; Tsyganova, Anna V; Brewin, Nicholas J; Tikhonovich, Igor A; Tsyganov, Viktor E

    2015-11-01

    Rhizobia are able to establish a beneficial interaction with legumes by forming a new organ, called the symbiotic root nodule, which is a unique ecological niche for rhizobial nitrogen fixation. Rhizobial infection has many similarities with pathogenic infection and induction of defence responses accompanies both interactions, but defence responses are induced to a lesser extent during rhizobial infection. However, strong defence responses may result from incompatible interactions between legumes and rhizobia due to a mutation in either macro- or microsymbiont. The aim of this research was to analyse different plant defence reactions in response to Rhizobium infection for several pea (Pisum sativum) mutants that result in ineffective symbiosis. Pea mutants were examined by histochemical and immunocytochemical analyses, light, fluorescence and transmission electron microscopy and quantitative real-time PCR gene expression analysis. It was observed that mutations in pea symbiotic genes sym33 (PsIPD3/PsCYCLOPS encoding a transcriptional factor) and sym40 (PsEFD encoding a putative negative regulator of the cytokinin response) led to suberin depositions in ineffective nodules, and in the sym42 there were callose depositions in infection thread (IT) and host cell walls. The increase in deposition of unesterified pectin in IT walls was observed for mutants in the sym33 and sym42; for mutant in the sym42, unesterified pectin was also found around degrading bacteroids. In mutants in the genes sym33 and sym40, an increase in the expression level of a gene encoding peroxidase was observed. In the genes sym40 and sym42, an increase in the expression levels of genes encoding a marker of hypersensitive reaction and PR10 protein was demonstrated. Thus, a range of plant defence responses like suberisation, callose and unesterified pectin deposition as well as activation of defence genes can be triggered by different pea single mutations that cause perception of an otherwise beneficial strain of Rhizobium as a pathogen.

  11. Selection of Salmonella enterica Serovar Typhi Genes Involved during Interaction with Human Macrophages by Screening of a Transposon Mutant Library

    PubMed Central

    Sabbagh, Sébastien C.; Lepage, Christine; McClelland, Michael; Daigle, France

    2012-01-01

    The human-adapted Salmonella enterica serovar Typhi (S. Typhi) causes a systemic infection known as typhoid fever. This disease relies on the ability of the bacterium to survive within macrophages. In order to identify genes involved during interaction with macrophages, a pool of approximately 105 transposon mutants of S. Typhi was subjected to three serial passages of 24 hours through human macrophages. Mutants recovered from infected macrophages (output) were compared to the initial pool (input) and those significantly underrepresented resulted in the identification of 130 genes encoding for cell membrane components, fimbriae, flagella, regulatory processes, pathogenesis, and many genes of unknown function. Defined deletions in 28 genes or gene clusters were created and mutants were evaluated in competitive and individual infection assays for uptake and intracellular survival during interaction with human macrophages. Overall, 26 mutants had defects in the competitive assay and 14 mutants had defects in the individual assay. Twelve mutants had defects in both assays, including acrA, exbDB, flhCD, fliC, gppA, mlc, pgtE, typA, waaQGP, SPI-4, STY1867-68, and STY2346. The complementation of several mutants by expression of plasmid-borne wild-type genes or gene clusters reversed defects, confirming that the phenotypic impairments within macrophages were gene-specific. In this study, 35 novel phenotypes of either uptake or intracellular survival in macrophages were associated with Salmonella genes. Moreover, these results reveal several genes encoding molecular mechanisms not previously known to be involved in systemic infection by human-adapted typhoidal Salmonella that will need to be elucidated. PMID:22574205

  12. Maize endosperm-specific transcription factors O2 and PBF network the regulation of protein and starch synthesis

    PubMed Central

    Zhang, Zhiyong; Zheng, Xixi; Yang, Jun; Messing, Joachim; Wu, Yongrui

    2016-01-01

    The maize endosperm-specific transcription factors opaque2 (O2) and prolamine-box binding factor (PBF) regulate storage protein zein genes. We show that they also control starch synthesis. The starch content in the PbfRNAi and o2 mutants was reduced by ∼5% and 11%, respectively, compared with normal genotypes. In the double-mutant PbfRNAi;o2, starch was decreased by 25%. Transcriptome analysis reveals that >1,000 genes were affected in each of the two mutants and in the double mutant; these genes were mainly enriched in sugar and protein metabolism. Pyruvate orthophosphate dikinase 1 and 2 (PPDKs) and starch synthase III (SSIII) are critical components in the starch biosynthetic enzyme complex. The expression of PPDK1, PPDK2, and SSIII and their protein levels are further reduced in the double mutants as compared with the single mutants. When the promoters of these genes were analyzed, we found a prolamine box and an O2 box that can be additively transactivated by PBF and O2. Starch synthase IIa (SSIIa, encoding another starch synthase for amylopectin) and starch branching enzyme 1 (SBEI, encoding one of the two main starch branching enzymes) are not directly regulated by PBF and O2, but their protein levels are significantly decreased in the o2 mutant and are further decreased in the double mutant, indicating that o2 and PbfRNAi may affect the levels of some other transcription factor(s) or mRNA regulatory factor(s) that in turn would affect the transcript and protein levels of SSIIa and SBEI. These findings show that three important traits—nutritional quality, calories, and yield—are linked through the same transcription factors. PMID:27621432

  13. Extracellular deoxyribonuclease made by group A Streptococcus assists pathogenesis by enhancing evasion of the innate immune response.

    PubMed

    Sumby, Paul; Barbian, Kent D; Gardner, Donald J; Whitney, Adeline R; Welty, Diane M; Long, R Daniel; Bailey, John R; Parnell, Michael J; Hoe, Nancy P; Adams, Gerald G; Deleo, Frank R; Musser, James M

    2005-02-01

    Many pathogenic bacteria produce extracellular DNase, but the benefit of this enzymatic activity is not understood. For example, all strains of the human bacterial pathogen group A Streptococcus (GAS) produce at least one extracellular DNase, and most strains make several distinct enzymes. Despite six decades of study, it is not known whether production of DNase by GAS enhances virulence. To test the hypothesis that extracellular DNase is required for normal progression of GAS infection, we generated seven isogenic mutant strains in which the three chromosomal- and prophage-encoded DNases made by a contemporary serotype M1 GAS strain were inactivated. Compared to the wild-type parental strain, the isogenic triple-mutant strain was significantly less virulent in two mouse models of invasive infection. The triple-mutant strain was cleared from the skin injection site significantly faster than the wild-type strain. Preferential clearance of the mutant strain was related to the differential extracellular killing of the mutant and wild-type strains, possibly through degradation of neutrophil extracellular traps, innate immune structures composed of chromatin and granule proteins. The triple-mutant strain was also significantly compromised in its ability to cause experimental pharyngeal disease in cynomolgus macaques. Comparative analysis of the seven DNase mutant strains strongly suggested that the prophage-encoded SdaD2 enzyme is the major DNase that contributes to virulence in this clone. We conclude that extracellular DNase activity made by GAS contributes to disease progression, thereby resolving a long-standing question in bacterial pathogenesis research.

  14. The prrF-Encoded Small Regulatory RNAs Are Required for Iron Homeostasis and Virulence of Pseudomonas aeruginosa

    PubMed Central

    Reinhart, Alexandria A.; Powell, Daniel A.; Nguyen, Angela T.; O'Neill, Maura; Djapgne, Louise; Wilks, Angela; Ernst, Robert K.

    2014-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that requires iron to cause infection, but it also must regulate the uptake of iron to avoid iron toxicity. The iron-responsive PrrF1 and PrrF2 small regulatory RNAs (sRNAs) are part of P. aeruginosa's iron regulatory network and affect the expression of at least 50 genes encoding iron-containing proteins. The genes encoding the PrrF1 and PrrF2 sRNAs are encoded in tandem in P. aeruginosa, allowing for the expression of a distinct, heme-responsive sRNA named PrrH that appears to regulate genes involved in heme metabolism. Using a combination of growth, mass spectrometry, and gene expression analysis, we showed that the ΔprrF1,2 mutant, which lacks expression of the PrrF and PrrH sRNAs, is defective for both iron and heme homeostasis. We also identified phuS, encoding a heme binding protein involved in heme acquisition, and vreR, encoding a previously identified regulator of P. aeruginosa virulence genes, as novel targets of prrF-mediated heme regulation. Finally, we showed that the prrF locus encoding the PrrF and PrrH sRNAs is required for P. aeruginosa virulence in a murine model of acute lung infection. Moreover, we showed that inoculation with a ΔprrF1,2 deletion mutant protects against future challenge with wild-type P. aeruginosa. Combined, these data demonstrate that the prrF-encoded sRNAs are critical regulators of P. aeruginosa virulence. PMID:25510881

  15. Linking Central Metabolism with Increased Pathway Flux: l-Valine Accumulation by Corynebacterium glutamicum

    PubMed Central

    Radmacher, Eva; Vaitsikova, Adela; Burger, Udo; Krumbach, Karin; Sahm, Hermann; Eggeling, Lothar

    2002-01-01

    Mutants of Corynebacterium glutamicum were made and enzymatically characterized to clone ilvD and ilvE, which encode dihydroxy acid dehydratase and transaminase B, respectively. These genes of the branched-chain amino acid synthesis were overexpressed together with ilvBN (which encodes acetohydroxy acid synthase) and ilvC (which encodes isomeroreductase) in the wild type, which does not excrete l-valine, to result in an accumulation of this amino acid to a concentration of 42 mM. Since l-valine originates from two pyruvate molecules, this illustrates the comparatively easy accessibility of the central metabolite pyruvate. The same genes, ilvBNCD, overexpressed in an ilvA deletion mutant which is unable to synthesize l-isoleucine increased the concentration of this amino acid to 58 mM. A further dramatic increase was obtained when panBC was deleted, making the resulting mutant auxotrophic for d-pantothenate. When the resulting strain, C. glutamicum 13032ΔilvAΔpanBC with ilvBNCD overexpressed, was grown under limiting conditions it accumulated 91 mM l-valine. This is attributed to a reduced coenzyme A availability and therefore reduced flux of pyruvate via pyruvate dehydrogenase enabling its increased drain-off via the l-valine biosynthesis pathway. PMID:11976094

  16. 1,3-Propanediol dehydrogenases in Lactobacillus reuteri: impact on central metabolism and 3-hydroxypropionaldehyde production.

    PubMed

    Stevens, Marc J A; Vollenweider, Sabine; Meile, Leo; Lacroix, Christophe

    2011-08-03

    Lactobacillus reuteri metabolizes glycerol to 3-hydroxypropionaldehyde (3-HPA) and further to 1,3-propanediol (1,3-PDO), the latter step catalysed by a propanediol dehydrogenase (PDH). The last step in this pathway regenerates NAD+ and enables therefore the energetically more favourable production of acetate over ethanol during growth on glucose. A search throughout the genome of L. reuteri DSM 20016 revealed two putative PDHs encoded by ORFs lr_0030 and lr_1734. ORF lr_1734 is situated in the pdu operon encoding the glycerol conversion machinery and therefore likely involved in 1,3-PDO formation. ORF lr_0030 has not been associated with PDH-activity so far. To elucidate the role of these two PDHs, gene deletion mutant strains were constructed. Growth behaviour on glucose was comparable between the wild type and both mutant strains. However, on glucose + glycerol, the exponential growth rate of Δlr_0030 was lower compared to the wild type and the lr_1734 mutant. Furthermore, glycerol addition resulted in decreased ethanol production in the wild type and Δlr_1734, but not in Δlr_0030. PDH activity measurements using 3-HPA as a substrate revealed lower activity of Δlr_0030 extracts from exponential growing cells compared to wild type and Δlr_1734 extracts.During biotechnological 3-HPA production using non-growing cells, the ratio 3-HPA to 1,3-PDO was approximately 7 in the wild type and Δlr_0030, whereas this ratio was 12.5 in the mutant Δlr_1734. The enzyme encoded by lr_0030 plays a pivotal role in 3-HPA conversion in exponential growing L. reuteri cells. The enzyme encoded by lr_1734 is active during 3-HPA production by non-growing cells and this enzyme is a useful target to enhance 3-HPA production and minimize formation of the by-product 1,3-PDO.

  17. A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair.

    PubMed Central

    Ayyagari, R; Impellizzeri, K J; Yoder, B L; Gary, S L; Burgers, P M

    1995-01-01

    The saccharomyces cerevisiae proliferating cell nuclear antigen (PCNA), encoded by the POL30 gene, is essential for DNA replication and DNA repair processes. Twenty-one site-directed mutations were constructed in the POL30 gene, each mutation changing two adjacently located charged amino acids to alanines. Although none of the mutant strains containing these double-alanine mutations as the sole source of PCNA were temperature sensitive or cold sensitive for growth, about a third of the mutants showed sensitivity to UV light. Some of those UV-sensitive mutants had elevated spontaneous mutation rates. In addition, several mutants suppressed a cold-sensitive mutation in the CDC44 gene, which encodes the large subunit of replication factor C. A cold-sensitive mutant, which was isolated by random mutagenesis, showed a terminal phenotype at the restrictive temperature consistent with a defect in DNA replication. Several mutant PCNAs were expressed and purified from Escherichia coli, and their in vitro properties were determined. The cold-sensitive mutant (pol30-52, S115P) was a monomer, rather than a trimer, in solution. This mutant was deficient for DNA synthesis in vitro. Partial restoration of DNA polymerase delta holoenzyme activity was achieved at 37 degrees C but not at 14 degrees C by inclusion of the macromolecular crowding agent polyethylene glycol in the assay. The only other mutant (pol30-6, DD41,42AA) that showed a growth defect was partially defective for interaction with replication factor C and DNA polymerase delta but completely defective for interaction with DNA polymerase epsilon. Two other mutants sensitive to DNA damage showed no defect in vitro. These results indicate that the latter mutants are specifically impaired in one or more DNA repair processes whereas pol30-6 and pol30-52 mutants show their primary defects in the basic DNA replication machinery with probable associated defects in DNA repair. Therefore, DNA repair requires interactions between repair-specific protein(s) and PCNA, which are distinct from those required for DNA replication. PMID:7623835

  18. WhiB5, a Transcriptional Regulator That Contributes to Mycobacterium tuberculosis Virulence and Reactivation

    PubMed Central

    Casonato, Stefano; Cervantes Sánchez, Axel; Haruki, Hirohito; Rengifo González, Monica; Provvedi, Roberta; Dainese, Elisa; Jaouen, Thomas; Gola, Susanne; Bini, Estela; Vicente, Miguel; Johnsson, Kai; Ghisotti, Daniela; Palù, Giorgio; Hernández-Pando, Rogelio

    2012-01-01

    The proteins belonging to the WhiB superfamily are small global transcriptional regulators typical of actinomycetes. In this paper, we characterize the role of WhiB5, a Mycobacterium tuberculosis protein belonging to this superfamily. A null mutant was constructed in M. tuberculosis H37Rv and was shown to be attenuated during both progressive and chronic mouse infections. Mice infected with the mutant had smaller bacillary burdens in the lungs but a larger inflammatory response, suggesting a role of WhiB5 in immunomodulation. Most interestingly, the whiB5 mutant was not able to resume growth after reactivation from chronic infection, suggesting that WhiB5 controls the expression of genes involved in this process. The mutant was also more sensitive than the wild-type parental strain to S-nitrosoglutathione (GSNO) and was less metabolically active following prolonged starvation, underscoring the importance of GSNO and starvation in development and maintenance of chronic infection. DNA microarray analysis identified 58 genes whose expression is influenced by WhiB5, including sigM, encoding an alternative sigma factor, and genes encoding the constituents of two type VII secretion systems, namely, ESX-2 and ESX-4. PMID:22733573

  19. Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations.

    PubMed

    Pourahmad Jaktaji, Razieh; Jazayeri, Nasim

    2013-12-01

    The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. RESULTS showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin.

  20. The non-essential UL50 gene of avian infectious laryngotracheitis virus encodes a functional dUTPase which is not a virulence factor.

    PubMed

    Fuchs, W; Ziemann, K; Teifke, J P; Werner, O; Mettenleiter, T C

    2000-03-01

    The DNA sequence of the infectious laryngotracheitis virus (ILTV) UL50, UL51 and UL52 gene homologues was determined. Although the deduced UL50 protein lacks the first of five conserved domains of the corresponding proteins of mammalian alphaherpesviruses, the ILTV gene product was also shown to possess dUTPase activity. The generation of UL50-negative ILTV mutants was facilitated by recombination plasmids encoding green fluorescent protein (GFP), and expression constructs of predicted transactivator proteins of ILTV (alphaTIF, ICP4) were successfully used to increase the infectivity of viral genomic DNA. A GFP-expressing UL50-deletion mutant of ILTV showed reduced cell-to-cell spread in vitro, and was attenuated in vivo. A similar deletion mutant without the foreign gene, however, propagated like wild-type ILTV in cell culture and was pathogenic in chickens. We conclude that the viral dUTPase is not required for efficient replication of ILTV in the respiratory tract of infected animals. The replication defect of the GFP-expressing ILTV recombinant is most likely caused by toxic effects of the reporter gene product, since spontaneously occurring inactivation mutants exhibited wild-type-like growth.

  1. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    PubMed Central

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  2. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity.

    PubMed

    Zaragoza, O; Blazquez, M A; Gancedo, C

    1998-08-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30 degreesC was indistinguishable from that of the wild type. However, at 42 degreesC it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37 degreesC, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42 degreesC, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 10(6) CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation.

  3. Retinoic acid deficiency impairs the vestibular function.

    PubMed

    Romand, Raymond; Krezel, Wojciech; Beraneck, Mathieu; Cammas, Laura; Fraulob, Valérie; Messaddeq, Nadia; Kessler, Pascal; Hashino, Eri; Dollé, Pascal

    2013-03-27

    The retinaldehyde dehydrogenase 3 (Raldh3) gene encodes a major retinoic acid synthesizing enzyme and is highly expressed in the inner ear during embryogenesis. We found that mice deficient in Raldh3 bear severe impairment in vestibular functions. These mutant mice exhibited spontaneous circling/tilted behaviors and performed poorly in several vestibular-motor function tests. In addition, video-oculography revealed a complete loss of the maculo-ocular reflex and a significant reduction in the horizontal angular vestibulo-ocular reflex, indicating that detection of both linear acceleration and angular rotation were compromised in the mutants. Consistent with these behavioral and functional deficiencies, morphological anomalies, characterized by a smaller vestibular organ with thinner semicircular canals and a significant reduction in the number of otoconia in the saccule and the utricle, were consistently observed in the Raldh3 mutants. The loss of otoconia in the mutants may be attributed, at least in part, to significantly reduced expression of Otop1, which encodes a protein known to be involved in calcium regulation in the otolithic organs. Our data thus reveal a previously unrecognized role of Raldh3 in structural and functional development of the vestibular end organs.

  4. GOLD HULL AND INTERNODE2 encodes a primarily multifunctional cinnamyl-alcohol dehydrogenase in rice.

    PubMed

    Zhang, Kewei; Qian, Qian; Huang, Zejun; Wang, Yiqin; Li, Ming; Hong, Lilan; Zeng, Dali; Gu, Minghong; Chu, Chengcai; Cheng, Zhukuan

    2006-03-01

    Lignin content and composition are two important agronomic traits for the utilization of agricultural residues. Rice (Oryza sativa) gold hull and internode phenotype is a classical morphological marker trait that has long been applied to breeding and genetics study. In this study, we have cloned the GOLD HULL AND INTERNODE2 (GH2) gene in rice using a map-based cloning approach. The result shows that the gh2 mutant is a lignin-deficient mutant, and GH2 encodes a cinnamyl-alcohol dehydrogenase (CAD). Consistent with this finding, extracts from roots, internodes, hulls, and panicles of the gh2 plants exhibited drastically reduced CAD activity and undetectable sinapyl alcohol dehydrogenase activity. When expressed in Escherichia coli, purified recombinant GH2 was found to exhibit strong catalytic ability toward coniferaldehyde and sinapaldehyde, while the mutant protein gh2 completely lost the corresponding CAD and sinapyl alcohol dehydrogenase activities. Further phenotypic analysis of the gh2 mutant plants revealed that the p-hydroxyphenyl, guaiacyl, and sinapyl monomers were reduced in almost the same ratio compared to the wild type. Our results suggest GH2 acts as a primarily multifunctional CAD to synthesize coniferyl and sinapyl alcohol precursors in rice lignin biosynthesis.

  5. Deletion of Citrate Synthase Restores Growth of Sinorhizobium meliloti 1021 Aconitase Mutants▿

    PubMed Central

    Koziol, Uriel; Hannibal, Luciana; Rodríguez, María Cecilia; Fabiano, Elena; Kahn, Michael L.; Noya, Francisco

    2009-01-01

    The symbiotic nitrogen-fixing bacterium Sinorhizobium meliloti 1021 encodes only one predicted aconitase (AcnA) in its genome. AcnA has a significant degree of similarity with other bacterial aconitases that behave as dual proteins: enzymes and posttranscriptional regulators of gene expression. Similar to the case with these bacterial aconitases, AcnA activity was reversibly labile and was regained upon reconstitution with reduced iron. The aconitase promoter was active in root nodules. acnA mutants grew very poorly, had secondary mutations, and were quickly outgrown by pseudorevertants. The acnA gene was stably interrupted in a citrate synthase (gltA) null background, indicating that the intracellular accumulation of citrate may be deleterious for survival of strain 1021. No aconitase activity was detected in this mutant, suggesting that the acnA gene encodes the only functional aconitase of strain 1021. To uncover a function of AcnA beyond its catalytic role in the tricarboxylic acid cycle pathway, the gltA acnA double mutant was compared with the gltA single mutant for differences in motility, resistance to oxidative stress, nodulation, and growth on different substrates. However, no differences in any of these characteristics were found. PMID:19820082

  6. The Arabidopsis thaliana RNA editing factor SLO2, which affects the mitochondrial electron transport chain, participates in multiple stress and hormone responses.

    PubMed

    Zhu, Qiang; Dugardeyn, Jasper; Zhang, Chunyi; Mühlenbock, Per; Eastmond, Peter J; Valcke, Roland; De Coninck, Barbara; Oden, Sevgi; Karampelias, Michael; Cammue, Bruno P A; Prinsen, Els; Van Der Straeten, Dominique

    2014-02-01

    Recently, we reported that the novel mitochondrial RNA editing factor SLO2 is essential for mitochondrial electron transport, and vital for plant growth through regulation of carbon and energy metabolism. Here, we show that mutation in SLO2 causes hypersensitivity to ABA and insensitivity to ethylene, suggesting a link with stress responses. Indeed, slo2 mutants are hypersensitive to salt and osmotic stress during the germination stage, while adult plants show increased drought and salt tolerance. Moreover, slo2 mutants are more susceptible to Botrytis cinerea infection. An increased expression of nuclear-encoded stress-responsive genes, as well as mitochondrial-encoded NAD genes of complex I and genes of the alternative respiratory pathway, was observed in slo2 mutants, further enhanced by ABA treatment. In addition, H2O2 accumulation and altered amino acid levels were recorded in slo2 mutants. We conclude that SLO2 is required for plant sensitivity to ABA, ethylene, biotic, and abiotic stress. Although two stress-related RNA editing factors were reported very recently, this study demonstrates a unique role of SLO2, and further supports a link between mitochondrial RNA editing events and stress response.

  7. ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

    PubMed

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-25

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

  8. ngs (Notochord Granular Surface) Gene Encodes a Novel Type of Intermediate Filament Family Protein Essential for Notochord Maintenance in Zebrafish*

    PubMed Central

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-01

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861

  9. Export of Extracellular Polysaccharides Modulates Adherence of the Cyanobacterium Synechocystis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fisher, ML; Allen, R; Luo, YQ

    2013-09-10

    The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter),more » slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.« less

  10. Cloning of a methanol-inducible moxF promoter and its analysis in moxB mutants of Methylobacterium extorquens AM1rif.

    PubMed Central

    Morris, C J; Lidstrom, M E

    1992-01-01

    In Methylobacterium extorquens AM1, gene encoding methanol dehydrogenase polypeptides are transcriptionally regulated in response to C1 compounds, including methanol (M. E. Lidstrom and D. I. Stirling, Annu. Rev. Microbiol. 44:27-57, 1990). In order to study this regulation, a transcriptional fusion has been constructed between a beta-galactosidase reporter gene and a 1.55-kb XhoI-SalI fragment of M. extorquens AM1rif DNA encoding the N terminus of the methanol dehydrogenase large subunit (moxF) and 1,289 bp of upstream DNA. The fusion exhibited orientation-specific promoter activity in M. extorquens AM1rif but was expressed constitutively when the transcriptional fusion was located on the plasmid. However, correct regulation was restored when the construction was inserted in the M. extorquens AM1rif chromosome. This DNA fragment was shown to contain both the moxFJGI promoter and the sequences necessary in cis for its transcriptional regulation by methanol. Transcription from this promoter was studied in the M. extorquens AM1rif moxB mutant strains UV4rif and UV25rif, which have a pleiotropic phenotype with regard to the components of methanol oxidation. In these mutants, beta-galactosidase activity from the fusion was reduced to a level equal to that of the vector background when the fusion was present in both plasmid and chromosomal locations. Since both constitutive and methanol-inducible promoter activities were lost in the mutants, moxB appears to be required for transcription of the genes encoding the methanol dehydrogenase polypeptides. Images PMID:1624436

  11. Increasing leaf longevity and disease resistance by altering salicylic acid catabolism

    DOEpatents

    Gan, Susheng; Zhang, Kewei

    2018-01-23

    The present invention relates to a transgenic plant having an altered level of salicylic acid 3-hydroxylase ("S3H") protein, compared to that of a non-transgenic plant, where the transgenic plant displays an altered leaf senescence phenotype, relative to a non-transgenic plant. The present invention relates to a mutant plant comprising an inactivated gene encoding S3H protein, where the mutant plant displays a premature or precocious leaf senescence phenotype, relative to a non-mutant plant. The present invention also relates to methods for promoting premature or precocious leaf senescence in a plant, delaying leaf senescence in a plant, and making a mutant plant having a decreased level of S3H protein compared to that of a non-mutant plant, where the mutant plant displays a premature or precocious leaf senescence phenotype relative to a non-mutant plant. The present invention also relates to inducing or promoting pathogen resistance in plants.

  12. Friendly fire: redirecting herpes simplex virus-1 for therapeutic applications.

    PubMed

    Advani, S J; Weichselbaum, R R; Whitley, R J; Roizman, B

    2002-09-01

    Herpes simplex virus-1 (HSV-1) is a relatively large double-stranded DNA virus encoding at least 89 proteins with well characterized disease pathology. An understanding of the functions of viral proteins together with the ability to genetically engineer specific viral mutants has led to the development of attenuated HSV-1 for gene therapy. This review highlights the progress in creating attenuated genetically engineered HSV-1 mutants that are either replication competent (viral non-essential gene deleted) or replication defective (viral essential gene deleted). The choice between a replication-competent or -defective virus is based on the end-goal of the therapeutic intervention. Replication-competent HSV-1 mutants have primarily been employed as antitumor oncolytic viruses, with the lytic nature of the virus harnessed to destroy tumor cells selectively. In replacement gene therapy, replication-defective viruses have been utilized as delivery vectors. The advantages of HSV-1 vectors are that they infect quiescent and dividing cells efficiently and can encode for relatively large transgenes.

  13. Galactose transport in Kluyveromyces lactis: major role of the glucose permease Hgt1.

    PubMed

    Baruffini, Enrico; Goffrini, Paola; Donnini, Claudia; Lodi, Tiziana

    2006-12-01

    In Kluyveromyces lactis, galactose transport has been thought to be mediated by the lactose permease encoded by LAC12. In fact, a lac12 mutant unable to grow on lactose did not grow on galactose either and showed low and uninducible galactose uptake activity. The existence of other galactose transport systems, at low and at high affinity, had, however, been hypothesized on the basis of galactose uptake kinetics studies. Here we confirmed the existence of a second galactose transporter and we isolated its structural gene. It turned out to be HGT1, previously identified as encoding the high-affinity glucose carrier. Analysis of galactose transporter mutants, hgt1 and lac12, and the double mutant hgt1lac12, suggested that Hgt1 was the high-affinity and Lac12 was the low-affinity galactose transporter. HGT1 expression was strongly induced by galactose and insensitive to glucose repression. This could explain the rapid adaptation to galactose observed in K. lactis after a shift from glucose to galactose medium.

  14. SSD1, which encodes a plant-specific novel protein, controls plant elongation by regulating cell division in rice.

    PubMed

    Asano, Kenji; Miyao, Akio; Hirochika, Hirohiko; Kitano, Hidemi; Matsuoka, Makoto; Ashikari, Motoyuki

    2010-01-01

    Plant height is one of the most important traits in crop improvement. Therefore revealing the mechanism of plant elongation and controlling plant height in accordance with breeding object is important. In this study we analyzed a novel dwarf mutant, ssd1, of which phenotype is different from typical GA- or BR-related dwarf phenotype. ssd1 exhibits pleiotropic defects in elongation of various organs such as stems, roots, leaves, and flowers. ssd1 also shows abnormal cell files and shapes, which suggests defects of normal cell division in the mutant. Map-based cloning and complementation test demonstrated that the dwarf phenotype in ssd1 mutant was caused by insertion of retrotransposon in a gene, which encodes plant-specific protein with unknown biochemical function. A BLAST search revealed that SSD1-like genes exist in diverse plant species, including monocots and dicots, but not fern and moss. Our results demonstrate that SSD1 controls plant elongation by controlling cell division in higher plants.

  15. Essential role of the HMG domain in the function of yeast mitochondrial histone HM: functional complementation of HM by the nuclear nonhistone protein NHP6A.

    PubMed

    Kao, L R; Megraw, T L; Chae, C B

    1993-06-15

    The yeast mitochondrial histone protein HM is required for maintenance of the mitochondrial genome, and disruption of the gene encoding HM (HIM1/ABF2) results in formation of a respiration-deficient petite mutant phenotype. HM contains two homologous regions, which share sequence similarity with the eukaryotic nuclear nonhistone protein, HMG-1. Experiments with various deletion mutants of HM show that a single HMG domain of HM is functional and can restore respiration competency to cells that lack HM protein (him1 mutant cells). The gene encoding the putative yeast nuclear HMG-1 homolog, the NHP6A protein, can functionally complement the him1 mutation. These results suggest that the HMG domain is the basic unit for the function of HM in mitochondria and that the function of HMG-1 proteins in the nucleus and HM in the mitochondrion may be equivalent.

  16. Comparative Genomics and an Insect Model Rapidly Identify Novel Virulence Genes of Burkholderia mallei

    DTIC Science & Technology

    2008-04-01

    IID on A pril 23, 2008 jb.asm .org D ow nloaded from metabolite-producing clusters encoding nonribosomal peptide or polyketide synthetases...BMA1848) encod- ing a subunit of acetolactate synthase III. The resultant mutant was not able to grow on minimal glucose medium and, similar to what has...caused by the wild type. BMAA1204 is a 4,200-residue CDS annotated as encoding a putative polyketide synthase (PKS) in COG family 0332. PKSs are

  17. Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens

    PubMed Central

    Kumar, Ayush; Worobec, Elizabeth A.

    2005-01-01

    Serratia marcescens is an important nosocomial agent known for causing various infections in immunocompromised individuals. Resistance of this organism to a broad spectrum of antibiotics makes the treatment of infections very difficult. This study was undertaken to identify multidrug resistance efflux pumps in S. marcescens. Three mutant strains of S. marcescens were isolated in vitro by the serial passaging of a wild-type strain in culture medium supplemented with ciprofloxacin, norfloxacin, or ofloxacin. Fluoroquinolone accumulation assays were performed to detect the presence of a proton gradient-dependent efflux mechanism. Two of the mutant strains were found to be effluxing norfloxacin, ciprofloxacin, and ofloxacin, while the third was found to efflux only ofloxacin. A genomic library of S. marcescens wild-type strain UOC-67 was constructed and screened for RND pump-encoding genes by using DNA probes for two putative RND pump-encoding genes. Two different loci were identified: sdeAB, encoding an MFP and an RND pump, and sdeCDE, encoding an MFP and two different RND pumps. Northern blot analysis revealed overexpression of sdeB in two mutant strains effluxing fluoroquinolones. Analysis of the sdeAB and sdeCDE loci in Escherichia coli strain AG102MB, deficient in the RND pump (AcrB), revealed that gene products of sdeAB are responsible for the efflux of a diverse range of substrates that includes ciprofloxacin, norfloxacin, ofloxacin, chloramphenicol, sodium dodecyl sulfate, ethidium bromide, and n-hexane, while those of sdeCDE did not result in any change in susceptibilities to any of these agents. PMID:15793131

  18. Cloning, sequencing, and characterization of the SdeAB multidrug efflux pump of Serratia marcescens.

    PubMed

    Kumar, Ayush; Worobec, Elizabeth A

    2005-04-01

    Serratia marcescens is an important nosocomial agent known for causing various infections in immunocompromised individuals. Resistance of this organism to a broad spectrum of antibiotics makes the treatment of infections very difficult. This study was undertaken to identify multidrug resistance efflux pumps in S. marcescens. Three mutant strains of S. marcescens were isolated in vitro by the serial passaging of a wild-type strain in culture medium supplemented with ciprofloxacin, norfloxacin, or ofloxacin. Fluoroquinolone accumulation assays were performed to detect the presence of a proton gradient-dependent efflux mechanism. Two of the mutant strains were found to be effluxing norfloxacin, ciprofloxacin, and ofloxacin, while the third was found to efflux only ofloxacin. A genomic library of S. marcescens wild-type strain UOC-67 was constructed and screened for RND pump-encoding genes by using DNA probes for two putative RND pump-encoding genes. Two different loci were identified: sdeAB, encoding an MFP and an RND pump, and sdeCDE, encoding an MFP and two different RND pumps. Northern blot analysis revealed overexpression of sdeB in two mutant strains effluxing fluoroquinolones. Analysis of the sdeAB and sdeCDE loci in Escherichia coli strain AG102MB, deficient in the RND pump (AcrB), revealed that gene products of sdeAB are responsible for the efflux of a diverse range of substrates that includes ciprofloxacin, norfloxacin, ofloxacin, chloramphenicol, sodium dodecyl sulfate, ethidium bromide, and n-hexane, while those of sdeCDE did not result in any change in susceptibilities to any of these agents.

  19. Characterization of a chromosomally encoded 2,4-dichlorophenoxyacetic acid/alpha-ketoglutarate dioxygenase from Burkholderia sp. strain RASC.

    PubMed Central

    Suwa, Y; Wright, A D; Fukimori, F; Nummy, K A; Hausinger, R P; Holben, W E; Forney, L J

    1996-01-01

    The findings of previous studies indicate that the genes required for metabolism of the pesticide 2,4-dichlorophenoxyacetic acid (2,4-D) are typically encoded on broad-host-range plasmids. However, characterization of plasmid-cured strains of Burkholderia sp. strain RASC, as well as mutants obtained by transposon mutagenesis, suggested that the 2,4-D catabolic genes were located on the chromosome of this strain. Mutants of Burkholderia strain RASC unable to degrade 2,4-D (2,4-D- strains) were obtained by insertional inactivation with Tn5. One such mutant (d1) was shown to have Tn5 inserted in tfdARASC, which encodes 2,4-D/alpha-ketoglutarate dioxygenase. This is the first reported example of a chromosomally encoded tfdA. The tfdARASC gene was cloned from a library of wild-type Burkholderia strain RASC DNA and shown to express 2,4-D/alpha-ketoglutarate dioxygenase activity in Escherichia coli. The DNA sequence of the gene was determined and shown to be similar, although not identical, to those of isofunctional genes from other bacteria. Moreover, the gene product (TfdARASC) was purified and shown to be similar in molecular weight, amino-terminal sequence, and reaction mechanism to the canonical TfdA of Alcaligenes eutrophus JMP134. The data presented here indicate that tfdA genes can be found on the chromosome of some bacterial species and suggest that these catabolic genes are rather mobile and may be transferred by means other than conjugation. PMID:8779585

  20. The RING finger/B-box factor TAM-1 and a retinoblastoma-like protein LIN-35 modulate context-dependent gene silencing in Caenorhabditis elegans.

    PubMed

    Hsieh, J; Liu, J; Kostas, S A; Chang, C; Sternberg, P W; Fire, A

    1999-11-15

    Context-dependent gene silencing is used by many organisms to stably modulate gene activity for large chromosomal regions. We have used tandem array transgenes as a model substrate in a screen for Caenorhabditis elegans mutants that affect context-dependent gene silencing in somatic tissues. This screen yielded multiple alleles of a previously uncharacterized gene, designated tam-1 (for tandem-array-modifier). Loss-of-function mutations in tam-1 led to a dramatic reduction in the activity of numerous highly repeated transgenes. These effects were apparently context dependent, as nonrepetitive transgenes retained activity in a tam-1 mutant background. In addition to the dramatic alterations in transgene activity, tam-1 mutants showed modest alterations in expression of a subset of endogenous cellular genes. These effects include genetic interactions that place tam-1 into a group called the class B synMuv genes (for a Synthetic Multivulva phenotype); this family plays a negative role in the regulation of RAS pathway activity in C. elegans. Loss-of-function mutants in other members of the class-B synMuv family, including lin-35, which encodes a protein similar to the tumor suppressor Rb, exhibit a hypersilencing in somatic transgenes similar to that of tam-1 mutants. Molecular analysis reveals that tam-1 encodes a broadly expressed nuclear protein with RING finger and B-box motifs.

  1. A Yersinia pestis YscN ATPase mutant functions as a live attenuated vaccine against bubonic plague in mice.

    PubMed

    Bozue, Joel; Cote, Christopher K; Webster, Wendy; Bassett, Anthony; Tobery, Steven; Little, Stephen; Swietnicki, Wieslaw

    2012-07-01

    Yersinia pestis is the causative agent responsible for bubonic and pneumonic plague. The bacterium uses the pLcr plasmid-encoded type III secretion system to deliver virulence factors into host cells. Delivery requires ATP hydrolysis by the YscN ATPase encoded by the yscN gene also on pLcr. A yscN mutant was constructed in the fully virulent CO92 strain containing a nonpolar, in-frame internal deletion within the gene. We demonstrate that CO92 with a yscN mutation was not able to secrete the LcrV protein (V-Antigen) and attenuated in a subcutaneous model of plague demonstrating that the YscN ATPase was essential for virulence. However, if the yscN mutant was complemented with a functional yscN gene in trans, virulence was restored. To evaluate the mutant as a live vaccine, Swiss-Webster mice were vaccinated twice with the ΔyscN mutant at varying doses and were protected against bubonic plague in a dose-dependent manner. Antibodies to F1 capsule but not to LcrV were detected in sera from the vaccinated mice. These preliminary results suggest a proof-of-concept for an attenuated, genetically engineered, live vaccine effective against bubonic plague. Published 2012. This article is a US Government work and is in the public domain in the USA.

  2. Disruption in Candida albicans of the TPS2 gene encoding trehalose-6-phosphate phosphatase affects cell integrity and decreases infectivity.

    PubMed

    Zaragoza, Oscar; de Virgilio, Claudio; Pontón, José; Gancedo, Carlos

    2002-05-01

    The gene CaTPS2 encoding trehalose-6-phosphate (T6P) phosphatase from Candida albicans has been cloned and disrupted in this organism. The Catps2/Catps2 mutant did not accumulate trehalose but accumulated high levels of T6P. Disruption of the two copies of the CaTPS2 gene did not abolish growth even at 42 degrees C, but decreased the growth rate. In the stationary phase, the Catps2/Catps2 mutant aggregated, more than 50% of its cells became permeable to propidium iodide and a large amount of protein was found in the culture medium. Aggregation occurred only at pH values higher than 7 and was avoided by osmoprotectants; it was never observed during the exponential phase of growth. The mutant formed colonies with a smooth border on Spider medium. Mice inoculated with 1.5 x 10(6) c.f.u. of wild-type cells died after 8 days, while 80% of those inoculated with the same number of c.f.u. of the Catps2/Catps2 mutant survived for at least 1 month. Reintroduction of the wild-type CaTPS2 gene in the Catps2/Catps2 mutant abolished the phenotypes described. It is hypothesized that the accumulation of T6P interferes with the assembly of a normal cell wall.

  3. Loss of RNA-directed DNA Methylation in Maize Chromomethylase and DDM1-type Nucleosome Remodeler Mutants.

    PubMed

    Fu, Fang-Fang; Dawe, R Kelly; Gent, Jonathan I

    2018-06-08

    Plants make use of distinct types of DNA methylation characterized by their DNA methyltransferases and modes of regulation. One type, RNA-directed DNA methylation (RdDM), is guided by small interfering RNAs (siRNAs) to the edges of transposons that are close to genes, areas called mCHH islands in maize (Zea mays). Another type, chromomethylation, is guided by histone H3 lysine 9 methylation to heterochromatin across the genome. We examined DNA methylation and small RNA expression in plant tissues that were mutant for both copies of the genes encoding chromomethylases as well as mutants for both copies of the genes encoding DECREASED DNA METHYLATION1 (DDM1)-type nucleosome remodelers, which facilitate chromomethylation. Both sets of double mutants were nonviable but produced embryos and endosperm. RdDM was severely compromised in the double mutant embryos, both in terms of DNA methylation and siRNAs. Loss of 24-nt siRNA from mCHH islands was coupled with a gain of 21-, 22-, and 24-nt siRNAs in heterochromatin. These results reveal a requirement for both chromomethylation and DDM1-type nucleosome remodeling for RdDM in mCHH islands, which we hypothesize is due to dilution of RdDM components across the genome when heterochromatin is compromised. © 2018 American Society of Plant Biologists. All rights reserved.

  4. Analysis of isoniazid-resistant transposon mutants of Mycobacterium smegmatis.

    PubMed

    Billman-Jacobe, H; Sloan, J; Coppel, R L

    1996-10-15

    The emergence of multidrug-resistant tuberculosis has renewed interest in the study of drug resistance in mycobacteria with the objective of improved chemotherapy. The genetic basis of isoniazid resistance in a model mycobacterium was studied. Eleven isoniazid-resistant mutants of Mycobacterium smegmatis were created using transposon mutagenesis. Genetic and enzymatic characterisation of the mutants showed that katG, encoding T-catalase, was inactivated. The nucleotide sequence of M. smegmatis katG was determined and the mutation sites mapped demonstrating that both the amino and carboxyl halves of T-catalase are important for enzymatic activity.

  5. Three alpha-subunits of heterotrimeric G proteins and an adenylyl cyclase have distinct roles in fruiting body development in the homothallic fungus Sordaria macrospora.

    PubMed

    Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

    2008-09-01

    Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different alpha-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Deltagsa1, Deltagsa2, and Deltagsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Galpha-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Deltagsa1Deltagsa2 and Deltagsa1Deltagsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Galpha-subunits, two recently generated Deltapre strains were crossed with all Deltagsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three DeltagsaDeltasac1 double mutants and one Deltagsa2Deltagsa3Deltasac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1-GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Galpha-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora.

  6. An integrated "omics" approach to the characterization of maize (Zea mays L.) mutants deficient in the expression of two genes encoding cytosolic glutamine synthetase.

    PubMed

    Amiour, Nardjis; Imbaud, Sandrine; Clément, Gilles; Agier, Nicolas; Zivy, Michel; Valot, Benoît; Balliau, Thierry; Quilleré, Isabelle; Tercé-Laforgue, Thérèse; Dargel-Graffin, Céline; Hirel, Bertrand

    2014-11-20

    To identify the key elements controlling grain production in maize, it is essential to have an integrated view of the responses to alterations in the main steps of nitrogen assimilation by modification of gene expression. Two maize mutant lines (gln1.3 and gln1.4), deficient in two genes encoding cytosolic glutamine synthetase, a key enzyme involved in nitrogen assimilation, were previously characterized by a reduction of kernel size in the gln1.4 mutant and by a reduction of kernel number in the gln1.3 mutant. In this work, the differences in leaf gene transcripts, proteins and metabolite accumulation in gln1.3 and gln1.4 mutants were studied at two key stages of plant development, in order to identify putative candidate genes, proteins and metabolic pathways contributing on one hand to the control of plant development and on the other to grain production. The most interesting finding in this study is that a number of key plant processes were altered in the gln1.3 and gln1.4 mutants, including a number of major biological processes such as carbon metabolism and transport, cell wall metabolism, and several metabolic pathways and stress responsive and regulatory elements. We also found that the two mutants share common or specific characteristics across at least two or even three of the "omics" considered at the vegetative stage of plant development, or during the grain filling period. This is the first comprehensive molecular and physiological characterization of two cytosolic glutamine synthetase maize mutants using a combined transcriptomic, proteomic and metabolomic approach. We find that the integration of the three "omics" procedures is not straight forward, since developmental and mutant-specific levels of regulation seem to occur from gene expression to metabolite accumulation. However, their potential use is discussed with a view to improving our understanding of nitrogen assimilation and partitioning and its impact on grain production.

  7. A mutation affecting carbon catabolite repression suppresses growth defects in pyruvate carboxylase mutants from Saccharomyces cerevisiae.

    PubMed

    Blázquez, M A; Gamo, F J; Gancedo, C

    1995-12-18

    Yeasts with disruptions in the genes PYC1 and PYC2 encoding the isoenzymes of pyruvate carboxylase cannot grow in a glucose-ammonium medium (Stucka et al. (1991) Mol. Gen. Genet. 229, 307-315). We have isolated a dominant mutation, BPC1-1, that allows growth in this medium of yeasts with interrupted PYC1 and PYC2 genes. The BPC1-1 mutation abolishes catabolite repression of a series of genes and allows expression of the enzymes of the glyoxylate cycle during growth in glucose. A functional glyoxylate cycle is necessary for suppression as a disruption of gene ICL1 encoding isocitrate lyase abolished the phenotypic effect of BPC1-1 on growth in glucose-ammonium. Concurrent expression from constitutive promoters of genes ICL1 and MLS1 (encoding malate synthase) also suppressed the growth phenotype of pyc1 pyc2 mutants. The mutation BPC1-1 is either allelic or closely linked to the mutation DGT1-1.

  8. Outer membrane defect and stronger biofilm formation caused by inactivation of a gene encoding for heptosyltransferase I in Cronobacter sakazakii ATCC BAA-894.

    PubMed

    Wang, L; Hu, X; Tao, G; Wang, X

    2012-05-01

    To investigate the role of lipopolysaccharide (LPS) structure in the stability of outer membrane and the ability of biofilm formation in Cronobacter sakazakii. A C. sakazakii mutant strain LWW02 was constructed by inactivating the gene ESA_04107 encoding for heptosyltransferase I. LPS were purified from LWW02, and changes in their structure were confirmed by thin-layer chromatography and electrospray ionization mass spectrometry. Comparing with the wild-type strain BAA-894, slower growth, higher membrane permeability, higher surface hydrophobicity, stronger ability of autoaggregation and biofilm formation were observed for the mutant strain LWW02. The gene ESA_04107 encodes heptosyltransferase I in C. sakazakii ATCC BAA-894. The cleavage of LPS in C. sakazakii could cause its outer membrane defects and increase its ability to form biofilms. The study is important for understanding the pathogenic mechanism and efficient control of C. sakazakii. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  9. Agonists and Antagonists of Protease-Activated Receptor 2 Discovered within a DNA-Encoded Chemical Library Using Mutational Stabilization of the Target.

    PubMed

    Brown, Dean G; Brown, Giles A; Centrella, Paolo; Certel, Kaan; Cooke, Robert M; Cuozzo, John W; Dekker, Niek; Dumelin, Christoph E; Ferguson, Andrew; Fiez-Vandal, Cédric; Geschwindner, Stefan; Guié, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Schlenker, Oliver; Sigel, Eric A; Snijder, Arjan; Soutter, Holly T; Sundström, Linda; Troast, Dawn M; Wiggin, Giselle; Zhang, Jing; Zhang, Ying; Clark, Matthew A

    2018-06-01

    The discovery of ligands via affinity-mediated selection of DNA-encoded chemical libraries is driven by the quality and concentration of the protein target. G-protein-coupled receptors (GPCRs) and other membrane-bound targets can be difficult to isolate in their functional state and at high concentrations, and therefore have been challenging for affinity-mediated selection. Here, we report a successful selection campaign against protease-activated receptor 2 (PAR2). Using a thermo-stabilized mutant of PAR2, we conducted affinity selection using our >100-billion-compound DNA-encoded library. We observed a number of putative ligands enriched upon selection, and subsequent cellular profiling revealed these ligands to comprise both agonists and antagonists. The agonist series shared structural similarity with known agonists. The antagonists were shown to bind in a novel allosteric binding site on the PAR2 protein. This report serves to demonstrate that cell-free affinity selection against GPCRs can be achieved with mutant stabilized protein targets.

  10. Involvement of Clostridium botulinum ATCC 3502 Sigma Factor K in Early-Stage Sporulation

    PubMed Central

    Kirk, David G.; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu

    2012-01-01

    A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σK is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods. PMID:22544236

  11. Involvement of Clostridium botulinum ATCC 3502 sigma factor K in early-stage sporulation.

    PubMed

    Kirk, David G; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu; Lindström, Miia

    2012-07-01

    A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σ(K) is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods.

  12. Filamentous invasive growth of mutants of the genes encoding ammonia-metabolizing enzymes in the fission yeast Schizosaccharomyces pombe.

    PubMed

    Sasaki, Yoshie; Kojima, Ayumi; Shibata, Yuriko; Mitsuzawa, Hiroshi

    2017-01-01

    The fission yeast Schizosaccharomyces pombe undergoes a switch from yeast to filamentous invasive growth in response to certain environmental stimuli. Among them is ammonium limitation. Amt1, one of the three ammonium transporters in this yeast, is required for the ammonium limitation-induced morphological transition; however, the underlying molecular mechanism remains to be understood. Cells lacking Amt1 became capable of invasive growth upon increasing concentrations of ammonium in the medium, suggesting that the ammonium taken up into the cell or a metabolic intermediate in ammonium assimilation might serve as a signal for the ammonium limitation-induced morphological transition. To investigate the possible role of ammonium-metabolizing enzymes in the signaling process, deletion mutants were constructed for the gdh1, gdh2, gln1, and glt1 genes, which were demonstrated by enzyme assays to encode NADP-specific glutamate dehydrogenase, NAD-specific glutamate dehydrogenase, glutamine synthetase, and glutamate synthase, respectively. Growth tests on various nitrogen sources revealed that a gln1Δ mutant was a glutamine auxotroph and that a gdh1Δ mutant had a defect in growth on ammonium, particularly at high concentrations. The latter observation indicates that the NADP-specific glutamate dehydrogenase of S. pombe plays a major role in ammonium assimilation under high ammonium concentrations. Invasive growth assays showed that gdh1Δ and glt1Δ mutants underwent invasive growth to a lesser extent than did wild-type strains. Increasing the ammonium concentration in the medium suppressed the invasive growth defect of the glt1Δ mutant, but not the gdh1Δ mutant. These results suggest that the nitrogen status of the cell is important in the induction of filamentous invasive growth in S. pombe.

  13. Characterization of Haemophilus ducreyi cdtA, cdtB, and cdtC Mutants in In Vitro and In Vivo Systems

    PubMed Central

    Lewis, David A.; Stevens, Marla K.; Latimer, Jo L.; Ward, Christine K.; Deng, Kaiping; Blick, Robert; Lumbley, Sheryl R.; Ison, Catherine A.; Hansen, Eric J.

    2001-01-01

    Haemophilus ducreyi expresses a soluble cytolethal distending toxin (CDT) that is encoded by the cdtABC gene cluster and can be detected in culture supernatant fluid by its ability to kill HeLa cells. The cdtA, cdtB, and cdtC genes of H. ducreyi were cloned independently into plasmid vectors, and their encoded proteins expressed singly or in various combinations in an Escherichia coli background. All three gene products had to be expressed in order for E. coli-derived culture supernatant fluids to demonstrate cytotoxicity for HeLa cells. Isogenic H. ducreyi cdtA and cdtB mutants were constructed and used in combination with the wild-type parent strain and a previously described H. ducreyi cdtC mutant (M. K. Stevens, J. L. Latimer, S. R. Lumbley, C. K. Ward, L. D. Cope, T. Lagergard, and E. J. Hansen, Infect. Immun. 67:3900–3908, 1999) to determine the relative contributions of the CdtA, CdtB, and CdtC proteins to CDT activity. Expression of CdtA, CdtB, and CdtC appeared necessary for H. ducreyi-derived culture supernatant fluid to exhibit cytotoxicity for HeLa cells. Whole-cell sonicates and periplasmic extracts from the cdtB and cdtC mutants had no effect on HeLa cells, whereas these same fractions from a cdtA mutant had a very modest cytotoxic effect on these same human cells. CdtA appeared to be primarily associated with the H. ducreyi cell envelope, whereas both CdtB and CdtC were present primarily in the soluble fraction from sonicated cells. Both the cdtA mutant and the cdtB mutant were found to be fully virulent in the temperature-dependent rabbit model for experimental chancroid. PMID:11500438

  14. MIB-1 Is Required for Spermatogenesis and Facilitates LIN-12 and GLP-1 Activity in Caenorhabditis elegans.

    PubMed

    Ratliff, Miriam; Hill-Harfe, Katherine L; Gleason, Elizabeth J; Ling, Huiping; Kroft, Tim L; L'Hernault, Steven W

    2018-05-01

    Covalent attachment of ubiquitin to substrate proteins changes their function or marks them for proteolysis, and the specificity of ubiquitin attachment is mediated by the numerous E3 ligases encoded by animals. Mind Bomb is an essential E3 ligase during Notch pathway signaling in insects and vertebrates. While Caenorhabditis elegans encodes a Mind Bomb homolog ( mib-1 ), it has never been recovered in the extensive Notch suppressor/enhancer screens that have identified numerous pathway components. Here, we show that C. elegans mib-1 null mutants have a spermatogenesis-defective phenotype that results in a heterogeneous mixture of arrested spermatocytes, defective spermatids, and motility-impaired spermatozoa. mib-1 mutants also have chromosome segregation defects during meiosis, molecular null mutants are intrinsically temperature-sensitive, and many mib-1 spermatids contain large amounts of tubulin. These phenotypic features are similar to the endogenous RNA intereference (RNAi) mutants, but mib-1 mutants do not affect RNAi. MIB-1 protein is expressed throughout the germ line with peak expression in spermatocytes followed by segregation into the residual body during spermatid formation. C. elegans mib-1 expression, while upregulated during spermatogenesis, also occurs somatically, including in vulva precursor cells. Here, we show that mib-1 mutants suppress both lin-12 and glp-1 ( C. elegans Notch) gain-of-function mutants, restoring anchor cell formation and a functional vulva to the former and partly restoring oocyte production to the latter. However, suppressed hermaphrodites are only observed when grown at 25°, and they are self-sterile. This probably explains why mib-1 was not previously recovered as a Notch pathway component in suppressor/enhancer selection experiments. Copyright © 2018 by the Genetics Society of America.

  15. Msh1p counteracts oxidative lesion-induced instability of mtDNA and stimulates mitochondrial recombination in Saccharomyces cerevisiae.

    PubMed

    Kaniak, Aneta; Dzierzbicki, Piotr; Rogowska, Agata T; Malc, Ewa; Fikus, Marta; Ciesla, Zygmunt

    2009-03-01

    The proximity of the mitochondrial genome to the respiratory chain, a major source of ROS (radical oxygen species), makes mtDNA more vulnerable to oxidative damage than nuclear DNA. Mitochondrial BER (base excision repair) is generally considered to be the main pathway involved in the prevention of oxidative lesion-induced mutations in mtDNA. However, we previously demonstrated that the increased frequency of mitochondrial Oli(r) mutants in an ogg1Delta strain, lacking the activity of a crucial mtBER glycosylase, is reduced in the presence of plasmids encoding Msh1p, the mitochondrial homologue of the bacterial mismatch protein MutS. This finding suggested that Msh1p might be involved in the prevention of mitochondrial mutagenesis induced by oxidative stress. Here we show that a double mutant carrying the msh1-R813W allele, encoding a variant of the protein defective in the ATP hydrolysis activity, combined with deletion of SOD2, encoding the mitochondrial superoxide dismutase, displays a synergistic effect on the frequency of Oli(r) mutants, indicating that Msh1p prevents generation of oxidative lesion-induced mitochondrial mutations. We also show that double mutants carrying the msh1-R813W allele, combined with deletion of either OGG1 or APN1, the latter resulting in deficiency of the Apn1 endonuclease, exhibit a synergistic effect on the frequency of respiration-defective mutants having gross rearrangements of the mitochondrial genome. This suggests that Msh1p, Ogg1p and Apn1p play overlapping functions in maintaining the stability of mtDNA. In addition, we demonstrate, using a novel ARG8(m) recombination assay, that a surplus of Msh1p results in enhanced mitochondrial recombination. Interestingly, the mutant forms of the protein, msh1p-R813W and msh1p-G776D, fail to stimulate recombination. We postulate that the Msh1p-enhanced homologous recombination may play an important role in the prevention of oxidative lesion-induced rearrangements of the mitochondrial genome.

  16. Bcl-2 Blocks a Caspase-Dependent Pathway of Apoptosis Activated by Herpes Simplex Virus 1 Infection in HEp-2 Cells

    PubMed Central

    Galvan, Veronica; Brandimarti, Renato; Munger, Joshua; Roizman, Bernard

    2000-01-01

    Earlier reports have shown that herpes simplex virus 1 (HSV-1) mutants induce programmed cell death and that wild-type virus blocks the execution of the cell death program triggered by expression of viral genes, by the Fas and tumor necrosis factor pathways, or by nonspecific stress agents. In particular, an earlier report from this laboratory showed that the mutant virus d120 lacking the genes encoding infected cell protein 4 (ICP4), the major regulatory protein of the virus, induces a caspase-3-independent pathway of apoptosis in human SK-N-SH cells. Here we report that the pathway of apoptosis induced by the d120 mutant in human HEp-2 cells is caspase dependent. Specifically, in HEp-2 cells infected with d120, (i) a broad-range inhibitor of caspase activity, z-vad-FMK, efficiently blocked DNA fragmentation, (ii) cytochrome c was released into the cytoplasm, (iii) caspase-3 was activated inasmuch as poly(ADP-ribose) polymerase was cleaved, and (iv) chromatin condensation and fragmentation of cellular DNA were observed. In parallel studies, HEp-2 cells were transfected with a plasmid encoding human Bcl-2 and a clone (VAX-3) expressing high levels of Bcl-2 was selected. This report shows that Bcl-2 blocked all of the manifestations associated with programmed cell death caused by infection with the d120 mutant. Consistent with their resistance to programmed cell death, VAX-3 cells overproduced infected cell protein 0 (ICP0). An unexpected observation was that ICP0 encoded by the d120 mutant accumulated late in infection in small, quasi-uniform vesicle-like structures in all cell lines tested. Immunofluorescence-based colocalization studies indicated that these structures were not mitochondria or components of the endoplasmic reticulum or the late endosomal compartment. These studies affirm the conclusion that HSV can induce programmed cell death at multiple steps in the course of its replication, that the d120 mutant can induce both caspase-dependent and -independent pathways of programmed cell death, and that virus-induced stimuli of programmed cell death may differ with respect to the pathway that they activate. PMID:10644366

  17. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    PubMed

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two enterobactin receptors probably illustrates a more general phenomenon of siderophore receptor redundancy in P. aeruginosa.

  18. Biodegradation of the organic disulfide 4,4'-dithiodibutyric acid by Rhodococcus spp.

    PubMed

    Khairy, Heba; Wübbeler, Jan Hendrik; Steinbüchel, Alexander

    2015-12-01

    Four Rhodococcus spp. exhibited the ability to use 4,4'-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. The RAS Initiative

    Cancer.gov

    NCI established the RAS Initiative to explore innovative approaches for attacking the proteins encoded by mutant forms of RAS genes and to ultimately create effective, new therapies for RAS-related cancers.

  20. Mutations in sit B and sit D genes affect manganese-growth requirements in Sinorhizobium meliloti.

    PubMed

    Platero, Raúl A; Jaureguy, Melina; Battistoni, Federico J; Fabiano, Elena R

    2003-01-21

    Two transposon-induced mutants of Sinorhizobium meliloti 242 were isolated based on their inability to grow on rich medium supplemented with the metal chelator ethylenediamine di-o-hydroxyphenylacetic acid (EDDHA) and either heme-compounds or siderophores as iron sources. Tagged loci of these mutants were identified as sit B and sit D genes. These genes encode components of an ABC (ATP-binding cassette) metal-type permease in several Gram-negative bacteria. In this work, the phenotypes of these two mutants were compared with those of two siderophore-mediated iron transport mutants. The results strongly implicate a role of the sit genes in manganese acquisition when this metal is limiting in S. meliloti.

  1. Identification and Phenotypic Characterization of ZEBRA LEAF16 Encoding a β-Hydroxyacyl-ACP Dehydratase in Rice

    PubMed Central

    Liu, Ziwen; Wang, Zhiyuan; Gu, Han; You, Jia; Hu, Manman; Zhang, Yujun; Zhu, Ze; Wang, Yihua; Liu, Shijia; Chen, Liangming; Liu, Xi; Tian, Yunlu; Zhou, Shirong; Jiang, Ling; Liu, Linglong; Wan, Jianmin

    2018-01-01

    The chloroplast is a self-independent organelle and contains its own transcription and translation systems. The establishment of genetic systems is vital for normal plant growth and development. We isolated a rice zebra leaf 16 (zl16) mutant derived from rice cultivar 9311. The zl16 mutant showed chlorotic abnormalities in the transverse sectors of the young leaves of seedlings. The use of transmission electron microscopy (TEM) demonstrated that dramatic defects occurred in variegated zl16 leaves during the early development of a chloroplast. Map-based cloning revealed that ZL16 encodes a β-hydroxyacyl-ACP dehydratase (HAD) involved in de novo fatty acid synthesis. Compared with the wild type, a missense mutation (Arg164Trp) in the zl16 mutant was identified, which significantly reduced enzymatic activity and altered the three-dimensional modeling structure of the putative protein. ZL16 was ubiquitously expressed in various plant organs, with a pronounced level in the young leaf. A subcellular localization experiment indicated that ZL16 was targeted in the chloroplast. Furthermore, we analyzed the expression of some nuclear genes involved in chloroplast development, and found they were altered in the zl16 mutant. RNA-Seq analysis indicated that some genes related to cell membrane constituents were downregulated in the mutant. An in vivo metabolic assay revealed that the total fatty acid content in the mutant was significantly decreased relative to the wild type. Our results indicate that HAD is essential for the development of chloroplasts by regulating the synthesis of fatty acids in rice. PMID:29946330

  2. Genetic Screening Identifies Cyanogenesis-Deficient Mutants of Lotus japonicus and Reveals Enzymatic Specificity in Hydroxynitrile Glucoside Metabolism[W][OA

    PubMed Central

    Takos, Adam; Lai, Daniela; Mikkelsen, Lisbeth; Abou Hachem, Maher; Shelton, Dale; Motawia, Mohammed Saddik; Olsen, Carl Erik; Wang, Trevor L.; Martin, Cathie; Rook, Fred

    2010-01-01

    Cyanogenesis, the release of hydrogen cyanide from damaged plant tissues, involves the enzymatic degradation of amino acid–derived cyanogenic glucosides (α-hydroxynitrile glucosides) by specific β-glucosidases. Release of cyanide functions as a defense mechanism against generalist herbivores. We developed a high-throughput screening method and used it to identify cyanogenesis deficient (cyd) mutants in the model legume Lotus japonicus. Mutants in both biosynthesis and catabolism of cyanogenic glucosides were isolated and classified following metabolic profiling of cyanogenic glucoside content. L. japonicus produces two cyanogenic glucosides: linamarin (derived from Val) and lotaustralin (derived from Ile). Their biosynthesis may involve the same set of enzymes for both amino acid precursors. However, in one class of mutants, accumulation of lotaustralin and linamarin was uncoupled. Catabolic mutants could be placed in two complementation groups, one of which, cyd2, encoded the β-glucosidase BGD2. Despite the identification of nine independent cyd2 alleles, no mutants involving the gene encoding a closely related β-glucosidase, BGD4, were identified. This indicated that BGD4 plays no role in cyanogenesis in L. japonicus in vivo. Biochemical analysis confirmed that BGD4 cannot hydrolyze linamarin or lotaustralin and in L. japonicus is specific for breakdown of related hydroxynitrile glucosides, such as rhodiocyanoside A. By contrast, BGD2 can hydrolyze both cyanogenic glucosides and rhodiocyanosides. Our genetic analysis demonstrated specificity in the catabolic pathways for hydroxynitrile glucosides and implied specificity in their biosynthetic pathways as well. In addition, it has provided important tools for elucidating and potentially modifying cyanogenesis pathways in plants. PMID:20453117

  3. Inactivation of Genes Encoding Subunits of the Peripheral and Membrane Arms of Neurospora Mitochondrial Complex I and Effects on Enzyme Assembly

    PubMed Central

    Duarte, M.; Sousa, R.; Videira, A.

    1995-01-01

    We have isolated and characterized the nuclear genes encoding the 12.3-kD subunit of the membrane arm and the 29.9-kD subunit of the peripheral arm of complex I from Neurospora crassa. The former gene was known to be located in linkage group I and the latter is now assigned to linkage group IV of the fungal genome. The genes were separately transformed into different N. crassa strains and transformants with duplicated DNA sequences were isolated. Selected transformants were then mated with other strains to generate repeat-induced point mutations in both copies of the genes present in the nucleus of the parental transformant. From the progeny of the crosses, we were then able to recover two individual mutants lacking the 12.3- and 29.9-kD proteins in their mitochondria, mutants nuo12.3 and nuo29.9, respectively. Several other subunits of complex I are present in the mutant organelles, although with altered stoichiometries as compared with those in the wild-type strain. Based on the analysis of Triton-solubilized mitochondrial complexes in sucrose gradients, neither mutant is able to fully assemble complex I. Our results indicate that mutant nuo12.3 separately assembles the peripheral arm and most of the membrane arm of the enzyme. Mutant nuo29.9 seems to accumulate the membrane arm of complex I and being devoid of the peripheral part. This implicates the 29.9-kD protein in an early step of complex I assembly. PMID:7768434

  4. Identification of a transporter Slr0982 involved in ethanol tolerance in cyanobacterium Synechocystis sp. PCC 6803

    PubMed Central

    Zhang, Yanan; Niu, Xiangfeng; Shi, Mengliang; Pei, Guangsheng; Zhang, Xiaoqing; Chen, Lei; Zhang, Weiwen

    2015-01-01

    Cyanobacteria have been engineered to produce ethanol through recent synthetic biology efforts. However, one major challenge to the cyanobacterial systems for high-efficiency ethanol production is their low tolerance to the ethanol toxicity. With a major goal to identify novel transporters involved in ethanol tolerance, we constructed gene knockout mutants for 58 transporter-encoding genes of Synechocystis sp. PCC 6803 and screened their tolerance change under ethanol stress. The efforts allowed discovery of a mutant of slr0982 gene encoding an ATP-binding cassette transporter which grew poorly in BG11 medium supplemented with 1.5% (v/v) ethanol when compared with the wild type, and the growth loss could be recovered by complementing slr0982 in the Δslr0982 mutant, suggesting that slr0982 is involved in ethanol tolerance in Synechocystis. To decipher the tolerance mechanism involved, a comparative metabolomic and network-based analysis of the wild type and the ethanol-sensitive Δslr0982 mutant was performed. The analysis allowed the identification of four metabolic modules related to slr0982 deletion in the Δslr0982 mutant, among which metabolites like sucrose and L-pyroglutamic acid which might be involved in ethanol tolerance, were found important for slr0982 deletion in the Δslr0982 mutant. This study reports on the first transporter related to ethanol tolerance in Synechocystis, which could be a useful target for further tolerance engineering. In addition, metabolomic and network analysis provides important findings for better understanding of the tolerance mechanism to ethanol stress in Synechocystis. PMID:26052317

  5. α2-COP is involved in early secretory traffic in Arabidopsis and is required for plant growth

    PubMed Central

    Gimeno-Ferrer, Fátima; Pastor-Cantizano, Noelia; Bernat-Silvestre, César; Selvi-Martínez, Pilar; Vera-Sirera, Francisco; Gao, Caiji; Perez-Amador, Miguel Angel; Jiang, Liwen; Aniento, Fernando

    2017-01-01

    Abstract COP (coat protein) I-coated vesicles mediate intra-Golgi transport and retrograde transport from the Golgi to the endoplasmic reticulum. These vesicles form through the action of the small GTPase ADP-ribosylation factor 1 (ARF1) and the COPI heptameric protein complex (coatomer), which consists of seven subunits (α-, β-, β′-, γ-, δ-, ε- and ζ-COP). In contrast to mammals and yeast, several isoforms for coatomer subunits, with the exception of γ and δ, have been identified in Arabidopsis. To understand the role of COPI proteins in plant biology, we have identified and characterized a loss-of-function mutant of α2-COP, an Arabidopsis α-COP isoform. The α2-cop mutant displayed defects in plant growth, including small rosettes, stems and roots and mislocalization of p24δ5, a protein of the p24 family containing a C-terminal dilysine motif involved in COPI binding. The α2-cop mutant also exhibited abnormal morphology of the Golgi apparatus. Global expression analysis of the α2-cop mutant revealed altered expression of plant cell wall-associated genes. In addition, a strong upregulation of SEC31A, which encodes a subunit of the COPII coat, was observed in the α2-cop mutant; this also occurs in a mutant of a gene upstream of COPI assembly, GNL1, which encodes an ARF-guanine nucleotide exchange factor (GEF). These findings suggest that loss of α2-COP affects the expression of secretory pathway genes. PMID:28025315

  6. Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

    PubMed Central

    MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

    2008-01-01

    C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

  7. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (p)ppGpp synthase

    PubMed Central

    Brockmann-Gretza, Olaf; Kalinowski, Jörn

    2006-01-01

    Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (p)ppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (p)ppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX) in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be responsible for the complex transcriptional patterns detected in the rel mutant when compared directly with its rel-proficient parent strain. Conclusion In C. glutamicum the stringent response enfolds a fast answer to an induced amino acid starvation on the transcriptome level. It also showed some significant differences to the transcriptional reactions occuring in Escherichia coli and Bacillus subtilis. Notable are the rel-dependent regulation of the nitrogen metabolism genes and the rel-independent regulation of the genes encoding ribosomal proteins. PMID:16961923

  8. Two-Component System RgfA/C Activates the fbsB Gene Encoding Major Fibrinogen-Binding Protein in Highly Virulent CC17 Clone Group B Streptococcus

    PubMed Central

    Safadi, Rim Al; Mereghetti, Laurent; Salloum, Mazen; Lartigue, Marie-Frédérique; Virlogeux-Payant, Isabelle; Quentin, Roland; Rosenau, Agnès

    2011-01-01

    Group B streptococcus (GBS) strains with the highest ability to bind to human fibrinogen belong to the highly invasive clonal complex (CC) 17. To investigate the fibrinogen-binding mechanisms of CC17 strains, we determined the prevalence of fibrinogen-binding genes (fbsA and fbsB), and fbs regulator genes (rogB encoding an fbsA activator, rovS encoding an fbsA repressor and rgf encoding a two-component system [TCS] whose role on fbs genes was not determined yet) in a collection of 134 strains representing the major CCs of the species. We showed that specific gene combinations were related to particular CCs; only CC17 strains contained the fbsA, fbsB, and rgf genes combination. Non polar rgfAC deletion mutants of three CC17 serotype III strains were constructed. They showed a 3.2- to 5.1-fold increase of fbsA transcripts, a 4.8- to 6.7-fold decrease of fbsB transcripts, and a 52% to 68% decreased fibrinogen-binding ability, demonstrating that the RgfA/RgfC TCS inhibits the fbsA gene and activates the fbsB gene. The relative contribution of the two fbs genes in fibrinogen-binding ability was determined by constructing isogenic fbsA, fbsB, deletion mutants of the three CC17 strains. The ability to bind to fibrinogen was reduced by 49% to 57% in ΔfbsA mutants, and by 78% to 80% in ΔfbsB mutants, suggesting that FbsB protein plays a greater role in the fibrinogen-binding ability of CC17 strains. Moreover, the relative transcription level of fbsB gene was 9.2- to 12.7-fold higher than that of fbsA gene for the three wild type strains. Fibrinogen-binding ability could be restored by plasmid-mediated expression of rgfAC, fbsA, and fbsB genes in the corresponding deletion mutants. Thus, our results demonstrate that a specific combination of fbs genes and fbs regulator genes account for the high fibrinogen-binding ability of CC17 strains that may participate to their enhanced invasiveness for neonates as compared to strains of other CCs. PMID:21326613

  9. Mitogen-activated protein kinase hog1 in the entomopathogenic fungus Beauveria bassiana regulates environmental stress responses and virulence to insects.

    PubMed

    Zhang, Yongjun; Zhao, Jianhua; Fang, Weiguo; Zhang, Jianqing; Luo, Zhibing; Zhang, Mi; Fan, Yanhua; Pei, Yan

    2009-06-01

    Beauveria bassiana is an economically important insect-pathogenic fungus which is widely used as a biocontrol agent to control a variety of insect pests. However, its insecticide efficacy in the field is often influenced by adverse environmental factors. Thus, understanding the genetic regulatory processes involved in the response to environmental stress would facilitate engineering and production of a more efficient biocontrol agent. Here, a mitogen-activated protein kinase (MAPK)-encoding gene, Bbhog1, was isolated from B. bassiana and shown to encode a functional homolog of yeast HIGH-OSMOLARITY GLYCEROL 1 (HOG1). A Bbhog1 null mutation was generated in B. bassiana by targeted gene replacement, and the resulting mutants were more sensitive to hyperosmotic stress, high temperature, and oxidative stress than the wild-type controls. These results demonstrate the conserved function of HOG1 MAPKs in the regulation of abiotic stress responses. Interestingly, DeltaBbhog1 mutants exhibited greatly reduced pathogenicity, most likely due to a decrease in spore viability, a reduced ability to attach to insect cuticle, and a reduction in appressorium formation. The transcript levels of two hydrophobin-encoding genes, hyd1 and hyd2, were dramatically decreased in a DeltaBbhog1 mutant, suggesting that Bbhog1 may regulate the expression of the gene associated with hydrophobicity or adherence.

  10. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    PubMed

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  11. A Shigella flexneri Virulence Plasmid Encoded Factor Controls Production of Outer Membrane Vesicles

    PubMed Central

    Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R.

    2014-01-01

    Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474

  12. Gain-of-function mutations in the gene encoding the tyrosine phosphatase SHP2 induce hydrocephalus in a catalytically dependent manner.

    PubMed

    Zheng, Hong; Yu, Wen-Mei; Waclaw, Ronald R; Kontaridis, Maria I; Neel, Benjamin G; Qu, Cheng-Kui

    2018-03-20

    Catalytically activating mutations in Ptpn11 , which encodes the protein tyrosine phosphatase SHP2, cause 50% of Noonan syndrome (NS) cases, whereas inactivating mutations in Ptpn11 are responsible for nearly all cases of the similar, but distinct, developmental disorder Noonan syndrome with multiple lentigines (NSML; formerly called LEOPARD syndrome). However, both types of disease mutations are gain-of-function mutations because they cause SHP2 to constitutively adopt an open conformation. We found that the catalytic activity of SHP2 was required for the pathogenic effects of gain-of-function, disease-associated mutations on the development of hydrocephalus in the mouse. Targeted pan-neuronal knockin of a Ptpn11 allele encoding the active SHP2 E76K mutant resulted in hydrocephalus due to aberrant development of ependymal cells and their cilia. These pathogenic effects of the E76K mutation were suppressed by the additional mutation C459S, which abolished the catalytic activity of SHP2. Moreover, ependymal cells in NSML mice bearing the inactive SHP2 mutant Y279C were also unaffected. Mechanistically, the SHP2 E76K mutant induced developmental defects in ependymal cells by enhancing dephosphorylation and inhibition of the transcription activator STAT3. Whereas STAT3 activity was reduced in Ptpn11 E76K/+ cells, the activities of the kinases ERK and AKT were enhanced, and neural cell-specific Stat3 knockout mice also manifested developmental defects in ependymal cells and cilia. These genetic and biochemical data demonstrate a catalytic-dependent role of SHP2 gain-of-function disease mutants in the pathogenesis of hydrocephalus. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  13. Map-based cloning and characterization of Zea mays male sterility33 (ZmMs33) gene, encoding a glycerol-3-phosphate acyltransferase.

    PubMed

    Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan

    2018-06-01

    Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.

  14. The Fusarium oxysporum gnt2, Encoding a Putative N-Acetylglucosamine Transferase, Is Involved in Cell Wall Architecture and Virulence

    PubMed Central

    López-Fernández, Loida; Ruiz-Roldán, Carmen; Pareja-Jaime, Yolanda; Prieto, Alicia; Khraiwesh, Husam; Roncero, M. Isabel G.

    2013-01-01

    With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt) in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity. PMID:24416097

  15. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    PubMed

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  16. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  17. Potential role for a B-catenin coactivator (high mobility group AT-hook 1 protein) during the latency-reactivation cycle of bovine herpesverus 1

    USDA-ARS?s Scientific Manuscript database

    The latency-related (LR)-RNA encoded by bovine herpes virus 1 (BoHV-1) is abundantly expressed in latently infected sensory neurons. Although the LR gene encodes several products, ORF2 appears to play a dominant role during the latency-reactivation cycle because a mutant virus containing stop codons...

  18. Evaluation of Hha and Hha SepB Mutant Strains of Escherichia coli O157:H7 as Bacterins for Reducing E. coli O157:H7 Shedding in Cattle

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 colonizes cattle intestines by using locus of enterocyte effacement (LEE)-encoded proteins. Induction of systemic immune response against LEE-encoded proteins, therefore, will prove effective in reducing E. coli O157:H7 colonization in cattle. Previous studies have demonstra...

  19. Initial characterization of 17 viruses harboring mutant forms of the immediate-early gene of equine herpesvirus 1.

    PubMed

    Buczynski, Kimberly A; Kim, Seong K; O'Callaghan, Dennis J

    2005-10-01

    The sole immediate-early (IE) gene of equine herpesvirus 1 (EHV-1) encodes a major regulatory protein of 1487 amino acids (aa) capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a specially designed recombination system and a library of IE linker-insertion, deletion, point, and nonsense mutant constructs that encode forms of the IE protein (IEP) harboring mutations within all five regions, 17 mutant viruses were generated and characterized. Ribonuclease protection analyses revealed that all 17 mutants synthesize the IE mRNA in RK-13 cells, whereas those that failed to replicate on non-complementing RK-13 cells displayed a defect in the transcription of either an important early gene (EICP0) and/or an essential late gene (glycoprotein D). Western blot analyses showed that the IEP was synthesized and detectable in cells infected with each mutant virus, including those mutants that failed to replicate on non-complementing RK-13 cells. Eleven of the 17 mutants were capable of growth on non-complementing RK-13 cells, whereas mutant viruses with deletions within the serine-rich tract (SRT), nucleus localization signal (NLS), or DNA-binding domain (DBD) were capable of growth only on the IEP-producing cell line (IE13.1). Lastly, temperature shift experiments revealed that mutant viruses containing deletions within the C-terminus (KyAn1029 and KyAn1411) or within the SRT (KyADeltaSRT2) of the IEP exhibited a temperature-sensitive phenotype in that these viruses, in contrast to the parent KyA, failed to replicate at 39 degrees C. Overall, these results indicate that the C-terminus of the IEP is not essential for IEP function in cell culture, but this region contains elements that enhance the function(s) of the IEP. The initial characterization of these 17 EHV-1 mutants has shown that sequences totaling at least 43% of the IEP are not essential for virus replication in cell culture.

  20. Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT).

    PubMed

    Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas

    2015-05-14

    In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.

  1. Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT)

    PubMed Central

    2015-01-01

    In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein. PMID:26005528

  2. Disruption of the CAR1 gene encoding arginase enhances freeze tolerance of the commercial baker's yeast Saccharomyces cerevisiae.

    PubMed

    Shima, Jun; Sakata-Tsuda, Yuko; Suzuki, Yasuo; Nakajima, Ryouichi; Watanabe, Hajime; Kawamoto, Shinichi; Takano, Hiroyuki

    2003-01-01

    The effect of intracellular charged amino acids on freeze tolerance in dough was determined by constructing homozygous diploid arginase-deficient mutants of commercial baker's yeast. An arginase mutant accumulated higher levels of arginine and/or glutamate and showed increased leavening ability during the frozen-dough baking process, suggesting that disruption of the CAR1 gene enhances freeze tolerance.

  3. Nucleic acid molecules conferring enhanced ethanol tolerance and microorganisms having enhanced tolerance to ethanol

    DOEpatents

    Brown, Steven; Guss, Adam; Yang, Shihui; Karpinets, Tatiana; Lynd, Lee; Shao, Xiongjun

    2014-01-14

    The present invention provides isolated nucleic acid molecules which encode a mutant acetaldehyde-CoA/alcohol dehydrogenase or mutant alcohol dehydrogenase and confer enhanced tolerance to ethanol. The invention also provides related expression vectors, genetically engineered microorganisms having enhanced tolerance to ethanol, as well as methods of making and using such genetically modified microorganisms for production of biofuels based on fermentation of biomass materials.

  4. Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.

    PubMed

    Bardin, S D; Voegele, R T; Finan, T M

    1998-08-01

    Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.

  5. Leptospiral outer membrane protein LipL41 is not essential for acute leptospirosis but requires a small chaperone protein, lep, for stable expression.

    PubMed

    King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L

    2013-08-01

    Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.

  6. The ADAR RNA editing enzyme controls neuronal excitability in Drosophila melanogaster

    PubMed Central

    Li, Xianghua; Overton, Ian M.; Baines, Richard A.; Keegan, Liam P.; O’Connell, Mary A.

    2014-01-01

    RNA editing by deamination of specific adenosine bases to inosines during pre-mRNA processing generates edited isoforms of proteins. Recoding RNA editing is more widespread in Drosophila than in vertebrates. Editing levels rise strongly at metamorphosis, and Adar5G1 null mutant flies lack editing events in hundreds of CNS transcripts; mutant flies have reduced viability, severely defective locomotion and age-dependent neurodegeneration. On the other hand, overexpressing an adult dADAR isoform with high enzymatic activity ubiquitously during larval and pupal stages is lethal. Advantage was taken of this to screen for genetic modifiers; Adar overexpression lethality is rescued by reduced dosage of the Rdl (Resistant to dieldrin), gene encoding a subunit of inhibitory GABA receptors. Reduced dosage of the Gad1 gene encoding the GABA synthetase also rescues Adar overexpression lethality. Drosophila Adar5G1 mutant phenotypes are ameliorated by feeding GABA modulators. We demonstrate that neuronal excitability is linked to dADAR expression levels in individual neurons; Adar-overexpressing larval motor neurons show reduced excitability whereas Adar5G1 null mutant or targeted Adar knockdown motor neurons exhibit increased excitability. GABA inhibitory signalling is impaired in human epileptic and autistic conditions, and vertebrate ADARs may have a relevant evolutionarily conserved control over neuronal excitability. PMID:24137011

  7. Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations

    PubMed Central

    Pourahmad Jaktaji, Razieh; Jazayeri, Nasim

    2013-01-01

    Objective(s): The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. Materials and Methods: The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. Results: Results showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. Conclusions: The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin. PMID:24570831

  8. Functional characterization of electron-transferring flavoprotein and its dehydrogenase required for fungal development and plant infection by the rice blast fungus

    PubMed Central

    Li, Ya; Zhu, Jindong; Hu, Jiexiong; Meng, Xiuli; Zhang, Qi; Zhu, Kunpeng; Chen, Xiaomin; Chen, Xuehang; Li, Guangpu; Wang, Zonghua; Lu, Guodong

    2016-01-01

    Electron-transferring flavoprotein (ETF) and its dehydrogenase (ETFDH) are highly conserved electron carriers which mainly function in mitochondrial fatty acid β oxidation. Here, we report the identification and characterization of ETF α and β subunit encoding genes (ETFA and ETFB) and ETFDH encoding gene (ETFDH) in the rice blast fungus Magnaporthe oryzae. It was demonstrated that, by impacting fatty acid metabolism, ETF and ETFDH mutations led to severe growth and conidiation defects, which could be largely rescued by exogenous acetate or carbonate. Furthermore, although conidium germination and appressorium formation appeared to be normal in ETF and ETFDH mutants, most appressoria failed to penetrate the host epidermis due to low turgor pressure. The few appressoria that succeeded in penetration were severely restricted in invasive growth and consequently failed to cause disease. Moreover, ETF mutant etfb− induced ROS accumulation in infected host cells and exogenous antioxidant GSH accelerated mutant invading growth without increasing the penetration rate. In addition, mutant etfb− displayed elevated lipid body accumulation and reduced ATP synthesis. Taken together, ETF and ETFDH play an important role in fungal development and plant infection in M. oryzae by regulation of fatty acid metabolism, turgor establishment and induction of host ROS accumulation. PMID:27113712

  9. Functional characterization of electron-transferring flavoprotein and its dehydrogenase required for fungal development and plant infection by the rice blast fungus.

    PubMed

    Li, Ya; Zhu, Jindong; Hu, Jiexiong; Meng, Xiuli; Zhang, Qi; Zhu, Kunpeng; Chen, Xiaomin; Chen, Xuehang; Li, Guangpu; Wang, Zonghua; Lu, Guodong

    2016-04-26

    Electron-transferring flavoprotein (ETF) and its dehydrogenase (ETFDH) are highly conserved electron carriers which mainly function in mitochondrial fatty acid β oxidation. Here, we report the identification and characterization of ETF α and β subunit encoding genes (ETFA and ETFB) and ETFDH encoding gene (ETFDH) in the rice blast fungus Magnaporthe oryzae. It was demonstrated that, by impacting fatty acid metabolism, ETF and ETFDH mutations led to severe growth and conidiation defects, which could be largely rescued by exogenous acetate or carbonate. Furthermore, although conidium germination and appressorium formation appeared to be normal in ETF and ETFDH mutants, most appressoria failed to penetrate the host epidermis due to low turgor pressure. The few appressoria that succeeded in penetration were severely restricted in invasive growth and consequently failed to cause disease. Moreover, ETF mutant etfb(-) induced ROS accumulation in infected host cells and exogenous antioxidant GSH accelerated mutant invading growth without increasing the penetration rate. In addition, mutant etfb(-) displayed elevated lipid body accumulation and reduced ATP synthesis. Taken together, ETF and ETFDH play an important role in fungal development and plant infection in M. oryzae by regulation of fatty acid metabolism, turgor establishment and induction of host ROS accumulation.

  10. GOLD HULL AND INTERNODE2 Encodes a Primarily Multifunctional Cinnamyl-Alcohol Dehydrogenase in Rice1

    PubMed Central

    Zhang, Kewei; Qian, Qian; Huang, Zejun; Wang, Yiqin; Li, Ming; Hong, Lilan; Zeng, Dali; Gu, Minghong; Chu, Chengcai; Cheng, Zhukuan

    2006-01-01

    Lignin content and composition are two important agronomic traits for the utilization of agricultural residues. Rice (Oryza sativa) gold hull and internode phenotype is a classical morphological marker trait that has long been applied to breeding and genetics study. In this study, we have cloned the GOLD HULL AND INTERNODE2 (GH2) gene in rice using a map-based cloning approach. The result shows that the gh2 mutant is a lignin-deficient mutant, and GH2 encodes a cinnamyl-alcohol dehydrogenase (CAD). Consistent with this finding, extracts from roots, internodes, hulls, and panicles of the gh2 plants exhibited drastically reduced CAD activity and undetectable sinapyl alcohol dehydrogenase activity. When expressed in Escherichia coli, purified recombinant GH2 was found to exhibit strong catalytic ability toward coniferaldehyde and sinapaldehyde, while the mutant protein gh2 completely lost the corresponding CAD and sinapyl alcohol dehydrogenase activities. Further phenotypic analysis of the gh2 mutant plants revealed that the p-hydroxyphenyl, guaiacyl, and sinapyl monomers were reduced in almost the same ratio compared to the wild type. Our results suggest GH2 acts as a primarily multifunctional CAD to synthesize coniferyl and sinapyl alcohol precursors in rice lignin biosynthesis. PMID:16443696

  11. Multidrug ATP-binding cassette transporters are essential for hepatic development of Plasmodium sporozoites.

    PubMed

    Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M

    2016-03-01

    Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.

  12. LitR of Vibrio salmonicida Is a Salinity-Sensitive Quorum-Sensing Regulator of Phenotypes Involved in Host Interactions and Virulence

    PubMed Central

    Bjelland, Ane Mohn; Sørum, Henning; Tegegne, Daget Ayana; Winther-Larsen, Hanne C.; Willassen, Nils Peder

    2012-01-01

    Vibrio (Aliivibrio) salmonicida is the causal agent of cold-water vibriosis, a fatal bacterial septicemia primarily of farmed salmonid fish. The molecular mechanisms of invasion, colonization, and growth of V. salmonicida in the host are still largely unknown, and few virulence factors have been identified. Quorum sensing (QS) is a cell-to-cell communication system known to regulate virulence and other activities in several bacterial species. The genome of V. salmonicida LFI1238 encodes products presumably involved in several QS systems. In this study, the gene encoding LitR, a homolog of the master regulator of QS in V. fischeri, was deleted. Compared to the parental strain, the litR mutant showed increased motility, adhesion, cell-to-cell aggregation, and biofilm formation. Furthermore, the litR mutant produced less cryptic bioluminescence, whereas production of acylhomoserine lactones was unaffected. Our results also indicate a salinity-sensitive regulation of LitR. Finally, reduced mortality was observed in Atlantic salmon infected with the litR mutant, implying that the fish were more susceptible to infection with the wild type than with the mutant strain. We hypothesize that LitR inhibits biofilm formation and favors planktonic growth, with the latter being more adapted for pathogenesis in the fish host. PMID:22371373

  13. Fork stalling and template switching as a mechanism for polyalanine tract expansion affecting the DYC mutant of HOXD13, a new murine model of synpolydactyly.

    PubMed

    Cocquempot, Olivier; Brault, Véronique; Babinet, Charles; Herault, Yann

    2009-09-01

    Polyalanine expansion diseases are proposed to result from unequal crossover of sister chromatids that increases the number of repeats. In this report we suggest an alternative mechanism we put forward while we investigated a new spontaneous mutant that we named "Dyc" for "Digit in Y and Carpe" phenotype. Phenotypic analysis revealed an abnormal limb patterning similar to that of the human inherited congenital disease synpolydactyly (SPD) and to the mouse mutant model Spdh. Both human SPD and mouse Spdh mutations affect the Hoxd13 gene within a 15-residue polyalanine-encoding repeat in the first exon of the gene, leading to a dominant negative HOXD13. Genetic analysis of the Dyc mutant revealed a trinucleotide expansion in the polyalanine-encoding region of the Hoxd13 gene resulting in a 7-alanine expansion. However, unlike the Spdh mutation, this expansion cannot result from a simple duplication of a short segment. Instead, we propose the fork stalling and template switching (FosTeS) described for generation of nonrecurrent genomic rearrangements as a possible mechanism for the Dyc polyalanine extension, as well as for other polyalanine expansions described in the literature and that could not be explained by unequal crossing over.

  14. Fork Stalling and Template Switching As a Mechanism for Polyalanine Tract Expansion Affecting the DYC Mutant of HOXD13, a New Murine Model of Synpolydactyly

    PubMed Central

    Cocquempot, Olivier; Brault, Véronique; Babinet, Charles; Herault, Yann

    2009-01-01

    Polyalanine expansion diseases are proposed to result from unequal crossover of sister chromatids that increases the number of repeats. In this report we suggest an alternative mechanism we put forward while we investigated a new spontaneous mutant that we named “Dyc” for “Digit in Y and Carpe” phenotype. Phenotypic analysis revealed an abnormal limb patterning similar to that of the human inherited congenital disease synpolydactyly (SPD) and to the mouse mutant model Spdh. Both human SPD and mouse Spdh mutations affect the Hoxd13 gene within a 15-residue polyalanine-encoding repeat in the first exon of the gene, leading to a dominant negative HOXD13. Genetic analysis of the Dyc mutant revealed a trinucleotide expansion in the polyalanine-encoding region of the Hoxd13 gene resulting in a 7-alanine expansion. However, unlike the Spdh mutation, this expansion cannot result from a simple duplication of a short segment. Instead, we propose the fork stalling and template switching (FosTeS) described for generation of nonrecurrent genomic rearrangements as a possible mechanism for the Dyc polyalanine extension, as well as for other polyalanine expansions described in the literature and that could not be explained by unequal crossing over. PMID:19546318

  15. Suppressor of gamma response 1 (SOG1) encodes a putative transcription factor governing multiple responses to DNA damage

    PubMed Central

    Yoshiyama, Kaoru; Conklin, Phillip A.; Huefner, Neil D.; Britt, Anne B.

    2009-01-01

    The Arabidopsis sog1-1 (suppressor of gamma response) mutant was originally isolated as a second-site suppressor of the radiosensitive phenotype of seeds defective in the repair endonuclease XPF. Here, we report that SOG1 encodes a putative transcription factor. This gene is a member of the NAC domain [petunia NAM (no apical meristem) and Arabidopsis ATAF1, 2 and CUC2] family (a family of proteins unique to land plants). Hundreds of genes are normally up-regulated in Arabidopsis within an hour of treatment with ionizing radiation; the induction of these genes requires the damage response protein kinase ATM, but not the related kinase ATR. Here, we find that SOG1 is also required for this transcriptional up-regulation. In contrast, the SOG1-dependent checkpoint response observed in xpf mutant seeds requires ATR, but does not require ATM. Thus, phenotype of the sog1-1 mutant mimics aspects of the phenotypes of both atr and atm mutants in Arabidopsis, suggesting that SOG1 participates in pathways governed by both of these sensor kinases. We propose that, in plants, signals related to genomic stress are processed through a single, central transcription factor, SOG1. PMID:19549833

  16. The mitochondrial cytochrome c peroxidase Ccp1 of Saccharomyces cerevisiae is involved in conveying an oxidative stress signal to the transcription factor Pos9 (Skn7).

    PubMed

    Charizanis, C; Juhnke, H; Krems, B; Entian, K D

    1999-10-01

    In Saccharomyces cerevisiae two transcription factors, Pos9 (Skn7) and Yap1, are involved in the response to oxidative stress. Fusion of the Pos9 response-regulator domain to the Gal4 DNA-binding domain results in a transcription factor which renders the expression of a GAL1-lacZ reporter gene dependent on oxidative stress. To identify genes which are involved in the oxygen-dependent activation of the Gal4-Pos9 hybrid protein we screened for mutants that failed to induce the heterologous test system upon oxidative stress (fap mutants for factors activating Pos9). We isolated several respiration-deficient and some respiration-competent mutants by this means. We selected for further characterization only those mutants which also displayed an oxidative-stress-sensitive phenotype. One of the respiration-deficient mutants (complementation groupfap6) could be complemented by the ISM1 gene, which encodes mitochondrial isoleucyl tRNA synthetase, suggesting that respiration competence was important for signalling of oxidative stress. In accordance with this notion a rho0 strain and a wild-type strain in which respiration had been blocked (by treatment with antimycin A or with cyanide) also failed to activate Gal4-Pos9 upon imposition of oxidative stress. Another mutant, fap24, which was respiration-competent, could be complemented by CCP1, which encodes the mitochondrial cytochrome c peroxidase. Mitochondrial cytochrome c peroxidase degrades reactive oxygen species within the mitochondria. This suggested a possible sensor function for the enzyme in the oxidative stress response. To test this we used the previously described point mutant ccp1 W191F, which is characterized by a 10(4)-fold decrease in electron flux between cytochrome c and cytochrome c peroxidase. The Ccp1W191F mutant was still capable of activating the Pos9 transcriptional activation domain, suggesting that the signalling function of Ccp1 is independent of electron flux rates.

  17. Gene Encoding the Hydrolase for the Product of the meta-Cleavage Reaction in Testosterone Degradation by Comamonas testosteroni

    PubMed Central

    Horinouchi, Masae; Hayashi, Toshiaki; Koshino, Hiroyuki; Yamamoto, Takako; Kudo, Toshiaki

    2003-01-01

    In a previous study we isolated the meta-cleavage enzyme gene, tesB, that encodes an enzyme that carries out a meta-cleavage reaction in the breakdown of testosterone by Comamonas testeroni TA441 (M. Horinouchi et al., Microbiology 147:3367-3375, 2001). Here we report the isolation of a gene, tesD, that encodes a hydrolase which acts on the product of the meta-cleavage reaction. We isolated tesD by using a Tn5 mutant of TA441 that showed limited growth on testosterone. TesD exhibited ca. 40% identity in amino acid sequence with BphDs, known hydrolases of biphenyl degradation in Pseudomonas spp. The TesD-disrupted mutant showed limited growth on testosterone, and the culture shows an intense yellow color. High-pressure liquid chromatography analysis of the culture of TesD-disrupted mutant incubated with testosterone detected five major intermediate compounds, one of which, showing yellow color under neutral conditions, was considered to be the product of the meta-cleavage reaction. The methylation product was analyzed and identified as methyl-4,5-9,10-diseco-3-methoxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oate, indicating that the substrate of TesD in testosterone degradation is 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oic acid. 4,5-9,10-Diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oic acid was transformed by Escherichia coli-expressed TesD. Downstream of tesD, we identified tesE, F, and G, which encode for enzymes that degrade one of the products of 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-dien-4-oic acid converted by TesD. PMID:12676694

  18. Trichome-Related Mutants Provide a New Perspective on Multicellular Trichome Initiation and Development in Cucumber (Cucumis sativus L)

    PubMed Central

    Liu, Xingwang; Bartholomew, Ezra; Cai, Yanling; Ren, Huazhong

    2016-01-01

    Trichomes are specialized epidermal cells located in aerial parts of plants that function in plant defense against biotic and abiotic stresses. The simple unicellular trichomes of Arabidopsis serve as an excellent model to study the molecular mechanism of cell differentiation and pattern formation in plants. Loss-of-function mutations in Arabidopsis thaliana have suggested that the core genes GL1 (which encodes a MYB transcription factor) and TTG1 (which encodes a WD40 repeat-containing protein) are important for the initiation and spacing of leaf trichomes, while for normal trichome initiation, the genes GL3, and EGL3 (which encode a bHLH protein) are needed. However, the positive regulatory genes involved in multicellular trichrome development in cucumber remain unclear. This review focuses on the phenotype of mutants (csgl3, tril, tbh, mict, and csgl1) with disturbed trichomes in cucumber and then infers which gene(s) play key roles in trichome initiation and development in those mutants. Evidence indicates that MICT, TBH, and CsGL1 are allelic with alternative splicing. CsGL3 and TRIL are allelic and override the effect of TBH, MICT, and CsGL1 on the regulation of multicellular trichome development; and affect trichome initiation. CsGL3, TRIL, MICT, TBH, and CsGL1 encode HD-Zip proteins with different subfamilies. Genetic and molecular analyses have revealed that CsGL3, TRIL, MICT, TBH, and CsGL1 are responsible for the differentiation of epidermal cells and the development of trichomes. Based on current knowledge, a positive regulator pathway model for trichome development in cucumber was proposed and compared to a model in Arabidopsis. These data suggest that trichome development in cucumber may differ from that in Arabidopsis. PMID:27559338

  19. Mito-Nuclear Interactions Affecting Lifespan and Neurodegeneration in a Drosophila Model of Leigh Syndrome.

    PubMed

    Loewen, Carin A; Ganetzky, Barry

    2018-04-01

    Proper mitochondrial activity depends upon proteins encoded by genes in the nuclear and mitochondrial genomes that must interact functionally and physically in a precisely coordinated manner. Consequently, mito-nuclear allelic interactions are thought to be of crucial importance on an evolutionary scale, as well as for manifestation of essential biological phenotypes, including those directly relevant to human disease. Nonetheless, detailed molecular understanding of mito-nuclear interactions is still lacking, and definitive examples of such interactions in vivo are sparse. Here we describe the characterization of a mutation in Drosophila ND23 , a nuclear gene encoding a highly conserved subunit of mitochondrial complex 1. This characterization led to the discovery of a mito-nuclear interaction that affects the ND23 mutant phenotype. ND23 mutants exhibit reduced lifespan, neurodegeneration, abnormal mitochondrial morphology, and decreased ATP levels. These phenotypes are similar to those observed in patients with Leigh syndrome, which is caused by mutations in a number of nuclear genes that encode mitochondrial proteins, including the human ortholog of ND23 A key feature of Leigh syndrome, and other mitochondrial disorders, is unexpected and unexplained phenotypic variability. We discovered that the phenotypic severity of ND23 mutations varies depending on the maternally inherited mitochondrial background. Sequence analysis of the relevant mitochondrial genomes identified several variants that are likely candidates for the phenotypic interaction with mutant ND23 , including a variant affecting a mitochondrially encoded component of complex I. Thus, our work provides an in vivo demonstration of the phenotypic importance of mito-nuclear interactions in the context of mitochondrial disease. Copyright © 2018 by the Genetics Society of America.

  20. Characterization of Escherichia coli Type 1 Pilus Mutants with Altered Binding Specificities

    PubMed Central

    Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Hamrick, Terri S.; Horton, John R.; Orndorff, Paul E.

    2001-01-01

    PCR mutagenesis and a unique enrichment scheme were used to obtain two mutants, each with a single lesion in fimH, the chromosomal gene that encodes the adhesin protein (FimH) of Escherichia coli type 1 pili. These mutants were noteworthy in part because both were altered in the normal range of cell types bound by FimH. One mutation altered an amino acid at a site previously shown to be involved in temperature-dependent binding, and the other altered an amino acid lining the predicted FimH binding pocket. PMID:11395476

  1. Developmental Loss of Photosystem II Activity and Structure in a Chloroplast-Encoded Tobacco Mutant, Lutescens-11

    PubMed Central

    Chia, Catherine P.; Duesing, John H.; Arntzen, Charles J.

    1986-01-01

    Lutescens-1, a tobacco mutant with a maternally inherited dysfunction, displayed an unusual developmental phenotype. In vivo measurement of chlorophyll fluorescence revealed deterioration in photosystem II (PSII) function as leaves expanded. Analysis of thylakoid membrane proteins by polyacrylamide gel electrophoresis indicated the physical loss of nuclear- and chloroplast-encoded polypeptides comprising the PSII core complex concomitant with loss of activity. Freeze fracture electron micrographs of mutant thylakoids showed a reduced density, compared to wild type, of the EFs particles which have been shown previously to be the structural entity containing PSII core complexes and associated pigment-proteins. The selective loss of PSII cores from thylakoids resulted in a higher ratio of antenna chlorophyll to reaction centers and an altered 77 K chlorophyll fluorescence emission spectra; these data are interpreted to indicate functional isolation of light-harvesting chlorophyll a/b complexes in the absence of PSII centers. Examination of PSII reaction centers (which were present at lower levels in mutant membranes) by monitoring the light-dependent phosphorylation of PSII polypeptides and flash-induced O2 evolution patterns demonstrated that the PSII cores which were assembled in mutant thylakoids were functionally identical to those of wild type. We conclude that the lutescens-1 mutation affected the correct stoichiometry of PSII centers, in relation to other membrane constituents, by disrupting the proper assembly and maintenance of PSII complexes in lutescens-1 thylakoid membranes. Images Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:16664990

  2. Development of a Markerless Knockout Method for Actinobacillus succinogenes

    PubMed Central

    Joshi, Rajasi V.; Schindler, Bryan D.; McPherson, Nikolas R.; Tiwari, Kanupriya

    2014-01-01

    Actinobacillus succinogenes is one of the best natural succinate-producing organisms, but it still needs engineering to further increase succinate yield and productivity. In this study, we developed a markerless knockout method for A. succinogenes using natural transformation or electroporation. The Escherichia coli isocitrate dehydrogenase gene with flanking flippase recognition target sites was used as the positive selection marker, making use of A. succinogenes's auxotrophy for glutamate to select for growth on isocitrate. The Saccharomyces cerevisiae flippase recombinase (Flp) was used to remove the selection marker, allowing its reuse. Finally, the plasmid expressing flp was cured using acridine orange. We demonstrate that at least two consecutive deletions can be introduced into the same strain using this approach, that no more than a total of 1 kb of DNA is needed on each side of the selection cassette to protect from exonuclease activity during transformation, and that no more than 200 bp of homologous DNA is needed on each side for efficient recombination. We also demonstrate that electroporation can be used as an alternative transformation method to obtain knockout mutants and that an enriched defined medium can be used for direct selection of knockout mutants on agar plates with high efficiency. Single-knockout mutants of the fumarate reductase and of the pyruvate formate lyase-encoding genes were obtained using this knockout strategy. Double-knockout mutants were also obtained by deleting the citrate lyase-, β-galactosidase-, and aconitase-encoding genes in the pyruvate formate lyase knockout mutant strain. PMID:24610845

  3. Development of a markerless knockout method for Actinobacillus succinogenes.

    PubMed

    Joshi, Rajasi V; Schindler, Bryan D; McPherson, Nikolas R; Tiwari, Kanupriya; Vieille, Claire

    2014-05-01

    Actinobacillus succinogenes is one of the best natural succinate-producing organisms, but it still needs engineering to further increase succinate yield and productivity. In this study, we developed a markerless knockout method for A. succinogenes using natural transformation or electroporation. The Escherichia coli isocitrate dehydrogenase gene with flanking flippase recognition target sites was used as the positive selection marker, making use of A. succinogenes's auxotrophy for glutamate to select for growth on isocitrate. The Saccharomyces cerevisiae flippase recombinase (Flp) was used to remove the selection marker, allowing its reuse. Finally, the plasmid expressing flp was cured using acridine orange. We demonstrate that at least two consecutive deletions can be introduced into the same strain using this approach, that no more than a total of 1 kb of DNA is needed on each side of the selection cassette to protect from exonuclease activity during transformation, and that no more than 200 bp of homologous DNA is needed on each side for efficient recombination. We also demonstrate that electroporation can be used as an alternative transformation method to obtain knockout mutants and that an enriched defined medium can be used for direct selection of knockout mutants on agar plates with high efficiency. Single-knockout mutants of the fumarate reductase and of the pyruvate formate lyase-encoding genes were obtained using this knockout strategy. Double-knockout mutants were also obtained by deleting the citrate lyase-, β-galactosidase-, and aconitase-encoding genes in the pyruvate formate lyase knockout mutant strain.

  4. Partial deficiency of isoleucine impairs root development and alters transcript levels of the genes involved in branched-chain amino acid and glucosinolate metabolism in Arabidopsis

    PubMed Central

    Liu, Dong

    2013-01-01

    Isoleucine is one of the branched-chain amino acids (BCAAs) that are essential substrates for protein synthesis in all organisms. Although the metabolic pathway for isoleucine has been well characterized in higher plants, it is not known whether it plays a specific role in plant development. In this study, an Arabidopsis mutant, lib (low isoleucine biosynthesis), that has defects in both cell proliferation and cell expansion processes during root development, was characterized. The lib mutant carries a T-DNA insertion in the last exon of the OMR1 gene that encodes a threonine deaminase/dehydratase (TD). TD catalyses the deamination and dehydration of threonine, which is the first and also the committed step in the biosynthesis of isoleucine. This T-DNA insertion results in a partial deficiency of isoleucine in lib root tissues but it does not affect its total protein content. Application of exogenous isoleucine or introduction of a wild-type OMR1 gene into the lib mutant can completely rescue the mutant phenotypes. These results reveal an important role for isoleucine in plant development. In addition, microarray analysis indicated that the partial deficiency of isoleucine in the lib mutant triggers a decrease in transcript levels of the genes encoding the major enzymes involved in the BCAA degradation pathway; the analysis also indicated that many genes involved in the biosynthesis of methionine-derived glucosinolates are up-regulated. PMID:23230023

  5. Phenotypic characterization of 10 methanol oxidation mutant classes in Methylobacterium sp. strain AM1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nunn, D.N.; Lidstrom, M.E.

    Twenty-five methanol oxidation mutants of the facultative methylotroph Methylobacterium sp. strain AM1 have been characterized by complementation analysis and assigned to 10 complementation groups, Mox A1, A2, A3, and B through H. In this study we have characterized each of the mutants belonging to the 10 Mox complementation groups for the following criteria: (i) phenazine methosulfate-dichlorophenolindophenol dye-linked methanol dehydrogenase activity; (ii) methanol-dependent whole-cell oxygen consumption; (iii) the presence or absence of methanol dehydrogenase protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting; (iv) the absorption spectra of purified mutant methanol dehydrogenase proteins; and (v) the presence or absence ofmore » the soluble cytochrome c proteins of Methylobacterium sp. strain AM1, as determined by reduced-oxidized difference spectra and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. With this information, we have proposed functions for each of the genes deficient in the mutants of the 10 Mox complementation groups. These proposed gene functions include two linked genes that encode the methanol dehydrogenase structural protein and the soluble cytochrome c/sub L/, a gene encoding a secretion function essential for the synthesis and export of methanol dehydrogenase and cytochrome c/sub L/, three gene functions responsible for the proper association of the pyrrolo-quinoline quinone prosthetic group with the methanol dehydrogenase apoprotein, and four positive regulatory gene functions controlling the expression of the ability to oxidize methanol.« less

  6. The Flagellar Hook Protein, FlgE, of Salmonella enterica Serovar Typhimurium Is Posttranscriptionally Regulated in Response to the Stage of Flagellar Assembly

    PubMed Central

    Bonifield, Heather R.; Yamaguchi, Shigeru; Hughes, Kelly T.

    2000-01-01

    We investigated the posttranscriptional regulation of flgE, a class 2 gene that encodes the hook subunit protein of the flagella. RNase protection assays demonstrated that the flgE gene was transcribed at comparable levels in numerous strains defective in known steps of flagellar assembly. However, Western analyses of these strains demonstrated substantial differences in FlgE protein levels. Although wild-type FlgE levels were observed in strains with deletions of genes encoding components of the switch complex and the flagellum-specific secretion apparatus, no protein was detected in a strain with deletions of the rod, ring, and hook-associated proteins. To determine whether FlgE levels were affected by the stage of hook–basal-body assembly, Western analysis was performed on strains with mutations at individual loci encompassed by the deletion. FlgE protein was undetectable in rod mutants, intermediate in ring mutants, and wild type in hook-associated protein mutants. The lack of negative regulation in switch complex and flagellum-specific secretion apparatus deletion mutants blocked for flagellar construction prior to rod assembly suggests that these structures play a role in the negative regulation of FlgE. Quantitative Western analyses of numerous flagellar mutants indicate that FlgE levels reflect the stage at which flagellar assembly is blocked. These data provide evidence for negative posttranscriptional regulation of FlgE in response to the stage of flagellar assembly. PMID:10869084

  7. Directed mutagenesis of the Rickettsia prowazekii pld gene encoding phospholipase D.

    PubMed

    Driskell, Lonnie O; Yu, Xue-jie; Zhang, Lihong; Liu, Yan; Popov, Vsevolod L; Walker, David H; Tucker, Aimee M; Wood, David O

    2009-08-01

    Rickettsia prowazekii, the causative agent of epidemic typhus, is an obligately intracytoplasmic bacterium, a lifestyle that imposes significant barriers to genetic manipulation. The key to understanding how this unique bacterium evades host immunity is the mutagenesis of selected genes hypothesized to be involved in virulence. The R. prowazekii pld gene, encoding a protein with phospholipase D activity, has been associated with phagosomal escape. To demonstrate the feasibility of site-directed knockout mutagenesis of rickettsial genes and to generate a nonrevertible vaccine strain, we utilized homologous recombination to generate a pld mutant of the virulent R. prowazekii strain Madrid Evir. Using linear DNA for transformation, a double-crossover event resulted in the replacement of the rickettsial wild-type gene with a partially deleted pld gene. Linear DNA was used to prevent potentially revertible single-crossover events resulting in plasmid insertion. Southern blot and PCR analyses were used to confirm the presence of the desired mutation and to demonstrate clonality. While no phenotypic differences were observed between the mutant and wild-type strains when grown in tissue culture, the pld mutant exhibited attenuated virulence in the guinea pig model. In addition, animals immunized with the mutant strain were protected against subsequent challenge with the virulent Breinl strain, suggesting that this transformant could serve as a nonrevertible, attenuated vaccine strain. This study demonstrates the feasibility of generating site-directed rickettsial gene mutants, providing a new tool for understanding rickettsial biology and furthering advances in the prevention of epidemic typhus.

  8. Contribution of lipoproteins and lipoprotein processing to endocarditis virulence in Streptococcus sanguinis.

    PubMed

    Das, Sankar; Kanamoto, Taisei; Ge, Xiuchun; Xu, Ping; Unoki, Takeshi; Munro, Cindy L; Kitten, Todd

    2009-07-01

    Streptococcus sanguinis is an important cause of infective endocarditis. Previous studies have identified lipoproteins as virulence determinants in other streptococcal species. Using a bioinformatic approach, we identified 52 putative lipoprotein genes in S. sanguinis strain SK36 as well as genes encoding the lipoprotein-processing enzymes prolipoprotein diacylglyceryl transferase (lgt) and signal peptidase II (lspA). We employed a directed signature-tagged mutagenesis approach to systematically disrupt these genes and screen each mutant for the loss of virulence in an animal model of endocarditis. All mutants were viable. In competitive index assays, mutation of a putative phosphate transporter reduced in vivo competitiveness by 14-fold but also reduced in vitro viability by more than 20-fold. Mutations in lgt, lspA, or an uncharacterized lipoprotein gene reduced competitiveness by two- to threefold in the animal model and in broth culture. Mutation of ssaB, encoding a putative metal transporter, produced a similar effect in culture but reduced in vivo competiveness by >1,000-fold. [(3)H]palmitate labeling and Western blot analysis confirmed that the lgt mutant failed to acylate lipoproteins, that the lspA mutant had a general defect in lipoprotein cleavage, and that SsaB was processed differently in both mutants. These results indicate that the loss of a single lipoprotein, SsaB, dramatically reduces endocarditis virulence, whereas the loss of most other lipoproteins or of normal lipoprotein processing has no more than a minor effect on virulence.

  9. Contribution of Lipoproteins and Lipoprotein Processing to Endocarditis Virulence in Streptococcus sanguinis▿ §

    PubMed Central

    Das, Sankar; Kanamoto, Taisei; Ge, Xiuchun; Xu, Ping; Unoki, Takeshi; Munro, Cindy L.; Kitten, Todd

    2009-01-01

    Streptococcus sanguinis is an important cause of infective endocarditis. Previous studies have identified lipoproteins as virulence determinants in other streptococcal species. Using a bioinformatic approach, we identified 52 putative lipoprotein genes in S. sanguinis strain SK36 as well as genes encoding the lipoprotein-processing enzymes prolipoprotein diacylglyceryl transferase (lgt) and signal peptidase II (lspA). We employed a directed signature-tagged mutagenesis approach to systematically disrupt these genes and screen each mutant for the loss of virulence in an animal model of endocarditis. All mutants were viable. In competitive index assays, mutation of a putative phosphate transporter reduced in vivo competitiveness by 14-fold but also reduced in vitro viability by more than 20-fold. Mutations in lgt, lspA, or an uncharacterized lipoprotein gene reduced competitiveness by two- to threefold in the animal model and in broth culture. Mutation of ssaB, encoding a putative metal transporter, produced a similar effect in culture but reduced in vivo competiveness by >1,000-fold. [3H]palmitate labeling and Western blot analysis confirmed that the lgt mutant failed to acylate lipoproteins, that the lspA mutant had a general defect in lipoprotein cleavage, and that SsaB was processed differently in both mutants. These results indicate that the loss of a single lipoprotein, SsaB, dramatically reduces endocarditis virulence, whereas the loss of most other lipoproteins or of normal lipoprotein processing has no more than a minor effect on virulence. PMID:19395487

  10. Regulation of leaf organ size by the Arabidopsis RPT2a 19S proteasome subunit.

    PubMed

    Sonoda, Yutaka; Sako, Kaori; Maki, Yuko; Yamazaki, Naoko; Yamamoto, Hiroko; Ikeda, Akira; Yamaguchi, Junji

    2009-10-01

    The ubiquitin/26S proteasome pathway plays a central role in the degradation of short-lived regulatory proteins, to control many cellular events. To further understand this pathway, we focused on the RPT2 subunit of the 26S proteasome regulatory particle. The Arabidopsis genome contains two genes, AtRPT2a and AtRPT2b, which encode paralog molecules of the RPT2 subunit, with a difference of only three amino acids in the protein sequences. Both genes showed similar mRNA accumulation patterns. However, the rpt2a mutant showed a specific phenotype of enlarged leaves caused by increased cell size, in correlation with increased ploidy. Detailed analyses revealed that cell expansion is increased in the rpt2a mutant by extended endoreduplication early in leaf development. The transcription of genes encoding cell cycle-related components, for DNA replication licensing and the G2/M phase, was also promoted in the rpt2a mutant, suggesting that extended endoreduplication was caused by increased DNA replication, and disrupted regulation of the G2/M checkpoint, at the proliferation stage of leaf development.

  11. Mode of action of the qcr9 and cat3 mutations in restoring the ability of Saccharomyces cerevisiae tps1 mutants to grow on glucose.

    PubMed

    Blázquez, M A; Gancedo, C

    1995-12-20

    Mutations in the TPS1 gene, which encodes trehalose-6-P synthase, cause a glucose-negative phenotype in Saccharomyces cerevisiae. Antimycin A or disruption of the QCR9 gene, which encodes one subunit of the cytochrome bc1 complex, restore the ability to grow in glucose-containing media. Under these conditions the cell excreted a large amount of glycerol, corresponding to about 20% of the glucose taken up. Suppression appears to be achieved by diversion of accumulated glycolytic intermediates to the production of glycerol, thereby providing NAD+ and phosphate for the glyceraldehyde-3-P dehydrogenase reaction. Analysis of the mutation sci1-1, which also suppresses the glucose-negative phenotype of tps1 mutants, showed that glucose transport was decreased in sci1-1 mutants. The gene SCI1 was cloned and its nucleotide sequence revealed it to be identical to CAT3/SNF4. The suppression mediated by sci1-1 is attributable to a decrease in glycolytic flux.

  12. Actin dynamics involved in gravity perception in Arabidopsis inflorescense stem

    NASA Astrophysics Data System (ADS)

    Tasaka, Masao; Nakamura, Moritaka; Morita, Miyo T.

    The amyloplasts sedimentation in the endodermal cells is important for gravity perception in Arabidopsis shoot. Our previous study suggests that SGR5(SHOOT GRAVITROPISM 5) and SGR9 are synergistically involved in regulation of amyloplast movement in these cells, and shows that sgr5 sgr9 double mutant completely loses gravitropic response. SGR5 encodes putative transcription factor and SGR9 encodes a ring finger containing protein, which surrounds amyloplasts. It has been reported that amyloplasts are surrounded by actin microfilaments (MFs), and that treatment with actin polymerization inhibitor enhances gravitropic organ curvature. However, not only the molecular link between amyolplasts and MFs, but also regulatory role of MFs in gravitropic response is still unclear. Here, we found that treatment with actin polymerization inhibitor restored gravitropic response of sgr5 sgr9 double mutant stems. The result suggests that abnormal amyloplasts movement in the double mutant could result from inhibition of MFs depolymerization, leading to abnormal gravitropism. We are investigating whether SGR5 and SGR9 are involved in amyloplasts movement by regulating actin remodeling in gravity perceptive cells.

  13. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    PubMed

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  14. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    PubMed Central

    Zhu, Y; Lin, E C

    1988-01-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

  15. The yeast vps class E mutants: the beginning of the molecular genetic analysis of multivesicular body biogenesis.

    PubMed

    Coonrod, Emily M; Stevens, Tom H

    2010-12-01

    In 1992, Raymond et al. published a compilation of the 41 yeast vacuolar protein sorting (vps) mutant groups and described a large class of mutants (class E vps mutants) that accumulated an exaggerated prevacuolar endosome-like compartment. Further analysis revealed that this "class E compartment" contained soluble vacuolar hydrolases, vacuolar membrane proteins, and Golgi membrane proteins unable to recycle back to the Golgi complex, yet these class E vps mutants had what seemed to be normal vacuoles. The 13 class E VPS genes were later shown to encode the proteins that make up the complexes required for formation of intralumenal vesicles in late endosomal compartments called multivesicular bodies, and for the sorting of ubiquitinated cargo proteins into these internal vesicles for eventual delivery to the vacuole or lysosome.

  16. Tricarboxylic acid cycle without malate dehydrogenase in Streptomyces coelicolor M-145.

    PubMed

    Takahashi-Íñiguez, Tóshiko; Barrios-Hernández, Joana; Rodríguez-Maldonado, Marion; Flores, María Elena

    2018-06-23

    The oxidation of malate to oxaloacetate is catalysed only by a nicotinamide adenine dinucleotide-dependent malate dehydrogenase encoded by SCO4827 in Streptomyces coelicolor. A mutant lacking the malate dehydrogenase gene was isolated and no enzymatic activity was detected. As expected, the ∆mdh mutant was unable to grow on malate as the sole carbon source. However, the mutant grew less in minimal medium with glucose and there was a delay of 36 h. The same behaviour was observed when the mutant was grown on minimal medium with casamino acids or glycerol. For unknown reasons, the mutant was not able to grow in YEME medium with glucose. The deficiency of malate dehydrogenase affected the expression of the isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase genes, decreasing the expression of both genes by approximately two- to threefold.

  17. Insulin-like growth factor (IGF) signaling through type 1 IGF receptor plays an important role in remyelination.

    PubMed

    Mason, Jeffrey L; Xuan, Shouhong; Dragatsis, Ioannis; Efstratiadis, Argiris; Goldman, James E

    2003-08-20

    We examined the role of IGF signaling in the remyelination process by disrupting the gene encoding the type 1 IGF receptor (IGF1R) specifically in the mouse brain by Cre-mediated recombination and then exposing these mutants and normal siblings to cuprizone. This neurotoxicant induces a demyelinating lesion in the corpus callosum that is reversible on termination of the insult. Acute demyelination and oligodendrocyte depletion were the same in mutants and controls, but the mutants did not remyelinate adequately. We observed that oligodendrocyte progenitors did not accumulate, proliferate, or survive within the mutant mice, compared with wild type, indicating that signaling through the IGF1R plays a critical role in remyelination via effects on oligodendrocyte progenitors.

  18. The OSU1/QUA2/TSD2-Encoded Putative Methyltransferase Is a Critical Modulator of Carbon and Nitrogen Nutrient Balance Response in Arabidopsis

    PubMed Central

    Zheng, Zhi-Liang

    2008-01-01

    The balance between carbon (C) and nitrogen (N) nutrients must be tightly coordinated so that cells can optimize their opportunity for metabolism, growth and development. However, the C and N nutrient balance perception and signaling mechanism remains poorly understood. Here, we report the isolation and characterization of two allelic oversensitive to sugar1 mutants (osu1-1, osu1-2) in Arabidopsis thaliana. Using the cotyledon anthocyanin accumulation and root growth inhibition assays, we show that the osu1 mutants are more sensitive than wild-type to both of the imbalanced C/N conditions, high C/low N and low C/high N. However, under the balanced C/N conditions (low C/low N or high C/high N), the osu1 mutants have similar anthocyanin levels and root lengths as wild-type. Consistently, the genes encoding two MYB transcription factors (MYB75 and MYB90) and an Asn synthetase isoform (ASN1) are strongly up-regulated by the OSU1 mutation in response to high C/low N and low C/high N, respectively. Furthermore, the enhanced sensitivity of osu1-1 to high C/low N with respect to anthocyanin accumulation but not root growth inhibition can be suppressed by co-suppression of MYB75, indicating that MYB75 acts downstream of OSU1 in the high C/low N imbalance response. Map-based cloning reveals that OSU1 encodes a member of a large family of putative methyltransferases and is allelic to the recently reported QUA2/TSD2 locus identified in genetic screens for cell-adhesion-defective mutants. Accumulation of OSU1/QUA2/TSD2 transcript was not regulated by C and N balance, but the OSU1 promoter was slightly more active in the vascular system. Taken together, our results show that the OSU1/QUA2/TSD2-encoded putative methyltransferase is required for normal C/N nutrient balance response in plants. PMID:18167546

  19. Multiple regulatory elements for the glpA operon encoding anaerobic glycerol-3-phosphate dehydrogenase and the glpD operon encoding aerobic glycerol-3-phosphate dehydrogenase in Escherichia coli: further characterization of respiratory control.

    PubMed

    Iuchi, S; Cole, S T; Lin, E C

    1990-01-01

    In Escherichia coli, sn-glycerol-3-phosphate can be oxidized by two different flavo-dehydrogenases, an anaerobic enzyme encoded by the glpACB operon and an aerobic enzyme encoded by the glpD operon. These two operons belong to the glp regulon specifying the utilization of glycerol, sn-glycerol-3-phosphate, and glycerophosphodiesters. In glpR mutant cells grown under conditions of low catabolite repression, the glpA operon is best expressed anaerobically with fumarate as the exogenous electron acceptor, whereas the glpD operon is best expressed aerobically. Increased anaerobic expression of glpA is dependent on the fnr product, a pleiotropic activator of genes involved in anaerobic respiration. In this study we found that the expression of a glpA1(Oxr) (oxygen-resistant) mutant operon, selected for increased aerobic expression, became less dependent on the FNR protein but more dependent on the cyclic AMP-catabolite gene activator protein complex mediating catabolite repression. Despite the increased aerobic expression of glpA1(Oxr), a twofold aerobic repressibility persisted. Moreover, anaerobic repression by nitrate respiration remained normal. Thus, there seems to exist a redox control apart from the FNR-mediated one. We also showed that the anaerobic repression of the glpD operon was fully relieved by mutations in either arcA (encoding a presumptive DNA recognition protein) or arcB (encoding a presumptive redox sensor protein). The arc system is known to mediate pleiotropic control of genes of aerobic function.

  20. Intracistronic complementation in the simian virus 40 A gene.

    PubMed Central

    Tornow, J; Cole, C N

    1983-01-01

    A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

  1. In Silico Analysis of Usher Encoding Genes in Klebsiella pneumoniae and Characterization of Their Role in Adhesion and Colonization

    PubMed Central

    Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane

    2015-01-01

    Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to γκп and ϭ clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21ΔkpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21∆kpaC and LM21∆kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21∆kpbC and LM21∆kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658

  2. The Sterol Methyltransferases SMT1, SMT2, and SMT3 Influence Arabidopsis Development through Nonbrassinosteroid Products1[W][OA

    PubMed Central

    Carland, Francine; Fujioka, Shozo; Nelson, Timothy

    2010-01-01

    Plant sterols are structural components of cell membranes that provide rigidity, permeability, and regional identity to membranes. Sterols are also the precursors to the brassinosteroid signaling molecules. Evidence is accumulating that specific sterols have roles in pattern formation during development. COTYLEDON VASCULAR PATTERNING1 (CVP1) encodes C-24 STEROL METHYLTRANSFERASE2 (SMT2), one of three SMTs in Arabidopsis (Arabidopsis thaliana). SMT2 and SMT3, which also encodes a C-24 SMT, catalyze the reaction that distinguishes the synthesis of structural sterols from signaling brassinosteroid derivatives and are highly regulated. The deficiency of SMT2 in the cvp1 mutant results in moderate developmental defects, including aberrant cotyledon vein patterning, serrated floral organs, and reduced stature, but plants are viable, suggesting that SMT3 activity can substitute for the loss of SMT2. To test the distinct developmental roles of SMT2 and SMT3, we identified a transcript null smt3 mutant. Although smt3 single mutants appear wild type, cvp1 smt3 double mutants show enhanced defects relative to cvp1 mutants, such as discontinuous cotyledon vein pattern, and produce novel phenotypes, including defective root growth, loss of apical dominance, sterility, and homeotic floral transformations. These phenotypes are correlated with major alterations in the profiles of specific sterols but without significant alterations to brassinosteroid profiles. The alterations to sterol profiles in cvp1 mutants affect auxin response, demonstrated by weak auxin insensitivity, enhanced axr1 auxin resistance, ectopically expressed DR5:β-glucuronidase in developing embryos, and defective response to auxin-inhibited PIN2-green fluorescent protein endocytosis. We discuss the developmental roles of sterols implied by these results. PMID:20421456

  3. Ribosome Biogenesis Modulates Ty1 Copy Number Control in Saccharomyces cerevisiae

    PubMed Central

    Ahn, Hyo Won; Tucker, Jessica M.; Arribere, Joshua A.; Garfinkel, David J.

    2017-01-01

    Transposons can impact the host genome by altering gene expression and participating in chromosome rearrangements. Therefore, organisms evolved different ways to minimize the level of transposition. In Saccharomyces cerevisiae and its close relative S. paradoxus, Ty1 copy number control (CNC) is mediated by the self-encoded restriction factor p22, which is derived from the GAG capsid gene and inhibits virus-like particle (VLP) assembly and function. Based on secondary screens of Ty1 cofactors, we identified LOC1, a RNA localization/ribosome biogenesis gene that affects Ty1 mobility predominantly in strains harboring Ty1 elements. Ribosomal protein mutants rps0bΔ and rpl7aΔ displayed similar CNC-specific phenotypes as loc1Δ, suggesting that ribosome biogenesis is critical for CNC. The level of Ty1 mRNA and Ty1 internal (Ty1i) transcripts encoding p22 was altered in these mutants, and displayed a trend where the level of Ty1i RNA increased relative to full-length Ty1 mRNA. The level of p22 increased in these mutants, and the half-life of p22 also increased in a loc1Δ mutant. Transcriptomic analyses revealed small changes in the level of Ty1 transcripts or efficiency of translation initiation in a loc1Δ mutant. Importantly, a loc1Δ mutant had defects in assembly of Gag complexes and packaging Ty1 RNA. Our results indicate that defective ribosome biogenesis enhances CNC by increasing the level of p22, and raise the possibility for versatile links between VLP assembly, its cytoplasmic environment, and a novel stress response. PMID:29046400

  4. Major role for FeoB in Campylobacter jejuni ferrous iron acquisition, gut colonization, and intracellular survival.

    PubMed

    Naikare, Hemant; Palyada, Kiran; Panciera, Roger; Marlow, Denver; Stintzi, Alain

    2006-10-01

    To assess the importance of ferrous iron acquisition in Campylobacter physiology and pathogenesis, we disrupted and characterized the Fe2+ iron transporter, FeoB, in Campylobacter jejuni NCTC 11168, 81-176, and ATCC 43431. The feoB mutant was significantly affected in its ability to transport 55Fe2+. It accumulated half the amount of iron than the wild-type strain during growth in an iron-containing medium. The intracellular iron of the feoB mutant was localized in the periplasmic space versus the cytoplasm for the wild-type strain. These results indicate that the feoB gene of C. jejuni encodes a functional ferrous iron transport system. Reverse transcriptase PCR analysis revealed the cotranscription of feoB and Cj1397, which encodes a homolog of Escherichia coli feoA. C. jejuni 81-176 feoB mutants exhibited reduced ability to persist in human INT-407 embryonic intestinal cells and porcine IPEC-1 small intestinal epithelial cells compared to the wild type. C. jejuni NCTC 11168 feoB mutant was outcompeted by the wild type for colonization and/or survival in the rabbit ileal loop. The feoB mutants of the three C. jejuni strains were significantly affected in their ability to colonize the chick cecum. And finally, the three feoB mutants were outcompeted by their respective wild-type strains for infection of the intestinal tracts of colostrum-deprived piglets. Taken together, these results demonstrate that FeoB-mediated ferrous iron acquisition contributes significantly to colonization of the gastrointestinal tract during both commensal and infectious relationship, and thus it plays an important role in Campylobacter pathogenesis.

  5. lbtA and lbtB Are Required for Production of the Legionella pneumophila Siderophore Legiobactin

    PubMed Central

    Allard, Kimberly A.; Viswanathan, V. K.; Cianciotto, Nicholas P.

    2006-01-01

    Under iron stress, Legionella pneumophila secretes legiobactin, a nonclassical siderophore that is reactive in the chrome azurol S (CAS) assay. Here, we have optimized conditions for legiobactin expression, shown its biological activity, and identified two genes, lbtA and lbtB, which are involved in legiobactin production. lbtA appears to be iron repressed and encodes a protein that has significant homology with siderophore synthetases, and FrgA, a previously described iron-regulated protein of L. pneumophila. lbtB encodes a protein homologous with members of the major facilitator superfamily of multidrug efflux pumps. Mutants lacking lbtA or lbtB were defective for legiobactin, producing 40 to 70% less CAS reactivity in deferrated chemically defined medium (CDM). In bioassays, mutant CDM culture supernatants, unlike those of the wild type, did not support growth of iron-limited wild-type bacteria in 2′,2′-dipyridyl-containing buffered charcoal yeast extract (BCYE) agar and a ferrous iron transport mutant on BCYE agar without added iron. The lbtA mutant was modestly defective for growth in deferrated CDM containing the iron chelator citrate, indicating that legiobactin is required in conditions of severe iron limitation. Complementation of the lbt mutants restored both siderophore expression, as measured by the CAS assay and bioassays, and bacterial growth in deferrated, citrate-containing media. The lbtA mutant replicated as the wild type did in macrophages, amoebae, and the lungs of mice. However, L. pneumophila expresses lbtA in the macrophage, suggesting that legiobactin, though not required, may play a dispensable role in intracellular growth. The discovery of lbtAB represents the first identification of genes required for L. pneumophila siderophore expression. PMID:16452417

  6. GATA-Dependent Glutaminolysis Drives Appressorium Formation in Magnaporthe oryzae by Suppressing TOR Inhibition of cAMP/PKA Signaling

    PubMed Central

    Marroquin-Guzman, Margarita; Wilson, Richard A.

    2015-01-01

    Fungal plant pathogens are persistent and global food security threats. To invade their hosts they often form highly specialized infection structures, known as appressoria. The cAMP/ PKA- and MAP kinase-signaling cascades have been functionally delineated as positive-acting pathways required for appressorium development. Negative-acting regulatory pathways that block appressorial development are not known. Here, we present the first detailed evidence that the conserved Target of Rapamycin (TOR) signaling pathway is a powerful inhibitor of appressorium formation by the rice blast fungus Magnaporthe oryzae. We determined TOR signaling was activated in an M. oryzae mutant strain lacking a functional copy of the GATA transcription factor-encoding gene ASD4. Δasd4 mutant strains could not form appressoria and expressed GLN1, a glutamine synthetase-encoding orthologue silenced in wild type. Inappropriate expression of GLN1 increased the intracellular steady-state levels of glutamine in Δasd4 mutant strains during axenic growth when compared to wild type. Deleting GLN1 lowered glutamine levels and promoted appressorium formation by Δasd4 strains. Furthermore, glutamine is an agonist of TOR. Treating Δasd4 mutant strains with the specific TOR kinase inhibitor rapamycin restored appressorium development. Rapamycin was also shown to induce appressorium formation by wild type and Δcpka mutant strains on non-inductive hydrophilic surfaces but had no effect on the MAP kinase mutant Δpmk1. When taken together, we implicate Asd4 in regulating intracellular glutamine levels in order to modulate TOR inhibition of appressorium formation downstream of cPKA. This study thus provides novel insight into the metabolic mechanisms that underpin the highly regulated process of appressorium development. PMID:25901357

  7. Identification of a novel SPLIT-HULL (SPH) gene associated with hull splitting in rice (Oryza sativa L.).

    PubMed

    Lee, Gileung; Lee, Kang-Ie; Lee, Yunjoo; Kim, Backki; Lee, Dongryung; Seo, Jeonghwan; Jang, Su; Chin, Joong Hyoun; Koh, Hee-Jong

    2018-07-01

    The split-hull phenotype caused by reduced lemma width and low lignin content is under control of SPH encoding a type-2 13-lipoxygenase and contributes to high dehulling efficiency. Rice hulls consist of two bract-like structures, the lemma and palea. The hull is an important organ that helps to protect seeds from environmental stress, determines seed shape, and ensures grain filling. Achieving optimal hull size and morphology is beneficial for seed development. We characterized the split-hull (sph) mutant in rice, which exhibits hull splitting in the interlocking part between lemma and palea and/or the folded part of the lemma during the grain filling stage. Morphological and chemical analysis revealed that reduction in the width of the lemma and lignin content of the hull in the sph mutant might be the cause of hull splitting. Genetic analysis indicated that the mutant phenotype was controlled by a single recessive gene, sph (Os04g0447100), which encodes a type-2 13-lipoxygenase. SPH knockout and knockdown transgenic plants displayed the same split-hull phenotype as in the mutant. The sph mutant showed significantly higher linoleic and linolenic acid (substrates of lipoxygenase) contents in spikelets compared to the wild type. It is probably due to the genetic defect of SPH and subsequent decrease in lipoxygenase activity. In dehulling experiment, the sph mutant showed high dehulling efficiency even by a weak tearing force in a dehulling machine. Collectively, the results provide a basis for understanding of the functional role of lipoxygenase in structure and maintenance of hulls, and would facilitate breeding of easy-dehulling rice.

  8. Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2more » gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.« less

  9. Impaired auxin biosynthesis in the defective endosperm18 mutant is due to mutational loss of expression in the ZmYuc1 gene encoding endosperm-specific YUCCA1 protein in maize.

    USDA-ARS?s Scientific Manuscript database

    A seed-specific maize mutant, defective endosperm18 (de18), accumulates approximately 40% less dry mass and 10- to 15- fold less auxin (IAA) as compared to the De18; however, a causal basis of these changes is not known. Cellular analyses here showed that the de18 developing endosperm had lower tota...

  10. The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

    PubMed Central

    Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

    2001-01-01

    We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

  11. A speculated ribozyme site in the herpes simplex virus type 1 latency-associated transcript gene is not essential for a wild-type reactivation phenotype

    PubMed Central

    Carpenter, Dale; Singh, Sukhpreet; Osorio, Nelson; Hsiang, Chinhui; Jiang, Xianzhi; Jin, Ling; Jones, Clinton; Wechsler, Steven L

    2010-01-01

    During herpes simplex virus-1 (HSV-1) latency in sensory neurons, LAT (latency-associated transcript) is the only abundantly expressed viral gene. LAT plays an important role in the HSV-1 latency-reactivation cycle, because LAT deletion mutants have a significantly decreased reactivation phenotype. Based solely on sequence analysis, it was speculated that LAT encodes a ribozyme that plays an important role in how LAT enhances the virus’ reactivation phenotype. Because LAT ribozyme activity has never been reported, we decided to test the converse hypothesis, namely, that this region of LAT does not encode a ribozyme function important for LAT’s ability to enhance the reactivation phenotype. We constructed a viral mutant (LAT-Rz) in which the speculated ribozyme consensus sequence was altered such that no ribozyme was encoded. We report here that LAT-Rz had a wild-type reactivation phenotype in mice, confirming the hypothesis that the speculated LAT ribozyme is not a dominant factor in stimulating the latency-reactivation cycle in mice. PMID:18982533

  12. Three α-Subunits of Heterotrimeric G Proteins and an Adenylyl Cyclase Have Distinct Roles in Fruiting Body Development in the Homothallic Fungus Sordaria macrospora

    PubMed Central

    Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

    2008-01-01

    Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different α-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Δgsa1, Δgsa2, and Δgsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Gα-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Δgsa1Δgsa2 and Δgsa1Δgsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Gα-subunits, two recently generated Δpre strains were crossed with all Δgsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three ΔgsaΔsac1 double mutants and one Δgsa2Δgsa3Δsac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1–GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Gα-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora. PMID:18723884

  13. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  14. Disruption of non-anchored cell wall protein NCW-1 promotes cellulase production by increasing cellobiose uptake in Neurospora crassa.

    PubMed

    Lin, Liangcai; Chen, Yong; Li, Jingen; Wang, Shanshan; Sun, Wenliang; Tian, Chaoguang

    2017-04-01

    To elucidate the mechanism of cellulase signal transduction in filamentous fungi including the components of the cellulase induction pathway. Neurospora crassa ncw-1 encodes a non-anchored cell wall protein. The absence of ncw-1 increased cellulase gene expression and this is not due to relieving carbon catabolite repression mediated by the cre-1 pathway. A mutant lacking genes encoding both three major β-glucosidase enzymes and NCW-1 (Δ3βGΔncw-1) was constructed. Transcriptome analysis of the quadruple mutant demonstrated enhanced expression of cellodextrin transporters after ncw-1 deletion, indicating that ncw-1 affects cellulase expression and production by inhibiting the uptake of the cellodextrin. NCW-1 is a novel component that plays a critical role in the cellulase induction signaling pathway.

  15. Rapid directed evolution of stabilized proteins with cellular high-throughput encapsulation solubilization and screening (CHESS).

    PubMed

    Yong, K J; Scott, D J

    2015-03-01

    Directed evolution is a powerful method for engineering proteins towards user-defined goals and has been used to generate novel proteins for industrial processes, biological research and drug discovery. Typical directed evolution techniques include cellular display, phage display, ribosome display and water-in-oil compartmentalization, all of which physically link individual members of diverse gene libraries to their translated proteins. This allows the screening or selection for a desired protein function and subsequent isolation of the encoding gene from diverse populations. For biotechnological and industrial applications there is a need to engineer proteins that are functional under conditions that are not compatible with these techniques, such as high temperatures and harsh detergents. Cellular High-throughput Encapsulation Solubilization and Screening (CHESS), is a directed evolution method originally developed to engineer detergent-stable G proteins-coupled receptors (GPCRs) for structural biology. With CHESS, library-transformed bacterial cells are encapsulated in detergent-resistant polymers to form capsules, which serve to contain mutant genes and their encoded proteins upon detergent mediated solubilization of cell membranes. Populations of capsules can be screened like single cells to enable rapid isolation of genes encoding detergent-stable protein mutants. To demonstrate the general applicability of CHESS to other proteins, we have characterized the stability and permeability of CHESS microcapsules and employed CHESS to generate thermostable, sodium dodecyl sulfate (SDS) resistant green fluorescent protein (GFP) mutants, the first soluble proteins to be engineered using CHESS. © 2014 Wiley Periodicals, Inc.

  16. Identification of phosphomethylethanolamine N-methyltransferase from Arabidopsis and its role in choline and phospholipid metabolism.

    PubMed

    BeGora, Michael D; Macleod, Mitchell J R; McCarry, Brian E; Summers, Peter S; Weretilnyk, Elizabeth A

    2010-09-17

    Three sequential methylations of phosphoethanolamine (PEA) are required for the synthesis of phosphocholine (PCho) in plants. A cDNA encoding an N-methyltransferase that catalyzes the last two methylation steps was cloned from Arabidopsis by heterologous complementation of a Saccharomyces cerevisiae cho2, opi3 mutant. The cDNA encodes phosphomethylethanolamine N-methyltransferase (PMEAMT), a polypeptide of 475 amino acids that is organized as two tandem methyltransferase domains. PMEAMT shows 87% amino acid identity to a related enzyme, phosphoethanolamine N-methyltransferase, an enzyme in plants that catalyzes all three methylations of PEA to PCho. PMEAMT cannot use PEA as a substrate, but assays using phosphomethylethanolamine as a substrate result in both phosphodimethylethanolamine and PCho as products. PMEAMT is inhibited by the reaction products PCho and S-adenosyl-l-homocysteine, a property reported for phosphoethanolamine N-methyltransferase from various plants. An Arabidopsis mutant with a T-DNA insertion associated with locus At1g48600 showed no transcripts encoding PMEAMT. Shotgun lipidomic analyses of leaves of atpmeamt and wild-type plants generated phospholipid profiles showing the content of phosphatidylmethylethanolamine to be altered relative to wild type with the content of a 34:3 lipid molecular species 2-fold higher in mutant plants. In S. cerevisiae, an increase in PtdMEA in membranes is associated with reduced viability. This raises a question regarding the role of PMEAMT in plants and whether it serves to prevent the accumulation of PtdMEA to potentially deleterious levels.

  17. Evidence for a Ustilago maydis Steroid 5α-Reductase by Functional Expression in Arabidopsis det2-1 Mutants1

    PubMed Central

    Basse, Christoph W.; Kerschbamer, Christine; Brustmann, Markus; Altmann, Thomas; Kahmann, Regine

    2002-01-01

    We have identified a gene (udh1) in the basidiomycete Ustilago maydis that is induced during the parasitic interaction with its host plant maize (Zea mays). udh1 encodes a protein with high similarity to mammalian and plant 5α-steroid reductases. Udh1 differs from those of known 5α-steroid reductases by six additional domains, partially predicted to be membrane-spanning. A fusion protein of Udh1 and the green fluorescent protein provided evidence for endoplasmic reticulum localization in U. maydis. The function of the Udh1 protein was demonstrated by complementing Arabidopsis det2-1 mutants, which display a dwarf phenotype due to a mutation in the 5α-steroid reductase encoding DET2 gene. det2-1 mutant plants expressing either the udh1 or the DET2 gene controlled by the cauliflower mosaic virus 35S promoter differed from wild-type Columbia plants by accelerated stem growth, flower and seed development and a reduction in size and number of rosette leaves. The accelerated growth phenotype of udh1 transgenic plants was stably inherited and was favored under reduced light conditions. Truncation of the N-terminal 70 amino acids of the Udh1 protein abolished the ability to restore growth in det2-1 plants. Our results demonstrate the existence of a 5α-steroid reductase encoding gene in fungi and suggest a common ancestor between fungal, plant, and mammalian proteins. PMID:12068114

  18. Evidence for a Ustilago maydis steroid 5alpha-reductase by functional expression in Arabidopsis det2-1 mutants.

    PubMed

    Basse, Christoph W; Kerschbamer, Christine; Brustmann, Markus; Altmann, Thomas; Kahmann, Regine

    2002-06-01

    We have identified a gene (udh1) in the basidiomycete Ustilago maydis that is induced during the parasitic interaction with its host plant maize (Zea mays). udh1 encodes a protein with high similarity to mammalian and plant 5alpha-steroid reductases. Udh1 differs from those of known 5alpha-steroid reductases by six additional domains, partially predicted to be membrane-spanning. A fusion protein of Udh1 and the green fluorescent protein provided evidence for endoplasmic reticulum localization in U. maydis. The function of the Udh1 protein was demonstrated by complementing Arabidopsis det2-1 mutants, which display a dwarf phenotype due to a mutation in the 5alpha-steroid reductase encoding DET2 gene. det2-1 mutant plants expressing either the udh1 or the DET2 gene controlled by the cauliflower mosaic virus 35S promoter differed from wild-type Columbia plants by accelerated stem growth, flower and seed development and a reduction in size and number of rosette leaves. The accelerated growth phenotype of udh1 transgenic plants was stably inherited and was favored under reduced light conditions. Truncation of the N-terminal 70 amino acids of the Udh1 protein abolished the ability to restore growth in det2-1 plants. Our results demonstrate the existence of a 5alpha-steroid reductase encoding gene in fungi and suggest a common ancestor between fungal, plant, and mammalian proteins.

  19. Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

    PubMed Central

    van der Ploeg, Jan R.

    2005-01-01

    In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

  20. Investigating the Molecular Mechanism of TSO1 Function in Arabidopsis cell division and meristem development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhongchi Liu

    2004-10-01

    Unlike animals, plants are constantly exposed to environmental mutagens including ultraviolet light and reactive oxygen species. Further, plant cells are totipotent with highly plastic developmental programs. An understanding of molecular mechanisms underlying the ability of plants to monitor and repair its DNA and to eliminate damaged cells are of great importance. Previously we have identified two genes, TSO1 and TSO2, from a flowering plant Arabidopsis thaliana. Mutations in these two genes cause callus-like flowers, fasciated shoot apical meristems, and abnormal cell division, indicating that TSO1 and TSO2 may encode important cell cycle regulators. Previous funding from DOE led to themore » molecular cloning of TSO1, which was shown to encode a novel nuclear protein with two CXC domains suspected to bind DNA. This DOE grant has allowed us to characterize and isolate TSO2 that encodes the small subunit of the ribonucleotide reductase (RNR). RNR comprises two large subunits (R1) an d two small subunits (R2), catalyzes a rate-limiting step in the production of deoxyribonucleotides needed for DNA replication and repair. Previous studies in yeast and mammals indicated that defective RNR often led to cell cycle arrest, growth retardation and p53-dependent apoptosis while abnormally elevated RNR activities led to higher mutation rates. Subsequently, we identified two additional R2 genes, R2A and R2B in the Arabidopsis genome. Using reverse genetics, mutations in R2A and R2B were isolated, and double and triple mutants among the three R2 genes (TSO2, R2A and R2B) were constructed and analyzed. We showed that Arabidopsis tso2 mutants, with reduced dNTP levels, were more sensitive to UV-C. While r2a or r2b single mutants did not exhibit any phenotypes, tso2 r2b double mutants were embryonic lethal and tso2 r2a double mutants were seedling lethal indicating redundant functions among the three R2 genes. Furthermore, tso2 r2a double mutants exhibited increased DNA dam age, massive programmed cell death, and the release of transcriptional gene silencing. Our data suggests that plants can initiate programmed cell death to eliminate damaged cells despite the absence of p53 in plant genome.« less

  1. Modification of glucose import capacity in Escherichia coli: physiologic consequences and utility for improving DNA vaccine production

    PubMed Central

    2013-01-01

    Background The bacterium Escherichia coli can be grown employing various carbohydrates as sole carbon and energy source. Among them, glucose affords the highest growth rate. This sugar is nowadays widely employed as raw material in industrial fermentations. When E. coli grows in a medium containing non-limiting concentrations of glucose, a metabolic imbalance occurs whose main consequence is acetate secretion. The production of this toxic organic acid reduces strain productivity and viability. Solutions to this problem include reducing glucose concentration by substrate feeding strategies or the generation of mutant strains with impaired glucose import capacity. In this work, a collection of E. coli strains with inactive genes encoding proteins involved in glucose transport where generated to determine the effects of reduced glucose import capacity on growth rate, biomass yield, acetate and production of an experimental plasmid DNA vaccine (pHN). Results A group of 15 isogenic derivatives of E. coli W3110 were generated with single and multiple deletions of genes encoding glucose, mannose, beta-glucoside, maltose and N-acetylglucosamine components of the phosphoenolpyruvate:sugar phosphotransferase system (PTS), as well as the galactose symporter and the Mgl galactose/glucose ABC transporter. These strains were characterized by growing them in mineral salts medium supplemented with 2.5 g/L glucose. Maximum specific rates of glucose consumption (qs) spanning from 1.33 to 0.32 g/g h were displayed by the group of mutants and W3110, which resulted in specific growth rates ranging from 0.65-0.18 h-1. Acetate accumulation was reduced or abolished in cultures with all mutant strains. W3110 and five selected mutant derivatives were transformed with pHN. A 3.2-fold increase in pHN yield on biomass was observed in cultures of a mutant strain with deletion of genes encoding the glucose and mannose PTS components, as well as Mgl. Conclusions The group of E. coli mutants generated in this study displayed a reduction or elimination of overflow metabolism and a linear correlation between qs and the maximum specific growth rate as well as the acetate production rate. By comparing DNA vaccine production parameters among some of these mutants, it was possible to identify a near-optimal glucose import rate value for this particular application. The strains employed in this study should be a useful resource for studying the effects of different predefined qs values on production capacity for various biotechnological products. PMID:23638701

  2. A Forward Genetic Approach in Chlamydomonas reinhardtii as a Strategy for Exploring Starch Catabolism

    PubMed Central

    Duchêne, Thierry; Cogez, Virginie; Cousin, Charlotte; Peltier, Gilles; Ball, Steven G.; Dauvillée, David

    2013-01-01

    A screen was recently developed to study the mobilization of starch in the unicellular green alga Chlamydomonas reinhardtii. This screen relies on starch synthesis accumulation during nitrogen starvation followed by the supply of nitrogen and the switch to darkness. Hence multiple regulatory networks including those of nutrient starvation, cell cycle control and light to dark transitions are likely to impact the recovery of mutant candidates. In this paper we monitor the specificity of this mutant screen by characterizing the nature of the genes disrupted in the selected mutants. We show that one third of the mutants consisted of strains mutated in genes previously reported to be of paramount importance in starch catabolism such as those encoding β-amylases, the maltose export protein, and branching enzyme I. The other mutants were defective for previously uncharacterized functions some of which are likely to define novel proteins affecting starch mobilization in green algae. PMID:24019981

  3. Forebrain-Specific Loss of BMPRII in Mice Reduces Anxiety and Increases Object Exploration.

    PubMed

    McBrayer, Zofeyah L; Dimova, Jiva; Pisansky, Marc T; Sun, Mu; Beppu, Hideyuki; Gewirtz, Jonathan C; O'Connor, Michael B

    2015-01-01

    To investigate the role of Bone Morphogenic Protein Receptor Type II (BMPRII) in learning, memory, and exploratory behavior in mice, a tissue-specific knockout of BMPRII in the post-natal hippocampus and forebrain was generated. We found that BMPRII mutant mice had normal spatial learning and memory in the Morris water maze, but showed significantly reduced swimming speeds with increased floating behavior. Further analysis using the Porsolt Swim Test to investigate behavioral despair did not reveal any differences in immobility between mutants and controls. In the Elevated Plus Maze, BMPRII mutants and Smad4 mutants showed reduced anxiety, while in exploratory tests, BMPRII mutants showed more interest in object exploration. These results suggest that loss of BMPRII in the mouse hippocampus and forebrain does not disrupt spatial learning and memory encoding, but instead impacts exploratory and anxiety-related behaviors.

  4. Forebrain-Specific Loss of BMPRII in Mice Reduces Anxiety and Increases Object Exploration

    PubMed Central

    McBrayer, Zofeyah L.; Dimova, Jiva; Pisansky, Marc T.; Sun, Mu; Beppu, Hideyuki; Gewirtz, Jonathan C.; O’Connor, Michael B.

    2015-01-01

    To investigate the role of Bone Morphogenic Protein Receptor Type II (BMPRII) in learning, memory, and exploratory behavior in mice, a tissue-specific knockout of BMPRII in the post-natal hippocampus and forebrain was generated. We found that BMPRII mutant mice had normal spatial learning and memory in the Morris water maze, but showed significantly reduced swimming speeds with increased floating behavior. Further analysis using the Porsolt Swim Test to investigate behavioral despair did not reveal any differences in immobility between mutants and controls. In the Elevated Plus Maze, BMPRII mutants and Smad4 mutants showed reduced anxiety, while in exploratory tests, BMPRII mutants showed more interest in object exploration. These results suggest that loss of BMPRII in the mouse hippocampus and forebrain does not disrupt spatial learning and memory encoding, but instead impacts exploratory and anxiety-related behaviors. PMID:26444546

  5. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-01-01

    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  6. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

    PubMed Central

    Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

    2018-01-01

    A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea. PMID:29867912

  7. Involvement of two glycoside hydrolase family 19 members in colony morphotype and virulence in Flavobacterium columnare

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaolin; Li, Nan; Qin, Ting; Huang, Bei; Nie, Pin

    2017-11-01

    Flavobacterium columnare is the pathogenic agent of columnaris disease in aquaculture. Using a recently developed gene deletion strategy, two genes that encode the Glyco_hydro_19 domain (GH19 domain) containing proteins, ghd-1 and ghd-2, were deleted separately and together from the F. columnare G4 wild type strain. Surprisingly, the single-, Δ ghd-1 and Δ ghd-2, and double-gene mutants, Δ ghd-1 Δghd -2, all had rhizoid and non-rhizoid colony morphotypes, which we named Δ ghd-1, Δ ghd-2, Δ ghd-1 Δ ghd-2, and NΔ ghd-1, NΔ ghd-2, and NΔ ghd-1 Δ ghd-2. However, chitin utilization was not detected in either these mutants or in the wild type. Instead, skimmed milk degradation was observed for the mutants and the wild type; the non-rhizoid strain NΔ ghd-2 exhibited higher degradation activity as revealed by the larger transparent circle on the skimmed milk plate. Using zebrafish as the model organism, we found that non-rhizoid mutants had higher LD50 values and were less virulent because zebrafish infected with these survived longer. Transcriptome analysis between the non-rhizoid and rhizoid colony morphotypes of each mutant, i.e., NΔ ghd -1 versus (vs) Δ ghd-1, NΔ ghd-2 vs Δ ghd-2, and NΔ ghd-1 Δ ghd-2 vs Δ ghd-1 Δ ghd-2, revealed a large number of differentially expressed genes, among which 39 genes were common in three of the pairs compared. Although most of these genes encode hypothetical proteins, a few molecules such as phage tail protein, rhs element Vgr protein, thiol-activated cytolysin, and TonB-dependent outer membrane receptor precursor, expression of which was down-regulated in non-rhizoid mutants but up-regulated in rhizoid mutants, may play a role F. columnare virulence.

  8. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

    PubMed

    Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

    2018-01-01

    A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

  9. Structural and functional characterization of the product of disease-related factor H gene conversion.

    PubMed

    Herbert, Andrew P; Kavanagh, David; Johansson, Conny; Morgan, Hugh P; Blaum, Bärbel S; Hannan, Jonathan P; Barlow, Paul N; Uhrín, Dušan

    2012-03-06

    Numerous complement factor H (FH) mutations predispose patients to atypical hemolytic uremic syndrome (aHUS) and other disorders arising from inadequately regulated complement activation. No unifying structural or mechanistic consequences have been ascribed to these mutants beyond impaired self-cell protection. The S1191L and V1197A mutations toward the C-terminus of FH, which occur in patients singly or together, arose from gene conversion between CFH encoding FH and CFHR1 encoding FH-related 1. We show that neither single nor double mutations structurally perturbed recombinant proteins consisting of the FH C-terminal modules, 19 and 20 (FH19-20), although all three FH19-20 mutants were poor, compared to wild-type FH19-20, at promoting hemolysis of C3b-coated erythrocytes through competition with full-length FH. Indeed, our new crystal structure of the S1191L mutant of FH19-20 complexed with an activation-specific complement fragment, C3d, was nearly identical to that of the wild-type FH19-20:C3d complex, consistent with mutants binding to C3b with wild-type-like affinity. The S1191L mutation enhanced thermal stability of module 20, whereas the V1197A mutation dramatically decreased it. Thus, although mutant proteins were folded at 37 °C, they differ in conformational rigidity. Neither single substitutions nor double substitutions increased measurably the extent of FH19-20 self-association, nor did these mutations significantly affect the affinity of FH19-20 for three glycosaminoglycans, despite critical roles of module 20 in recognizing polyanionic self-surface markers. Unexpectedly, FH19-20 mutants containing Leu1191 self-associated on a heparin-coated surface to a higher degree than on surfaces coated with dermatan or chondroitin sulfates. Thus, potentially disease-related functional distinctions between mutants, and between FH and FH-related 1, may manifest in the presence of specific glycosaminoglycans.

  10. Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants.

    PubMed

    Nicolson, T; Rüsch, A; Friedrich, R W; Granato, M; Ruppersberg, J P; Nüsslein-Volhard, C

    1998-02-01

    The molecular basis of sensory hair cell mechanotransduction is largely unknown. In order to identify genes that are essential for mechanosensory hair cell function, we characterized a group of recently isolated zebrafish motility mutants. These mutants are defective in balance and swim in circles but have no obvious morphological defects. We examined the mutants using calcium imaging of acoustic-vibrational and tactile escape responses, high resolution microscopy of sensory neuroepithelia in live larvae, and recordings of extracellular hair cell potentials (microphonics). Based on the analyses, we have identified several classes of genes. Mutations in sputnik and mariner affect hair bundle integrity. Mutant astronaut and cosmonaut hair cells have relatively normal microphonics and thus appear to affect events downstream of mechanotransduction. Mutant orbiter, mercury, and gemini larvae have normal hair cell morphology and yet do not respond to acoustic-vibrational stimuli. The microphonics of lateral line hair cells of orbiter, mercury, and gemini larvae are absent or strongly reduced. Therefore, these genes may encode components of the transduction apparatus.

  11. Identification and characterization of a putative cyclic nucleotide-gated channel, CNG-1, in C. elegans.

    PubMed

    Cho, Suk-Woo; Cho, Jeong-Hoon; Song, Hyun-Ok; Park, Chul-Seung

    2005-02-28

    Cyclic nucleotide-gated (CNG) channels encoded by the tax-4 and tax-2 genes are required for chemosensing and thermosensing in the nematode C. elegans. We identified a gene in the C. elegans genome, which we designated cng-1, that is highly homologous to tax-4. Partial CNG-1 protein tagged with green fluorescent protein was expressed in several sensory neurons of the amphid. We created a deletion mutant of cng-1, cng-1 (jh111), to investigate its in vivo function. The mutant worms had no detectable abnormalities in terms of their basic behavior or morphology. Whereas tax-4 and tax-2 mutants failed to respond to water-soluble or volatile chemical attractants, the cng-1 null mutant exhibited normal chemotaxis to such chemicals and a tax-4;cng-1 double mutant had a similar phenotype to tax-4 single mutants. Interestingly, cng-1 and tax-4 had a synergistic effect on brood size.

  12. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd

    2016-01-01

    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

  13. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

    PubMed

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-05-01

    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

  14. Lack of hormone binding in COS-7 cells expressing a mutated growth hormone receptor found in Laron dwarfism.

    PubMed Central

    Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A

    1993-01-01

    A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064

  15. Mutant selection in the self-incompatible plant radish (Raphanus sativus L. var. sativus) using two-step TILLING

    PubMed Central

    Kohzuma, Kaori; Chiba, Motoko; Nagano, Soichiro; Anai, Toyoaki; Ueda, Miki U.; Oguchi, Riichi; Shirai, Kazumasa; Hanada, Kousuke; Hikosaka, Kouki; Fujii, Nobuharu

    2017-01-01

    Radish (Raphanus sativus L. var. sativus), a widely cultivated root vegetable crop, possesses a large sink organ (the root), implying that photosynthetic activity in radish can be enhanced by altering both the source and sink capacity of the plant. However, since radish is a self-incompatible plant, improved mutation-breeding strategies are needed for this crop. TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful method used for reverse genetics. In this study, we developed a new TILLING strategy involving a two-step mutant selection process for mutagenized radish plants: the first selection is performed to identify a BC1M1 line, that is, progenies of M1 plants crossed with wild-type, and the second step is performed to identify BC1M1 individuals with mutations. We focused on Rubisco as a target, since Rubisco is the most abundant plant protein and a key photosynthetic enzyme. We found that the radish genome contains six RBCS genes and one pseudogene encoding small Rubisco subunits. We screened 955 EMS-induced BC1M1 lines using our newly developed TILLING strategy and obtained six mutant lines for the six RsRBCS genes, encoding proteins with four different types of amino acid substitutions. Finally, we selected a homozygous mutant and subjected it to physiological measurements. PMID:28744180

  16. The Arabidopsis SOS5 Locus Encodes a Putative Cell Surface Adhesion Protein and Is Required for Normal Cell Expansion

    PubMed Central

    Shi, Huazhong; Kim, YongSig; Guo, Yan; Stevenson, Becky; Zhu, Jian-Kang

    2003-01-01

    Cell surface proteoglycans have been implicated in many aspects of plant growth and development, but genetic evidence supporting their function has been lacking. Here, we report that the Salt Overly Sensitive5 (SOS5) gene encodes a putative cell surface adhesion protein and is required for normal cell expansion. The sos5 mutant was isolated in a screen for Arabidopsis salt-hypersensitive mutants. Under salt stress, the root tips of sos5 mutant plants swell and root growth is arrested. The root-swelling phenotype is caused by abnormal expansion of epidermal, cortical, and endodermal cells. The SOS5 gene was isolated through map-based cloning. The predicted SOS5 protein contains an N-terminal signal sequence for plasma membrane localization, two arabinogalactan protein–like domains, two fasciclin-like domains, and a C-terminal glycosylphosphatidylinositol lipid anchor signal sequence. The presence of fasciclin-like domains, which typically are found in animal cell adhesion proteins, suggests a role for SOS5 in cell-to-cell adhesion in plants. The SOS5 protein was present at the outer surface of the plasma membrane. The cell walls are thinner in the sos5 mutant, and those between neighboring epidermal and cortical cells in sos5 roots appear less organized. SOS5 is expressed ubiquitously in all plant organs and tissues, including guard cells in the leaf. PMID:12509519

  17. Cytochrome oxidase assembly does not require catalytically active cytochrome C.

    PubMed

    Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

    2003-03-14

    Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

  18. Erect panicle2 encodes a novel protein that regulates panicle erectness in indica rice.

    PubMed

    Zhu, Keming; Tang, Ding; Yan, Changjie; Chi, Zhengchang; Yu, Hengxiu; Chen, Jianmin; Liang, Jiansheng; Gu, Minghong; Cheng, Zhukuan

    2010-02-01

    Rice (Oryza sativa L.) inflorescence (panicle) architecture is an important agronomic trait for rice breeding. A number of high-yielding japonica rice strains, characterized by an erect panicle (EP) of their architecture, have been released as commercial varieties in China. But no EP-type indica varieties are released so far. Here, we identified two allelic erect-panicle mutants in indica rice, erect panicle2-1 (ep2-1) and erect panicle2-2 (ep2-2), exhibiting the characteristic erect panicle phenotype. Both mutants were derived from spontaneous mutation. We cloned the EP2 gene by way of a map-based cloning strategy, and a transgenic complementation test rescued the phenotype of ep2-1. Anatomical investigations revealed that the ep2 mutants have more vascular bundles and a thicker stem than that of wild-type plants, explaining the panicle erectness phenotype in ep2 mutants. It was shown that EP2 was specifically expressed in the vascular bundles of internodes by GUS staining and RT-PCR. EP2 encodes a novel plant-specific protein, which localizes to the endoplasmic reticulum with unknown biochemical function. In addition, EP2 also regulates other panicle characteristics, such as panicle length and grain size, but grain number per panicle shows little change, indicating that the mutation of the ep2 gene could be applied in EP-type indica rice breeding.

  19. Brucella ovis PA mutants for outer membrane proteins Omp10, Omp19, SP41, and BepC are not altered in their virulence and outer membrane properties.

    PubMed

    Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves

    2016-04-15

    Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19-that encode two other outer membrane lipoproteins--was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Atf3 mutant mice show reduced axon regeneration and impaired regeneration-associated gene induction after peripheral nerve injury

    PubMed Central

    Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T.; Sinske, Daniela

    2016-01-01

    Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce ‘effector’ RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653

  1. MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

    PubMed

    Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

    2010-03-01

    Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

  2. Mg2+ Extrusion from Intestinal Epithelia by CNNM Proteins Is Essential for Gonadogenesis via AMPK-TORC1 Signaling in Caenorhabditis elegans

    PubMed Central

    Ishii, Tasuku; Funato, Yosuke; Hashizume, Osamu; Yamazaki, Daisuke; Hirata, Yusuke; Nishiwaki, Kiyoji; Kono, Nozomu; Arai, Hiroyuki; Miki, Hiroaki

    2016-01-01

    Mg2+ serves as an essential cofactor for numerous enzymes and its levels are tightly regulated by various Mg2+ transporters. Here, we analyzed Caenorhabditis elegans strains carrying mutations in genes encoding cyclin M (CNNM) Mg2+ transporters. We isolated inactivating mutants for each of the five Caenorhabditis elegans cnnm family genes, cnnm-1 through cnnm-5. cnnm-1; cnnm-3 double mutant worms showed various phenotypes, among which the sterile phenotype was rescued by supplementing the media with Mg2+. This sterility was caused by a gonadogenesis defect with severely attenuated proliferation of germ cells. Using this gonadogenesis defect as an indicator, we performed genome-wide RNAi screening, to search for genes associated with this phenotype. The results revealed that RNAi-mediated inactivation of several genes restores gonad elongation, including aak-2, which encodes the catalytic subunit of AMP-activated protein kinase (AMPK). We then generated triple mutant worms for cnnm-1; cnnm-3; aak-2 and confirmed that the aak-2 mutation also suppressed the defective gonadal elongation in cnnm-1; cnnm-3 mutant worms. AMPK is activated under low-energy conditions and plays a central role in regulating cellular metabolism to adapt to the energy status of cells. Thus, we provide genetic evidence linking Mg2+ homeostasis to energy metabolism via AMPK. PMID:27564576

  3. Life-span extension by dietary restriction is mediated by NLP-7 signaling and coelomocyte endocytosis in C. elegans.

    PubMed

    Park, Sang-Kyu; Link, Christopher D; Johnson, Thomas E

    2010-02-01

    Recent studies have shown that the rate of aging can be modulated by diverse interventions. Dietary restriction is the most widely used intervention to promote longevity; however, the mechanisms underlying the effect of dietary restriction remain elusive. In a previous study, we identified two novel genes, nlp-7 and cup-4, required for normal longevity in Caenorhabditis elegans. nlp-7 is one of a set of neuropeptide-like protein genes; cup-4 encodes an ion-channel involved in endocytosis by coelomocytes. Here, we assess whether nlp-7 and cup-4 mediate longevity increases by dietary restriction. RNAi of nlp-7 or cup-4 significantly reduces the life span of the eat-2 mutant, a genetic model of dietary restriction, but has no effect on the life span of long-lived mutants resulting from reduced insulin/IGF-1 signaling or dysfunction of the mitochondrial electron transport chain. The life-span extension observed in wild-type N2 worms by dietary restriction using bacterial dilution is prevented significantly in nlp-7 and cup-4 mutants. RNAi knockdown of genes encoding candidate receptors of NLP-7 and genes involved in endocytosis by coelomocytes also specifically shorten the life span of the eat-2 mutant. We conclude that two novel pathways, NLP-7 signaling and endocytosis by coelomocytes, are required for life extension under dietary restriction in C. elegans.

  4. rigor mortis encodes a novel nuclear receptor interacting protein required for ecdysone signaling during Drosophila larval development.

    PubMed

    Gates, Julie; Lam, Geanette; Ortiz, José A; Losson, Régine; Thummel, Carl S

    2004-01-01

    Pulses of the steroid hormone ecdysone trigger the major developmental transitions in Drosophila, including molting and puparium formation. The ecdysone signal is transduced by the EcR/USP nuclear receptor heterodimer that binds to specific response elements in the genome and directly regulates target gene transcription. We describe a novel nuclear receptor interacting protein encoded by rigor mortis (rig) that is required for ecdysone responses during larval development. rig mutants display defects in molting, delayed larval development, larval lethality, duplicated mouth parts, and defects in puparium formation--phenotypes that resemble those seen in EcR, usp, E75A and betaFTZ-F1 mutants. Although the expression of these nuclear receptor genes is essentially normal in rig mutant larvae, the ecdysone-triggered switch in E74 isoform expression is defective. rig encodes a protein with multiple WD-40 repeats and an LXXLL motif, sequences that act as specific protein-protein interaction domains. Consistent with the presence of these elements and the lethal phenotypes of rig mutants, Rig protein interacts with several Drosophila nuclear receptors in GST pull-down experiments, including EcR, USP, DHR3, SVP and betaFTZ-F1. The ligand binding domain of betaFTZ-F1 is sufficient for this interaction, which can occur in an AF-2-independent manner. Antibody stains reveal that Rig protein is present in the brain and imaginal discs of second and third instar larvae, where it is restricted to the cytoplasm. In larval salivary gland and midgut cells, however, Rig shuttles between the cytoplasm and nucleus in a spatially and temporally regulated manner, at times that correlate with the major lethal phase of rig mutants and major switches in ecdysone-regulated gene expression. Taken together, these data indicate that rig exerts essential functions during larval development through gene-specific effects on ecdysone-regulated transcription, most likely as a cofactor for one or more nuclear receptors. Furthermore, the dynamic intracellular redistribution of Rig protein suggests that it may act to refine spatial and temporal responses to ecdysone during development.

  5. Key Enzymes of the Semiphosphorylative Entner-Doudoroff Pathway in the Haloarchaeon Haloferax volcanii: Characterization of Glucose Dehydrogenase, Gluconate Dehydratase, and 2-Keto-3-Deoxy-6-Phosphogluconate Aldolase.

    PubMed

    Sutter, Jan-Moritz; Tästensen, Julia-Beate; Johnsen, Ulrike; Soppa, Jörg; Schönheit, Peter

    2016-08-15

    The halophilic archaeon Haloferax volcanii has been proposed to degrade glucose via the semiphosphorylative Entner-Doudoroff (spED) pathway. So far, the key enzymes of this pathway, glucose dehydrogenase (GDH), gluconate dehydratase (GAD), and 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase (KDPGA), have not been characterized, and their functional involvement in glucose degradation has not been demonstrated. Here we report that the genes HVO_1083 and HVO_0950 encode GDH and KDPGA, respectively. The recombinant enzymes show high specificity for glucose and KDPG and did not convert the corresponding C4 epimers galactose and 2-keto-3-deoxy-6-phosphogalactonate at significant rates. Growth studies of knockout mutants indicate the functional involvement of both GDH and KDPGA in glucose degradation. GAD was purified from H. volcanii, and the encoding gene, gad, was identified as HVO_1488. GAD catalyzed the specific dehydration of gluconate and did not utilize galactonate at significant rates. A knockout mutant of GAD lost the ability to grow on glucose, indicating the essential involvement of GAD in glucose degradation. However, following a prolonged incubation period, growth of the Δgad mutant on glucose was recovered. Evidence is presented that under these conditions, GAD was functionally replaced by xylonate dehydratase (XAD), which uses both xylonate and gluconate as substrates. Together, the characterization of key enzymes and analyses of the respective knockout mutants present conclusive evidence for the in vivo operation of the spED pathway for glucose degradation in H. volcanii The work presented here describes the identification and characterization of the key enzymes glucose dehydrogenase, gluconate dehydratase, and 2-keto-3-deoxy-6-phosphogluconate aldolase and their encoding genes of the proposed semiphosphorylative Entner-Doudoroff pathway in the haloarchaeon Haloferax volcanii The functional involvement of the three enzymes was proven by analyses of the corresponding knockout mutants. These results provide evidence for the in vivo operation of the semiphosphorylative Entner-Doudoroff pathway in haloarchaea and thus expand our understanding of the unusual sugar degradation pathways in the domain Archaea. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Adenovirus-mediated interleukin-18 mutant in vivo gene transfer inhibits tumor growth through the induction of T cell immunity and activation of natural killer cell cytotoxicity.

    PubMed

    Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Seong, Young Rim; Kim, Bum-Kyeng; Kim, Samyong; Im, Dong-Soo

    2004-06-01

    We report here that gene transfer using recombinant adenoviruses encoding interleukin (IL)-18 mutants induces potent antitumor activity in vivo. The precursor form of IL-18 (ProIL-18) is processed by caspase-1 to produce bioactive IL-18, but its cleavage by caspase-3 (CPP32) produces an inactive form. To prepare IL-18 molecules with an effective antitumor activity, a murine IL-18 mutant with the signal sequence of murine granulocyte-macrophage (GM)- colony stimulating factor (CSF) at the 5'-end of mature IL-18 cDNA (GMmIL-18) and human IL-18 mutant with the prepro leader sequence of trypsin (PPT), which is not cleaved by caspase-3 (PPThIL-18CPP32-), respectively, were constructed. Adenovirus vectors carrying GMmIL-18 or PPThIL-18CPP32- produced bioactive IL-18. Ad.GMmIL-18 had a more potent antitumor effect than Ad.mProIL-18 encoding immature IL-18 in renal cell adenocarcinoma (Renca) tumor-bearing mice. Tumor-specific cytotoxic T lymphocytes, the induction of Th1 cytokines, and an augmented natural killer (NK) cell activity were detected in Renca tumor-bearing mice treated with Ad.GMmIL-18. An immunohistological analysis revealed that CD4+ and CD8+ T cells abundantly infiltrated into tumors of mice treated with Ad.GMmIL-18. Huh-7 human hepatoma tumor growth in nude mice with a defect of T cell function was significantly inhibited by Ad.PPThIL-18CPP32- compared with Ad.hProIL-18 encoding immature IL-18. Nude mice treated with Ad.PPThIL-18CPP32- contained NK cells with increased cytotoxicity. The results suggest that the release of mature IL-18 in tumors is required for achieving an antitumor effect including tumor-specific cellular immunity and augmented NK cell-mediated cytotoxicity. These optimally designed IL-18 mutants could be useful for improving the antitumor effectiveness of wild-type IL-18. Copyright 2004 Nature Publishing Group

  7. Of the Nine Cytidine Deaminase-Like Genes in Arabidopsis, Eight Are Pseudogenes and Only One Is Required to Maintain Pyrimidine Homeostasis in Vivo1

    PubMed Central

    2016-01-01

    CYTIDINE DEAMINASE (CDA) catalyzes the deamination of cytidine to uridine and ammonia in the catabolic route of C nucleotides. The Arabidopsis (Arabidopsis thaliana) CDA gene family comprises nine members, one of which (AtCDA) was shown previously in vitro to encode an active CDA. A possible role in C-to-U RNA editing or in antiviral defense has been discussed for other members. A comprehensive bioinformatic analysis of plant CDA sequences, combined with biochemical functionality tests, strongly suggests that all Arabidopsis CDA family members except AtCDA are pseudogenes and that most plants only require a single CDA gene. Soybean (Glycine max) possesses three CDA genes, but only two encode functional enzymes and just one has very high catalytic efficiency. AtCDA and soybean CDAs are located in the cytosol. The functionality of AtCDA in vivo was demonstrated with loss-of-function mutants accumulating high amounts of cytidine but also CMP, cytosine, and some uridine in seeds. Cytidine hydrolysis in cda mutants is likely caused by NUCLEOSIDE HYDROLASE1 (NSH1) because cytosine accumulation is strongly reduced in a cda nsh1 double mutant. Altered responses of the cda mutants to fluorocytidine and fluorouridine indicate that a dual specific nucleoside kinase is involved in cytidine as well as uridine salvage. CDA mutants display a reduction in rosette size and have fewer leaves compared with the wild type, which is probably not caused by defective pyrimidine catabolism but by the accumulation of pyrimidine catabolism intermediates reaching toxic concentrations. PMID:27208239

  8. A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

    PubMed

    Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

    2013-05-01

    A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

  9. Whole-transcriptome RNA-seq, gene set enrichment pathway analysis, and exon coverage analysis of two plastid RNA editing mutants.

    PubMed

    Hackett, Justin B; Lu, Yan

    2017-05-04

    In land plants, plastid and mitochondrial RNAs are subject to post-transcriptional C-to-U RNA editing. T-DNA insertions in the ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 gene resulted in reduced photosystem II (PSII) activity and smaller plant and leaf sizes. Exon coverage analysis of the ORRM6 gene showed that orrm6-1 and orrm6-2 are loss-of-function mutants. Compared to other ORRM proteins, ORRM6 affects a relative small number of RNA editing sites. Sanger sequencing of reverse transcription-PCR products of plastid transcripts revealed 2 plastid RNA editing sites that are substantially affected in the orrm6 mutants: psbF-C77 and accD-C794. The psbF gene encodes the β subunit of cytochrome b 559 , an essential component of PSII. The accD gene encodes the β subunit of acetyl-CoA carboxylase, a protein required in plastid fatty acid biosynthesis. Whole-transcriptome RNA-seq demonstrated that editing at psbF-C77 is nearly absent and the editing extent at accD-C794 was significantly reduced. Gene set enrichment pathway analysis showed that expression of multiple gene sets involved in photosynthesis, especially photosynthetic electron transport, is significantly upregulated in both orrm6 mutants. The upregulation could be a mechanism to compensate for the reduced PSII electron transport rate in the orrm6 mutants. These results further demonstrated that Organelle RNA Recognition Motif protein ORRM6 is required in editing of specific RNAs in the Arabidopsis (Arabidopsis thaliana) plastid.

  10. Identification of Potential Virulence Determinants by Himar1 Transposition of Infectious Borrelia burgdorferi B31▿

    PubMed Central

    Botkin, Douglas J.; Abbott, April N.; Stewart, Philip E.; Rosa, Patricia A.; Kawabata, Hiroki; Watanabe, Haruo; Norris, Steven J.

    2006-01-01

    Lyme disease Borrelia organisms are highly invasive spirochetes that alternate between vertebrate and arthropod hosts and that establish chronic infections and elicit inflammatory reactions in mammals. Although progress has been made in the targeted mutagenesis of individual genes in infectious Borrelia burgdorferi, the roles of the vast majority of gene products in pathogenesis remain unresolved. In this study, we examined the feasibility of using transposon mutagenesis to identify infectivity-related factors in B. burgdorferi. The transformable, infectious strain 5A18 NP1 was transformed with the spirochete-adapted Himar1 transposon delivery vector pMarGent to create a small library of 33 insertion mutants. Single mouse inoculations followed by culture of four tissue sites and serology were used to screen the mutants for infectivity phenotypes. Mutants that appeared attenuated (culture positive at some sites) or noninfectious (negative at all sites) and contained the virulence-associated plasmids lp25 and lp28-1 were examined in more extensive animal studies. Three of these mutants (including those with insertions in the putative fliG-1-encoded flagellar motor switch protein and the guaB-encoded IMP dehydrogenase) were noninfectious, whereas four clones appeared to exhibit reduced infectivity. Serological reactivity in VlsE enzyme-linked immunosorbent assays correlated with the assignment of mutants to the noninfectious or attenuated-infectivity groups. The results of this study indicate that random transposon mutagenesis of infectious B. burgdorferi is feasible and will be of value in studying the pathogenesis of Lyme disease Borrelia. PMID:17015459

  11. tassel-less1 encodes a boron channel protein required for inflorescence development in maize.

    PubMed

    Leonard, April; Holloway, Beth; Guo, Mei; Rupe, Mary; Yu, GongXin; Beatty, Mary; Zastrow-Hayes, Gina; Meeley, Robert; Llaca, Victor; Butler, Karlene; Stefani, Tony; Jaqueth, Jennifer; Li, Bailin

    2014-06-01

    tassel-less1 (tls1) is a classical maize (Zea mays) inflorescence mutant. Homozygous mutant plants have no tassels or very small tassels, and ear development is also impaired. Using a positional cloning approach, ZmNIP3;1 (a NOD26-like intrinsic protein) was identified as the candidate gene for tls1. The ZmNIP3;1 gene is completely deleted in the tls1 mutant genome. Two Mutator-insertional TUSC alleles of ZmNIP3;1 exhibited tls1-like phenotypes, and allelism tests confirmed that the tls1 gene encodes ZmNIP3;1. Transgenic plants with an RNA interference (RNAi) construct to down-regulate ZmNIP3;1 also showed tls1-like phenotypes, further demonstrating that TLS1 is ZmNIP3;1. Sequence analysis suggests that ZmNIP3;1 is a boron channel protein. Foliar application of boron could rescue the tls1 phenotypes and restore the normal tassel and ear development. Gene expression analysis indicated that in comparison with that of the wild type or tls1 plants treated with boron, the transition from the vegetative to reproductive phase or the development of the floral meristem is impaired in the shoot apical meristem of the tls1 mutant plants. It is concluded that the tls1 mutant phenotypes are caused by impaired boron transport, and boron is essential for inflorescence development in maize. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. The RNA Chaperone Hfq Promotes Fitness of Actinobacillus pleuropneumoniae during Porcine Pleuropneumonia

    PubMed Central

    Subashchandrabose, Sargurunathan; Leveque, Rhiannon M.; Kirkwood, Roy N.; Kiupel, Matti

    2013-01-01

    Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, an economically important disease of pigs. The hfq gene in A. pleuropneumoniae, encoding the RNA chaperone and posttranscriptional regulator Hfq, is upregulated during infection of porcine lungs. To investigate the role of this in vivo-induced gene in A. pleuropneumoniae, an hfq mutant strain was constructed. The hfq mutant was defective in biofilm formation on abiotic surfaces. The level of pgaC transcript, encoding the biosynthesis of poly-β-1,6-N-acetylglucosamine (PNAG), a major biofilm matrix component, was lower and PNAG content was 10-fold lower in the hfq mutant than in the wild-type strain. When outer membrane proteins were examined, cysteine synthase, implicated in resistance to oxidative stress and tellurite, was not found at detectable levels in the absence of Hfq. The hfq mutant displayed enhanced sensitivity to superoxide generated by methyl viologen and tellurite. These phenotypes were readily reversed by complementation with the hfq gene expressed from its native promoter. The role of Hfq in the fitness of A. pleuropneumoniae was assessed in a natural host infection model. The hfq mutant failed to colonize porcine lungs and was outcompeted by the wild-type strain (median competitive index of 2 × 10−5). Our data demonstrate that the in vivo-induced gene hfq is involved in the regulation of PNAG-dependent biofilm formation, resistance to superoxide stress, and the fitness and virulence of A. pleuropneumoniae in pigs and begin to elucidate the role of an in vivo-induced gene in the pathogenesis of pleuropneumonia. PMID:23732171

  13. Acyl-chain remodeling of dioctanoyl-phosphatidylcholine in Saccharomyces cerevisiae mutant defective in de novo and salvage phosphatidylcholine synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kishino, Hideyuki; Eguchi, Hiroki; Takagi, Keiko

    2014-03-07

    Highlights: • Dioctanoyl-PC (diC8PC) supported growth of a yeast mutant defective in PC synthesis. • diC8PC was converted to PC species containing longer acyl residues in the mutant. • Both acyl residues of diC8PC were replaced by longer fatty acids in vitro. • This system will contribute to the elucidation of the acyl chain remodeling of PC. - Abstract: A yeast strain, in which endogenous phosphatidylcholine (PC) synthesis is controllable, was constructed by the replacement of the promoter of PCT1, encoding CTP:phosphocholine cytidylyltransferase, with GAL1 promoter in a double deletion mutant of PEM1 and PEM2, encoding phosphatidylethanolamine methyltransferase and phospholipidmore » methyltransferase, respectively. This mutant did not grow in the glucose-containing medium, but the addition of dioctanoyl-phosphatidylcholine (diC8PC) supported its growth. Analyses of the metabolism of {sup 13}C-labeled diC8PC ((methyl-{sup 13}C){sub 3}-diC8PC) in this strain using electrospray ionization tandem mass spectrometry revealed that it was converted to PC species containing acyl residues of 16 or 18 carbons at both sn-1 and sn-2 positions. In addition, both acyl residues of (methyl-{sup 13}C){sub 3}-diC8PC were replaced with 16:1 acyl chains in the in vitro reaction using the yeast cell extract in the presence of palmitoleoyl-CoA. These results indicate that PC containing short acyl residues was remodeled to those with acyl chains of physiological length in yeast.« less

  14. B56δ-related protein phosphatase 2A dysfunction identified in patients with intellectual disability

    PubMed Central

    Houge, Gunnar; Haesen, Dorien; Vissers, Lisenka E.L.M.; Mehta, Sarju; Parker, Michael J.; Wright, Michael; Vogt, Julie; McKee, Shane; Tolmie, John L.; Cordeiro, Nuno; Kleefstra, Tjitske; Willemsen, Marjolein H.; Reijnders, Margot R.F.; Berland, Siren; Hayman, Eli; Lahat, Eli; Brilstra, Eva H.; van Gassen, Koen L.I.; Zonneveld-Huijssoon, Evelien; de Bie, Charlotte I.; Hoischen, Alexander; Eichler, Evan E.; Holdhus, Rita; Steen, Vidar M.; Døskeland, Stein Ove; Hurles, Matthew E.; FitzPatrick, David R.; Janssens, Veerle

    2015-01-01

    Here we report inherited dysregulation of protein phosphatase activity as a cause of intellectual disability (ID). De novo missense mutations in 2 subunits of serine/threonine (Ser/Thr) protein phosphatase 2A (PP2A) were identified in 16 individuals with mild to severe ID, long-lasting hypotonia, epileptic susceptibility, frontal bossing, mild hypertelorism, and downslanting palpebral fissures. PP2A comprises catalytic (C), scaffolding (A), and regulatory (B) subunits that determine subcellular anchoring, substrate specificity, and physiological function. Ten patients had mutations within a highly conserved acidic loop of the PPP2R5D-encoded B56δ regulatory subunit, with the same E198K mutation present in 6 individuals. Five patients had mutations in the PPP2R1A-encoded scaffolding Aα subunit, with the same R182W mutation in 3 individuals. Some Aα cases presented with large ventricles, causing macrocephaly and hydrocephalus suspicion, and all cases exhibited partial or complete corpus callosum agenesis. Functional evaluation revealed that mutant A and B subunits were stable and uncoupled from phosphatase activity. Mutant B56δ was A and C binding–deficient, while mutant Aα subunits bound B56δ well but were unable to bind C or bound a catalytically impaired C, suggesting a dominant-negative effect where mutant subunits hinder dephosphorylation of B56δ-anchored substrates. Moreover, mutant subunit overexpression resulted in hyperphosphorylation of GSK3β, a B56δ-regulated substrate. This effect was in line with clinical observations, supporting a correlation between the ID degree and biochemical disturbance. PMID:26168268

  15. UDP-glucose Dehydrogenase Polymorphisms from Patients with Congenital Heart Valve Defects Disrupt Enzyme Stability and Quaternary Assembly*

    PubMed Central

    Hyde, Annastasia S.; Farmer, Erin L.; Easley, Katherine E.; van Lammeren, Kristy; Christoffels, Vincent M.; Barycki, Joseph J.; Bakkers, Jeroen; Simpson, Melanie A.

    2012-01-01

    Cardiac valve defects are a common congenital heart malformation and a significant clinical problem. Defining molecular factors in cardiac valve development has facilitated identification of underlying causes of valve malformation. Gene disruption in zebrafish revealed a critical role for UDP-glucose dehydrogenase (UGDH) in valve development, so this gene was screened for polymorphisms in a patient population suffering from cardiac valve defects. Two genetic substitutions were identified and predicted to encode missense mutations of arginine 141 to cysteine and glutamate 416 to aspartate, respectively. Using a zebrafish model of defective heart valve formation caused by morpholino oligonucleotide knockdown of UGDH, transcripts encoding the UGDH R141C or E416D mutant enzymes were unable to restore cardiac valve formation and could only partially rescue cardiac edema. Characterization of the mutant recombinant enzymes purified from Escherichia coli revealed modest alterations in the enzymatic activity of the mutants and a significant reduction in the half-life of enzyme activity at 37 °C. This reduction in activity could be propagated to the wild-type enzyme in a 1:1 mixed reaction. Furthermore, the quaternary structure of both mutants, normally hexameric, was destabilized to favor the dimeric species, and the intrinsic thermal stability of the R141C mutant was highly compromised. The results are consistent with the reduced function of both missense mutations significantly reducing the ability of UGDH to provide precursors for cardiac cushion formation, which is essential to subsequent valve formation. The identification of these polymorphisms in patient populations will help identify families genetically at risk for valve defects. PMID:22815472

  16. Mutant fatty acid desaturase and methods for directed mutagenesis

    DOEpatents

    Shanklin, John [Shoreham, NY; Whittle, Edward J [Greenport, NY

    2008-01-29

    The present invention relates to methods for producing fatty acid desaturase mutants having a substantially increased activity towards substrates with fewer than 18 carbon atom chains relative to an unmutagenized precursor desaturase having an 18 carbon chain length specificity, the sequences encoding the desaturases and to the desaturases that are produced by the methods. The present invention further relates to a method for altering a function of a protein, including a fatty acid desaturase, through directed mutagenesis involving identifying candidate amino acid residues, producing a library of mutants of the protein by simultaneously randomizing all amino acid candidates, and selecting for mutants which exhibit the desired alteration of function. Candidate amino acids are identified by a combination of methods. Enzymatic, binding, structural and other functions of proteins can be altered by the method.

  17. Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

    PubMed Central

    Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

    1999-01-01

    Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

  18. Genetically engineered mutant of the cyanobacterium Synechocystis 6803 lacks the photosystem II chlorophyll-binding protein CP-47

    PubMed Central

    Vermaas, Wim F. J.; Williams, John G. K.; Rutherford, A. William; Mathis, Paul; Arntzen, Charles J.

    1986-01-01

    CP-47 is absent in a genetically engineered mutant of cyanobacterium Synechocystis 6803, in which the psbB gene [encoding the chlorophyll-binding photosystem II (PSII) protein CP-47] was interrupted. Another chlorophyll-binding PSII protein, CP-43, is present in the mutant, and functionally inactive PSII-enriched particles can be isolated from mutant thylakoids. We interpret these data as indicating that the PSII core complex of the mutant still assembles in the absence of CP-47. The mutant lacks a 77 K fluorescence emission maximum at 695 nm, suggesting that the PSII reaction center is not functional. The absence of primary photochemistry was indicated by EPR and optical measurements: no chlorophyll triplet originating from charge recombination between P680+ and Pheo- was observed in the mutant, and there were no flash-induced absorption changes at 820 nm attributable to chlorophyll P680 oxidation. These observations lead us to conclude that CP-47 plays an essential role in the activity of the PSII reaction center. Images PMID:16593788

  19. Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

    PubMed

    Han, Gil-Soo; Carman, George M

    2017-08-11

    The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Imp2, the PSTPIP homolog in fission yeast, affects sensitivity to the immunosuppressant FK506 and membrane trafficking in fission yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kita, Ayako; Higa, Mari; Doi, Akira

    Cytokinesis is a highly ordered process that divides one cell into two cells, which is functionally linked to the dynamic remodeling of the plasma membrane coordinately with various events such as membrane trafficking. Calcineurin is a highly conserved serine/threonine protein phosphatase, which regulates multiple biological functions, such as membrane trafficking and cytokinesis. Here, we isolated imp2-c3, a mutant allele of the imp2{sup +} gene, encoding a homolog of the mouse PSTPIP1 (proline-serine-threonine phosphatase interacting protein 1), using a genetic screen for mutations that are synthetically lethal with calcineurin deletion in fission yeast. The imp2-c3 mutants showed a defect in cytokinesis withmore » multi-septated phenotypes, which was further enhanced upon treatment with the calcineurin inhibitor FK506. Notably, electron micrographs revealed that the imp2-c3 mutant cells accumulated aberrant multi-lamella Golgi structures and putative post-Golgi secretory vesicles, and exhibited fragmented vacuoles in addition to thickened septa. Consistently, imp2-c3 mutants showed a reduced secretion of acid phosphatase and defects in vacuole fusion. The imp2-c3 mutant cells exhibited a weakened cell wall, similar to the membrane trafficking mutants identified in the same genetic screen such as ypt3-i5. These findings implicate the PSTPIP1 homolog Imp2 in Golgi/vacuole function, thereby affecting various cellular processes, including cytokinesis and cell integrity. - Highlights: • We isolated imp2-c3, in a synthetic lethal screen with calcineurin in fission yeast. • The imp2{sup +} gene encodes a component of the actin contractile ring similar to Cdc15. • The imp2-c3 mutants showed defects in cytokinesis, which were exacerbated by FK506. • The imp2-c3 mutants were defective in membrane trafficking and cell wall integrity. • Our study revealed a novel role for Imp2 in the Golgi/vacuolar membrane trafficking.« less

  1. The yersiniabactin transport system is critical for the pathogenesis of bubonic and pneumonic plague.

    PubMed

    Fetherston, Jacqueline D; Kirillina, Olga; Bobrov, Alexander G; Paulley, James T; Perry, Robert D

    2010-05-01

    Iron acquisition from the host is an important step in the pathogenic process. While Yersinia pestis has multiple iron transporters, the yersiniabactin (Ybt) siderophore-dependent system plays a major role in iron acquisition in vitro and in vivo. In this study, we determined that the Ybt system is required for the use of iron bound by transferrin and lactoferrin and examined the importance of the Ybt system for virulence in mouse models of bubonic and pneumonic plague. Y. pestis mutants unable to either transport Ybt or synthesize the siderophore were both essentially avirulent via subcutaneous injection (bubonic plague model). Surprisingly, via intranasal instillation (pneumonic plague model), we saw a difference in the virulence of Ybt biosynthetic and transport mutants. Ybt biosynthetic mutants displayed an approximately 24-fold-higher 50% lethal dose (LD(50)) than transport mutants. In contrast, under iron-restricted conditions in vitro, a Ybt transport mutant had a more severe growth defect than the Ybt biosynthetic mutant. Finally, a Delta pgm mutant had a greater loss of virulence than the Ybt biosynthetic mutant, indicating that the 102-kb pgm locus encodes a virulence factor, in addition to Ybt, that plays a role in the pathogenesis of pneumonic plague.

  2. CSL encodes a leucine-rich-repeat protein implicated in red/violet light signaling to the circadian clock in Chlamydomonas

    PubMed Central

    Kinoshita, Ayumi; Niwa, Yoshimi; Onai, Kiyoshi; Fukuzawa, Hideya; Ishiura, Masahiro

    2017-01-01

    The green alga Chlamydomonas reinhardtii shows various light responses in behavior and physiology. One such photoresponse is the circadian clock, which can be reset by external light signals to entrain its oscillation to daily environmental cycles. In a previous report, we suggested that a light-induced degradation of the clock protein ROC15 is a trigger to reset the circadian clock in Chlamydomonas. However, light signaling pathways of this process remained unclear. Here, we screened for mutants that show abnormal ROC15 diurnal rhythms, including the light-induced protein degradation at dawn, using a luciferase fusion reporter. In one mutant, ROC15 degradation and phase resetting of the circadian clock by light were impaired. Interestingly, the impairments were observed in response to red and violet light, but not to blue light. We revealed that an uncharacterized gene encoding a protein similar to RAS-signaling-related leucine-rich repeat (LRR) proteins is responsible for the mutant phenotypes. Our results indicate that a previously uncharacterized red/violet light signaling pathway is involved in the phase resetting of circadian clock in Chlamydomonas. PMID:28333924

  3. The Drosophila mitochondrial translation elongation factor G1 contains a nuclear localization signal and inhibits growth and DPP signaling.

    PubMed

    Trivigno, Catherine; Haerry, Theodor E

    2011-02-25

    Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low.

  4. The Drosophila Mitochondrial Translation Elongation Factor G1 Contains a Nuclear Localization Signal and Inhibits Growth and DPP Signaling

    PubMed Central

    Trivigno, Catherine; Haerry, Theodor E.

    2011-01-01

    Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low. PMID:21364917

  5. Congenital amegakaryocytic thrombocytopenia in three siblings: molecular analysis of atypical clinical presentation.

    PubMed

    Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G

    2005-10-01

    An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.

  6. Emergence of a bacterial clone with enhanced virulence by acquisition of a phage encoding a secreted phospholipase A2.

    PubMed

    Sitkiewicz, Izabela; Nagiec, Michal J; Sumby, Paul; Butler, Stephanie D; Cywes-Bentley, Colette; Musser, James M

    2006-10-24

    The molecular basis of pathogen clone emergence is relatively poorly understood. Acquisition of a bacteriophage encoding a previously unknown secreted phospholipase A(2) (designated SlaA) has been implicated in the rapid emergence in the mid-1980s of a new hypervirulent clone of serotype M3 group A Streptococcus. Although several lines of circumstantial evidence suggest that SlaA is a virulence factor, this issue has not been addressed experimentally. We found that an isogenic DeltaslaA mutant strain was significantly impaired in ability to adhere to and kill human epithelial cells compared with the wild-type parental strain. The mutant strain was less virulent for mice than the wild-type strain, and immunization with purified SlaA significantly protected mice from invasive disease. Importantly, the mutant strain was significantly attenuated for colonization in a monkey model of pharyngitis. We conclude that transductional acquisition of the ability of a GAS strain to produce SlaA enhanced the spread and virulence of the serotype M3 precursor strain. Hence, these studies identified a crucial molecular event underlying the evolution, rapid emergence, and widespread dissemination of unusually severe human infections caused by a distinct bacterial clone.

  7. Regulation of Compound Leaf Development by PHANTASTICA in Medicago truncatula1[C][W][OPEN

    PubMed Central

    Ge, Liangfa; Peng, Jianling; Berbel, Ana; Madueño, Francisco; Chen, Rujin

    2014-01-01

    Plant leaves, simple or compound, initiate as peg-like structures from the peripheral zone of the shoot apical meristem, which requires class I KNOTTED-LIKE HOMEOBOXI (KNOXI) transcription factors to maintain its activity. The MYB domain protein encoded by the ASYMMETRIC LEAVES1/ROUGH SHEATH2/PHANTASTICA (ARP) gene, together with other factors, excludes KNOXI gene expression from incipient leaf primordia to initiate leaves and specify leaf adaxial identity. However, the regulatory relationship between ARP and KNOXI is more complex in compound-leafed species. Here, we investigated the role of ARP and KNOXI genes in compound leaf development in Medicago truncatula. We show that the M. truncatula phantastica mutant exhibited severe compound leaf defects, including curling and deep serration of leaf margins, shortened petioles, increased rachises, petioles acquiring motor organ characteristics, and ectopic development of petiolules. On the other hand, the M. truncatula brevipedicellus mutant did not exhibit visible compound leaf defects. Our analyses show that the altered petiole development requires ectopic expression of ELONGATED PETIOLULE1, which encodes a lateral organ boundary domain protein, and that the distal margin serration requires the auxin efflux protein M. truncatula PIN-FORMED10 in the M. truncatula phantastica mutant. PMID:24218492

  8. Harvesting of novel polyhydroxyalkanaote (PHA) synthase encoding genes from a soil metagenome library using phenotypic screening.

    PubMed

    Schallmey, Marcus; Ly, Anh; Wang, Chunxia; Meglei, Gabriela; Voget, Sonja; Streit, Wolfgang R; Driscoll, Brian T; Charles, Trevor C

    2011-08-01

    We previously reported the construction of metagenomic libraries in the IncP cosmid vector pRK7813, enabling heterologous expression of these broad-host-range libraries in multiple bacterial hosts. Expressing these libraries in Sinorhizobium meliloti, we have successfully complemented associated phenotypes of polyhydroxyalkanoate synthesis mutants. DNA sequence analysis of three clones indicates that the complementing genes are homologous to, but substantially different from, known polyhydroxyalkanaote synthase-encoding genes. Thus we have demonstrated the ability to isolate diverse genes for polyhydroxyalkanaote synthesis by functional complementation of defined mutants. Such genes might be of use in the engineering of more efficient systems for the industrial production of bioplastics. The use of functional complementation will also provide a vehicle to probe the genetics of polyhydroxyalkanaote metabolism and its relation to carbon availability in complex microbial assemblages. 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. The Stress-Responsive dgk Gene from Streptococcus mutans Encodes a Putative Undecaprenol Kinase Activity

    PubMed Central

    Lis, Maciej; Kuramitsu, Howard K.

    2003-01-01

    We analyzed a previously constructed stress-sensitive Streptococcus mutans mutant Tn-1 strain resulting from disruption by transposon Tn916 of a gene encoding a protein exhibiting amino acid sequence similarity to the Escherichia coli diacylglycerol kinase. It was confirmed that the mutation led to significantly reduced lipid kinase activity, while expression of the intact gene on a plasmid restored both kinase activity and the wild-type phenotype. Further analysis revealed that the product of the dgk gene in S. mutans predominantly recognizes a lipid substrate other than diacylglycerol, most likely undecaprenol, as demonstrated by its efficient phosphorylation and the resistance of the product of the reaction to saponification. The physiological role of the product of the dgk gene as a putative undecaprenol kinase was further supported by a significantly higher sensitivity of the mutant to bacitracin compared with that of the parental strain. PMID:12654811

  10. Type II thioesterase gene (ECO-orf27) from Amycolatopsis orientalis influences production of the polyketide antibiotic, ECO-0501 (LW01).

    PubMed

    Shen, Yang; Huang, He; Zhu, Li; Luo, Minyu; Chen, Daijie

    2012-11-01

    ECO-orf27 associated with the cluster of ECO-0501 (LW01) from Amycolatopsis orientalis is deduced to encode a type II thioesterase. Disruption of ECO-orf27 reduced LW01 production by 95 %. Complementation of the disrupted mutant with intact ECO-orf27 restored the production of LW01 suggesting that ECO-orf27 is crucial for LW01 biosynthesis. ECO-TE I, the gene encoding type I thioesterase from LW01 polyketide synthases, cannot complement ECO-orf27 deficient mutant distinguishing ECO-orf27 from type I thioesterase gene. Type II thioesterase gene pikAV from Streptomyces venezuelae could complement ECO-orf27 in A. orientalis indicating that the two genes are equivalent in their function. Overexpression of ECO-orf27 resulted in a 20 % increase in LW01 production providing an alternative approach for yield improvement.

  11. Molecular and Mutational Analysis of a Gelsolin-Family Member Encoded by the Flightless I Gene of Drosophila Melanogaster

    PubMed Central

    de-Couet, H. G.; Fong, KSK.; Weeds, A. G.; McLaughlin, P. J.; Miklos, GLG.

    1995-01-01

    The flightless locus of Drosophila melanogaster has been analyzed at the genetic, molecular, ultrastructural and comparative crystallographic levels. The gene encodes a single transcript encoding a protein consisting of a leucine-rich amino terminal half and a carboxyterminal half with high sequence similarity to gelsolin. We determined the genomic sequence of the flightless landscape, the breakpoints of four chromosomal rearrangements, and the molecular lesions in two lethal and two viable alleles of the gene. The two alleles that lead to flight muscle abnormalities encode mutant proteins exhibiting amino acid replacements within the S1-like domain of their gelsolin-like region. Furthermore, the deduced intronexon structure of the D. melanogaster gene has been compared with that of the Caenorhabditis elegans homologue. Furthermore, the sequence similarities of the flightless protein with gelsolin allow it to be evaluated in the context of the published crystallographic structure of the S1 domain of gelsolin. Amino acids considered essential for the structural integrity of the core are found to be highly conserved in the predicted flightless protein. Some of the residues considered essential for actin and calcium binding in gelsolin S1 and villin V1 are also well conserved. These data are discussed in light of the phenotypic characteristics of the mutants and the putative functions of the protein. PMID:8582612

  12. Control of cellular morphogenesis by the Ip12/Bem2 GTPase-activating protein: possible role of protein phosphorylation

    PubMed Central

    1994-01-01

    The IPL2 gene is known to be required for normal polarized cell growth in the budding yeast Saccharomyces cerevisiae. We now show that IPL2 is identical to the previously identified BEM2 gene. bem2 mutants are defective in bud site selection at 26 degrees C and localized cell surface growth and organization of the actin cytoskeleton at 37 degrees C. BEM2 encodes a protein with a COOH-terminal domain homologous to sequences found in several GTPase-activating proteins, including human Bcr. The GTPase-activating protein-domain from the Bem2 protein (Bem2p) or human Bcr can functionally substitute for Bem2p. The Rho1 and Rho2 GTPases are the likely in vivo targets of Bem2p because bem2 mutant phenotypes can be partially suppressed by increasing the gene dosage of RHO1 or RHO2. CDC55 encodes the putative regulatory B subunit of protein phosphatase 2A, and mutations in BEM2 have previously been identified as suppressors of the cdc55-1 mutation. We show here that mutations in the previously identified GRR1 gene can suppress bem2 mutations. grr1 and cdc55 mutants are both elongated in shape and cold- sensitive for growth, and cells lacking both GRR1 and CDC55 exhibit a synthetic lethal phenotype. bem2 mutant phenotypes also can be suppressed by the SSD1-vl (also known as SRK1) mutation, which was shown previously to suppress mutations in the protein phosphatase- encoding SIT4 gene. Cells lacking both BEM2 and SIT4 exhibit a synthetic lethal phenotype even in the presence of the SSD1-v1 suppressor. These genetic interactions together suggest that protein phosphorylation and dephosphorylation play an important role in the BEM2-mediated process of polarized cell growth. PMID:7962097

  13. Control of cellular morphogenesis by the Ip12/Bem2 GTPase-activating protein: possible role of protein phosphorylation.

    PubMed

    Kim, Y J; Francisco, L; Chen, G C; Marcotte, E; Chan, C S

    1994-12-01

    The IPL2 gene is known to be required for normal polarized cell growth in the budding yeast Saccharomyces cerevisiae. We now show that IPL2 is identical to the previously identified BEM2 gene. bem2 mutants are defective in bud site selection at 26 degrees C and localized cell surface growth and organization of the actin cytoskeleton at 37 degrees C. BEM2 encodes a protein with a COOH-terminal domain homologous to sequences found in several GTPase-activating proteins, including human Bcr. The GTPase-activating protein-domain from the Bem2 protein (Bem2p) or human Bcr can functionally substitute for Bem2p. The Rho1 and Rho2 GTPases are the likely in vivo targets of Bem2p because bem2 mutant phenotypes can be partially suppressed by increasing the gene dosage of RHO1 or RHO2. CDC55 encodes the putative regulatory B subunit of protein phosphatase 2A, and mutations in BEM2 have previously been identified as suppressors of the cdc55-1 mutation. We show here that mutations in the previously identified GRR1 gene can suppress bem2 mutations. grr1 and cdc55 mutants are both elongated in shape and cold-sensitive for growth, and cells lacking both GRR1 and CDC55 exhibit a synthetic lethal phenotype. bem2 mutant phenotypes also can be suppressed by the SSD1-vl (also known as SRK1) mutation, which was shown previously to suppress mutations in the protein phosphatase-encoding SIT4 gene. Cells lacking both BEM2 and SIT4 exhibit a synthetic lethal phenotype even in the presence of the SSD1-v1 suppressor. These genetic interactions together suggest that protein phosphorylation and dephosphorylation play an important role in the BEM2-mediated process of polarized cell growth.

  14. Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

    PubMed Central

    Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

    2000-01-01

    Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

  15. EUI1, encoding a putative cytochrome P450 monooxygenase, regulates internode elongation by modulating gibberellin responses in rice.

    PubMed

    Luo, Anding; Qian, Qian; Yin, Hengfu; Liu, Xiaoqiang; Yin, Changxi; Lan, Ying; Tang, Jiuyou; Tang, Zuoshun; Cao, Shouyun; Wang, Xiujie; Xia, Kai; Fu, Xiangdong; Luo, Da; Chu, Chengcai

    2006-02-01

    Elongation of rice internodes is one of the most important agronomic traits, which determines the plant height and underlies the grain yield. It has been shown that the elongation of internodes is under genetic control, and various factors are implicated in the process. Here, we report a detailed characterization of an elongated uppermost internode1 (eui1) mutant, which has been used in hybrid rice breeding. In the eui1-2 mutant, the cell lengths in the uppermost internodes are significantly longer than that of wild type and thus give rise to the elongated uppermost internode. It was found that the level of active gibberellin was elevated in the mutant, whereas its growth in response to gibberellin is similar to that of the wild type, suggesting that the higher level accumulation of gibberellin in the eui1 mutant causes the abnormal elongation of the uppermost internode. Consistently, the expression levels of several genes which encode gibberellin biosynthesis enzymes were altered. We cloned the EUI1 gene, which encodes a putative cytochrome P450 monooxygenase, by map-based cloning and found that EUI1 was weakly expressed in most tissues, but preferentially in young panicles. To confirm its function, transgenic experiments with different constructs of EUI1 were conducted. Overexpression of EUI1 gave rise to the gibberellin-deficient-like phenotypes, which could be partially reversed by supplementation with gibberellin. Furthermore, apart from the alteration of expression levels of the gibberellin biosynthesis genes, accumulation of SLR1 protein was found in the overexpressing transgenic plants, indicating that the expression level of EUI1 is implicated in both gibberellin-mediated SLR1 destruction and a feedback regulation in gibberellin biosynthesis. Therefore, we proposed that EUI1 plays a negative role in gibberellin-mediated regulation of cell elongation in the uppermost internode of rice.

  16. Separable roles for Mycobacterium tuberculosis ESX-3 effectors in iron acquisition and virulence

    PubMed Central

    Tufariello, JoAnn M.; Chapman, Jessica R.; Kerantzas, Christopher A.; Wong, Ka-Wing; Vilchèze, Catherine; Jones, Christopher M.; Cole, Laura E.; Tinaztepe, Emir; Thompson, Victor; Fenyö, David; Niederweis, Michael; Ueberheide, Beatrix; Philips, Jennifer A.; Jacobs, William R.

    2016-01-01

    Mycobacterium tuberculosis (Mtb) encodes five type VII secretion systems (T7SS), designated ESX-1–ESX-5, that are critical for growth and pathogenesis. The best characterized is ESX-1, which profoundly impacts host cell interactions. In contrast, the ESX-3 T7SS is implicated in metal homeostasis, but efforts to define its function have been limited by an inability to recover deletion mutants. We overcame this impediment using medium supplemented with various iron complexes to recover mutants with deletions encompassing select genes within esx-3 or the entire operon. The esx-3 mutants were defective in uptake of siderophore-bound iron and dramatically accumulated cell-associated mycobactin siderophores. Proteomic analyses of culture filtrate revealed that secretion of EsxG and EsxH was codependent and that EsxG–EsxH also facilitated secretion of several members of the proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) protein families (named for conserved PE and PPE N-terminal motifs). Substrates that depended on EsxG–EsxH for secretion included PE5, encoded within the esx-3 locus, and the evolutionarily related PE15–PPE20 encoded outside the esx-3 locus. In vivo characterization of the mutants unexpectedly showed that the ESX-3 secretion system plays both iron-dependent and -independent roles in Mtb pathogenesis. PE5–PPE4 was found to be critical for the siderophore-mediated iron-acquisition functions of ESX-3. The importance of this iron-acquisition function was dependent upon host genotype, suggesting a role for ESX-3 secretion in counteracting host defense mechanisms that restrict iron availability. Further, we demonstrate that the ESX-3 T7SS secretes certain effectors that are important for iron uptake while additional secreted effectors modulate virulence in an iron-independent fashion. PMID:26729876

  17. Tolerance of an Antarctic Bacterium to Multiple Environmental Stressors.

    PubMed

    Sengupta, Dipanwita; Sangu, Kavya; Shivaji, Sisinthy; Chattopadhyay, Madhab K

    2015-10-01

    A population of cold-tolerant Antarctic bacteria was screened for their ability to tolerate other environmental stress factors. Besides low temperature, they were predominantly found to be tolerant to alkali. Attempt was also made to postulate a genetic basis of their multistress-tolerance. Transposon mutagenesis of an isolate Pseudomonas syringae Lz4W was performed, and mutants with delayed growth at low temperature were further screened for sensitivity to some other stress factors. A number of multistress-sensitive mutants were isolated. The mutated gene in one of the mutants sensitive to low temperature, acid and alkali was found to encode citrate synthase. Possible role of citrate synthase in conferring multistress-tolerance was postulated.

  18. Characterization of the aes gene of Escherichia coli encoding an enzyme with esterase activity.

    PubMed Central

    Peist, R; Koch, A; Bolek, P; Sewitz, S; Kolbus, T; Boos, W

    1997-01-01

    malQ mutants of Escherichia coli lacking amylomaltase cannot grow on maltose. They express the maltose system constitutively and are sensitive to maltose when grown on another carbon source. In an attempt to isolate a multicopy suppressor that would result in growth on maltose, we transformed a malQ mutant with a gene bank of E. coli DNA which had been digested with Sau3a and cloned in pBR322. We screened the transformants on MacConkey maltose plates. A colony was isolated that appeared to be resistant to maltose and was pink on these plates, but it was still unable to grow on minimal medium with maltose as the carbon source. The plasmid was isolated, and the gene causing this phenotype was characterized. The deduced amino acid sequence of the encoded protein shows homology to that of lipases and esterases. We termed the gene aes, for acetyl esterase. Extracts of cells harboring plasmid-encoded aes under its own promoter exhibit a fivefold higher capacity to hydrolyze p-nitrophenyl acetate than do extracts of cells of plasmid-free strains. Similarly, strains harboring plasmid-encoded aes are able to grow on triacetyl glycerol (triacetin) whereas the plasmid-free strains are not. The expression of plasmid-encoded aes resulted in strong repression of the maltose transport genes in malT+ strains (10-fold reduction), but not in a malT(Con) strain which is independent of the inducer. Also, overproduction of MalT counteracted the Aes-dependent repression, indicating a direct interaction between MalT and Aes. PMID:9401025

  19. Dissecting protein function: an efficient protocol for identifying separation-of-function mutations that encode structurally stable proteins.

    PubMed

    Lubin, Johnathan W; Rao, Timsi; Mandell, Edward K; Wuttke, Deborah S; Lundblad, Victoria

    2013-03-01

    Mutations that confer the loss of a single biochemical property (separation-of-function mutations) can often uncover a previously unknown role for a protein in a particular biological process. However, most mutations are identified based on loss-of-function phenotypes, which cannot differentiate between separation-of-function alleles vs. mutations that encode unstable/unfolded proteins. An alternative approach is to use overexpression dominant-negative (ODN) phenotypes to identify mutant proteins that disrupt function in an otherwise wild-type strain when overexpressed. This is based on the assumption that such mutant proteins retain an overall structure that is comparable to that of the wild-type protein and are able to compete with the endogenous protein (Herskowitz 1987). To test this, the in vivo phenotypes of mutations in the Est3 telomerase subunit from Saccharomyces cerevisiae were compared with the in vitro secondary structure of these mutant proteins as analyzed by circular-dichroism spectroscopy, which demonstrates that ODN is a more sensitive assessment of protein stability than the commonly used method of monitoring protein levels from extracts. Reverse mutagenesis of EST3, which targeted different categories of amino acids, also showed that mutating highly conserved charged residues to the oppositely charged amino acid had an increased likelihood of generating a severely defective est3(-) mutation, which nevertheless encoded a structurally stable protein. These results suggest that charge-swap mutagenesis directed at a limited subset of highly conserved charged residues, combined with ODN screening to eliminate partially unfolded proteins, may provide a widely applicable and efficient strategy for generating separation-of-function mutations.

  20. Multiple Legionella pneumophila effector virulence phenotypes revealed through high-throughput analysis of targeted mutant libraries

    PubMed Central

    Shames, Stephanie R.; Liu, Luying; Havey, James C.; Schofield, Whitman B.; Goodman, Andrew L.; Roy, Craig R.

    2017-01-01

    Legionella pneumophila is the causative agent of a severe pneumonia called Legionnaires’ disease. A single strain of L. pneumophila encodes a repertoire of over 300 different effector proteins that are delivered into host cells by the Dot/Icm type IV secretion system during infection. The large number of L. pneumophila effectors has been a limiting factor in assessing the importance of individual effectors for virulence. Here, a transposon insertion sequencing technology called INSeq was used to analyze replication of a pool of effector mutants in parallel both in a mouse model of infection and in cultured host cells. Loss-of-function mutations in genes encoding effector proteins resulted in host-specific or broad virulence phenotypes. Screen results were validated for several effector mutants displaying different virulence phenotypes using genetic complementation studies and infection assays. Specifically, loss-of-function mutations in the gene encoding LegC4 resulted in enhanced L. pneumophila in the lungs of infected mice but not within cultured host cells, which indicates LegC4 augments bacterial clearance by the host immune system. The effector proteins RavY and Lpg2505 were important for efficient replication within both mammalian and protozoan hosts. Further analysis of Lpg2505 revealed that this protein functions as a metaeffector that counteracts host cytotoxicity displayed by the effector protein SidI. Thus, this study identified a large cohort of effectors that contribute to L. pneumophila virulence positively or negatively and has demonstrated regulation of effector protein activities by cognate metaeffectors as being critical for host pathogenesis. PMID:29133401

  1. Transposon-disruption of a maize nuclear gene, tha1, encoding a chloroplast SecA homologue: in vivo role of cp-SecA in thylakoid protein targeting.

    PubMed

    Voelker, R; Mendel-Hartvig, J; Barkan, A

    1997-02-01

    A nuclear mutant of maize, tha1, which exhibited defects in the translocation of proteins across the thylakoid membrane, was described previously. A transposon insertion at the tha1 locus facilitated the cloning of portions of the tha1 gene. Strong sequence similarity with secA genes from bacteria, pea and spinach indicates that tha1 encodes a SecA homologue (cp-SecA). The tha1-ref allele is either null or nearly so, in that tha1 mRNA is undetectable in mutant leaves and cp-SecA accumulation is reduced > or = 40-fold. These results, in conjunction with the mutant phenotype described previously, demonstrate that cp-SecA functions in vivo to facilitate the translocation of OEC33, PSI-F and plastocyanin but does not function in the translocation of OEC23 and OEC16. Our results confirm predictions for cp-SecA function made from the results of in vitro experiments and establish several new functions for cp-SecA, including roles in the targeting of a chloroplast-encoded protein, cytochrome f, and in protein targeting in the etioplast, a nonphotosynthetic plastid type. Our finding that the accumulation of properly targeted plastocyanin and cytochrome f in tha1-ref thylakoid membranes is reduced only a few-fold despite the near or complete absence of cp-SecA suggests that cp-SecA facilitates but is not essential in vivo for their translocation across the membrane.

  2. Export of l-Isoleucine from Corynebacterium glutamicum: a Two-Gene-Encoded Member of a New Translocator Family

    PubMed Central

    Kennerknecht, Nicole; Sahm, Hermann; Yen, Ming-Ren; Pátek, Miroslav; Saier, Jr., Milton H.; Eggeling, Lothar

    2002-01-01

    Bacteria possess amino acid export systems, and Corynebacterium glutamicum excretes l-isoleucine in a process dependent on the proton motive force. In order to identify the system responsible for l-isoleucine export, we have used transposon mutagenesis to isolate mutants of C. glutamicum sensitive to the peptide isoleucyl-isoleucine. In one such mutant, strong peptide sensitivity resulted from insertion into a gene designated brnF encoding a hydrophobic protein predicted to possess seven transmembrane spanning helices. brnE is located downstream of brnF and encodes a second hydrophobic protein with four putative membrane-spanning helices. A mutant deleted of both genes no longer exports l-isoleucine, whereas an overexpressing strain exports this amino acid at an increased rate. BrnF and BrnE together are also required for the export of l-leucine and l-valine. BrnFE is thus a two-component export permease specific for aliphatic hydrophobic amino acids. Upstream of brnFE and transcribed divergently is an Lrp-like regulatory gene required for active export. Searches for homologues of BrnFE show that this type of exporter is widespread in prokaryotes but lacking in eukaryotes and that both gene products which together comprise the members of a novel family, the LIV-E family, generally map together within a single operon. Comparisons of the BrnF and BrnE phylogenetic trees show that gene duplication events in the early bacterial lineage gave rise to multiple paralogues that have been retained in α-proteobacteria but not in other prokaryotes analyzed. PMID:12081967

  3. The translational regulator Cup controls NMJ presynaptic terminal morphology.

    PubMed

    Menon, Kaushiki P; Carrillo, Robert A; Zinn, Kai

    2015-07-01

    During oogenesis and early embryonic development in Drosophila, translation of proteins from maternally deposited mRNAs is tightly controlled. We and others have previously shown that translational regulatory proteins that function during oogenesis also have essential roles in the nervous system. Here we examine the role of Cup in neuromuscular system development. Maternal Cup controls translation of localized mRNAs encoding the Oskar and Nanos proteins and binds to the general translation initiation factor eIF4E. In this paper, we show that zygotic Cup protein is localized to presynaptic terminals at larval neuromuscular junctions (NMJs). cup mutant NMJs have strong phenotypes characterized by the presence of small clustered boutons called satellite boutons. They also exhibit an increase in the frequency of spontaneous glutamate release events (mEPSPs). Reduction of eIF4E expression synergizes with partial loss of Cup expression to produce satellite bouton phenotypes. The presence of satellite boutons is often associated with increases in retrograde bone morphogenetic protein (BMP) signaling, and we show that synaptic BMP signaling is elevated in cup mutants. cup genetically interacts with two genes, EndoA and Dap160, that encode proteins involved in endocytosis that are also neuronal modulators of the BMP pathway. Endophilin protein, encoded by the EndoA gene, is downregulated in a cup mutant. Our results are consistent with a model in which Cup and eIF4E work together to ensure efficient localization and translation of endocytosis proteins in motor neurons and control the strength of the retrograde BMP signal. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. The translational regulator Cup controls NMJ presynaptic terminal morphology

    PubMed Central

    Menon, Kaushiki P.; Carrillo, Robert A.; Zinn, Kai

    2015-01-01

    During oogenesis and early embryonic development in Drosophila, translation of proteins from maternally deposited mRNAs is tightly controlled. We and others have previously shown that translational regulatory proteins that function during oogenesis also have essential roles in the nervous system. Here we examine the role of Cup in neuromuscular system development. Maternal Cup controls translation of localized mRNAs encoding the Oskar and Nanos proteins and binds to the general translation initiation factor eIF4E. In this paper, we show that zygotic Cup protein is localized to presynaptic terminals at larval neuromuscular junctions (NMJs). cup mutant NMJs have strong phenotypes characterized by the presence of small clustered boutons called satellite boutons. They also exhibit an increase in the frequency of spontaneous glutamate release events (mEPSPs). Reduction of eIF4E expression synergizes with partial loss of Cup expression to produce satellite bouton phenotypes. The presence of satellite boutons is often associated with increases in retrograde bone morphogenetic protein (BMP) signaling, and we show that synaptic BMP signaling is elevated in cup mutants. cup genetically interacts with four genes (EndoA, WASp, Dap160, and Synj) encoding proteins involved in endocytosis that are also neuronal modulators of the BMP pathway. Endophilin protein, encoded by the EndoA gene, is downregulated in a cup mutant. Our results are consistent with a model in which Cup and eIF4E work together to ensure efficient localization and translation of endocytosis proteins in motor neurons and control the strength of the retrograde BMP signal. PMID:26102195

  5. A sodium channel knockin mutant (NaV1.4-R669H) mouse model of hypokalemic periodic paralysis

    PubMed Central

    Wu, Fenfen; Mi, Wentao; Burns, Dennis K.; Fu, Yu; Gray, Hillery F.; Struyk, Arie F.; Cannon, Stephen C.

    2011-01-01

    Hypokalemic periodic paralysis (HypoPP) is an ion channelopathy of skeletal muscle characterized by attacks of muscle weakness associated with low serum K+. HypoPP results from a transient failure of muscle fiber excitability. Mutations in the genes encoding a calcium channel (CaV1.1) and a sodium channel (NaV1.4) have been identified in HypoPP families. Mutations of NaV1.4 give rise to a heterogeneous group of muscle disorders, with gain-of-function defects causing myotonia or hyperkalemic periodic paralysis. To address the question of specificity for the allele encoding the NaV1.4-R669H variant as a cause of HypoPP and to produce a model system in which to characterize functional defects of the mutant channel and susceptibility to paralysis, we generated knockin mice carrying the ortholog of the gene encoding the NaV1.4-R669H variant (referred to herein as R669H mice). Homozygous R669H mice had a robust HypoPP phenotype, with transient loss of muscle excitability and weakness in low-K+ challenge, insensitivity to high-K+ challenge, dominant inheritance, and absence of myotonia. Recovery was sensitive to the Na+/K+-ATPase pump inhibitor ouabain. Affected fibers had an anomalous inward current at hyperpolarized potentials, consistent with the proposal that a leaky gating pore in R669H channels triggers attacks, whereas a reduction in the amplitude of action potentials implies additional loss-of-function changes for the mutant NaV1.4 channels. PMID:21881211

  6. Regulation of virulence by a two-component system in group B streptococcus.

    PubMed

    Jiang, Sheng-Mei; Cieslewicz, Michael J; Kasper, Dennis L; Wessels, Michael R

    2005-02-01

    Group B Streptococcus (GBS) is frequently carried in the gastrointestinal or genitourinary tract as a commensal organism, yet it has the potential to cause life-threatening infection in newborn infants, pregnant women, and individuals with chronic illness. Regulation of virulence factor expression may affect whether GBS behaves as an asymptomatic colonizer or an invasive pathogen, but little is known about how such factors are controlled in GBS. We now report the characterization of a GBS locus that encodes a two-component regulatory system similar to CsrRS (or CovRS) in Streptococcus pyogenes. Inactivation of csrR, encoding the putative response regulator, in two unrelated wild-type strains of GBS resulted in a marked increase in production of beta-hemolysin/cytolysin and a striking decrease in production of CAMP factor, an unrelated cytolytic toxin. Quantitative RNA hybridization experiments revealed that these two phenotypes were associated with a marked increase and decrease in expression of the corresponding genes, cylE and cfb, respectively. The CsrR mutant strains also displayed increased expression of scpB encoding C5a peptidase. Similar, but less marked, changes in gene expression were observed in CsrS (putative sensor component) mutants, evidence that CsrR and CsrS constitute a functional two-component system. Experimental infection studies in mice demonstrated reduced virulence of both CsrR and CsrS mutant strains relative to the wild type. Together, these results indicate that CsrRS regulates expression of multiple GBS virulence determinants and is likely to play an important role in GBS pathogenesis.

  7. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  8. GDH3 encodes a glutamate dehydrogenase isozyme, a previously unrecognized route for glutamate biosynthesis in Saccharomyces cerevisiae.

    PubMed Central

    Avendaño, A; Deluna, A; Olivera, H; Valenzuela, L; Gonzalez, A

    1997-01-01

    It has been considered that the yeast Saccharomyces cerevisiae, like many other microorganisms, synthesizes glutamate through the action of NADP+-glutamate dehydrogenase (NADP+-GDH), encoded by GDH1, or through the combined action of glutamine synthetase and glutamate synthase (GOGAT), encoded by GLN1 and GLT1, respectively. A double mutant of S. cerevisiae lacking NADP+-GDH and GOGAT activities was constructed. This strain was able to grow on ammonium as the sole nitrogen source and thus to synthesize glutamate through an alternative pathway. A computer search for similarities between the GDH1 nucleotide sequence and the complete yeast genome was carried out. In addition to identifying its cognate sequence at chromosome XIV, the search found that GDH1 showed high identity with a previously recognized open reading frame (GDH3) of chromosome I. Triple mutants impaired in GDH1, GLT1, and GDH3 were obtained. These were strict glutamate auxotrophs. Our results indicate that GDH3 plays a significant physiological role, providing glutamate when GDH1 and GLT1 are impaired. This is the first example of a microorganism possessing three pathways for glutamate biosynthesis. PMID:9287019

  9. A putative regulatory genetic locus modulates virulence in the pathogen Leptospira interrogans.

    PubMed

    Eshghi, Azad; Becam, Jérôme; Lambert, Ambroise; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Wunder, Elsio A; Ko, Albert I; Coppee, Jean-Yves; Goarant, Cyrille; Picardeau, Mathieu

    2014-06-01

    Limited research has been conducted on the role of transcriptional regulators in relation to virulence in Leptospira interrogans, the etiological agent of leptospirosis. Here, we identify an L. interrogans locus that encodes a sensor protein, an anti-sigma factor antagonist, and two genes encoding proteins of unknown function. Transposon insertion into the gene encoding the sensor protein led to dampened transcription of the other 3 genes in this locus. This lb139 insertion mutant (the lb139(-) mutant) displayed attenuated virulence in the hamster model of infection and reduced motility in vitro. Whole-transcriptome analyses using RNA sequencing revealed the downregulation of 115 genes and the upregulation of 28 genes, with an overrepresentation of gene products functioning in motility and signal transduction and numerous gene products with unknown functions, predicted to be localized to the extracellular space. Another significant finding encompassed suppressed expression of the majority of the genes previously demonstrated to be upregulated at physiological osmolarity, including the sphingomyelinase C precursor Sph2 and LigB. We provide insight into a possible requirement for transcriptional regulation as it relates to leptospiral virulence and suggest various biological processes that are affected due to the loss of native expression of this genetic locus.

  10. A functional TOC complex contributes to gravity signal transduction in Arabidopsis

    PubMed Central

    Strohm, Allison K.; Barrett-Wilt, Greg A.; Masson, Patrick H.

    2014-01-01

    Although plastid sedimentation has long been recognized as important for a plant's perception of gravity, it was recently shown that plastids play an additional function in gravitropism. The Translocon at the Outer envelope membrane of Chloroplasts (TOC) complex transports nuclear-encoded proteins into plastids, and a receptor of this complex, Toc132, was previously hypothesized to contribute to gravitropism either by directly functioning as a gravity signal transducer or by indirectly mediating the plastid localization of a gravity signal transducer. Here we show that mutations in multiple genes encoding TOC complex components affect gravitropism in a genetically sensitized background and that the cytoplasmic acidic domain of Toc132 is not required for its involvement in this process. Furthermore, mutations in TOC132 enhance the gravitropic defect of a mutant whose amyloplasts lack starch. Finally, we show that the levels of several nuclear-encoded root proteins are altered in toc132 mutants. These data suggest that the TOC complex indirectly mediates gravity signal transduction in Arabidopsis and support the idea that plastids are involved in gravitropism not only through their ability to sediment but also as part of the signal transduction mechanism. PMID:24795735

  11. A functional TOC complex contributes to gravity signal transduction in Arabidopsis.

    PubMed

    Strohm, Allison K; Barrett-Wilt, Greg A; Masson, Patrick H

    2014-01-01

    Although plastid sedimentation has long been recognized as important for a plant's perception of gravity, it was recently shown that plastids play an additional function in gravitropism. The Translocon at the Outer envelope membrane of Chloroplasts (TOC) complex transports nuclear-encoded proteins into plastids, and a receptor of this complex, Toc132, was previously hypothesized to contribute to gravitropism either by directly functioning as a gravity signal transducer or by indirectly mediating the plastid localization of a gravity signal transducer. Here we show that mutations in multiple genes encoding TOC complex components affect gravitropism in a genetically sensitized background and that the cytoplasmic acidic domain of Toc132 is not required for its involvement in this process. Furthermore, mutations in TOC132 enhance the gravitropic defect of a mutant whose amyloplasts lack starch. Finally, we show that the levels of several nuclear-encoded root proteins are altered in toc132 mutants. These data suggest that the TOC complex indirectly mediates gravity signal transduction in Arabidopsis and support the idea that plastids are involved in gravitropism not only through their ability to sediment but also as part of the signal transduction mechanism.

  12. CatB is Critical for Total Catalase Activity and Reduces Bactericidal Effects of Phenazine-1-Carboxylic Acid on Xanthomonas oryzae pv. oryzae and X. oryzae pv. oryzicola.

    PubMed

    Pan, Xiayan; Wu, Jian; Xu, Shu; Duan, Yabing; Zhou, Mingguo

    2017-02-01

    Rice bacterial leaf blight, caused by Xanthomonas oryzae pv. oryzae, and rice bacterial leaf streak, caused by X. oryzae pv. oryzicola, are major diseases of rice. Phenazine-1-carboxylic acid (PCA) is a natural product that is isolated from Pseudomonas spp. and is used to control many important rice diseases in China. We previously reported that PCA disturbs the redox balance, which results in the accumulation of reactive oxygen species in X. oryzae pv. oryzae. In this study, we found that PCA significantly upregulated the transcript levels of catB and katE, which encode catalases, and that PCA sensitivity was reduced when X. oryzae pvs. oryzae and oryzicola were cultured with exogenous catalase. Furthermore, catB deletion mutants of X. oryzae pvs. oryzae and oryzicola showed dramatically decreased total catalase activity, increased sensitivity to PCA, and reduced virulence in rice. In contrast, deletion mutants of srpA and katG, which also encode catalases, exhibited little change in PCA sensitivity. The results indicate that catB in both X. oryzae pvs. oryzae and oryzicola encodes a catalase that helps protect the bacteria against PCA-induced stress.

  13. SGRL can regulate chlorophyll metabolism and contributes to normal plant growth and development in Pisum sativum L.

    PubMed

    Bell, Andrew; Moreau, Carol; Chinoy, Catherine; Spanner, Rebecca; Dalmais, Marion; Le Signor, Christine; Bendahmane, Abdel; Klenell, Markus; Domoney, Claire

    2015-12-01

    Among a set of genes in pea (Pisum sativum L.) that were induced under drought-stress growth conditions, one encoded a protein with significant similarity to a regulator of chlorophyll catabolism, SGR. This gene, SGRL, is distinct from SGR in genomic location, encoded carboxy-terminal motif, and expression through plant and seed development. Divergence of the two encoded proteins is associated with a loss of similarity in intron/exon gene structure. Transient expression of SGRL in leaves of Nicotiana benthamiana promoted the degradation of chlorophyll, in a manner that was distinct from that shown by SGR. Removal of a predicted transmembrane domain from SGRL reduced its activity in transient expression assays, although variants with and without this domain reduced SGR-induced chlorophyll degradation, indicating that the effects of the two proteins are not additive. The combined data suggest that the function of SGRL during growth and development is in chlorophyll re-cycling, and its mode of action is distinct from that of SGR. Studies of pea sgrL mutants revealed that plants had significantly lower stature and yield, a likely consequence of reduced photosynthetic efficiencies in mutant compared with control plants under conditions of high light intensity.

  14. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    NASA Technical Reports Server (NTRS)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  15. Expression of the genes for insecticidal crystal proteins in Bacillus thuringiensis: cryIVA, not cryIVB, is transcribed by RNA polymerase containing sigma H and that containing sigma E.

    PubMed

    Yoshisue, H; Ihara, K; Nishimoto, T; Sakai, H; Komano, T

    1995-03-15

    To investigate the mechanism of transcriptional regulation of cryIVA and cryIVB, encoding 130-kDa dipteran-active crystal proteins, in Bacillus thuringiensis subsp. israelensis, we introduced each gene into several sporulation mutants of Bacillus subtilis. A spoIIG mutation, the wild-type gene of which encodes sigma E precursor, completely blocked the cryIVB transcription. In contrast, low but detectable transcription of cryIVA was observed in the spoIIG mutant. In the wild-type B. subtilis, no transcription of cryIVB was detected before T2 (2 h after the onset of stationary phase), while the cryIVA transcription started at the late exponential phase at low levels. Furthermore, in a wild-type strain of B. thuringiensis subsp. israelensis, transcription of cryIVA began earlier than that of genes encoding other crystal components, cryIVB and cytA. A consensus sequence recognized by an RNA polymerase containing sigma H of B. subtilis was found upstream of the transcription start point of cryIVA, which overlapped with that recognized by sigma E.

  16. Nipah virus sequesters inactive STAT1 in the nucleus via a P gene-encoded mechanism.

    PubMed

    Ciancanelli, Michael J; Volchkova, Valentina A; Shaw, Megan L; Volchkov, Viktor E; Basler, Christopher F

    2009-08-01

    The Nipah virus (NiV) phosphoprotein (P) gene encodes the C, P, V, and W proteins. P, V, and W, have in common an amino-terminal domain sufficient to bind STAT1, inhibiting its interferon (IFN)-induced tyrosine phosphorylation. P is also essential for RNA-dependent RNA polymerase function. C is encoded by an alternate open reading frame (ORF) within the common amino-terminal domain. Mutations within residues 81 to 113 of P impaired its polymerase cofactor function, as assessed by a minireplicon assay, but these mutants retained STAT1 inhibitory function. Mutations within the residue 114 to 140 region were identified that abrogated interaction with and inhibition of STAT1 by P, V, and W without disrupting P polymerase cofactor function. Recombinant NiVs were then generated. A G121E mutation, which abrogated inhibition of STAT1, was introduced into a C protein knockout background (C(ko)) because the mutation would otherwise also alter the overlapping C ORF. In cell culture, relative to the wild-type virus, the C(ko) mutation proved attenuating but the G121E mutant virus replicated identically to the C(ko) virus. In cells infected with the wild-type and C(ko) viruses, STAT1 was nuclear despite the absence of tyrosine phosphorylation. This latter observation mirrors what has been seen in cells expressing NiV W. In the G121E mutant virus-infected cells, STAT1 was not phosphorylated and was cytoplasmic in the absence of IFN stimulation but became tyrosine phosphorylated and nuclear following IFN addition. These data demonstrate that the gene for NiV P encodes functions that sequester inactive STAT1 in the nucleus, preventing its activation and suggest that the W protein is the dominant inhibitor of STAT1 in NiV-infected cells.

  17. Four of the Most Common Mutations in Primary Hyperoxaluria Type 1 Unmask the Cryptic Mitochondrial Targeting Sequence of Alanine:glyoxylate Aminotransferase Encoded by the Polymorphic Minor Allele*

    PubMed Central

    Fargue, Sonia; Lewin, Jackie; Rumsby, Gill; Danpure, Christopher J.

    2013-01-01

    The gene encoding the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT, EC. 2.6.1.44) exists as two common polymorphic variants termed the “major” and “minor” alleles. The P11L amino acid replacement encoded by the minor allele creates a hidden N-terminal mitochondrial targeting sequence, the unmasking of which occurs in the hereditary calcium oxalate kidney stone disease primary hyperoxaluria type 1 (PH1). This unmasking is due to the additional presence of a common disease-specific G170R mutation, which is encoded by about one third of PH1 alleles. The P11L and G170R replacements interact synergistically to reroute AGT to the mitochondria where it cannot fulfill its metabolic role (i.e. glyoxylate detoxification) effectively. In the present study, we have reinvestigated the consequences of the interaction between P11L and G170R in stably transformed CHO cells and have studied for the first time whether a similar synergism exists between P11L and three other mutations that segregate with the minor allele (i.e. I244T, F152I, and G41R). Our investigations show that the latter three mutants are all able to unmask the cryptic P11L-generated mitochondrial targeting sequence and, as a result, all are mistargeted to the mitochondria. However, whereas the G170R, I244T, and F152I mutants are able to form dimers and are catalytically active, the G41R mutant aggregates and is inactive. These studies open up the possibility that all PH1 mutations, which segregate with the minor allele, might also lead to the peroxisome-to-mitochondrion mistargeting of AGT, a suggestion that has important implications for the development of treatment strategies for PH1. PMID:23229545

  18. Two genes in Arabidopsis thaliana encoding GDP-L-galactose phosphorylase are required for ascorbate biosynthesis and seedling viability.

    PubMed

    Dowdle, John; Ishikawa, Takahiro; Gatzek, Stephan; Rolinski, Susanne; Smirnoff, Nicholas

    2007-11-01

    Plants synthesize ascorbate from guanosine diphosphate (GDP)-mannose via L-galactose/L-gulose, although uronic acids have also been proposed as precursors. Genes encoding all the enzymes of the GDP-mannose pathway have previously been identified, with the exception of the step that converts GDP-L-galactose to L-galactose 1-P. We show that a GDP-L-galactose phosphorylase, encoded by the Arabidopsis thaliana VTC2 gene, catalyses this step in the ascorbate biosynthetic pathway. Furthermore, a homologue of VTC2, At5g55120, encodes a second GDP-L-galactose phosphorylase with similar properties to VTC2. Two At5g55120 T-DNA insertion mutants (vtc5-1 and vtc5-2) have 80% of the wild-type ascorbate level. Double mutants were produced by crossing the loss-of-function vtc2-1 mutant with each of the two vtc5 alleles. These show growth arrest immediately upon germination and the cotyledons subsequently bleach. Normal growth was restored by supplementation with ascorbate or L-galactose, indicating that both enzymes are necessary for ascorbate generation. vtc2-1 leaves contain more mannose 6-P than wild-type. We conclude that the GDP-mannose pathway is the only significant source of ascorbate in A. thaliana seedlings, and that ascorbate is essential for seedling growth. A. thaliana leaves accumulate more ascorbate after acclimatization to high light intensity. VTC2 expression and GDP-L-galactose phosphorylase activity rapidly increase on transfer to high light, but the activity of other enzymes in the GDP-mannose pathway is little affected. VTC2 and At5g55120 (VTC5) expression also peak in at the beginning of the light cycle and are controlled by the circadian clock. The GDP-L-galactose phosphorylase step may therefore play an important role in controlling ascorbate biosynthesis.

  19. Small kernel 1 encodes a pentatricopeptide repeat protein required for mitochondrial nad7 transcript editing and seed development in maize (Zea mays) and rice (Oryza sativa).

    PubMed

    Li, Xiao-Jie; Zhang, Ya-Feng; Hou, Mingming; Sun, Feng; Shen, Yun; Xiu, Zhi-Hui; Wang, Xiaomin; Chen, Zong-Liang; Sun, Samuel S M; Small, Ian; Tan, Bao-Cai

    2014-09-01

    RNA editing modifies cytidines (C) to uridines (U) at specific sites in the transcripts of mitochondria and plastids, altering the amino acid specified by the DNA sequence. Here we report the identification of a critical editing factor of mitochondrial nad7 transcript via molecular characterization of a small kernel 1 (smk1) mutant in Zea mays (maize). Mutations in Smk1 arrest both the embryo and endosperm development. Cloning of Smk1 indicates that it encodes an E-subclass pentatricopeptide repeat (PPR) protein that is targeted to mitochondria. Loss of SMK1 function abolishes the C → U editing at the nad7-836 site, leading to the retention of a proline codon that is edited to encode leucine in the wild type. The smk1 mutant showed dramatically reduced complex-I assembly and NADH dehydrogenase activity, and abnormal biogenesis of the mitochondria. Analysis of the ortholog in Oryza sativa (rice) reveals that rice SMK1 has a conserved function in C → U editing of the mitochondrial nad7-836 site. T-DNA knock-out mutants showed abnormal embryo and endosperm development, resulting in embryo or seedling lethality. The leucine at NAD7-279 is highly conserved from bacteria to flowering plants, and analysis of genome sequences from many plants revealed a molecular coevolution between the requirement for C → U editing at this site and the existence of an SMK1 homolog. These results demonstrate that Smk1 encodes a PPR-E protein that is required for nad7-836 editing, and this editing is critical to NAD7 function in complex-I assembly in mitochondria, and hence to embryo and endosperm development in maize and rice. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  20. Rice gene SDL/RNRS1, encoding the small subunit of ribonucleotide reductase, is required for chlorophyll synthesis and plant growth development.

    PubMed

    Qin, Ran; Zeng, Dongdong; Liang, Rong; Yang, Chengcong; Akhter, Delara; Alamin, Md; Jin, Xiaoli; Shi, Chunhai

    2017-09-05

    A new mutant named sdl (stripe and drooping leaf) was characterized from indica cultivar Zhenong 34 by ethylmethane sulfonate (EMS) mutagenesis. The mutant sdl exhibited development defects including stripe and drooping leaf, dwarfism and deformed floral organs. The gene SDL was found allelic to RNRS1 by map-based cloning, which was homologous to Arabidopsis TSO2 encoding the small subunit of ribonucleotide reductase. The gDNA sequencing results of sdl in mutant showed that there was a repetitive sequence insertion of 138-bp at the 475 th bp in the exon. The redundant sequence was conserved in SDL homologous proteins, which contained the active site (tyrosine), as well as two amino acids glutamate and histidine involved in the binding of iron. There were fewer chloroplasts and grana lamellas in sdl leaf compared with those of wild-type. Additionally, the stripe leaves of sdl seedlings were highly sensitive to temperature, since the chlorophyll content was increased with the temperature rising. The drooping leaf of sdl might be resulted from the disappearance of vascular bundles and mesophyll cells in both leaf midrib and lateral veins. Fittingly to the phenotypes of mutant sdl, the expression levels of genes associated with photosynthesis and chlorophyll synthesis were found to be down- or up-regulated at different temperatures in mutant sdl. Also, the transcriptional levels of genes related to plant height and floral organ formation showed obvious differences between wild-type and sdl. The "SDL/RNRS1" was, hence, required for the chlorophyll biosynthesis and also played pleiotropic roles in the regulation of plant development. Copyright © 2017. Published by Elsevier B.V.

  1. Arabidopsis Class I and Class II TCP Transcription Factors Regulate Jasmonic Acid Metabolism and Leaf Development Antagonistically1[C][W

    PubMed Central

    Danisman, Selahattin; van der Wal, Froukje; Dhondt, Stijn; Waites, Richard; de Folter, Stefan; Bimbo, Andrea; van Dijk, Aalt DJ; Muino, Jose M.; Cutri, Lucas; Dornelas, Marcelo C.; Angenent, Gerco C.; Immink, Richard G.H.

    2012-01-01

    TEOSINTE BRANCHED1/CYCLOIDEA/PROLIFERATING CELL FACTOR1 (TCP) transcription factors control developmental processes in plants. The 24 TCP transcription factors encoded in the Arabidopsis (Arabidopsis thaliana) genome are divided into two classes, class I and class II TCPs, which are proposed to act antagonistically. We performed a detailed phenotypic analysis of the class I tcp20 mutant, showing an increase in leaf pavement cell sizes in 10-d-old seedlings. Subsequently, a glucocorticoid receptor induction assay was performed, aiming to identify potential target genes of the TCP20 protein during leaf development. The LIPOXYGENASE2 (LOX2) and class I TCP9 genes were identified as TCP20 targets, and binding of TCP20 to their regulatory sequences could be confirmed by chromatin immunoprecipitation analyses. LOX2 encodes for a jasmonate biosynthesis gene, which is also targeted by class II TCP proteins that are under the control of the microRNA JAGGED AND WAVY (JAW), although in an antagonistic manner. Mutation of TCP9, the second identified TCP20 target, resulted in increased pavement cell sizes during early leaf developmental stages. Analysis of senescence in the single tcp9 and tcp20 mutants and the tcp9tcp20 double mutants showed an earlier onset of this process in comparison with wild-type control plants in the double mutant only. Both the cell size and senescence phenotypes are opposite to the known class II TCP mutant phenotype in JAW plants. Altogether, these results point to an antagonistic function of class I and class II TCP proteins in the control of leaf development via the jasmonate signaling pathway. PMID:22718775

  2. Identification of Bicarbonate as a Trigger and Genes Involved with Extracellular DNA Export in Mycobacterial Biofilms

    PubMed Central

    Rose, Sasha J.

    2016-01-01

    ABSTRACT Extracellular DNA (eDNA) is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM). Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae. The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate. PMID:27923918

  3. Ergot cluster-encoded catalase is required for synthesis of chanoclavine-I in Aspergillus fumigatus.

    PubMed

    Goetz, Kerry E; Coyle, Christine M; Cheng, Johnathan Z; O'Connor, Sarah E; Panaccione, Daniel G

    2011-06-01

    Genes required for ergot alkaloid biosynthesis are clustered in the genomes of several fungi. Several conserved ergot cluster genes have been hypothesized, and in some cases demonstrated, to encode early steps of the pathway shared among fungi that ultimately make different ergot alkaloid end products. The deduced amino acid sequence of one of these conserved genes (easC) indicates a catalase as the product, but a role for a catalase in the ergot alkaloid pathway has not been established. We disrupted easC of Aspergillus fumigatus by homologous recombination with a truncated copy of that gene. The resulting mutant (ΔeasC) failed to produce the ergot alkaloids typically observed in A. fumigatus, including chanoclavine-I, festuclavine, and fumigaclavines B, A, and C. The ΔeasC mutant instead accumulated N-methyl-4-dimethylallyltryptophan (N-Me-DMAT), an intermediate recently shown to accumulate in Claviceps purpurea strains mutated at ccsA (called easE in A. fumigatus) (Lorenz et al. Appl Environ Microbiol 76:1822-1830, 2010). A ΔeasE disruption mutant of A. fumigatus also failed to accumulate chanoclavine-I and downstream ergot alkaloids and, instead, accumulated N-Me-DMAT. Feeding chanoclavine-I to the ΔeasC mutant restored ergot alkaloid production. Complementation of either ΔeasC or ΔeasE mutants with the respective wild-type allele also restored ergot alkaloid production. The easC gene was expressed in Escherichia coli, and the protein product displayed in vitro catalase activity with H(2)O(2) but did not act, in isolation, on N-Me-DMAT as substrate. The data indicate that the products of both easC (catalase) and easE (FAD-dependent oxidoreductase) are required for conversion of N-Me-DMAT to chanoclavine-I.

  4. Zn2+ Uptake in Streptococcus pyogenes: Characterization of adcA and lmb Null Mutants.

    PubMed

    Tedde, Vittorio; Rosini, Roberto; Galeotti, Cesira L

    2016-01-01

    An effective regulation of metal ion homeostasis is essential for the growth of microorganisms in any environment and in pathogenic bacteria is strongly associated with their ability to invade and colonise their hosts. To gain a better insight into zinc acquisition in Group A Streptococcus (GAS) we characterized null deletion mutants of the adcA and lmb genes of Streptococcus pyogenes strain MGAS5005 encoding the orthologues of AdcA and AdcAII, the two surface lipoproteins with partly redundant roles in zinc homeostasis in Streptococcus pneumoniae. Null adcA and lmb mutants were analysed for their capability to grow in zinc-depleted conditions and were found to be more susceptible to zinc starvation, a phenotype that could be rescued by the addition of Zn2+ ions to the growth medium. Expression of AdcA, Lmb and HtpA, the polyhistidine triad protein encoded by the gene adjacent to lmb, during growth under conditions of limited zinc availability was examined by Western blot analysis in wild type and null mutant strains. In the wild type strain, AdcA was always present with little variation in expression levels between conditions of excess or limited zinc availability. In contrast, Lmb and HtpA were expressed at detectable levels only during growth in the presence of low zinc concentrations or in the null adcA mutant, when expression of lmb is required to compensate for the lack of adcA expression. In the latter case, Lmb and HtpA were overexpressed by several fold, thus indicating that also in GAS AdcA is a zinc-specific importer and, although it shares this function with Lmb, the two substrate-binding proteins do not show fully overlapping roles in zinc homeostasis.

  5. Regulation of Bacteriocin Production and Cell Death by the VicRK Signaling System in Streptococcus mutans

    PubMed Central

    Senadheera, D. B.; Cordova, M.; Ayala, E. A.; Chávez de Paz, L. E.; Singh, K.; Downey, J. S.; Svensäter, G.; Goodman, S. D.

    2012-01-01

    The VicRK two-component signaling system modulates biofilm formation, genetic competence, and stress tolerance in Streptococcus mutans. We show here that the VicRK modulates bacteriocin production and cell viability, in part by direct modulation of competence-stimulating peptide (CSP) production in S. mutans. Global transcriptome and real-time transcriptional analysis of the VicK-deficient mutant (SmuvicK) revealed significant modulation of several bacteriocin-related loci, including nlmAB, nlmC, and nlmD (P < 0.001), suggesting a role for the VicRK in producing mutacins IV, V, and VI. Bacteriocin overlay assays revealed an altered ability of the vic mutants to kill related species. Since a well-conserved VicR binding site (TGTWAH-N5-TGTWAH) was identified within the comC coding region, we confirmed VicR binding to this sequence using DNA footprinting. Overexpression of the vic operon caused growth-phase-dependent repression of comC, comDE, and comX. In the vic mutants, transcription of nlmC/cipB encoding mutacin V, previously linked to CSP-dependent cell lysis, as well as expression of its putative immunity factor encoded by immB, were significantly affected relative to the wild type (P < 0.05). In contrast to previous reports that proposed a hyper-resistant phenotype for the VicK mutant in cell viability, the release of extracellular genomic DNA was significantly enhanced in SmuvicK (P < 0.05), likely as a result of increased autolysis compared with the parent. The drastic influence of VicRK on cell viability was also demonstrated using vic mutant biofilms. Taken together, we have identified a novel regulatory link between the VicRK and ComDE systems to modulate bacteriocin production and cell viability of S. mutans. PMID:22228735

  6. Monothiol glutaredoxin Grx5 interacts with Fe-S scaffold proteins Isa1 and Isa2 and supports Fe-S assembly and DNA integrity in mitochondria of fission yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Kyoung-Dong; Chung, Woo-Hyun; Kim, Hyo-Jin

    2010-02-12

    Mitochondrial monothiol glutaredoxins that bind Fe-S cluster are known to participate in Fe-S cluster assembly. However, their precise role has not been well understood. Among three monothiol glutaredoxins (Grx3, 4, and 5) in Schizosaccharomyces pombe only Grx5 resides in mitochondria. The {Delta}grx5 mutant requires cysteine on minimal media, and does not grow on non-fermentable carbon source such as glycerol. We found that the mutant is low in the activity of Fe-S enzymes in mitochondria as well as in the cytoplasm. Screening of multi-copy suppressor of growth defects of the mutant identified isa1{sup +} gene encoding a putative A-type Fe-S scaffold,more » in addition to mas5{sup +} and hsc1{sup +} genes encoding putative chaperones for Fe-S assembly process. Examination of other scaffold and chaperone genes revealed that isa2{sup +}, but not isu1{sup +} and ssc1{sup +}, complemented the growth phenotype of {Delta}grx5 mutant as isa1{sup +} did, partly through restoration of Fe-S enzyme activities. The mutant also showed a significant decrease in the amount of mitochondrial DNA. We demonstrated that Grx5 interacts in vivo with Isa1 and Isa2 proteins in mitochondria by observing bimolecular fluorescence complementation. These results indicate that Grx5 plays a central role in Fe-S assembly process through interaction with A-type Fe-S scaffold proteins Isa1 and Isa2, each of which is an essential protein in S. pombe, and supports mitochondrial genome integrity as well as Fe-S assembly.« less

  7. Development of low-linolenic acid Brassica oleracea lines through seed mutagenesis and molecular characterization of mutants.

    PubMed

    Rahman, Habibur; Singer, Stacy D; Weselake, Randall J

    2013-06-01

    Designing the fatty acid composition of Brassica napus L. seed oil for specific applications would extend the value of this crop. A mutation in Fatty Acid Desaturase 3 (FAD3), which encodes the desaturase responsible for catalyzing the formation of α-linolenic acid (ALA; 18:3 (cisΔ9,12,15)), in a diploid Brassica species would potentially result in useful germplasm for creating an amphidiploid displaying low ALA content in the seed oil. For this, seeds of B. oleracea (CC), one of the progenitor species of B. napus, were treated with ethyl-methane-sulfonate to induce mutations in genes encoding enzymes involved in fatty acid biosynthesis. Seeds from 1,430 M2 plants were analyzed, from which M3 seed families with 5.7-6.9 % ALA were obtained. Progeny testing and selection for low ALA content were carried out in M3-M7 generations, from which mutant lines with <2.0 % ALA were obtained. Molecular analysis revealed that the mutation was due to a single nucleotide substitution from G to A in exon 3 of FAD3, which corresponds to an amino acid residue substitution from glutamic acid to lysine. No obvious differences in the expression of the FAD3 gene were detected between wild type and mutant lines; however, evaluation of the performance of recombinant Δ-15 desaturase from mutant lines in yeast indicated reduced production of ALA. The novelty of this mutation can be inferred from the position of the point mutation in the C-genome FAD3 gene when compared to the position of mutations reported previously by other researchers. This B. oleracea mutant line has the potential to be used for the development of low-ALA B. napus and B. carinata oilseed crops.

  8. Inactivation of agmatinase expressed in vegetative cells alters arginine catabolism and prevents diazotrophic growth in the heterocyst-forming cyanobacterium Anabaena.

    PubMed

    Burnat, Mireia; Flores, Enrique

    2014-10-01

    Arginine decarboxylase produces agmatine, and arginase and agmatinase are ureohydrolases that catalyze the production of ornithine and putrescine from arginine and agmatine, respectively, releasing urea. In the genome of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, ORF alr2310 putatively encodes an ureohydrolase. Cells of Anabaena supplemented with [(14) C]arginine took up and catabolized this amino acid generating a set of labeled amino acids that included ornithine, proline, and glutamate. In an alr2310 deletion mutant, an agmatine spot appeared and labeled glutamate increased with respect to the wild type, suggesting that Alr2310 is an agmatinase rather than an arginase. As determined in cell-free extracts, agmatinase activity could be detected in the wild type but not in the mutant. Thus, alr2310 is the Anabaena speB gene encoding agmatinase. The ∆alr2310 mutant accumulated large amounts of cyanophycin granule polypeptide, lacked nitrogenase activity, and did not grow diazotrophically. Growth tests in solid media showed that agmatine is inhibitory for Anabaena, especially under diazotrophic conditions, suggesting that growth of the mutant is inhibited by non-metabolized agmatine. Measurements of incorporation of radioactivity from [(14) C]leucine into macromolecules showed, however, a limited inhibition of protein synthesis in the ∆alr2310 mutant. Analysis of an Anabaena strain producing an Alr2310-GFP (green fluorescent protein) fusion showed expression in vegetative cells but much less in heterocysts, implying compartmentalization of the arginine decarboxylation pathway in the diazotrophic filaments of this heterocyst-forming cyanobacterium. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  9. The bhuQ Gene Encodes a Heme Oxygenase That Contributes to the Ability of Brucella abortus 2308 To Use Heme as an Iron Source and Is Regulated by Irr

    PubMed Central

    Ojeda, Jenifer F.; Martinson, David A.; Menscher, Evan A.

    2012-01-01

    The Brucella BhuQ protein is a homolog of the Bradyrhizobium japonicum heme oxygenases HmuD and HmuQ. To determine if this protein plays a role in the ability of Brucella abortus 2308 to use heme as an iron source, an isogenic bhuQ mutant was constructed and its phenotype evaluated. Although the Brucella abortus bhuQ mutant DCO1 did not exhibit a defect in its capacity to use heme as an iron source or evidence of increased heme toxicity in vitro, this mutant produced increased levels of siderophore in response to iron deprivation compared to 2308. Introduction of a bhuQ mutation into the B. abortus dhbC mutant BHB2 (which cannot produce siderophores) resulted in a severe growth defect in the dhbC bhuQ double mutant JFO1 during cultivation under iron-restricted conditions, which could be rescued by the addition of FeCl3, but not heme, to the growth medium. The bhuQ gene is cotranscribed with the gene encoding the iron-responsive regulator RirA, and both of these genes are repressed by the other major iron-responsive regulator in the alphaproteobacteria, Irr. The results of these studies suggest that B. abortus 2308 has at least one other heme oxygenase that works in concert with BhuQ to allow this strain to efficiently use heme as an iron source. The genetic organization of the rirA-bhuQ operon also provides the basis for the proposition that BhuQ may perform a previously unrecognized function by allowing the transcriptional regulator RirA to recognize heme as an iron source. PMID:22636783

  10. HU participates in expression of a specific set of genes required for growth and survival at acidic pH in Escherichia coli.

    PubMed

    Bi, Hongkai; Sun, Lianle; Fukamachi, Toshihiko; Saito, Hiromi; Kobayashi, Hiroshi

    2009-05-01

    The major histone-like Escherichia coli protein, HU, is composed of alpha and beta subunits respectively encoded by hupA and hupB in Escherichia coli. A mutant deficient in both hupA and hupB grew at a slightly slower rate than the wild type at pH 7.5. Growth of the mutant diminished with a decrease in pH, and no growth was observed at pH 4.6. Mutants of either hupA or hupB grew at all pH levels tested. The arginine-dependent survival at pH 2.5 was diminished approximately 60-fold by the deletion of both hupA and hupB, whereas the survival was slightly affected by the deletion of either hupA or hupB. The mRNA levels of adiA and adiC, which respectively encode arginine decarboxylase and arginine/agmatine antiporter, were low in the mutant deficient in both hupA and hupB. The deletion of both hupA and hupB had little effect on survival at pH 2.5 in the presence of glutamate or lysine, and expression of the genes for glutamate and lysine decarboxylases was not impaired by the deletion of the HU genes. These results suggest that HU regulates expression of the specific set of genes required for growth and survival in acidic environments.

  11. A putative APSES transcription factor is necessary for normal growth and development of Aspergillus nidulans.

    PubMed

    Lee, Ji-Yeon; Kim, Lee-Han; Kim, Ha-Eun; Park, Jae-Sin; Han, Kap-Hoon; Han, Dong-Min

    2013-12-01

    The nsdD gene encoding a GATA type transcription factor positively controls sexual development in Aspergillus nidulans. According to microarray data, 20 genes that were upregulated by deleting nsdD during various life cycle stages were randomly selected and deleted for functional analysis. None of the mutants showed apparent changes in growth or development compared with those of the wild-type except the AN3154 gene that encodes a putative APSES transcription factor and is an ortholog of Saccharomyces cerevisiae swi4. Deleting AN3154 resulted in retarded growth and development, and the gene was named rgdA (retared growth and development). The rgdA deletion mutant developed a reduced number of conidia even under favorable conditions for asexual development. The retarded growth and development was partially suppressed by the veA1 mutation. The conidial heads of the mutant aborted, showing reduced and irregular shaped phialides. Fruiting body development was delayed compared with that in the wild-type. The mutant did not respond to various nutritional or environmental factors that affected the development patterns. The rgdA gene was expressed at low levels throughout the life cycle and was not significantly affected by several regulators of sexual and asexual development such as nsdD, veA, stuA, or brlA. However, the rgdA gene affected brlA and abaA expression, which function as key regulators of asexual sporulation, suggesting that rgdA functions upstream of those genes.

  12. The Bordetella bhu Locus Is Required for Heme Iron Utilization

    PubMed Central

    Vanderpool, Carin K.; Armstrong, Sandra K.

    2001-01-01

    Bordetella pertussis and Bordetella bronchiseptica are capable of obtaining iron from hemin and hemoglobin. Genes encoding a putative bacterial heme iron acquisition system (bhu, for Bordetella heme utilization) were identified in a B. pertussis genomic sequence database, and the corresponding DNA was isolated from a virulent strain of B. pertussis. A B. pertussis bhuR mutant, predicted to lack the heme outer membrane receptor, was generated by allelic exchange. In contrast to the wild-type strain, bhuR mutant PM5 was incapable of acquiring iron from hemin and hemoglobin; genetic complementation of PM5 with the cloned bhuRSTUV genes restored heme utilization to wild-type levels. In parallel studies, B. bronchiseptica bhu sequences were also identified and a B. bronchiseptica bhuR mutant was constructed and confirmed to be defective in heme iron acquisition. The wild-type B. bronchiseptica parent strain grown under low-iron conditions produced the presumptive BhuR protein, which was absent in the bhuR mutant. Furthermore, production of BhuR by iron-starved B. bronchiseptica was markedly enhanced by culture in hemin-supplemented medium, suggesting that these organisms sense and respond to heme in the environment. Analysis of the genetic region upstream of the bhu cluster identified open reading frames predicted to encode homologs of the Escherichia coli ferric citrate uptake regulators FecI and FecR. These putative Bordetella regulators may mediate heme-responsive positive transcriptional control of the bhu genes. PMID:11418569

  13. Decreased seed oil production in FUSCA3 Brassica napus mutant plants.

    PubMed

    Elahi, Nosheen; Duncan, Robert W; Stasolla, Claudio

    2015-11-01

    Canola (Brassica napus L.) oil is extensively utilized for human consumption and industrial applications. Among the genes regulating seed development and participating in oil accumulation is FUSCA3 (FUS3), a member of the plant-specific B3-domain family of transcription factors. To evaluate the role of this gene during seed storage deposition, three BnFUSCA3 (BnFUS3) TILLING mutants were generated. Mutations occurring downstream of the B3 domain reduced silique number and repressed seed oil level resulting in increased protein content in developing seeds. BnFUS3 mutant seeds also had increased levels of linoleic acid, possibly due to the reduced expression of ω-3 FA DESATURASE (FAD3). These observed phenotypic alterations were accompanied by the decreased expression of genes encoding transcription factors stimulating fatty acid (FA) synthesis: LEAFY COTYLEDON1 and 2 (LEC1 and 2) ABSCISIC ACID-INSENSITIVE 3 (BnABI3) and WRINKLED1 (WRI1). Additionally, expression of genes encoding enzymes involved in sucrose metabolism, glycolysis, and FA modifications were down-regulated in developing seeds of the mutant plants. Collectively, these transcriptional changes support altered sucrose metabolism and reduced glycolytic activity, diminishing the carbon pool available for the synthesis of FA and ultimately seed oil production. Based on these observations, it is suggested that targeted manipulations of BnFUS3 can be used as a tool to influence oil accumulation in the economically important species B. napus. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Function of Protein Phosphatase 2A in Control of Proliferation: Isolation and Analysis of Dominant-Defective Mutants

    DTIC Science & Technology

    1999-06-01

    subunits are expressed ubiquitously and appear to be encoded by small and quite homogeneous gene families. In plants , however, A and C subunit gene...1996). In both plants and animals, different B subunit isoforms are encoded by two or more unrelated gene families, some of which are expressed in a...PP2A functions in whole plants and in mammalian tissue culture cells. This genetic system may also prove useful for analyzing interactions between

  15. Accelerated bang recovery in Drosophila genderblind mutants.

    PubMed

    Featherstone, David E; Yanoga, Fatoumata; Grosjean, Yael

    2008-07-01

    Cystine-glutamate transporters import cystine into cells for glutathione synthesis and protection from oxidative stress, but also export significant amounts of glutamate. Increasing evidence suggests that 'ambient extracellular glutamate' secreted by cystine-glutamate transporters in the nervous system modulates glutamatergic synapse strength and behavior. To date, the only cystine-glutamate transporter mutants examined behaviorally are Drosophila genderblind mutants. These animals contain loss-of-function mutations in the 'genderblind' gene, which encodes an xCT subunit essential for cystine-glutamate transporter function. Genderblind was named based on a mutant courtship phenotype: male genderblind mutants are attracted to normally aversive male pheromones and thus court and attempt to copulate with both male and female partners equally. However, genderblind protein is expressed in many parts of the fly brain and thus might be expected to also regulate other behaviors, including behaviors not related to male courtship or chemosensation. Here, we show that genderblind mutants display faster recovery and increased negative geotaxis after strong mechanical stimuli (e.g., they climb faster and farther after vial banging). This phenotype is displayed by both males and females, consistent with strong genderblind expression in both sexes.

  16. Reduced Heme Levels Underlie the Exponential Growth Defect of the Shewanella oneidensis hfq Mutant

    PubMed Central

    Mezoian, Taylor; Hunt, Taylor M.; Keane, Meaghan L.; Leonard, Jessica N.; Scola, Shelby E.; Beer, Emma N.; Perdue, Sarah; Pellock, Brett J.

    2014-01-01

    The RNA chaperone Hfq fulfills important roles in small regulatory RNA (sRNA) function in many bacteria. Loss of Hfq in the dissimilatory metal reducing bacterium Shewanella oneidensis strain MR-1 results in slow exponential phase growth and a reduced terminal cell density at stationary phase. We have found that the exponential phase growth defect of the hfq mutant in LB is the result of reduced heme levels. Both heme levels and exponential phase growth of the hfq mutant can be completely restored by supplementing LB medium with 5-aminolevulinic acid (5-ALA), the first committed intermediate synthesized during heme synthesis. Increasing expression of gtrA, which encodes the enzyme that catalyzes the first step in heme biosynthesis, also restores heme levels and exponential phase growth of the hfq mutant. Taken together, our data indicate that reduced heme levels are responsible for the exponential growth defect of the S. oneidensis hfq mutant in LB medium and suggest that the S. oneidensis hfq mutant is deficient in heme production at the 5-ALA synthesis step. PMID:25356668

  17. The AAE14 gene encodes the Arabidopsis o-succinylbenzoyl-CoA ligase that is essential for phylloquinone synthesis and photosystem-I function.

    PubMed

    Kim, Hyun Uk; van Oostende, Chloë; Basset, Gilles J C; Browse, John

    2008-04-01

    Phylloquinone is the one-electron carrier at the A(1) site of photosystem I, and is essential for photosynthesis. Arabidopsis mutants deficient in early steps of phylloquinone synthesis do not become autotrophic and are seedling lethals, even when grown on sucrose-supplemented media. Here, we identify acyl-activating enzyme 14 (AAE14, At1g30520) as the o-succinylbenzoyl-coenzyme A (OSB-CoA) ligase acting in phylloquinone synthesis. Three aae14 mutant alleles, identified by reverse genetics, were found to be seedling lethal, to contain no detectable phylloquinone (< 0.1 pmol mg(-1) fresh weight) compared with 10 pmol mg(-1) fresh weight in wild-type leaves, and to accumulate OSB. AAE14 was able to restore menaquinone biosynthesis when expressed in an Escherichia coli mutant disrupted in the menE gene that encodes the bacterial OSB-CoA ligase. Weak expression of an AAE14 transgene in mutant plants (controlled by the uninduced XVE promoter) resulted in chlorotic, slow-growing plants that accumulated an average of 4.7 pmol mg(-1) fresh weight of phylloquinone. Inducing the XVE promoter in these plants, or expressing an AAE14 transgene under the control of the CaMV 35S promoter, led to full complementation of the mutant phenotype. aae14-mutant plants were also able to synthesize phylloquinone when provided with 1,4-dihydroxy-2-naphthoate, an intermediate in phylloquinone synthesis downstream of the OSB-CoA ligase reaction. Expression of an AAE14:GFP reporter construct indicated that the protein accumulated in discrete foci within the chloroplasts. This and other evidence suggests that the enzymes of phylloquinone synthesis from isochorismate may form a complex in the chloroplast stroma to facilitate the efficient channeling of intermediates through the pathway.

  18. Isolation and characterization of two cellulose morphology mutants of Gluconacetobacter hansenii ATCC23769 producing cellulose with lower crystallinity

    DOE PAGES

    Deng, Ying; Nagachar, Nivedita; Fang, Lin; ...

    2015-03-19

    Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC). These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To addressmore » this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of peptidoglycan in the assembly of crystalline cellulose.« less

  19. Computational Modelling of Dapsone Interaction With Dihydropteroate Synthase in Mycobacterium leprae; Insights Into Molecular Basis of Dapsone Resistance in Leprosy.

    PubMed

    Chaitanya V, Sundeep; Das, Madhusmita; Bhat, Pritesh; Ebenezer, Mannam

    2015-10-01

    The molecular basis for determination of resistance to anti-leprosy drugs is the presence of point mutations within the genes of Mycobacterium leprae (M. leprae) that encode active drug targets. The downstream structural and functional implications of these point mutations on drug targets were scarcely studied. In this study, we utilized computational tools to develop native and mutant protein models for 5 point mutations at codon positions 53 and 55 in 6-hydroxymethyl-7, 8-dihydropteroate synthase (DHPS) of M. leprae, an active target for dapsone encoded by folp1 gene, that confer resistance to dapsone. Molecular docking was performed to identify variations in dapsone interaction with mutant DHPS in terms of hydrogen bonding, hydrophobic interactions, and energy changes. Schrodinger Suite 2014-3 was used to build homology models and in performing molecular docking. An increase in volume of the binding cavities of mutant structures was noted when compared to native form indicating a weakening in interaction (60.7 Å(3) in native vs. 233.6 Å(3) in Thr53Ala, 659.9 Å(3) in Thr53Ile, 400 Å(3) for Thr53Val, 385 Å(3) for Pro55Arg, and 210 Å(3) for Pro55Leu). This was also reflected by changes in hydrogen bonds and decrease in hydrophobic interactions in the mutant models. The total binding energy (ΔG) decreased significantly in mutant forms when compared to the native form (-51.92 Kcal/mol for native vs. -35.64, -35.24, -46.47, -47.69, and -41.36 Kcal/mol for mutations Thr53Ala, Thr53Ile, Thr53Val, Pro55Arg, and Pro55Leu, respectively. In brief, this analysis provided structural and mechanistic insights to the degree of dapsone resistance contributed by each of these DHPS mutants in leprosy. © 2015 Wiley Periodicals, Inc.

  20. Isolation and characterization of two cellulose morphology mutants of Gluconacetobacter hansenii ATCC23769 producing cellulose with lower crystallinity.

    PubMed

    Deng, Ying; Nagachar, Nivedita; Fang, Lin; Luan, Xin; Catchmark, Jeffrey M; Tien, Ming; Kao, Teh-hui

    2015-01-01

    Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC). These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To address this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of peptidoglycan in the assembly of crystalline cellulose.

  1. Isolation and Characterization of Two Cellulose Morphology Mutants of Gluconacetobacter hansenii ATCC23769 Producing Cellulose with Lower Crystallinity

    PubMed Central

    Deng, Ying; Nagachar, Nivedita; Fang, Lin; Luan, Xin; Catchmark, Jeffrey M.; Tien, Ming; Kao, Teh-hui

    2015-01-01

    Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC). These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To address this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of peptidoglycan in the assembly of crystalline cellulose. PMID:25790428

  2. Inactivation of NMB0419, Encoding a Sel1-Like Repeat (SLR) Protein, in Neisseria meningitidis Is Associated with Differential Expression of Genes Belonging to the Fur Regulon and Reduced Intraepithelial Replication

    PubMed Central

    Li, Ming-Shi

    2017-01-01

    ABSTRACT Neisseria meningitidis is a commensal microbe that colonizes the human nasopharynx but occasionally invades the bloodstream to cause life-threatening infection. N. meningitidis MC58 NMB0419 encodes a Sel1-like repeat (SLR)-containing protein, previously implicated in invasion of epithelial cells. A gene-regulatory function was revealed in Escherichia coli expressing plasmid-borne NMB0419 and showing significantly increased epithelial adherence compared to the wild type, due to increased expression of mannose-sensitive type 1 pili. While a meningococcal NMB0419 mutant did not have altered epithelial adherence, in a transcriptome-wide comparison of the wild type and an NMB0419 mutant, a large proportion of genes differentially regulated in the mutant were involved in iron acquisition and metabolism. Fifty-one percent and 38% of genes, respectively, up- and downregulated in the NMB0419 mutant had previously been identified as being induced and repressed by meningococcal Fur. An in vitro growth defect of the NMB0419 mutant under iron restriction was consistent with the downregulation of tbpAB and hmbR, while an intraepithelial replication defect was consistent with the downregulation of tonB, exbB, and exbD, based on a known phenotype of a meningococcal tonB mutant. Disruption of the N-terminal NMB0419 signal peptide, predicted to export the protein beyond the cytoplasmic membrane, resulted in loss of functional traits in N. meningitidis and E. coli. Our study indicates that the expression of NMB0419 is associated with transcriptional changes counterbalancing the regulatory function of Fur, offering a new perspective on regulatory mechanisms involved in meningococcal interaction with epithelial cells, and suggests new insights into the roles of SLR-containing genes in other bacteria. PMID:28264906

  3. Root hair-specific disruption of cellulose and xyloglucan in AtCSLD3 mutants, and factors affecting the post-rupture resumption of mutant root hair growth.

    PubMed

    Galway, Moira E; Eng, Ryan C; Schiefelbein, John W; Wasteneys, Geoffrey O

    2011-05-01

    The glycosyl transferase encoded by the cellulose synthase-like gene CSLD3/KJK/RHD7 (At3g03050) is required for cell wall integrity during root hair formation in Arabidopsis thaliana but it remains unclear whether it contributes to the synthesis of cellulose or hemicellulose. We identified two new alleles, root hair-defective (rhd) 7-1 and rhd7-4, which affect the C-terminal end of the encoded protein. Like root hairs in the previously characterized kjk-2 putative null mutant, rhd7-1 and rhd7-4 hairs rupture before tip growth but, depending on the growth medium and temperature, hairs are able to survive rupture and initiate tip growth, indicating that these alleles retain some function. At 21°C, the rhd7 tip-growing root hairs continued to rupture but at 5ºC, rupture was inhibited, resulting in long, wild type-like root hairs. At both temperatures, the expression of another root hair-specific CSLD gene, CSLD2, was increased in the rhd7-4 mutant but reduced in the kjk-2 mutant, suggesting that CSLD2 expression is CSLD3-dependent, and that CSLD2 could partially compensate for CSLD3 defects to prevent rupture at 5°C. Using a fluorescent brightener (FB 28) to detect cell wall (1 → 4)-β-glucans (primarily cellulose) and CCRC-M1 antibody to detect fucosylated xyloglucans revealed a patchy distribution of both in the mutant root hair cell walls. Cell wall thickness varied, and immunogold electron microscopy indicated that xyloglucan distribution was altered throughout the root hair cell walls. These cell wall defects indicate that CSLD3 is required for the normal organization of both cellulose and xyloglucan in root hair cell walls.

  4. Implication of the VirD4 coupling protein of the Lvh type 4 secretion system in virulence phenotypes of Legionella pneumophila.

    PubMed

    Bandyopadhyay, Purnima; Lang, Elza A S; Rasaputra, Komal S; Steinman, Howard M

    2013-08-01

    The genome of the Philadelphia-1 strain of Legionella pneumophila, the causative organism of Legionnaires' disease, encodes two virulence-associated type 4 secretion systems (T4SSs), the Dot/Icm type 4B (T4BSS) and the Lvh type 4A (T4ASS). Broth stationary-phase cultures of most dot/icm mutants are defective in entry and evasion of phagosome acidification. However, those virulence defects can be reversed by incubating broth cultures of dot/icm mutants in water, termed water stress (WS). WS reversal requires the lvh T4ASS locus, suggesting an interaction between the two T4SSs in producing Legionella virulence phenotypes. In the current work, the loss of WS reversal in a dotA Δlvh mutant of strain JR32 was shown to be attributable to loss of the lvh virD4 gene, encoding the putative coupling protein of the T4ASS. Transformation of a dotA Δlvh mutant with virD4 also reversed entry and phagosome acidification defects in broth cultures. In addition, broth cultures of Δlvh and ΔvirD4 mutants, which were dot/icm(+), showed 5-fold and >6-fold increases in translocation of the Dot/Icm translocation substrates, proteins RalF and SidD, respectively. These data demonstrate that the Lvh T4ASS functions in both broth stationary-phase cultures conventionally used for infection and cultures exposed to WS treatment. Our studies in a dotA Δlvh mutant and in a dot/icm(+) background establish that VirD4 and the Lvh T4ASS contribute to virulence phenotypes and are consistent with independent functioning of Dot/Icm and Lvh T4SSs or functional substitution of the Lvh VirD4 protein for a component(s) of the Dot/Icm T4BSS.

  5. Implication of the VirD4 Coupling Protein of the Lvh Type 4 Secretion System in Virulence Phenotypes of Legionella pneumophila

    PubMed Central

    Bandyopadhyay, Purnima; Lang, Elza A. S.; Rasaputra, Komal S.

    2013-01-01

    The genome of the Philadelphia-1 strain of Legionella pneumophila, the causative organism of Legionnaires' disease, encodes two virulence-associated type 4 secretion systems (T4SSs), the Dot/Icm type 4B (T4BSS) and the Lvh type 4A (T4ASS). Broth stationary-phase cultures of most dot/icm mutants are defective in entry and evasion of phagosome acidification. However, those virulence defects can be reversed by incubating broth cultures of dot/icm mutants in water, termed water stress (WS). WS reversal requires the lvh T4ASS locus, suggesting an interaction between the two T4SSs in producing Legionella virulence phenotypes. In the current work, the loss of WS reversal in a dotA Δlvh mutant of strain JR32 was shown to be attributable to loss of the lvh virD4 gene, encoding the putative coupling protein of the T4ASS. Transformation of a dotA Δlvh mutant with virD4 also reversed entry and phagosome acidification defects in broth cultures. In addition, broth cultures of Δlvh and ΔvirD4 mutants, which were dot/icm+, showed 5-fold and >6-fold increases in translocation of the Dot/Icm translocation substrates, proteins RalF and SidD, respectively. These data demonstrate that the Lvh T4ASS functions in both broth stationary-phase cultures conventionally used for infection and cultures exposed to WS treatment. Our studies in a dotA Δlvh mutant and in a dot/icm+ background establish that VirD4 and the Lvh T4ASS contribute to virulence phenotypes and are consistent with independent functioning of Dot/Icm and Lvh T4SSs or functional substitution of the Lvh VirD4 protein for a component(s) of the Dot/Icm T4BSS. PMID:23729650

  6. Deletion of HAPS_2096 Increases Sensitivity to Cecropin B in Haemophilus parasuis.

    PubMed

    Chen, Fanjie; Hu, Han; Li, Zhonghua; Huang, Jiacheng; Cai, Xuwang; Wang, Chunmei; He, Qigai; Cao, Jiyue

    2015-01-01

    Cecropin B (CB) is a very effective natural antimicrobial peptide that has shown great potential for future antimicrobial drug development. HAPS_2096 is a Haemophilus parasuis gene that encodes the periplasmic substrate-binding protein of an ATP-binding cassette-type amino acid transporter. In this research, we constructed and verified an HAPS_2096 deletion mutant and a complementary HAPS_2096 mutant of H. parasuis JS0135. A bactericidal assay revealed that the HAPS_2096 deletion mutant was significantly more sensitive than the wild-type strain to 0.25-0.5 µg/ml CB. However, the gene complementation alleviated the CB sensitivity of the mutant. Immunoelectron microscopy observation following a 30-min treatment with a sublethal concentration of CB (0.25 μg/ml) revealed more extensive morphological damage in the mutant strain than in the wild-type strain. Hence, our results suggest that the HAPS_2096 gene contributes to H. parasuis resistance to CB. © 2015 S. Karger AG, Basel.

  7. Genetic and physical analyses of Methylobacterium organophilum XX genes encoding methanol oxidation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Machlin, S.M.; Tam, P.E.; Bastien, C.A.

    When allyl alcohol was used as a suicide substrate, spontaneous mutants and UV light- and nitrous acid-generated mutants of Methylobacterium organophilum XX were selected which grew on methylamine but not on methanol. There was no detectable methanol dehydrogenase (MDH) activity in crude extracts of these mutants, yet Western blots revealed that some mutants still produced MDH protein. Complementation of 50 mutants by a cosmid gene bank of M. organophilum XX demonstrated that three major regions of the genome, each of which was separated by a minimum of 40 kilobases, were required for expression of active MDH. By subcloning and Tn5more » insertion mutagenesis of subcloned fragments, at least 11 genes clustered within these three regions were subsequently identified. The identity of the MDH structural gene, which was initially determined by hybridization to the structural gene of Methylobacterium sp. strain AM1, was confirmed by Western blot analysis of an MDH-..beta..-galactosidase fusion protein.« less

  8. Data supporting mitochondrial morphological changes by SPG13-associated HSPD1 mutants.

    PubMed

    Miyamoto, Yuki; Megumi, Funakoshi-Tago; Hasegawa, Nanami; Eguchi, Takahiro; Tanoue, Akito; Tamura, Hiroomi; Yamauchi, Junji

    2016-03-01

    The data is related to the research article entitled "Hypomyelinating leukodystrophy-associated missense mutation in HSPD1 blunts mitochondrial dynamics" [1]. In addition to hypomyelinating leukodystrophy (HLD) 4 (OMIM no. 612233), it is known that spastic paraplegia (SPG) 13 (OMIM no. 605280) is caused by HSPD1's amino acid mutation. Two amino acid mutations Val-98-to-Ile (V98I) and Gln-461-to-Glu (Q461E) are associated with SPG13 [2]. In order to investigate the effects of HSPD1's V98I or Q461E mutant on mitochondrial morphological changes, we transfected each of the respective mutant-encoding genes into Cos-7 cells. Either of V98I or Q461E mutant exhibited increased number of mitochondria and short length mitochondrial morphologies. Using MitoTracker dye-incorporating assay, decreased mitochondrial membrane potential was also observed in both cases. The data described here supports that SPG13-associated HSPD1 mutant participates in causing aberrant mitochondrial morphological changes with decreased activities.

  9. Disruption of Endocytosis with the Dynamin Mutant shibirets1 Suppresses Seizures in Drosophila

    PubMed Central

    Kroll, Jason R.; Wong, Karen G.; Siddiqui, Faria M.; Tanouye, Mark A.

    2015-01-01

    One challenge in modern medicine is to control epilepsies that do not respond to currently available medications. Since seizures consist of coordinated and high-frequency neural activity, our goal was to disrupt neurotransmission with a synaptic transmission mutant and evaluate its ability to suppress seizures. We found that the mutant shibire, encoding dynamin, suppresses seizure-like activity in multiple seizure–sensitive Drosophila genotypes, one of which resembles human intractable epilepsy in several aspects. Because of the requirement of dynamin in endocytosis, increased temperature in the shits1 mutant causes impairment of synaptic vesicle recycling and is associated with suppression of the seizure-like activity. Additionally, we identified the giant fiber neuron as critical in the seizure circuit and sufficient to suppress seizures. Overall, our results implicate mutant dynamin as an effective seizure suppressor, suggesting that targeting or limiting the availability of synaptic vesicles could be an effective and general method of controlling epilepsy disorders. PMID:26341658

  10. Genetic analysis of indole-3-butyric acid responses in Arabidopsis thaliana reveals four mutant classes.

    PubMed Central

    Zolman, B K; Yoder, A; Bartel, B

    2000-01-01

    Indole-3-butyric acid (IBA) is widely used in agriculture because it induces rooting. To better understand the in vivo role of this endogenous auxin, we have identified 14 Arabidopsis mutants that are resistant to the inhibitory effects of IBA on root elongation, but that remain sensitive to the more abundant auxin indole-3-acetic acid (IAA). These mutants have defects in various IBA-mediated responses, which allowed us to group them into four phenotypic classes. Developmental defects in the absence of exogenous sucrose suggest that some of these mutants are impaired in peroxisomal fatty acid chain shortening, implying that the conversion of IBA to IAA is also disrupted. Other mutants appear to have normal peroxisomal function; some of these may be defective in IBA transport, signaling, or response. Recombination mapping indicates that these mutants represent at least nine novel loci in Arabidopsis. The gene defective in one of the mutants was identified using a positional approach and encodes PEX5, which acts in the import of most peroxisomal matrix proteins. These results indicate that in Arabidopsis thaliana, IBA acts, at least in part, via its conversion to IAA. PMID:11063705

  11. Suppression of mutants aberrant in light intensity responses of complementary chromatic adaptation.

    PubMed Central

    Casey, E S; Kehoe, D M; Grossman, A R

    1997-01-01

    Complementary chromatic adaptation is a process in which cyanobacteria alter the pigment protein (phycocyanin and phycoerythrin) composition of their light-harvesting complexes, the phycobilisomes, to help optimize the absorbance of prevalent wavelengths of light in the environment. Several classes of mutants that display aberrant complementary chromatic adaptation have been isolated. One of the mutant classes, designated "blue" or FdB, accumulates high levels of the blue chromoprotein phycocyanin in low-intensity green light, a condition that normally suppresses phycocyanin synthesis. We demonstrate here that the synthesis of the phycocyanin protein and mRNA in the FdB mutants can be suppressed by increasing the intensity of green light. Hence, these mutants have a decreased sensitivity to green light with respect to suppression of phycocyanin synthesis. Although we were unable to complement the blue mutants, we did isolate genes that could suppress the mutant phenotype. These genes, which have been identified previously, encode a histidine kinase sensor and response regulator protein that play key roles in controlling complementary chromatic adaptation. These findings are discussed with respect to the mechanism by which light quality and quantity control the biosynthesis of the phycobilisome. PMID:9226271

  12. The Yersiniabactin Transport System Is Critical for the Pathogenesis of Bubonic and Pneumonic Plague▿

    PubMed Central

    Fetherston, Jacqueline D.; Kirillina, Olga; Bobrov, Alexander G.; Paulley, James T.; Perry, Robert D.

    2010-01-01

    Iron acquisition from the host is an important step in the pathogenic process. While Yersinia pestis has multiple iron transporters, the yersiniabactin (Ybt) siderophore-dependent system plays a major role in iron acquisition in vitro and in vivo. In this study, we determined that the Ybt system is required for the use of iron bound by transferrin and lactoferrin and examined the importance of the Ybt system for virulence in mouse models of bubonic and pneumonic plague. Y. pestis mutants unable to either transport Ybt or synthesize the siderophore were both essentially avirulent via subcutaneous injection (bubonic plague model). Surprisingly, via intranasal instillation (pneumonic plague model), we saw a difference in the virulence of Ybt biosynthetic and transport mutants. Ybt biosynthetic mutants displayed an ∼24-fold-higher 50% lethal dose (LD50) than transport mutants. In contrast, under iron-restricted conditions in vitro, a Ybt transport mutant had a more severe growth defect than the Ybt biosynthetic mutant. Finally, a Δpgm mutant had a greater loss of virulence than the Ybt biosynthetic mutant, indicating that the 102-kb pgm locus encodes a virulence factor, in addition to Ybt, that plays a role in the pathogenesis of pneumonic plague. PMID:20160020

  13. RNA-Seq analysis of global transcriptomic changes suggests a roles for the MAPK pathway and carbon metabolism in cell wall maintenance in a Saccharomyces cerevisiae FKS1 mutant.

    PubMed

    Huang, Cong; Zhao, Fengguang; Lin, Ying; Zheng, Suiping; Liang, Shuli; Han, Shuangyan

    2018-06-07

    FKS1 encodes a β-1,3-glucan synthase, which is a key player in cell wall assembly in Saccharomyces cerevisiae. Here we analyzed the global transcriptomic changes in the FKS1 mutant to establish a correlation between the changes in the cell wall of the FKS1 mutant and the molecular mechanism of cell wall maintenance. These transcriptomic profiles showed that there are 1151 differentially expressed genes (DEGs) in the FKS1 mutant. Through KEGG pathway analysis of the DEGs, the MAPK pathway and seven pathways involved in carbon metabolism were significantly enriched. We found that the MAPK pathway is activated for FKS1 mutant survival and the synthesis of cell wall components are reinforced in the FKS1 mutant. Our results confirm that the FKS1 mutant has a β-1,3-glucan defect that affects the cell wall and partly elucidate the molecular mechanism responsible for cell wall synthesis. Our greater understanding of these mechanisms helps to explain how the FKS1 mutant survives, has useful implications for the study of similar pathways in other fungi, and increases the theoretical foundation for the regulation of the cell wall in S. cerevisiae. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants.

    PubMed

    García-Contreras, Rodolfo; Lira-Silva, Elizabeth; Jasso-Chávez, Ricardo; Hernández-González, Ismael L; Maeda, Toshinari; Hashimoto, Takahiro; Boogerd, Fred C; Sheng, Lili; Wood, Thomas K; Moreno-Sánchez, Rafael

    2013-12-01

    Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed 4- to 12-fold higher Ga minimal inhibitory growth concentrations and a greater than 8-fold increase in the minimum biofilm eliminating Ga concentration. Both types of mutants produced Ga resistant biofilms whereas the formation of wild-type biofilms was strongly inhibited by Ga. The gene interrupted in the transposon mutant was hitA, which encodes a periplasmic iron binding protein that delivers Fe³⁺ to the HitB iron permease; complementation of the mutant with the hitA gene restored the Ga sensitivity. This hitA mutant showed a 14-fold decrease in Ga internalization versus the wild-type strain, indicating that the HitAB system is also involved in the Ga uptake. Ga uptake in the spontaneous mutant was also lower, although no mutations were found in the hitAB genes. Instead, this mutant harbored 64 non-silent mutations in several genes including those of the phenazine pyocyanin biosynthesis. The spontaneous mutant produced 2-fold higher pyocyanin basal levels than the wild-type; the addition of this phenazine to wild-type cultures protected them from the Ga bacteriostatic effect. The present data indicate that mutations affecting Ga transport and probably pyocyanin biosynthesis enable cells to develop resistance to Ga. Copyright © 2013 Elsevier GmbH. All rights reserved.

  15. A disruption of ctpA encoding carboxy-terminal protease attenuates Burkholderia mallei and induces partial protection in CD1 mice.

    PubMed

    Bandara, Aloka B; DeShazer, David; Inzana, Thomas J; Sriranganathan, Nammalwar; Schurig, Gerhardt G; Boyle, Stephen M

    2008-09-01

    Burkholderia mallei is the etiologic agent of glanders in solipeds (horses, mules and donkeys), and incidentally in carnivores and humans. Little is known about the molecular mechanisms of B. mallei pathogenesis. The putative carboxy-terminal processing protease (CtpA) of B. mallei is a member of a novel family of endoproteases involved in the maturation of proteins destined for the cell envelope. All species and isolates of Burkholderia carry a highly conserved copy of ctpA. We studied the involvement of CtpA on growth, cell morphology, persistence, and pathogenicity of B. mallei. A sucrose-resistant strain of B. mallei was constructed by deleting a major portion of the sacB gene of the wild type strain ATCC 23344 by gene replacement, and designated as strain 23344DeltasacB. A portion of the ctpA gene (encoding CtpA) of strain 23344DeltasacB was deleted by gene replacement to generate strain 23344DeltasacBDeltactpA. In contrast to the wild type ATCC 23344 or the sacB mutant 23344DeltasacB, the ctpA mutant 23344DeltasacBDeltactpA displayed altered cell morphologies with partially or fully disintegrated cell envelopes. Furthermore, relative to the wild type, the ctpA mutant displayed slower growth in vitro and less ability to survive in J774.2 murine macrophages. The expression of mRNA of adtA, the gene downstream of ctpA was similar among the three strains suggesting that disruption of ctpA did not induce any polar effects. As with the wild type or the sacB mutant, the ctpA mutant exhibited a dose-dependent lethality when inoculated intraperitoneally into CD1 mice. The CD1 mice inoculated with a non-lethal dose of the ctpA mutant produced specific serum immunoglobulins IgG1 and IgG2a and were partially protected against challenge with wild type B. mallei ATCC 23344. These findings suggest that CtpA regulates in vitro growth, cell morphology and intracellular survival of B. mallei, and a ctpA mutant protects CD1 mice against glanders.

  16. MMS Exposure Promotes Increased MtDNA Mutagenesis in the Presence of Replication-Defective Disease-Associated DNA Polymerase γ Variants

    PubMed Central

    Stumpf, Jeffrey D.; Copeland, William C.

    2014-01-01

    Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but suppresses MMS-induced mutagenesis. These results suggest a novel mechanism wherein mutations that lead to hypermutation by DNA base-damaging agents and associate with mitochondrial disease may contribute to previously unexplained phenomena, such as the wide variation of age of disease onset and acquired mitochondrial toxicities. PMID:25340760

  17. MMS exposure promotes increased MtDNA mutagenesis in the presence of replication-defective disease-associated DNA polymerase γ variants.

    PubMed

    Stumpf, Jeffrey D; Copeland, William C

    2014-10-01

    Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but suppresses MMS-induced mutagenesis. These results suggest a novel mechanism wherein mutations that lead to hypermutation by DNA base-damaging agents and associate with mitochondrial disease may contribute to previously unexplained phenomena, such as the wide variation of age of disease onset and acquired mitochondrial toxicities.

  18. High-Throughput, Signature-Tagged Mutagenic Approach To Identify Novel Virulence Factors of Yersinia pestis CO92 in a Mouse Model of Infection

    PubMed Central

    Ponnusamy, Duraisamy; Fitts, Eric C.; Erova, Tatiana E.; Kozlova, Elena V.; Kirtley, Michelle L.; Tiner, Bethany L.; Andersson, Jourdan A.

    2015-01-01

    The identification of new virulence factors in Yersinia pestis and understanding their molecular mechanisms during an infection process are necessary in designing a better vaccine or to formulate an appropriate therapeutic intervention. By using a high-throughput, signature-tagged mutagenic approach, we created 5,088 mutants of Y. pestis strain CO92 and screened them in a mouse model of pneumonic plague at a dose equivalent to 5 50% lethal doses (LD50) of wild-type (WT) CO92. From this screen, we obtained 118 clones showing impairment in disseminating to the spleen, based on hybridization of input versus output DNA from mutant pools with 53 unique signature tags. In the subsequent screen, 20/118 mutants exhibited attenuation at 8 LD50 when tested in a mouse model of bubonic plague, with infection by 10/20 of the aforementioned mutants resulting in 40% or higher survival rates at an infectious dose of 40 LD50. Upon sequencing, six of the attenuated mutants were found to carry interruptions in genes encoding hypothetical proteins or proteins with putative functions. Mutants with in-frame deletion mutations of two of the genes identified from the screen, namely, rbsA, which codes for a putative sugar transport system ATP-binding protein, and vasK, a component of the type VI secretion system, were also found to exhibit some attenuation at 11 or 12 LD50 in a mouse model of pneumonic plague. Likewise, among the remaining 18 signature-tagged mutants, 9 were also attenuated (40 to 100%) at 12 LD50 in a pneumonic plague mouse model. Previously, we found that deleting genes encoding Braun lipoprotein (Lpp) and acyltransferase (MsbB), the latter of which modifies lipopolysaccharide function, reduced the virulence of Y. pestis CO92 in mouse models of bubonic and pneumonic plague. Deletion of rbsA and vasK genes from either the Δlpp single or the Δlpp ΔmsbB double mutant augmented the attenuation to provide 90 to 100% survivability to mice in a pneumonic plague model at 20 to 50 LD50. The mice infected with the Δlpp ΔmsbB ΔrbsA triple mutant at 50 LD50 were 90% protected upon subsequent challenge with 12 LD50 of WT CO92, suggesting that this mutant or others carrying combinational deletions of genes identified through our screen could potentially be further tested and developed into a live attenuated plague vaccine(s). PMID:25754198

  19. High-throughput, signature-tagged mutagenic approach to identify novel virulence factors of Yersinia pestis CO92 in a mouse model of infection.

    PubMed

    Ponnusamy, Duraisamy; Fitts, Eric C; Sha, Jian; Erova, Tatiana E; Kozlova, Elena V; Kirtley, Michelle L; Tiner, Bethany L; Andersson, Jourdan A; Chopra, Ashok K

    2015-05-01

    The identification of new virulence factors in Yersinia pestis and understanding their molecular mechanisms during an infection process are necessary in designing a better vaccine or to formulate an appropriate therapeutic intervention. By using a high-throughput, signature-tagged mutagenic approach, we created 5,088 mutants of Y. pestis strain CO92 and screened them in a mouse model of pneumonic plague at a dose equivalent to 5 50% lethal doses (LD50) of wild-type (WT) CO92. From this screen, we obtained 118 clones showing impairment in disseminating to the spleen, based on hybridization of input versus output DNA from mutant pools with 53 unique signature tags. In the subsequent screen, 20/118 mutants exhibited attenuation at 8 LD50 when tested in a mouse model of bubonic plague, with infection by 10/20 of the aforementioned mutants resulting in 40% or higher survival rates at an infectious dose of 40 LD50. Upon sequencing, six of the attenuated mutants were found to carry interruptions in genes encoding hypothetical proteins or proteins with putative functions. Mutants with in-frame deletion mutations of two of the genes identified from the screen, namely, rbsA, which codes for a putative sugar transport system ATP-binding protein, and vasK, a component of the type VI secretion system, were also found to exhibit some attenuation at 11 or 12 LD50 in a mouse model of pneumonic plague. Likewise, among the remaining 18 signature-tagged mutants, 9 were also attenuated (40 to 100%) at 12 LD50 in a pneumonic plague mouse model. Previously, we found that deleting genes encoding Braun lipoprotein (Lpp) and acyltransferase (MsbB), the latter of which modifies lipopolysaccharide function, reduced the virulence of Y. pestis CO92 in mouse models of bubonic and pneumonic plague. Deletion of rbsA and vasK genes from either the Δlpp single or the Δlpp ΔmsbB double mutant augmented the attenuation to provide 90 to 100% survivability to mice in a pneumonic plague model at 20 to 50 LD50. The mice infected with the Δlpp ΔmsbB ΔrbsA triple mutant at 50 LD50 were 90% protected upon subsequent challenge with 12 LD50 of WT CO92, suggesting that this mutant or others carrying combinational deletions of genes identified through our screen could potentially be further tested and developed into a live attenuated plague vaccine(s). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Ethylene signaling triggered by low concentrations of ascorbic acid regulates biomass accumulation in Arabidopsis thaliana.

    PubMed

    Caviglia, M; Mazorra Morales, L M; Concellón, A; Gergoff Grozeff, G E; Wilson, M; Foyer, C H; Bartoli, C G

    2018-02-02

    Ascorbic acid (AA) is a major redox buffer in plant cells. The role of ethylene in the redox signaling pathways that influence photosynthesis and growth was explored in two independent AA deficient Arabidopsis thaliana mutants (vtc2-1 and vtc2-4). Both mutants, which are defective in the AA biosynthesis gene GDP-L-galactose phosphorylase, produce higher amounts of ethylene than wt plants. In contrast to the wt, the inhibition of ethylene signaling increased leaf conductance, photosynthesis and dry weight in both vtc2 mutant lines. The AA-deficient mutants showed altered expression of genes encoding proteins involved in the synthesis/responses to phytohormones that control growth, particularly auxin, cytokinins, abscisic acid, brassinosterioids, ethylene and salicylic acid. These results demonstrate that AA deficiency modifies hormone signaling in plants, redox-ethylene interactions providing a regulatory node controlling shoot biomass accumulation. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. The pht4;1-3 mutant line contains a loss of function allele in the Fatty Acid Desaturase 7 gene caused by a remnant inactivated selection marker-a cautionary tale.

    PubMed

    Nilsson, Anders K; Andersson, Mats X

    2017-01-01

    A striking and unexpected biochemical phenotype was found in an insertion mutant line in the model plant Arabidopsis thaliana . One of two investigated insertion mutant lines in the gene encoding the phosphate transporter PHT4;1 demonstrated a prominent loss of trienoic fatty acids, whereas the other insertion line was indistinguishable from wild type in this aspect. We demonstrate that the loss of trienoic fatty acids was due to a remnant inactive negative selection marker gene in this particular transposon tagged line, pht4;1-3 . This constitutes a cautionary tale that warns of the importance to confirm the loss of this type of selection markers and the importance of verifying the relationship between a phenotype and genotype by more than one independent mutant line or alternatively genetic complementation.

  2. In vivo and in vitro analyses of a Bombyx mori nucleopolyhedrovirus mutant lacking functional vfgf.

    PubMed

    Katsuma, Susumu; Horie, Satoshi; Daimon, Takaaki; Iwanaga, Masashi; Shimada, Toru

    2006-11-10

    All lepidopteran baculovirus genomes sequenced to date encode a viral fibroblast growth factor homolog (vfgf), suggesting that vfgf may play an important role in the infection cycle of lepidopteran baculoviruses. Here, we describe the characterization of a Bombyx mori nucleopolyhedrovirus (BmNPV) mutant lacking functional vfgf. We constructed a vfgf deletion mutant (BmFGFD) and characterized it in BmN cells and B. mori larvae. We observed that budded virus (BV) production was reduced in BmFGFD-infected BmN cells and B. mori larvae. The larval bioassays also revealed that deletion of vfgf did not reduce the infectivity; however, the mutant virus did take 20 h longer to kill B. mori larvae than wild-type BmNPV, when tested either by BV injection or by polyhedrin-inclusion body ingestion. These results suggest that BmNPV vfgf is involved in efficient virus production in BmN cells and B. mori larvae.

  3. Electrical phenotypes of calcium transport mutant strains of a filamentous fungus, Neurospora crassa.

    PubMed

    Hamam, Ahmed; Lew, Roger R

    2012-05-01

    We characterized the electrical phenotypes of mutants with mutations in genes encoding calcium transporters-a mechanosensitive channel homolog (MscS), a Ca(2+)/H(+) exchange protein (cax), and Ca(2+)-ATPases (nca-1, nca-2, nca-3)-as well as those of double mutants (the nca-2 cax, nca-2 nca-3, and nca-3 cax mutants). The electrical characterization used dual impalements to obtain cable-corrected current-voltage measurements. Only two types of mutants (the MscS mutant; the nca-2 mutant and nca-2-containing double mutants) exhibited lower resting potentials. For the nca-2 mutant, on the basis of unchanged conductance and cyanide-induced depolarization of the potential, the cause is attenuated H(+)-ATPase activity. The growth of the nca-2 mutant-containing strains was inhibited by elevated extracellular Ca(2+) levels, indicative of lesions in Ca(2+) homeostasis. However, the net Ca(2+) effluxes of the nca-2 mutant, measured noninvasively with a self-referencing Ca(2+)-selective microelectrode, were similar to those of the wild type. All of the mutants exhibited osmosensitivity similar to that of the wild type (the turgor of the nca-2 mutant was also similar to that of the wild type), suggesting that Ca(2+) signaling does not play a role in osmoregulation. The hyphal tip morphology and tip-localized mitochondria of the nca-2 mutant were similar to those of the wild type, even when the external [Ca(2+)] was elevated. Thus, although Ca(2+) homeostasis is perturbed in the nca-2 mutant (B. J. Bowman et al., Eukaryot. Cell 10:654-661, 2011), the phenotype does not extend to tip growth or to osmoregulation but is revealed by lower H(+)-ATPase activity.

  4. Electrical Phenotypes of Calcium Transport Mutant Strains of a Filamentous Fungus, Neurospora crassa

    PubMed Central

    Hamam, Ahmed

    2012-01-01

    We characterized the electrical phenotypes of mutants with mutations in genes encoding calcium transporters—a mechanosensitive channel homolog (MscS), a Ca2+/H+ exchange protein (cax), and Ca2+-ATPases (nca-1, nca-2, nca-3)—as well as those of double mutants (the nca-2 cax, nca-2 nca-3, and nca-3 cax mutants). The electrical characterization used dual impalements to obtain cable-corrected current-voltage measurements. Only two types of mutants (the MscS mutant; the nca-2 mutant and nca-2-containing double mutants) exhibited lower resting potentials. For the nca-2 mutant, on the basis of unchanged conductance and cyanide-induced depolarization of the potential, the cause is attenuated H+-ATPase activity. The growth of the nca-2 mutant-containing strains was inhibited by elevated extracellular Ca2+ levels, indicative of lesions in Ca2+ homeostasis. However, the net Ca2+ effluxes of the nca-2 mutant, measured noninvasively with a self-referencing Ca2+-selective microelectrode, were similar to those of the wild type. All of the mutants exhibited osmosensitivity similar to that of the wild type (the turgor of the nca-2 mutant was also similar to that of the wild type), suggesting that Ca2+ signaling does not play a role in osmoregulation. The hyphal tip morphology and tip-localized mitochondria of the nca-2 mutant were similar to those of the wild type, even when the external [Ca2+] was elevated. Thus, although Ca2+ homeostasis is perturbed in the nca-2 mutant (B. J. Bowman et al., Eukaryot. Cell 10:654–661, 2011), the phenotype does not extend to tip growth or to osmoregulation but is revealed by lower H+-ATPase activity. PMID:22408225

  5. Escherichia coli mutant with altered respiratory control of the frd operon.

    PubMed Central

    Iuchi, S; Kuritzkes, D R; Lin, E C

    1985-01-01

    In wild-type Escherichia coli, fumarate reductase encoded by the frd operon is inducible by its substrate in the absence of molecular oxygen and nitrate. Synthesis of this enzyme under permissive conditions requires the fnr+ gene product, which is believed to be a pleiotropic regulatory protein that activates transcription. A spontaneous mutant was isolated in which the expression of the frd operon no longer depended on the presence of fumarate or the fnr+ gene product. Aerobic repression of the operon was abolished, but nitrate repression remained intact. Transductional analysis showed that the mutation was closely linked to the frd locus. The mutant phenotype strongly suggests that repression by molecular oxygen and nitrate is mediated by different mechanisms. PMID:3882660

  6. Assimilation of Nitrogen from Nitrite and Trinitrotoluene in Pseudomonas putida JLR11

    PubMed Central

    Caballero, Antonio; Esteve-Núñez, Abraham; Zylstra, Gerben J.; Ramos, Juan L.

    2005-01-01

    Pseudomonas putida JLR11 releases nitrogen from the 2,4,6-trinitrotoluene (TNT) ring as nitrite or ammonium. These processes can occur simultaneously, as shown by the observation that a nasB mutant impaired in the reduction of nitrite to ammonium grew at a slower rate than the parental strain. Nitrogen from TNT is assimilated via the glutamine syntethase-glutamate synthase (GS-GOGAT) pathway, as evidenced by the inability of GOGAT mutants to use TNT. This pathway is also used to assimilate ammonium from reduced nitrate and nitrite. Three mutants that had insertions in ntrC, nasT, and cnmA, which encode regulatory proteins, failed to grow on nitrite but grew on TNT, although slower than the wild type. PMID:15601726

  7. Recombinant Escherichia coli K5 strain with the deletion of waaR gene decreases the molecular weight of the heparosan capsular polysaccharide.

    PubMed

    Huang, Haichan; Liu, Xiaobo; Lv, Shencong; Zhong, Weihong; Zhang, Fuming; Linhardt, Robert J

    2016-09-01

    Heparosan, the capsular polysaccharide of Escherichia coli K5 having a carbohydrate backbone similar to that of heparin, has become a potential precursor for bioengineering heparin. In the heparosan biosynthesis pathway, the gene waaR encoding α-1-, 2- glycosyltransferase catalyze s the third glucosyl residues linking to the oligosaccharide chain. In the present study, a waaR deletion mutant of E. coli K5 was constructed. The mutant showed improvement of capsule polysaccharide yield. It is interesting that the heparosan molecular weight of the mutant is reduced and may become more suitable as a precursor for the production of low molecular weight heparin derived from the wild-type K5 capsular polysaccharide.

  8. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

    PubMed

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

    2017-11-15

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore, it is important to identify their regulators and induction cues to understand how the different roles of the chitinolytic system are controlled and mediated. Here, we provide evidence for the importance of lmo0327 and lmo0325 , encoding a putative internalin/autolysin and a putative transcriptional activator, respectively, in the efficient expression of chitinase activity in L. monocytogenes and thereby provide new information regarding the function of the lmo0325-lmo0327 locus. Copyright © 2017 Paspaliari et al.

  9. The PaAlr1 magnesium transporter is required for ascospore development in Podospora anserina.

    PubMed

    Grognet, Pierre; Lalucque, Hervé; Silar, Philippe

    2012-10-01

    The PaAlr1 gene encoding a putative plasma membrane magnesium (Mg) transporter in Podospora anserina was inactivated. The PaAlr1(Δ) mutants showed sensitivity to deprivation and excess Mg(2+) and Ca(2+). They also exhibited an autonomous ascospore maturation defect. Mutant ascospores were arrested at an early stage when they contained two nuclei. These data emphasize the role of Mg ions during sexual development in a filamentous fungus. Copyright © 2012 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  10. MDS1, a dosage suppressor of an mck1 mutant, encodes a putative yeast homolog of glycogen synthase kinase 3.

    PubMed Central

    Puziss, J W; Hardy, T A; Johnson, R B; Roach, P J; Hieter, P

    1994-01-01

    The yeast gene MCK1 encodes a serine/threonine protein kinase that is thought to function in regulating kinetochore activity and entry into meiosis. Disruption of MCK1 confers a cold-sensitive phenotype, a temperature-sensitive phenotype, and sensitivity to the microtubule-destabilizing drug benomyl and leads to loss of chromosomes during growth on benomyl. A dosage suppression selection was used to identify genes that, when present at high copy number, could suppress the cold-sensitive phenotype of mck1::HIS3 mutant cells. Several unique classes of clones were identified, and one of these, designated MDS1, has been characterized in some detail. Nucleotide sequence data reveal that MDS1 encodes a serine/threonine protein kinase that is highly homologous to the shaggy/zw3 kinase in Drosophila melanogaster and its functional homolog, glycogen synthase kinase 3, in rats. The presence of MDS1 in high copy number rescues both the cold-sensitive and the temperature-sensitive phenotypes, but not the benomyl-sensitive phenotype, associated with the disruption of MCK1. Analysis of strains harboring an mds1 null mutation demonstrates that MDS1 is not essential during normal vegetative growth but appears to be required for meiosis. Finally, in vitro experiments indicate that the proteins encoded by both MCK1 and MDS1 possess protein kinase activity with substrate specificity similar to that of mammalian glycogen synthase kinase 3. Images PMID:8264650

  11. The product of the Saccharomyces cerevisiae cell cycle gene DBF2 has homology with protein kinases and is periodically expressed in the cell cycle.

    PubMed Central

    Johnston, L H; Eberly, S L; Chapman, J W; Araki, H; Sugino, A

    1990-01-01

    Several Saccharomyces cerevisiae dbf mutants defective in DNA synthesis have been described previously. In this paper, one of them, dbf2, is characterized in detail. The DBF2 gene has been cloned and mapped, and its nucleotide sequence has been determined. This process has identified an open reading frame capable of encoding a protein of molecular weight 64,883 (561 amino acids). The deduced amino acid sequence contains all 11 conserved domains found in various protein kinases. DBF2 was periodically expressed in the cell cycle at a time that clearly differed from the time of expression of either the histone H2A or DNA polymerase I gene. Its first function was completed very near to initiation of DNA synthesis. However, DNA synthesis in the mutant was only delayed at 37 degrees C, and the cells blocked in nuclear division. Consistent with this finding, the execution point occurred about 1 h after DNA synthesis, and the nuclear morphology of the mutant at the restrictive temperature was that of cells blocked in late nuclear division. DBF2 is therefore likely to encode a protein kinase that may function in initiation of DNA synthesis and also in late nuclear division. Images PMID:2181271

  12. Plasmid-Encoded MCP Is Involved in Virulence, Motility, and Biofilm Formation of Cronobacter sakazakii ATCC 29544

    PubMed Central

    Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun

    2014-01-01

    The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. PMID:25332122

  13. The gene MACCHI-BOU 4/ENHANCER OF PINOID encodes a NPH3-like protein and reveals similarities between organogenesis and phototropism at the molecular level.

    PubMed

    Furutani, Masahiko; Kajiwara, Takahito; Kato, Takehide; Treml, Birgit S; Stockum, Christine; Torres-Ruiz, Ramón A; Tasaka, Masao

    2007-11-01

    Intercellular transport of the phytohormone auxin is a significant factor for plant organogenesis. To investigate molecular mechanisms by which auxin controls organogenesis, we analyzed the macchi-bou 4 (mab4) mutant identified as an enhancer of pinoid (pid). Although mab4 and pid single mutants displayed relatively mild cotyledon phenotypes, pid mab4 double mutants completely lacked cotyledons. We found that MAB4 was identical to ENHANCER OF PINOID (ENP), which has been suggested to control PIN1 polarity in cotyledon primordia. MAB4/ENP encodes a novel protein, which belongs to the NON-PHOTOTROPIC HYPOCOTYL 3 (NPH3) family thought to function as a signal transducer in phototropism and control lateral translocation of auxin. MAB4/ENP mRNA was detected in the protodermal cell layer of the embryo and the meristem L1 layer at the site of organ initiation. In the mab4 embryo, the abundance of PIN1:GFP was severely decreased at the plasma membrane in the protodermal cell layer. In addition, subcellular localization analyses indicated that MAB4/ENP resides on a subpopulation of endosomes as well as on unidentified intracellular compartments. These results indicate that MAB4/ENP is involved in polar auxin transport in organogenesis.

  14. Genetic and Functional Diversification of Small RNA Pathways in Plants

    PubMed Central

    Gustafson, Adam M; Kasschau, Kristin D; Lellis, Andrew D; Zilberman, Daniel; Jacobsen, Steven E

    2004-01-01

    Multicellular eukaryotes produce small RNA molecules (approximately 21–24 nucleotides) of two general types, microRNA (miRNA) and short interfering RNA (siRNA). They collectively function as sequence-specific guides to silence or regulate genes, transposons, and viruses and to modify chromatin and genome structure. Formation or activity of small RNAs requires factors belonging to gene families that encode DICER (or DICER-LIKE [DCL]) and ARGONAUTE proteins and, in the case of some siRNAs, RNA-dependent RNA polymerase (RDR) proteins. Unlike many animals, plants encode multiple DCL and RDR proteins. Using a series of insertion mutants of Arabidopsis thaliana, unique functions for three DCL proteins in miRNA (DCL1), endogenous siRNA (DCL3), and viral siRNA (DCL2) biogenesis were identified. One RDR protein (RDR2) was required for all endogenous siRNAs analyzed. The loss of endogenous siRNA in dcl3 and rdr2 mutants was associated with loss of heterochromatic marks and increased transcript accumulation at some loci. Defects in siRNA-generation activity in response to turnip crinkle virus in dcl2 mutant plants correlated with increased virus susceptibility. We conclude that proliferation and diversification of DCL and RDR genes during evolution of plants contributed to specialization of small RNA-directed pathways for development, chromatin structure, and defense. PMID:15024409

  15. Involvement of Fungal Pectin Methylesterase Activity in the Interaction Between Fusarium graminearum and Wheat.

    PubMed

    Sella, Luca; Castiglioni, Carla; Paccanaro, Maria Chiara; Janni, Michela; Schäfer, Wilhelm; D'Ovidio, Renato; Favaron, Francesco

    2016-04-01

    The genome of Fusarium graminearum, the causal agent of Fusarium head blight of wheat, contains two putative pectin methylesterase (PME)-encoding genes. However, when grown in liquid culture containing pectin, F. graminearum produces only a single PME, which was purified and identified. Its encoding gene, expressed during wheat spike infection, was disrupted by targeted homologous recombination. Two Δpme mutant strains lacked PME activity but were still able to grow on highly methyl-esterified pectin even though their polygalacturonase (PG) activity showed a reduced capacity to depolymerize this substrate. The enzymatic assays performed with purified F. graminearum PG and PME demonstrated an increase in PG activity in the presence of PME on highly methyl-esterified pectin. The virulence of the mutant strains was tested on Triticum aestivum and Triticum durum spikes, and a significant reduction in the percentage of symptomatic spikelets was observed between 7 and 12 days postinfection compared with wild type, demonstrating that the F. graminearum PME contributes to fungal virulence on wheat by promoting spike colonization in the initial and middle stages of infection. In contrast, transgenic wheat plants with increased levels of pectin methyl esterification did not show any increase in resistance to the Δpme mutant, indicating that the infectivity of the fungus relies only to a certain degree on pectin degradation.

  16. Isolation of the Chlamydomonas Regulatory Gene Nit2 by Transposon Tagging

    PubMed Central

    Schnell, R. A.; Lefebvre, P. A.

    1993-01-01

    Genetic evidence suggests that the NIT2 gene of Chlamydomonas reinhardtii encodes a positive regulator of the nitrate-assimilation pathway. To learn more about the function of the NIT2 gene product, we isolated the gene using a transposon-tagging strategy. A nit2 mutation caused by the insertion of a transposon was identified by testing spontaneous nit2 mutants for the presence of new copies of Gulliver or TOC1, transposable elements that have been identified in Chlamydomonas. In 2 of the 14 different mutants that were analyzed, a Gulliver element was found to be genetically and phenotypically associated with the nit2 mutation. Using the Gulliver element as a probe, one of the transposon-induced nit2 alleles was isolated, and a sequence adjoining the transposon was used to isolate the corresponding wild-type locus. The NIT2 gene was delimited by mapping DNA rearrangements associated with nit2 mutations and mutant rescue by genetic transformation. The NIT2 gene encodes a 6-kb transcript that was not detected in cells grown in the presence of ammonium. Likewise, NIT2-dependent genes are repressed in ammonium-grown cells. These results suggest that repression of the NIT2 gene may mediate metabolite repression of the nitrate assimilation pathway in Chlamydomonas. PMID:8394263

  17. Characterization of a Spontaneous Nonmagnetic Mutant of Magnetospirillum gryphiswaldense Reveals a Large Deletion Comprising a Putative Magnetosome Island

    PubMed Central

    Schübbe, Sabrina; Kube, Michael; Scheffel, André; Wawer, Cathrin; Heyen, Udo; Meyerdierks, Anke; Madkour, Mohamed H.; Mayer, Frank; Reinhardt, Richard; Schüler, Dirk

    2003-01-01

    Frequent spontaneous loss of the magnetic phenotype was observed in stationary-phase cultures of the magnetotactic bacterium Magnetospirillum gryphiswaldense MSR-1. A nonmagnetic mutant, designated strain MSR-1B, was isolated and characterized. The mutant lacked any structures resembling magnetosome crystals as well as internal membrane vesicles. The growth of strain MSR-1B was impaired under all growth conditions tested, and the uptake and accumulation of iron were drastically reduced under iron-replete conditions. A large chromosomal deletion of approximately 80 kb was identified in strain MSR-1B, which comprised both the entire mamAB and mamDC clusters as well as further putative operons encoding a number of magnetosome-associated proteins. A bacterial artificial chromosome clone partially covering the deleted region was isolated from the genomic library of wild-type M. gryphiswaldense. Sequence analysis of this fragment revealed that all previously identified mam genes were closely linked with genes encoding other magnetosome-associated proteins within less than 35 kb. In addition, this region was remarkably rich in insertion elements and harbored a considerable number of unknown gene families which appeared to be specific for magnetotactic bacteria. Overall, these findings suggest the existence of a putative large magnetosome island in M. gryphiswaldense and other magnetotactic bacteria. PMID:13129949

  18. Mutation of a Rice Gene Encoding a Phenylalanine Biosynthetic Enzyme Results in Accumulation of Phenylalanine and Tryptophan[W

    PubMed Central

    Yamada, Tetsuya; Matsuda, Fumio; Kasai, Koji; Fukuoka, Shuichi; Kitamura, Keisuke; Tozawa, Yuzuru; Miyagawa, Hisashi; Wakasa, Kyo

    2008-01-01

    Two distinct biosynthetic pathways for Phe in plants have been proposed: conversion of prephenate to Phe via phenylpyruvate or arogenate. The reactions catalyzed by prephenate dehydratase (PDT) and arogenate dehydratase (ADT) contribute to these respective pathways. The Mtr1 mutant of rice (Oryza sativa) manifests accumulation of Phe, Trp, and several phenylpropanoids, suggesting a link between the synthesis of Phe and Trp. Here, we show that the Mtr1 mutant gene (mtr1-D) encodes a form of rice PDT with a point mutation in the putative allosteric regulatory region of the protein. Transformed callus lines expressing mtr1-D exhibited all the characteristics of Mtr1 callus tissue. Biochemical analysis revealed that rice PDT possesses both PDT and ADT activities, with a preference for arogenate as substrate, suggesting that it functions primarily as an ADT. The wild-type enzyme is feedback regulated by Phe, whereas the mutant enzyme showed a reduced feedback sensitivity, resulting in Phe accumulation. In addition, these observations indicate that rice PDT is critical for regulating the size of the Phe pool in plant cells. Feeding external Phe to wild-type callus tissue and seedlings resulted in Trp accumulation, demonstrating a connection between Phe accumulation and Trp pool size. PMID:18487352

  19. Plasmid-encoded MCP is involved in virulence, motility, and biofilm formation of Cronobacter sakazakii ATCC 29544.

    PubMed

    Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun; Ryu, Sangryeol

    2015-01-01

    The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Mannose-specific interaction of Lactobacillus plantarum with porcine jejunal epithelium.

    PubMed

    Gross, Gabriele; van der Meulen, Jan; Snel, Johannes; van der Meer, Roelof; Kleerebezem, Michiel; Niewold, Theo A; Hulst, Marcel M; Smits, Mari A

    2008-11-01

    Host-microorganism interactions in the intestinal tract are complex, and little is known about specific nonpathogenic microbial factors triggering host responses in the gut. In this study, mannose-specific interactions of Lactobacillus plantarum 299v with jejunal epithelium were investigated using an in situ pig Small Intestinal Segment Perfusion model. The effects of L. plantarum 299v wild-type strain were compared with those of two corresponding mutant strains either lacking the gene encoding for the mannose-specific adhesin (msa) or sortase (srtA; responsible for anchoring of cell surface proteins like Msa to the cell wall). A slight enrichment of the wild-type strain associated with the intestinal surface could be observed after 8 h of perfusion when a mixture of wild-type and msa-mutant strain had been applied. In contrast to the mutant strains, the L. plantarum wild-type strain tended to induce a decrease in jejunal net fluid absorption compared with control conditions. Furthermore, after 8 h of perfusion expression of the host gene encoding pancreatitis-associated protein, a protein with proposed bactericidal properties, was found to be upregulated by the wild-type strain only. These observations suggest a role of Msa in the induction of host responses in the pig intestine.

  1. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    PubMed

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  2. SOA genes encode proteins controlling lipase expression in response to triacylglycerol utilization in the yeast Yarrowia lipolytica.

    PubMed

    Desfougères, Thomas; Haddouche, Ramdane; Fudalej, Franck; Neuvéglise, Cécile; Nicaud, Jean-Marc

    2010-02-01

    The oleaginous yeast Yarrowia lipolytica efficiently metabolizes hydrophobic substrates such as alkanes, fatty acids or triacylglycerol. This yeast has been identified in oil-polluted water and in lipid-rich food. The enzymes involved in lipid breakdown, for use as a carbon source, are known, but the molecular mechanisms controlling the expression of the genes encoding these enzymes are still poorly understood. The study of mRNAs obtained from cells grown on oleic acid identified a new group of genes called SOA genes (specific for oleic acid). SOA1 and SOA2 are two small genes coding for proteins with no known homologs. Single- and double-disrupted strains were constructed. Wild-type and mutant strains were grown on dextrose, oleic acid and triacylglycerols. The double mutant presents a clear phenotype consisting of a growth defect on tributyrin and triolein, but not on dextrose or oleic acid media. Lipase activity was 50-fold lower in this mutant than in the wild-type strain. The impact of SOA deletion on the expression of the main extracellular lipase gene (LIP2) was monitored using a LIP2-beta-galactosidase promoter fusion protein. These data suggest that Soa proteins are components of a molecular mechanism controlling lipase gene expression in response to extracellular triacylglycerol.

  3. A Genetic Locus Necessary for Rhamnose Uptake and Catabolism in Rhizobium leguminosarum bv. trifolii

    PubMed Central

    Richardson, Jason S.; Hynes, Michael F.; Oresnik, Ivan J.

    2004-01-01

    Rhizobium leguminosarum bv. trifolii mutants unable to catabolize the methyl-pentose rhamnose are unable to compete effectively for nodule occupancy. In this work we show that the locus responsible for the transport and catabolism of rhamnose spans 10,959 bp. Mutations in this region were generated by transposon mutagenesis, and representative mutants were characterized. The locus contains genes coding for an ABC-type transporter, a putative dehydrogenase, a probable isomerase, and a sugar kinase necessary for the transport and subsequent catabolism of rhamnose. The regulation of these genes, which are inducible by rhamnose, is carried out in part by a DeoR-type negative regulator (RhaR) that is encoded within the same transcript as the ABC-type transporter but is separated from the structural genes encoding the transporter by a terminator-like sequence. RNA dot blot analysis demonstrated that this terminator-like sequence is correlated with transcript attenuation only under noninducing conditions. Transport assays utilizing tritiated rhamnose demonstrated that uptake of rhamnose was inducible and dependent upon the presence of the ABC transporter at this locus. Phenotypic analyses of representative mutants from this locus provide genetic evidence that the catabolism of rhamnose differs from previously described methyl-pentose catabolic pathways. PMID:15576793

  4. Three SRA-Domain Methylcytosine-Binding Proteins Cooperate to Maintain Global CpG Methylation and Epigenetic Silencing in Arabidopsis

    PubMed Central

    Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.

    2008-01-01

    Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160

  5. Salt stress-induced proline transporters and salt stress-repressed broad specificity amino acid permeases identified by suppression of a yeast amino acid permease-targeting mutant.

    PubMed Central

    Rentsch, D; Hirner, B; Schmelzer, E; Frommer, W B

    1996-01-01

    A yeast mutant lacking SHR3, a protein specifically required for correct targeting of plasma membrane amino acid permeases, was used to study the targeting of plant transporters and as a tool to isolate new SHR3-independent amino acid transporters. For this purpose, an shr3 mutant was transformed with an Arabidopsis cDNA library. Thirty-four clones were capable of growth under selective conditions, but none showed homology with SHR3. However, genes encoding eight different amino acid transporters belonging to three different transporter families were isolated. Five of these are members of the general amino acid permease (AAP) gene family, one is a member of the NTR family, encoding an oligopeptide transporter, and two belong to a new class of transporter genes. A functional analysis of the latter two genes revealed that they encode specific proline transporters (ProT) that are distantly related to the AAP gene family. ProT1 was found to be expressed in all organs, but highest levels were found in roots, stems, and flowers. Expression in flowers was highest in the floral stalk phloem that enters the carpels and was downregulated after fertilization, indicating a specific role in supplying the ovules with proline. ProT2 transcripts were found ubiquitously throughout the plant, but expression was strongly induced under water or salt stress, implying that ProT2 plays an important role in nitrogen distribution during water stress, unlike members of the AAP gene family whose expression was repressed under the same conditions. These results corroborate the general finding that under water stress, amino acid export is impaired whereas proline export is increased. PMID:8776904

  6. Two Host-Induced Ralstonia solanacearum Genes, acrA and dinF, Encode Multidrug Efflux Pumps and Contribute to Bacterial Wilt Virulence▿ †

    PubMed Central

    Brown, Darby G.; Swanson, Jill K.; Allen, Caitilyn

    2007-01-01

    Multidrug efflux pumps (MDRs) are hypothesized to protect pathogenic bacteria from toxic host defense compounds. We created mutations in the Ralstonia solanacearum acrA and dinF genes, which encode putative MDRs in the broad-host-range plant pathogen. Both mutations reduced the ability of R. solanacearum to grow in the presence of various toxic compounds, including antibiotics, phytoalexins, and detergents. Both acrAB and dinF mutants were significantly less virulent on the tomato plant than the wild-type strain. Complementation restored near-wild-type levels of virulence to both mutants. Addition of either dinF or acrAB to Escherichia coli MDR mutants KAM3 and KAM32 restored the resistance of these strains to several toxins, demonstrating that the R. solanacearum genes can function heterologously to complement known MDR mutations. Toxic and DNA-damaging compounds induced expression of acrA and dinF, as did growth in both susceptible and resistant tomato plants. Carbon limitation also increased expression of acrA and dinF, while the stress-related sigma factor RpoS was required at a high cell density (>107 CFU/ml) to obtain wild-type levels of acrA expression both in minimal medium and in planta. The type III secretion system regulator HrpB negatively regulated dinF expression in culture at high cell densities. Together, these results show that acrAB and dinF encode MDRs in R. solanacearum and that they contribute to the overall aggressiveness of this phytopathogen, probably by protecting the bacterium from the toxic effects of host antimicrobial compounds. PMID:17337552

  7. Two host-induced Ralstonia solanacearum genes, acrA and dinF, encode multidrug efflux pumps and contribute to bacterial wilt virulence.

    PubMed

    Brown, Darby G; Swanson, Jill K; Allen, Caitilyn

    2007-05-01

    Multidrug efflux pumps (MDRs) are hypothesized to protect pathogenic bacteria from toxic host defense compounds. We created mutations in the Ralstonia solanacearum acrA and dinF genes, which encode putative MDRs in the broad-host-range plant pathogen. Both mutations reduced the ability of R. solanacearum to grow in the presence of various toxic compounds, including antibiotics, phytoalexins, and detergents. Both acrAB and dinF mutants were significantly less virulent on the tomato plant than the wild-type strain. Complementation restored near-wild-type levels of virulence to both mutants. Addition of either dinF or acrAB to Escherichia coli MDR mutants KAM3 and KAM32 restored the resistance of these strains to several toxins, demonstrating that the R. solanacearum genes can function heterologously to complement known MDR mutations. Toxic and DNA-damaging compounds induced expression of acrA and dinF, as did growth in both susceptible and resistant tomato plants. Carbon limitation also increased expression of acrA and dinF, while the stress-related sigma factor RpoS was required at a high cell density (>10(7) CFU/ml) to obtain wild-type levels of acrA expression both in minimal medium and in planta. The type III secretion system regulator HrpB negatively regulated dinF expression in culture at high cell densities. Together, these results show that acrAB and dinF encode MDRs in R. solanacearum and that they contribute to the overall aggressiveness of this phytopathogen, probably by protecting the bacterium from the toxic effects of host antimicrobial compounds.

  8. Four Proteins Encoded in the gspB-secY2A2 Operon of Streptococcus gordonii Mediate the Intracellular Glycosylation of the Platelet-Binding Protein GspB

    PubMed Central

    Takamatsu, Daisuke; Bensing, Barbara A.; Sullam, Paul M.

    2004-01-01

    Platelet binding by Streptococcus gordonii strain M99 is mediated predominantly by the cell surface glycoprotein GspB. This adhesin consists of a putative N-terminal signal peptide, two serine-rich regions (SRR1 and SRR2), a basic region between SRR1 and SRR2, and a C-terminal cell wall anchoring domain. The glycosylation of GspB is mediated at least in part by Gly and Nss, which are encoded in the secY2A2 locus immediately downstream of gspB. This region also encodes two proteins (Gtf and Orf4) that are required for the expression of GspB but whose functions have not been delineated. In this study, we further characterized the roles of Gly, Nss, Gtf, and Orf4 by investigating the expression and glycosylation of a series of glutathione S-transferase-GspB fusion proteins in M99 and in gly, nss, gtf, and orf4 mutants. Compared with fusion proteins expressed in the wild-type background, fusion proteins expressed in the mutant strain backgrounds showed altered electrophoretic mobility. In addition, the fusion proteins formed insoluble aggregates in protoplasts of the gtf and orf4 mutants. Glycan detection and lectin blot analysis revealed that SRR1 and SRR2 were glycosylated but that the basic region was unmodified. When the fusion protein was expressed in Escherichia coli, glycosylation of this protein was observed only in the presence of both gtf and orf4. These results demonstrate that Gly, Nss, Gtf, and Orf4 are all involved in the intracellular glycosylation of SRRs. Moreover, Gtf and Orf4 are essential for glycosylation, which in turn is important for the solubility of GspB. PMID:15489421

  9. Using co-expression analysis and stress-based screens to uncover Arabidopsis peroxisomal proteins involved in drought response

    DOE PAGES

    Li, Jiying; Hu, Jianping; Bassham, Diane

    2015-09-14

    Peroxisomes are essential organelles that house a wide array of metabolic reactions important for plant growth and development. However, our knowledge regarding the role of peroxisomal proteins in various biological processes, including plant stress response, is still incomplete. Recent proteomic studies of plant peroxisomes significantly increased the number of known peroxisomal proteins and greatly facilitated the study of peroxisomes at the systems level. The objectives of this study were to determine whether genes that encode peroxisomal proteins with related functions are co-expressed in Arabidopsis and identify peroxisomal proteins involved in stress response using in silico analysis and mutant screens. Usingmore » microarray data from online databases, we performed hierarchical clustering analysis to generate a comprehensive view of transcript level changes for Arabidopsis peroxisomal genes during development and under abiotic and biotic stress conditions. Many genes involved in the same metabolic pathways exhibited co-expression, some genes known to be involved in stress response are regulated by the corresponding stress conditions, and function of some peroxisomal proteins could be predicted based on their coexpression pattern. Since drought caused expression changes to the highest number of genes that encode peroxisomal proteins, we subjected a subset of Arabidopsis peroxisomal mutants to a drought stress assay. Mutants of the LON2 protease and the photorespiratory enzyme hydroxypyruvate reductase 1 (HPR1) showed enhanced susceptibility to drought, suggesting the involvement of peroxisomal quality control and photorespiration in drought resistance. Lastly, our study provided a global view of how genes that encode peroxisomal proteins respond to developmental and environmental cues and began to reveal additional peroxisomal proteins involved in stress response, thus opening up new avenues to investigate the role of peroxisomes in plant adaptation to environmental stresses.« less

  10. Determining the relative contribution and hierarchy of hha and qseBC in the regulation of flagellar motility of Escherichia coli O157:H7.

    PubMed

    Sharma, Vijay K; Casey, Thomas A

    2014-01-01

    In recent studies, we demonstrated that a deletion of hha caused increased secretion of locus of enterocyte encoded adherence proteins and reduced motility of enterohemorrhagic Escherichia coli (EHEC) O157:H7. In addition to the importance of hha in positive regulation of motility, a two-component quorum sensing pathway encoded by the qseBC genes has been shown to activate bacterial motility in response to mammalian stress hormones epinephrine and norepinephrine as well as bacterially produced autoinducer-3. In this study, we compared regulatory contribution and hierarchy of hha, a member of the Hha/YmoA family of nucleoid-associated proteins, to that of qseBC in the expression of EHEC O157:H7 motility. Since norepinephrine affects motility of EHEC O157:H7 through a qseBC-encoded two-component quorum sensing signaling, we also determined whether the hha-mediated regulation of motility is affected by norepinephrine and whether this effect is qseBC dependent. We used single (Δhha or ΔqseC) and double (Δhha ΔqseC) deletion mutants to show that hha exerts a greater positive regulatory effect in comparison to qseBC on the expression of motility by EHEC O157:H7. We also show that Hha is hierarchically superior in transcriptional regulation of motility than QseBC because transcription of qseC was significantly reduced in the hha deletion mutant compared to that in the parental and the hha-complemented mutant strains. These results suggest that hha regulates motility of EHEC O157:H7 directly as well as indirectly by controlling the transcription of qseBC.

  11. Sublethal Concentrations of Antibiotics Cause Shift to Anaerobic Metabolism in Listeria monocytogenes and Induce Phenotypes Linked to Antibiotic Tolerance

    PubMed Central

    Knudsen, Gitte M.; Fromberg, Arvid; Ng, Yin; Gram, Lone

    2016-01-01

    The human pathogenic bacterium Listeria monocytogenes is exposed to antibiotics both during clinical treatment and in its saprophytic lifestyle. As one of the keys to successful treatment is continued antibiotic sensitivity, the purpose of this study was to determine if exposure to sublethal antibiotic concentrations would affect the bacterial physiology and induce antibiotic tolerance. Transcriptomic analyses demonstrated that each of the four antibiotics tested caused an antibiotic-specific gene expression pattern related to mode-of-action of the particular antibiotic. All four antibiotics caused the same changes in expression of several metabolic genes indicating a shift from aerobic to anaerobic metabolism and higher ethanol production. A mutant in the bifunctional acetaldehyde-CoA/alcohol dehydrogenase encoded by lmo1634 did not have altered antibiotic tolerance. However, a mutant in lmo1179 (eutE) encoding an aldehyde oxidoreductase where rerouting caused increased ethanol production was tolerant to three of four antibiotics tested. This shift in metabolism could be a survival strategy in response to antibiotics to avoid generation of ROS production from respiration by oxidation of NADH through ethanol production. The monocin locus encoding a cryptic prophage was induced by co-trimoxazole and repressed by ampicillin and gentamicin, and this correlated with an observed antibiotic-dependent biofilm formation. A monocin mutant (ΔlmaDCBA) had increased biofilm formation when exposed to increasing concentration of co-trimoxazole similar to the wild type, but was more tolerant to killing by co-trimoxazole and ampicillin. Thus, sublethal concentrations of antibiotics caused metabolic and physiological changes indicating that the organism is preparing to withstand lethal antibiotic concentrations. PMID:27462313

  12. New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

    PubMed

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

    2014-03-01

    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

  13. New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

    PubMed Central

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

    2014-01-01

    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

  14. Determining the Relative Contribution and Hierarchy of hha and qseBC in the Regulation of Flagellar Motility of Escherichia coli O157:H7

    PubMed Central

    Sharma, Vijay K.; Casey, Thomas A.

    2014-01-01

    In recent studies, we demonstrated that a deletion of hha caused increased secretion of locus of enterocyte encoded adherence proteins and reduced motility of enterohemorrhagic Escherichia coli (EHEC) O157:H7. In addition to the importance of hha in positive regulation of motility, a two-component quorum sensing pathway encoded by the qseBC genes has been shown to activate bacterial motility in response to mammalian stress hormones epinephrine and norepinephrine as well as bacterially produced autoinducer-3. In this study, we compared regulatory contribution and hierarchy of hha, a member of the Hha/YmoA family of nucleoid-associated proteins, to that of qseBC in the expression of EHEC O157:H7 motility. Since norepinephrine affects motility of EHEC O157:H7 through a qseBC-encoded two-component quorum sensing signaling, we also determined whether the hha-mediated regulation of motility is affected by norepinephrine and whether this effect is qseBC dependent. We used single (Δhha or ΔqseC) and double (Δhha ΔqseC) deletion mutants to show that hha exerts a greater positive regulatory effect in comparison to qseBC on the expression of motility by EHEC O157:H7. We also show that Hha is hierarchically superior in transcriptional regulation of motility than QseBC because transcription of qseC was significantly reduced in the hha deletion mutant compared to that in the parental and the hha-complemented mutant strains. These results suggest that hha regulates motility of EHEC O157:H7 directly as well as indirectly by controlling the transcription of qseBC. PMID:24465756

  15. NAD(P)H-hydrate dehydratase- a metabolic repair enzyme and its role in Bacillus subtilis stress adaptation.

    PubMed

    Petrovova, Miroslava; Tkadlec, Jan; Dvoracek, Lukas; Streitova, Eliska; Licha, Irena

    2014-01-01

    One of the strategies for survival stress conditions in bacteria is a regulatory adaptive system called general stress response (GSR), which is dependent on the SigB transcription factor in Bacillus sp. The GSR is one of the largest regulon in Bacillus sp., including about 100 genes; however, most of the genes that show changes in expression during various stresses have not yet been characterized or assigned a biochemical function for the encoded proteins. Previously, we characterized the Bacillus subtilis168 osmosensitive mutant, defective in the yxkO gene (encoding a putative ribokinase), which was recently assigned in vitro as an ADP/ATP-dependent NAD(P)H-hydrate dehydratase and was demonstrated to belong to the SigB operon. We show the impact of YxkO on the activity of SigB-dependent Pctc promoter and adaptation to osmotic and ethanol stress and potassium limitation respectively. Using a 2DE approach, we compare the proteomes of WT and mutant strains grown under conditions of osmotic and ethanol stress. Both stresses led to changes in the protein level of enzymes that are involved in motility (flagellin), citrate cycle (isocitrate dehydrogenase, malate dehydrogenase), glycolysis (phosphoglycerate kinase), and decomposition of Amadori products (fructosamine-6-phosphate deglycase). Glutamine synthetase revealed a different pattern after osmotic stress. The patterns of enzymes for branched amino acid metabolism and cell wall synthesis (L-alanine dehydrogenase, aspartate-semialdehyde dehydrogenase, ketol-acid reductoisomerase) were altered after ethanol stress. We performed the first characterization of a Bacillus subtilis168 knock-out mutant in the yxkO gene that encodes a metabolite repair enzyme. We show that such enzymes could play a significant role in the survival of stressed cells.

  16. Characterization of the Thermal Stress Response of Campylobacter jejuni

    PubMed Central

    Konkel, Michael E.; Kim, Bong J.; Klena, John D.; Young, Colin R.; Ziprin, Richard

    1998-01-01

    Campylobacter jejuni, a microaerophilic, gram-negative bacterium, is a common cause of gastrointestinal disease in humans. Heat shock proteins are a group of highly conserved, coregulated proteins that play important roles in enabling organisms to cope with physiological stresses. The primary aim of this study was to characterize the heat shock response of C. jejuni. Twenty-four proteins were preferentially synthesized by C. jejuni immediately following heat shock. Upon immunoscreening of Escherichia coli transformants harboring a Campylobacter genomic DNA library, one recombinant plasmid that encoded a heat shock protein was isolated. The recombinant plasmid, designated pMEK20, contained an open reading frame of 1,119 bp that was capable of encoding a protein of 372 amino acids with a calculated molecular mass of 41,436 Da. The deduced amino acid sequence of the open reading frame shared similarity with that of DnaJ, which belongs to the Hsp-40 family of molecular chaperones, from a number of bacteria. An E. coli dnaJ mutant was successfully complemented with the pMEK20 recombinant plasmid, as judged by the ability of bacteriophage λ to form plaques, indicating that the C. jejuni gene encoding the 41-kDa protein is a functional homolog of the dnaJ gene from E. coli. The ability of each of two C. jejuni dnaJ mutants to form colonies at 46°C was severely retarded, indicating that DnaJ plays an important role in C. jejuni thermotolerance. Experiments revealed that a C. jejuni DnaJ mutant was unable to colonize newly hatched Leghorn chickens, suggesting that heat shock proteins play a role in vivo. PMID:9673247

  17. Gli function is essential for motor neuron induction in zebrafish.

    PubMed

    Vanderlaan, Gary; Tyurina, Oksana V; Karlstrom, Rolf O; Chandrasekhar, Anand

    2005-06-15

    The Gli family of zinc-finger transcription factors mediates Hedgehog (Hh) signaling in all vertebrates. However, their roles in ventral neural tube patterning, in particular motor neuron induction, appear to have diverged across species. For instance, cranial motor neurons are essentially lost in zebrafish detour (gli1(-)) mutants, whereas motor neuron development is unaffected in mouse single gli and some double gli knockouts. Interestingly, the expression of some Hh-regulated genes (ptc1, net1a, gli1) is mostly unaffected in the detour mutant hindbrain, suggesting that other Gli transcriptional activators may be involved. To better define the roles of the zebrafish gli genes in motor neuron induction and in Hh-regulated gene expression, we examined these processes in you-too (yot) mutants, which encode dominant repressor forms of Gli2 (Gli2(DR)), and following morpholino-mediated knockdown of gli1, gli2, and gli3 function. Motor neuron induction at all axial levels was reduced in yot (gli2(DR)) mutant embryos. In addition, Hh target gene expression at all axial levels except in rhombomere 4 was also reduced, suggesting an interference with the function of other Glis. Indeed, morpholino-mediated knockdown of Gli2(DR) protein in yot mutants led to a suppression of the defective motor neuron phenotype. However, gli2 knockdown in wild-type embryos generated no discernable motor neuron phenotype, while gli3 knockdown reduced motor neuron induction in the hindbrain and spinal cord. Significantly, gli2 or gli3 knockdown in detour (gli1(-)) mutants revealed roles for Gli2 and Gli3 activator functions in ptc1 expression and spinal motor neuron induction. Similarly, gli1 or gli3 knockdown in yot (gli2(DR)) mutants resulted in severe or complete loss of motor neurons, and of ptc1 and net1a expression, in the hindbrain and spinal cord. In addition, gli1 expression was greatly reduced in yot mutants following gli3, but not gli1, knockdown, suggesting that Gli3 activator function is specifically required for gli1 expression. These observations demonstrate that Gli activator function (encoded by gli1, gli2, and gli3) is essential for motor neuron induction and Hh-regulated gene expression in zebrafish.

  18. Involvement of EupR, a response regulator of the NarL/FixJ family, in the control of the uptake of the compatible solutes ectoines by the halophilic bacterium Chromohalobacter salexigens.

    PubMed

    Rodríguez-Moya, Javier; Argandoña, Montserrat; Reina-Bueno, Mercedes; Nieto, Joaquín J; Iglesias-Guerra, Fernando; Jebbar, Mohamed; Vargas, Carmen

    2010-10-13

    Osmosensing and associated signal transduction pathways have not yet been described in obligately halophilic bacteria. Chromohalobacter salexigens is a halophilic bacterium with a broad range of salt tolerance. In response to osmotic stress, it synthesizes and accumulates large amounts of the compatible solutes ectoine and hydroxyectoine. In a previous work, we showed that ectoines can be also accumulated upon transport from the external medium, and that they can be used as carbon sources at optimal, but not at low salinity. This was related to an insufficient ectoine(s) transport under these conditions. A C. salexigens Tn1732-induced mutant (CHR95) showed a delayed growth with glucose at low and optimal salinities, could not grow at high salinity, and was able to use ectoines as carbon sources at low salinity. CHR95 was affected in the transport and/or metabolism of glucose, and showed a deregulated ectoine uptake at any salinity, but it was not affected in ectoine metabolism. Transposon insertion in CHR95 caused deletion of three genes, Csal0865-Csal0867: acs, encoding an acetyl-CoA synthase, mntR, encoding a transcriptional regulator of the DtxR/MntR family, and eupR, encoding a putative two-component response regulator with a LuxR_C-like DNA-binding helix-turn-helix domain. A single mntR mutant was sensitive to manganese, suggesting that mntR encodes a manganese-dependent transcriptional regulator. Deletion of eupR led to salt-sensitivity and enabled the mutant strain to use ectoines as carbon source at low salinity. Domain analysis included EupR as a member of the NarL/FixJ family of two component response regulators. Finally, the protein encoded by Csal869, located three genes downstream of eupR was suggested to be the cognate histidine kinase of EupR. This protein was predicted to be a hybrid histidine kinase with one transmembrane and one cytoplasmic sensor domain. This work represents the first example of the involvement of a two-component response regulator in the osmoadaptation of a true halophilic bacterium. Our results pave the way to the elucidation of the signal transduction pathway involved in the control of ectoine transport in C. salexigens.

  19. Distribution and regulation of the mobile genetic element-encoded phenol-soluble modulin PSM-mec in methicillin-resistant Staphylococcus aureus.

    PubMed

    Chatterjee, Som S; Chen, Liang; Joo, Hwang-Soo; Cheung, Gordon Y C; Kreiswirth, Barry N; Otto, Michael

    2011-01-01

    The phenol-soluble modulin PSM-mec is the only known staphylococcal toxin that is encoded on a mobile antibiotic resistance determinant, namely the staphylococcal cassette chromosome (SCC) element mec encoding resistance to methicillin. Here we show that the psm-mec gene is found frequently among methicillin-resistant Staphylococcus aureus (MRSA) strains of SCCmec types II, III, and VIII, and is a conserved part of the class A mec gene complex. Controlled expression of AgrA versus RNAIII in agr mutants of all 3 psm-mec-positive SCCmec types demonstrated that expression of psm-mec, which is highly variable, is controlled by AgrA in an RNAIII-independent manner. Furthermore, psm-mec isogenic deletion mutants showed only minor changes in PSMα peptide production and unchanged (or, as previously described, diminished) virulence compared to the corresponding wild-type strains in a mouse model of skin infection. This indicates that the recently reported regulatory impact of the psm-mec locus on MRSA virulence, which is opposite to that of the PSM-mec peptide and likely mediated by a regulatory RNA, is minor when analyzed in the original strain background. Our study gives new insight in the distribution, regulation, and role in virulence of the PSM-mec peptide and the psm-mec gene locus.

  20. Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively.

    PubMed Central

    Johnson, A W

    1997-01-01

    XRN1 encodes an abundant cytoplasmic exoribonuclease, Xrn1p, responsible for mRNA turnover in yeast. A screen for bypass suppressors of the inviability of xrn1 ski2 double mutants identified dominant alleles of RAT1, encoding an exoribonuclease homologous with Xrn1p. These RAT1 alleles restored XRN1-like functions, including cytoplasmic RNA turnover, wild-type sensitivity to the microtubule-destabilizing drug benomyl, and sporulation. The mutations were localized to a region of the RAT1 gene encoding a putative bipartite nuclear localization sequence (NLS). Fusions to green fluorescent protein were used to demonstrate that wild-type Rat1p is localized to the nucleus and that the mutant alleles result in mislocalization of Rat1p to the cytoplasm. Conversely, targeting Xrn1p to the nucleus by the addition of the simian virus 40 large-T-antigen NLS resulted in complementation of the temperature sensitivity of a rat1-1 strain. These results indicate that Xrn1p and Rat1p are functionally interchangeable exoribonucleases that function in and are restricted to the cytoplasm and nucleus, respectively. It is likely that the higher eukaryotic homologs of these proteins will function similarly in the cytoplasm and nucleus. PMID:9315672

  1. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 Gene Encodes an Aldehyde Dehydrogenase Involved in Ferulic Acid and Sinapic Acid Biosynthesis

    PubMed Central

    Nair, Ramesh B.; Bastress, Kristen L.; Ruegger, Max O.; Denault, Jeff W.; Chapple, Clint

    2004-01-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP+-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall–esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes. PMID:14729911

  2. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 gene encodes an aldehyde dehydrogenase involved in ferulic acid and sinapic acid biosynthesis.

    PubMed

    Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint

    2004-02-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.

  3. Myxobacterium-Produced Antibiotic TA (Myxovirescin) Inhibits Type II Signal Peptidase

    PubMed Central

    Xiao, Yao; Gerth, Klaus; Müller, Rolf

    2012-01-01

    Antibiotic TA is a macrocyclic secondary metabolite produced by myxobacteria that has broad-spectrum bactericidal activity. The structure of TA is unique, and its molecular target is unknown. Here, we sought to elucidate TA's mode of action (MOA) through two parallel genetic approaches. First, chromosomal Escherichia coli TA-resistant mutants were isolated. One mutant that showed specific resistance toward TA was mapped and resulted from an IS4 insertion in the lpp gene, which encodes an abundant outer membrane (Braun's) lipoprotein. In a second approach, the comprehensive E. coli ASKA plasmid library was screened for overexpressing clones that conferred TAr. This effort resulted in the isolation of the lspA gene, which encodes the type II signal peptidase that cleaves signal sequences from prolipoproteins. In whole cells, TA was shown to inhibit Lpp prolipoprotein processing, similar to the known LspA inhibitor globomycin. Based on genetic evidence and prior globomycin studies, a block in Lpp expression or prevention of Lpp covalent cell wall attachment confers TAr by alleviating a toxic buildup of mislocalized pro-Lpp. Taken together, these data argue that LspA is the molecular target of TA. Strikingly, the giant ta biosynthetic gene cluster encodes two lspA paralogs that we hypothesize play a role in producer strain resistance. PMID:22232277

  4. Conditional-suicide containment system for bacteria which mineralize aromatics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Contreras, A.; Ramos, J.L.; Molin, S.

    A model conditional-suicide system to control genetically engineered microorganisms able to degrade substituted benzoates is reported. The system is based on two elements. One element consists of a fusion between the promoter of the Pseudomonas putide TOL plasmid-encoded meta-cleavage pathway operon (P{sub m}) and the lacI gene encoding Lac repressor plus sylS, coding for the positive regulator of P{sub m}. The other element carries a fusion between the P{sub tac} promoter and the gef gene, which encodes a killing function. In the absence of effectors, expression of the P{sub tac}::gef cassette is no longer prevented and a high rate ofmore » cell killing is observed. The substitution of XylS for XylSthr45, a mutant regulator with altered effector specificity and increased affinity for benzoates, allows the control of populations able to degrade a wider range of benzoates at micromolar substrate concentrations. Given the wide effector specificity of the key regulators, the wild-type and mutant ZylS proteins, the system should allow the control of populations able to metabolize benzoate; methyl-, dimethyl-, chloro-, dichloro-, ethyl-, and methoxybenzoates; salicylate; and methyl- and chlorosalicylates. A small population of genetically engineered microorganisms became Gef resistant; however, the mechanism of such survival remains unknown.« less

  5. Arabidopsis TOBAMOVIRUS MULTIPLICATION (TOM) 2 locus encodes a transmembrane protein that interacts with TOM1

    PubMed Central

    Tsujimoto, Yayoi; Numaga, Takuro; Ohshima, Kiyoshi; Yano, Masa-aki; Ohsawa, Ryuji; Goto, Derek B.; Naito, Satoshi; Ishikawa, Masayuki

    2003-01-01

    The tom2-1 mutation of Arabidopsis thaliana reduces the efficiency of intracellular multiplication of tobamoviruses. The tom2-1 mutant was derived from fast-neutron-irradiated seeds, and the original mutant line also carries ttm1, a dominant modifier that increases tobamovirus multiplication efficiency in a tobamovirus-strain-specific manner in the tom2-1 genetic background. Here, we show that the tom2-1 mutation involved a deletion of ∼20 kb in the nuclear genome. The deleted region included two genes named TOM2A and TOM2B that were both associated with the tom2-1 phenotype, whereas ttm1 corresponded to the translocation of part of the deleted region that included intact TOM2B but not TOM2A. TOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, while TOM2B encodes a 122 amino acid basic protein. The split-ubiquitin assay demonstrated an interaction of TOM2A both with itself and with TOM1, an integral membrane protein of A.thaliana presumed to be an essential constituent of tobamovirus replication complex. The data presented here suggest that TOM2A is also an integral part of the tobamovirus replication complex. PMID:12514139

  6. White collar-1, a central regulator of blue light responses in Neurospora, is a zinc finger protein.

    PubMed Central

    Ballario, P; Vittorioso, P; Magrelli, A; Talora, C; Cabibbo, A; Macino, G

    1996-01-01

    The Neurospora crassa blind mutant white collar-1 (wc-1) is pleiotropically defective in all blue light-induced phenomena, establishing a role for the wc-1 gene product in the signal transduction pathway. We report the cloning of the wc-1 gene isolated by chromosome walking and mutant complementation. The elucidation of the wc-1 gene product provides a key piece of the blue light signal transduction puzzle. The wc-1 gene encodes a 125 kDa protein whose encoded motifs include a single class four, zinc finger DNA binding domain and a glutamine-rich putative transcription activation domain. We demonstrate that the wc-1 zinc finger domain, expressed in Escherichia coli, is able to bind specifically to the promoter of a blue light-regulated gene of Neurospora using an in vitro gel retardation assay. Furthermore, we show that wc-1 gene expression is autoregulated and is transcriptionally induced by blue light irradiation. Images PMID:8612589

  7. Multiple, Distinct Isoforms of Sucrose Synthase in Pea1

    PubMed Central

    Barratt, D.H. Paul; Barber, Lorraine; Kruger, Nicholas J.; Smith, Alison M.; Wang, Trevor L.; Martin, Cathie

    2001-01-01

    Genes encoding three isoforms of sucrose synthase (Sus1, Sus2, and Sus3) have been cloned from pea (Pisum sativum). The genes have distinct patterns of expression in different organs of the plant, and during organ development. Studies of the isoforms expressed as recombinant proteins in Escherichia coli show that they differ in kinetic properties. Although not of great magnitude, the differences in properties are consistent with some differentiation of physiological function between the isoforms. Evidence for differentiation of function in vivo comes from the phenotypes of rug4 mutants of pea, which carry mutations in the gene encoding Sus1. One mutant line (rug4-c) lacks detectable Sus1 protein in both the soluble and membrane-associated fractions of the embryo, and Sus activity in the embryo is reduced by 95%. The starch content of the embryo is reduced by 30%, but the cellulose content is unaffected. The results imply that different isoforms of Sus may channel carbon from sucrose towards different metabolic fates within the cell. PMID:11598239

  8. Biosynthesis of the Caenorhabditis elegans dauer pheromone.

    PubMed

    Butcher, Rebecca A; Ragains, Justin R; Li, Weiqing; Ruvkun, Gary; Clardy, Jon; Mak, Ho Yi

    2009-02-10

    To sense its population density and to trigger entry into the stress-resistant dauer larval stage, Caenorhabditis elegans uses the dauer pheromone, which consists of ascaroside derivatives with short, fatty acid-like side chains. Although the dauer pheromone has been studied for 25 years, its biosynthesis is completely uncharacterized. The daf-22 mutant is the only known mutant defective in dauer pheromone production. Here, we show that daf-22 encodes a homolog of human sterol carrier protein SCPx, which catalyzes the final step in peroxisomal fatty acid beta-oxidation. We also show that dhs-28, which encodes a homolog of the human d-bifunctional protein that acts just upstream of SCPx, is also required for pheromone production. Long-term daf-22 and dhs-28 cultures develop dauer-inducing activity by accumulating less active, long-chain fatty acid ascaroside derivatives. Thus, daf-22 and dhs-28 are required for the biosynthesis of the short-chain fatty acid-derived side chains of the dauer pheromone and link dauer pheromone production to metabolic state.

  9. Construction of a psb C deletion strain in Synechocystis 6803.

    PubMed

    Goldfarb, N; Knoepfle, N; Putnam-Evans, C

    1997-01-01

    Synechocystis 6803 is a cyanobacterium that carries out-oxygenic photosynthesis. We are interested in the introduction of mutations in the large extrinsic loop region of the CP43 protein of Photosystem II (PSII). CP43 appears to be required for the stable assembly of the PSII complex and also appears to play a role in photosynthetic oxygen evolution. Deletion of short segments of the large extrinsic loop results in mutants incapable of evolving oxygen. Alterations in psbC, the gene encoding CP43, are introduced into Synechocystis 6803 by transformation and homologous recombination. Specifically, plasmid constructs bearing the site-directed mutations are introduced into a deletion strain where the portion of the gene encoding the area of mutation has been deleted and replaced by a gene conferring antibiotic resistance. We have constructed a deletion strain of Synechocystis appropriate for the introduction of mutations in the large extrinsic loop of CP43 and have used it successfully to produce site-directed mutants.

  10. Genetic analysis of chromosomal operons involved in degradation of aromatic hydrocarbons in Pseudomonas putida TMB

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polissi, A.; Bestetti, G.; Bertoni, G.

    1990-11-01

    The catabolic pathway for the degradation of aromatic hydrocarbons encoded by Pseudomonas putida TMB differs from the TOL plasmid-encoded pathway as far as regulation of the upper pathway is concerned. We found, by analyzing Tn5-induced mutants and by Southern blot hybridization with appropriate probes derived from the TOL plasmid pWWO, that the catabolic genes of strain TMB were located on the bacterial chromosome and not on the 84-kb plasmid harbored by this strain. The catabolic genes of TMB and pWWO had sequence homology, as shown by Southern blot hybridization, but different significantly in their restriction patterns. The analysis of themore » mutants suggests that a regulatory mechanism similar to that present in pWWO coexists in TMB with a second mode of regulation which is epistatic on the former and that the chromosomal region carrying the catabolic genes is prone to rearrangements and deletions.« less

  11. Isolation of temperature-sensitive mutations in murC of Staphylococcus aureus.

    PubMed

    Ishibashi, Mihoko; Kurokawa, Kenji; Nishida, Satoshi; Ueno, Kohji; Matsuo, Miki; Sekimizu, Kazuhisa

    2007-09-01

    Enzymes in the bacterial peptidoglycan biosynthesis pathway are important targets for novel antibiotics. Of 750 temperature-sensitive (TS) mutants of Gram-positive Staphylococcus aureus, six were complemented by the murC gene, which encodes the UDP-N-acetylmuramic acid:l-alanine ligase. Each mutation resulted in a single amino acid substitution and, in all cases, the TS phenotype was suppressed by high osmotic stress. In mutant strains with the G222E substitution, a decrease in the viable cell number immediately after shift to the restrictive temperature was observed. These results suggest that S. aureus MurC protein is essential for cell growth. The MurC H343Y mutation is located in the putative alanine recognition pocket. Consistent with this, allele-specific suppression was observed of the H343Y mutation by multiple copies of the aapA gene, which encodes an alanine transporter. The results suggest an in vivo role for the H343 residue of S. aureus MurC protein in high-affinity binding to L-alanine.

  12. Function and Regulation of the Formate Dehydrogenase Genes of the Methanogenic Archaeon Methanococcus maripaludis

    PubMed Central

    Wood, Gwendolyn E.; Haydock, Andrew K.; Leigh, John A.

    2003-01-01

    Methanococcus maripaludis is a mesophilic species of Archaea capable of producing methane from two substrates: hydrogen plus carbon dioxide and formate. To study the latter, we identified the formate dehydrogenase genes of M. maripaludis and found that the genome contains two gene clusters important for formate utilization. Phylogenetic analysis suggested that the two formate dehydrogenase gene sets arose from duplication events within the methanococcal lineage. The first gene cluster encodes homologs of formate dehydrogenase α (FdhA) and β (FdhB) subunits and a putative formate transporter (FdhC) as well as a carbonic anhydrase analog. The second gene cluster encodes only FdhA and FdhB homologs. Mutants lacking either fdhA gene exhibited a partial growth defect on formate, whereas a double mutant was completely unable to grow on formate as a sole methanogenic substrate. Investigation of fdh gene expression revealed that transcription of both gene clusters is controlled by the presence of H2 and not by the presence of formate. PMID:12670979

  13. CLA1, a novel gene required for chloroplast development, is highly conserved in evolution.

    PubMed

    Mandel, M A; Feldmann, K A; Herrera-Estrella, L; Rocha-Sosa, M; León, P

    1996-05-01

    An albino mutant designated cla1-1 (for "cloroplastos alterados', or "altered chloroplasts') has been isolated from a T-DNA-generated library of Arabidopsis thaliana. In cla1-1 plants, chloroplast development is arrested at an early stage. cla1-1 plants behave like wild-type in their capacity to etiolate and produce anthocyanins indicating that the light signal transduction pathway seems to be unaffected. Genetic and molecular analyses show that the disruption of a single gene, CLA1, by the T-DNA insertion is responsible for the mutant phenotype. RNA expression patterns indicate that CLA1 is positively regulated by light and that it has different effects on the steady-state RNA levels of some nuclear- and chloroplast-encoded photosynthetic genes. Although the specific function of the CLA1 gene is still unknown, it encodes a novel protein conserved in evolution between photosynthetic bacteria and plants which is essential for chloroplast development in Arabidopsis.

  14. hnRNP U protein is required for normal pre-mRNA splicing and postnatal heart development and function.

    PubMed

    Ye, Junqiang; Beetz, Nadine; O'Keeffe, Sean; Tapia, Juan Carlos; Macpherson, Lindsey; Chen, Weisheng V; Bassel-Duby, Rhonda; Olson, Eric N; Maniatis, Tom

    2015-06-09

    We report that mice lacking the heterogeneous nuclear ribonucleoprotein U (hnRNP U) in the heart develop lethal dilated cardiomyopathy and display numerous defects in cardiac pre-mRNA splicing. Mutant hearts have disorganized cardiomyocytes, impaired contractility, and abnormal excitation-contraction coupling activities. RNA-seq analyses of Hnrnpu mutant hearts revealed extensive defects in alternative splicing of pre-mRNAs encoding proteins known to be critical for normal heart development and function, including Titin and calcium/calmodulin-dependent protein kinase II delta (Camk2d). Loss of hnRNP U expression in cardiomyocytes also leads to aberrant splicing of the pre-mRNA encoding the excitation-contraction coupling component Junctin. We found that the protein product of an alternatively spliced Junctin isoform is N-glycosylated at a specific asparagine site that is required for interactions with specific protein partners. Our findings provide conclusive evidence for the essential role of hnRNP U in heart development and function and in the regulation of alternative splicing.

  15. ACCUMULATION OF PHOTOSYSTEM ONE1, a Member of a Novel Gene Family, Is Required for Accumulation of [4Fe-4S] Cluster–Containing Chloroplast Complexes and Antenna Proteins

    PubMed Central

    Amann, Katrin; Lezhneva, Lina; Wanner, Gerd; Herrmann, Reinhold G.; Meurer, Jörg

    2004-01-01

    To investigate the nuclear-controlled mechanisms of [4Fe-4S] cluster assembly in chloroplasts, we selected Arabidopsis thaliana mutants with a decreased content of photosystem I (PSI) containing three [4Fe-4S] clusters. One identified gene, ACCUMULATION OF PHOTOSYSTEM ONE1 (APO1), belongs to a previously unknown gene family with four defined groups (APO1 to APO4) only found in nuclear genomes of vascular plants. All homologs contain two related motifs of ∼100 amino acid residues that could potentially provide ligands for [4Fe-4S] clusters. APO1 is essentially required for photoautotrophic growth, and levels of PSI core subunits are below the limit of detection in the apo1 mutant. Unlike other Arabidopsis PSI mutants, apo1 fails to accumulate significant amounts of the outer antenna subunits of PSI and PSII and to form grana stacks. In particular, APO1 is essentially required for stable accumulation of other plastid-encoded and nuclear-encoded [4Fe-4S] cluster complexes within the chloroplast, whereas [2Fe-2S] cluster–containing complexes appear to be unaffected. In vivo labeling experiments and analyses of polysome association suggest that translational elongation of the PSI transcripts psaA and psaB is specifically arrested in the mutant. Taken together, our findings suggest that APO1 is involved in the stable assembly of several [4Fe-4S] cluster–containing complexes of chloroplasts and interferes with translational events probably in association with plastid nucleoids. PMID:15494558

  16. Phosphatidate Phosphatase Activity Plays Key Role in Protection against Fatty Acid-induced Toxicity in Yeast*

    PubMed Central

    Fakas, Stylianos; Qiu, Yixuan; Dixon, Joseph L.; Han, Gil-Soo; Ruggles, Kelly V.; Garbarino, Jeanne; Sturley, Stephen L.; Carman, George M.

    2011-01-01

    The PAH1-encoded phosphatidate (PA) phosphatase in Saccharomyces cerevisiae is a pivotal enzyme that produces diacylglycerol for the synthesis of triacylglycerol (TAG) and simultaneously controls the level of PA used for phospholipid synthesis. Quantitative lipid analysis showed that the pah1Δ mutation caused a reduction in TAG mass and an elevation in the mass of phospholipids and free fatty acids, changes that were more pronounced in the stationary phase. The levels of unsaturated fatty acids in the pah1Δ mutant were unaltered, although the ratio of palmitoleic acid to oleic acid was increased with a similar change in the fatty acid composition of phospholipids. The pah1Δ mutant exhibited classic hallmarks of apoptosis in stationary phase and a marked reduction in the quantity of cytoplasmic lipid droplets. Cells lacking PA phosphatase were sensitive to exogenous fatty acids in the order of toxicity palmitoleic acid > oleic acid > palmitic acid. In contrast, the growth of wild type cells was not inhibited by fatty acid supplementation. In addition, wild type cells supplemented with palmitoleic acid exhibited an induction in PA phosphatase activity and an increase in TAG synthesis. Deletion of the DGK1-encoded diacylglycerol kinase, which counteracts PA phosphatase in controlling PA content, suppressed the defect in lipid droplet formation in the pah1Δ mutant. However, the sensitivity of the pah1Δ mutant to palmitoleic acid was not rescued by the dgk1Δ mutation. Overall, these findings indicate a key role of PA phosphatase in TAG synthesis for protection against fatty acid-induced toxicity. PMID:21708942

  17. 'Overgrowth' mutants in barley and wheat: new alleles and phenotypes of the 'Green Revolution' DELLA gene.

    PubMed

    Chandler, Peter Michael; Harding, Carol Anne

    2013-04-01

    A suppressor screen using dwarf mutants of barley (Hordeum vulgare L.) led to the isolation of 'overgrowth' derivatives, which retained the original dwarfing gene but grew at a faster rate because of a new mutation. The new mutations were in the Slender1 (Sln1) gene (11/13 cases), which encodes the DELLA protein central to gibberellin (GA) signalling, showed 100% genetic linkage to Sln1 (1/13), or were in the Spindly1 (Spy1) gene (1/13), which encodes another protein involved in GA signalling. The overgrowth mutants were characterized by increased GA signalling, although the extent still depended on the background GA biosynthesis capacity, GA receptor function, and DELLA activity. A comparison between two GA responses, α-amylase production and leaf growth rate, revealed degrees of specificity for both the overgrowth allele and the GA response under consideration. Many overgrowth mutants were also isolated in a dwarf line of bread wheat (Triticum aestivum L.) and 19 new alleles were identified in the Rht-B1 gene, one of the 'Green Revolution' semi-dwarfing genes and the orthologue of Sln1. The sites of amino acid substitutions in the DELLA proteins of both species provide insight into DELLA function, and included examples where identical but independent substitutions were observed. In both species, the starting lines were too dwarfed to be directly useful in breeding programmes, but new overgrowth derivatives with semidwarf heights have now been characterized. The variation they exhibit in GA-influenced traits identifies novel alleles with perfect markers that are of potential use in breeding.

  18. Temperature-sensitive albino gene TCD5, encoding a monooxygenase, affects chloroplast development at low temperatures.

    PubMed

    Wang, Yufeng; Zhang, Jianhui; Shi, Xiaoliang; Peng, Yu; Li, Ping; Lin, Dongzhi; Dong, Yanjun; Teng, Sheng

    2016-09-01

    Chloroplasts are essential for photosynthesis and play critical roles in plant development. In this study, we characterized the temperature-sensitive chlorophyll-deficient rice mutant tcd5, which develops albino leaves at low temperatures (20 °C) and normal green leaves at high temperatures (32 °C). The development of chloroplasts and etioplasts is impaired in tcd5 plants at 20 °C, and the temperature-sensitive period for the albino phenotype is the P4 stage of leaf development. The development of thylakoid membranes is arrested at the mid-P4 stage in tcd5 plants at 20 °C. We performed positional cloning of TCD5 and then complementation and knock-down experiments, and the results showed that the transcript LOC_Os05g34040.1 from the LOC_Os05g34040 gene corresponded to the tcd5 phenotype. TCD5 encodes a conserved plastid-targeted monooxygenase family protein which has not been previously reported associated with a temperature-sensitive albino phenotype in plants. TCD5 is abundantly expressed in young leaves and immature spikes, and low temperatures increased this expression. The transcription of some genes involved in plastid transcription/translation and photosynthesis varied in the tcd5 mutant. Although the phenotype and temperature dependence of the TCD5 orthologous mutant phenotype were different in rice and Arabidopsis, OsTCD5 could rescue the phenotype of the Arabidopsis mutant, suggesting that TCD5 function is conserved between monocots and dicots. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  19. ABG1, a Novel and Essential Candida albicans Gene Encoding a Vacuolar Protein Involved in Cytokinesis and Hyphal Branching

    PubMed Central

    Veses, Verónica; Casanova, Manuel; Murgui, Amelia; Domínguez, Ángel; Gow, Neil A. R.; Martínez, José P.

    2005-01-01

    Immunoscreening of a Candida albicans expression library resulted in the isolation of a novel gene encoding a 32.9-kDa polypeptide (288 amino acids), with 27.7% homology to the product of Saccharomyces cerevisiae YGR106c, a putative vacuolar protein. Heterozygous mutants in this gene displayed an altered budding growth pattern, characterized by the formation of chains of buds, decreasingly in size towards the apex, without separation of the daughter buds. Consequently, this gene was designated ABG1. A conditional mutant for ABG1 with the remaining allele under the control of the MET3 promoter did not grow in the presence of methionine and cysteine, demonstrating that ABG1 was essential for viability. Western analysis revealed the presence of a major 32.9-kDa band, mainly in a particulate fraction (P40) enriched in vacuoles, and tagging with green fluorescent protein confirmed that Abg1p localized to the vacuole. Vacuole inheritance has been linked to the regulation of branching frequency in C. albicans. Under repressing conditions, the conditional mutant had an increased frequency of branching under hyphal inducing conditions and an altered sensitivity to substances that interfered with cell wall assembly. Repression of ABG1 in the conditional mutant strain caused disturbance of normal size and number of vacuoles both in yeast and mycelial cells and also in the asymmetric vacuole inheritance associated with the characteristic pattern of germ tubes and branching in C. albicans. These observations indicate that ABG1 plays a key role in vacuole biogenesis, cytokinesis, and hyphal branching. PMID:15947201

  20. ABG1, a novel and essential Candida albicans gene encoding a vacuolar protein involved in cytokinesis and hyphal branching.

    PubMed

    Veses, Verónica; Casanova, Manuel; Murgui, Amelia; Domínguez, Angel; Gow, Neil A R; Martínez, José P

    2005-06-01

    Immunoscreening of a Candida albicans expression library resulted in the isolation of a novel gene encoding a 32.9-kDa polypeptide (288 amino acids), with 27.7% homology to the product of Saccharomyces cerevisiae YGR106c, a putative vacuolar protein. Heterozygous mutants in this gene displayed an altered budding growth pattern, characterized by the formation of chains of buds, decreasingly in size towards the apex, without separation of the daughter buds. Consequently, this gene was designated ABG1. A conditional mutant for ABG1 with the remaining allele under the control of the MET3 promoter did not grow in the presence of methionine and cysteine, demonstrating that ABG1 was essential for viability. Western analysis revealed the presence of a major 32.9-kDa band, mainly in a particulate fraction (P40) enriched in vacuoles, and tagging with green fluorescent protein confirmed that Abg1p localized to the vacuole. Vacuole inheritance has been linked to the regulation of branching frequency in C. albicans. Under repressing conditions, the conditional mutant had an increased frequency of branching under hyphal inducing conditions and an altered sensitivity to substances that interfered with cell wall assembly. Repression of ABG1 in the conditional mutant strain caused disturbance of normal size and number of vacuoles both in yeast and mycelial cells and also in the asymmetric vacuole inheritance associated with the characteristic pattern of germ tubes and branching in C. albicans. These observations indicate that ABG1 plays a key role in vacuole biogenesis, cytokinesis, and hyphal branching.

  1. Either fadD1 or fadD2, Which Encode acyl-CoA Synthetase, Is Essential for the Survival of Haemophilus parasuis SC096.

    PubMed

    Feng, Saixiang; Xu, Chenggang; Yang, Kaijie; Wang, Haihong; Fan, Huiying; Liao, Ming

    2017-01-01

    In Haemophilus parasuis , the genes HAPS_0217 and HAPS_1695 are predicted to encode long-chain fatty acid-CoA ligases (FACSs). These proteins contain ATP/AMP signature motifs and FACS conserved motifs that are homologous to those in Escherichia coli FadD (EcFadD). In this study, we demonstrate that HAPS_0217 and HAPS_1695 can functionally replace EcFadD in the E. coli fadD mutant JW1794, and were thus designated fadD1 and fadD2 , respectively. An evaluation of kinetic parameters indicated that FadD1 and FadD2 have a substrate preference for long-chain fatty acids. Moreover, FadD2 exhibited substrate inhibition in the presence of high concentrations of oleic acid. Single mutants of each of the fadD genes were easily constructed, whereas double mutants were not. These results were further confirmed using genomic site-directed mutagenesis, which supported the idea that H. parasuis requires either fadD1 or fadD2 for survival. The fadD1 mutant exhibited slower growth than the wild-type strain SC096, and its complementation resulted in a restored phenotype. The wild-type strain did not grow on chemically defined medium without the addition of oleic acid, indicating that lipids are a vital nutrient for this bacterium. Additionally, strains with a disrupted fadD1 gene also exhibited increased sensitivity to quinolone antibiotics, including levofloxacin, enrofloxacin, ciprofloxacin and nalidixic acid.

  2. l-Proline Accumulation and Freeze Tolerance in Saccharomyces cerevisiae Are Caused by a Mutation in the PRO1 Gene Encoding γ-Glutamyl Kinase

    PubMed Central

    Morita, Yuko; Nakamori, Shigeru; Takagi, Hiroshi

    2003-01-01

    We previously isolated a mutant which showed a high tolerance to freezing that correlated with higher levels of intracellular l-proline derived from l-proline analogue-resistant mutants. The mutation responsible for the analogue resistance and l-proline accumulation was a single nuclear dominant mutation. By introducing the mutant-derived genomic library into a non-l-proline-utilizing strain, the mutant was found to carry an allele of the wild-type PRO1 gene encoding γ-glutamyl kinase, which resulted in a single amino acid replacement; Asp (GAC) at position 154 was replaced by Asn (AAC). Interestingly, the allele of PRO1 was shown to enhance the activities of γ-glutamyl kinase and γ-glutamyl phosphate reductase, both of which catalyze the first two steps of l-proline synthesis from l-glutamate and which together may form a complex in vivo. When cultured in liquid minimal medium, yeast cells expressing the mutated γ-glutamyl kinase were found to accumulate intracellular l-proline and showed a prominent increase in cell viability after freezing at −20°C compared to the viability of cells harboring the wild-type PRO1 gene. These results suggest that the altered γ-glutamyl kinase results in stabilization of the complex or has an indirect effect on γ-glutamyl phosphate reductase activity, which leads to an increase in l-proline production in Saccharomyces cerevisiae. The approach described in this paper could be a practical method for breeding novel freeze-tolerant yeast strains. PMID:12513997

  3. Regulation of Hemolysin Expression and Virulence of Staphylococcus aureus by a Serine/Threonine Kinase and Phosphatase

    PubMed Central

    Burnside, Kellie; Lembo, Annalisa; de los Reyes, Melissa; Iliuk, Anton; BinhTran, Nguyen-Thao; Connelly, James E.; Lin, Wan-Jung; Schmidt, Byron Z.; Richardson, Anthony R.; Fang, Ferric C.; Tao, Weiguo Andy; Rajagopal, Lakshmi

    2010-01-01

    Exotoxins, including the hemolysins known as the alpha (α) and beta (β) toxins, play an important role in the pathogenesis of Staphylococcus aureus infections. A random transposon library was screened for S. aureus mutants exhibiting altered hemolysin expression compared to wild type. Transposon insertions in 72 genes resulting in increased or decreased hemolysin expression were identified. Mutations inactivating a putative cyclic di-GMP synthetase and a serine/threonine phosphatase (Stp1) were found to reduce hemolysin expression, and mutations in genes encoding a two component regulator PhoR, LysR family transcriptional regulator, purine biosynthetic enzymes and a serine/threonine kinase (Stk1) increased expression. Transcription of the hla gene encoding α toxin was decreased in a Δstp1 mutant strain and increased in a Δstk1 strain. Microarray analysis of a Δstk1 mutant revealed increased transcription of additional exotoxins. A Δstp1 strain is severely attenuated for virulence in mice and elicits less inflammation and IL-6 production than the Δstk1 strain. In vivo phosphopeptide enrichment and mass spectrometric analysis revealed that threonine phosphorylated peptides corresponding to Stk1, DNA binding histone like protein (HU), serine-aspartate rich fibrinogen/bone sialoprotein binding protein (SdrE) and a hypothetical protein (NWMN_1123) were present in the wild type and not in the Δstk1 mutant. Collectively, these studies suggest that Stk1 mediated phosphorylation of HU, SrdE and NWMN_1123 affects S. aureus gene expression and virulence. PMID:20552019

  4. Mutations in the histone fold domain of the TAF12 gene show synthetic lethality with the TAF1 gene lacking the TAF N-terminal domain (TAND) by different mechanisms from those in the SPT15 gene encoding the TATA box-binding protein (TBP)

    PubMed Central

    Kobayashi, Akiko; Miyake, Tsuyoshi; Kawaichi, Masashi; Kokubo, Tetsuro

    2003-01-01

    The general transcription factor TFIID, composed of the TATA box-binding protein (TBP) and 14 TBP-associated factors (TAFs), is important for both basal and regulated transcription by RNA polymerase II. Although it is well known that the TAF N-terminal domain (TAND) at the amino-terminus of the TAF1 protein binds to TBP and thereby inhibits TBP function in vitro, the physiological role of this domain remains obscure. In our previous study, we screened for mutations that cause lethality when co-expressed with the TAF1 gene lacking TAND (taf1-ΔTAND) and identified two ΔTAND synthetic lethal (nsl) mutations as those in the SPT15 gene encoding TBP. In this study we isolated another nsl mutation in the same screen and identified it to be a mutation in the histone fold domain (HFD) of the TAF12 gene. Several other HFD mutations of this gene also exhibit nsl phenotypes, and all of them are more or less impaired in transcriptional activation in vivo. Interestingly, a set of genes affected in the taf1-ΔTAND mutant is similarly affected in the taf12 HFD mutants but not in the nsl mutants of TBP. Therefore, we discovered that the nsl mutations of these two genes cause lethality in the taf1-ΔTAND mutant by different mechanisms. PMID:12582246

  5. Identification of Mutant Genes and Introgressed Tiger Salamander DNA in the Laboratory Axolotl, Ambystoma mexicanum.

    PubMed

    Woodcock, M Ryan; Vaughn-Wolfe, Jennifer; Elias, Alexandra; Kump, D Kevin; Kendall, Katharina Denise; Timoshevskaya, Nataliya; Timoshevskiy, Vladimir; Perry, Dustin W; Smith, Jeramiah J; Spiewak, Jessica E; Parichy, David M; Voss, S Randal

    2017-01-31

    The molecular genetic toolkit of the Mexican axolotl, a classic model organism, has matured to the point where it is now possible to identify genes for mutant phenotypes. We used a positional cloning-candidate gene approach to identify molecular bases for two historic axolotl pigment phenotypes: white and albino. White (d/d) mutants have defects in pigment cell morphogenesis and differentiation, whereas albino (a/a) mutants lack melanin. We identified in white mutants a transcriptional defect in endothelin 3 (edn3), encoding a peptide factor that promotes pigment cell migration and differentiation in other vertebrates. Transgenic restoration of Edn3 expression rescued the homozygous white mutant phenotype. We mapped the albino locus to tyrosinase (tyr) and identified polymorphisms shared between the albino allele (tyr a ) and tyr alleles in a Minnesota population of tiger salamanders from which the albino trait was introgressed. tyr a has a 142 bp deletion and similar engineered alleles recapitulated the albino phenotype. Finally, we show that historical introgression of tyr a significantly altered genomic composition of the laboratory axolotl, yielding a distinct, hybrid strain of ambystomatid salamander. Our results demonstrate the feasibility of identifying genes for traits in the laboratory Mexican axolotl.

  6. Mutation of the Glucosinolate Biosynthesis Enzyme Cytochrome P450 83A1 Monooxygenase Increases Camalexin Accumulation and Powdery Mildew Resistance.

    PubMed

    Liu, Simu; Bartnikas, Lisa M; Volko, Sigrid M; Ausubel, Frederick M; Tang, Dingzhong

    2016-01-01

    Small secondary metabolites, including glucosinolates and the major phytoalexin camalexin, play important roles in immunity in Arabidopsis thaliana. We isolated an Arabidopsis mutant with increased resistance to the powdery mildew fungus Golovinomyces cichoracearum and identified a mutation in the gene encoding cytochrome P450 83A1 monooxygenase (CYP83A1), which functions in glucosinolate biosynthesis. The cyp83a1-3 mutant exhibited enhanced defense responses to G. cichoracearum and double mutant analysis showed that this enhanced resistance requires NPR1, EDS1, and PAD4, but not SID2 or EDS5. In cyp83a1-3 mutants, the expression of genes related to camalexin synthesis increased upon G. cichoracearum infection. Significantly, the cyp83a1-3 mutant also accumulated higher levels of camalexin. Decreasing camalexin levels by mutation of the camalexin synthetase gene PAD3 or the camalexin synthesis regulator AtWRKY33 compromised the powdery mildew resistance in these mutants. Consistent with these observations, overexpression of PAD3 increased camalexin levels and enhanced resistance to G. cichoracearum. Taken together, our data indicate that accumulation of higher levels of camalexin contributes to increased resistance to powdery mildew.

  7. Mutation of the Glucosinolate Biosynthesis Enzyme Cytochrome P450 83A1 Monooxygenase Increases Camalexin Accumulation and Powdery Mildew Resistance

    PubMed Central

    Liu, Simu; Bartnikas, Lisa M.; Volko, Sigrid M.; Ausubel, Frederick M.; Tang, Dingzhong

    2016-01-01

    Small secondary metabolites, including glucosinolates and the major phytoalexin camalexin, play important roles in immunity in Arabidopsis thaliana. We isolated an Arabidopsis mutant with increased resistance to the powdery mildew fungus Golovinomyces cichoracearum and identified a mutation in the gene encoding cytochrome P450 83A1 monooxygenase (CYP83A1), which functions in glucosinolate biosynthesis. The cyp83a1-3 mutant exhibited enhanced defense responses to G. cichoracearum and double mutant analysis showed that this enhanced resistance requires NPR1, EDS1, and PAD4, but not SID2 or EDS5. In cyp83a1-3 mutants, the expression of genes related to camalexin synthesis increased upon G. cichoracearum infection. Significantly, the cyp83a1-3 mutant also accumulated higher levels of camalexin. Decreasing camalexin levels by mutation of the camalexin synthetase gene PAD3 or the camalexin synthesis regulator AtWRKY33 compromised the powdery mildew resistance in these mutants. Consistent with these observations, overexpression of PAD3 increased camalexin levels and enhanced resistance to G. cichoracearum. Taken together, our data indicate that accumulation of higher levels of camalexin contributes to increased resistance to powdery mildew. PMID:26973671

  8. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    PubMed

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

    2005-04-01

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  9. Functional Loss of Bmsei Causes Thermosensitive Epilepsy in Contractile Mutant Silkworm, Bombyx mori

    NASA Astrophysics Data System (ADS)

    Nie, Hongyi; Cheng, Tingcai; Huang, Xiaofeng; Zhou, Mengting; Zhang, Yinxia; Dai, Fangyin; Mita, Kazuei; Xia, Qingyou; Liu, Chun

    2015-07-01

    The thermoprotective mechanisms of insects remain largely unknown. We reported the Bombyx mori contractile (cot) behavioral mutant with thermo-sensitive seizures phenotype. At elevated temperatures, the cot mutant exhibit seizures associated with strong contractions, rolling, vomiting, and a temporary lack of movement. We narrowed a region containing cot to ~268 kb by positional cloning and identified the mutant gene as Bmsei which encoded a potassium channel protein. Bmsei was present in both the cell membrane and cytoplasm in wild-type ganglia but faint in cot. Furthermore, Bmsei was markedly decreased upon high temperature treatment in cot mutant. With the RNAi method and injecting potassium channel blockers, the wild type silkworm was induced the cot phenotype. These results demonstrated that Bmsei was responsible for the cot mutant phenotype and played an important role in thermoprotection in silkworm. Meanwhile, comparative proteomic approach was used to investigate the proteomic differences. The results showed that the protein of Hsp-1 and Tn1 were significantly decreased and increased on protein level in cot mutant after thermo-stimulus, respectively. Our data provide insights into the mechanism of thermoprotection in insect. As cot phenotype closely resembles human epilepsy, cot might be a potential model for the mechanism of epilepsy in future.

  10. Functional Loss of Bmsei Causes Thermosensitive Epilepsy in Contractile Mutant Silkworm, Bombyx mori

    PubMed Central

    Nie, Hongyi; Cheng, Tingcai; Huang, Xiaofeng; Zhou, Mengting; Zhang, Yinxia; Dai, Fangyin; Mita, Kazuei; Xia, Qingyou; Liu, Chun

    2015-01-01

    The thermoprotective mechanisms of insects remain largely unknown. We reported the Bombyx mori contractile (cot) behavioral mutant with thermo-sensitive seizures phenotype. At elevated temperatures, the cot mutant exhibit seizures associated with strong contractions, rolling, vomiting, and a temporary lack of movement. We narrowed a region containing cot to ~268 kb by positional cloning and identified the mutant gene as Bmsei which encoded a potassium channel protein. Bmsei was present in both the cell membrane and cytoplasm in wild-type ganglia but faint in cot. Furthermore, Bmsei was markedly decreased upon high temperature treatment in cot mutant. With the RNAi method and injecting potassium channel blockers, the wild type silkworm was induced the cot phenotype. These results demonstrated that Bmsei was responsible for the cot mutant phenotype and played an important role in thermoprotection in silkworm. Meanwhile, comparative proteomic approach was used to investigate the proteomic differences. The results showed that the protein of Hsp-1 and Tn1 were significantly decreased and increased on protein level in cot mutant after thermo-stimulus, respectively. Our data provide insights into the mechanism of thermoprotection in insect. As cot phenotype closely resembles human epilepsy, cot might be a potential model for the mechanism of epilepsy in future. PMID:26198671

  11. Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

    PubMed Central

    Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

    2001-01-01

    The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that cytochrome bd is an important terminal oxidase in M. smegmatis. PMID:11717265

  12. Mechanisms of plant resistance to 1 g gravity and hypergravity

    NASA Astrophysics Data System (ADS)

    Hoson, Takayuki; Matsumoto, Shouhei; Kumasaki, Saori; Higuchi, Sayoko; Soga, Kouichi; Wakabayashi, Kazuyuki; Hashimoto, Takashi; Suzuki, Masashi; Muranaka, Toshiya; Sakaki, Takeshi

    Resistance to the gravitational force is one of two major graviresponses in plants, comparable to gravitropism. We have examined mechanisms of gravity resistance using hypergravity conditions produced by centrifugation. Under hypergravity conditions, the expression of the gene encoding 3-hydroxy-3-methylglutaryl-Coenzyme A reductase, which catalyzes a reaction producing mevalonic acid, was up-regulated in Arabidopsis hypocotyls, and the level of membrane sterols was kept higher, without influencing the level or composition of other membrane components. Out of sterols, the levels of steryl glycosides and acyl steryl glycosides were greatly increased, suggesting the stimulation of sterol raft formation under hypergravity conditions. On the other hand, the expression of the majority of alphaand beta-tubulin genes was up-regulated and the percentage of cells with longitudinal cortical microtubules was increased by hypergravity. Hypergravity also increased the expression of genes encoding gamma-tubulin complex and katanin transiently, whereas it decreased that encoding various microtubule-associated proteins such as MAP65. The role of membrane sterols and cortical microtubules in gravity resistance was confirmed using Arabidopsis mutants. The analysis with mutants has also revealed that the signal transduction process via sterol rafts is distinct from that via cortical microtubules. These results indicate that membrane sterol rafts and cortical microtubules are deeply and independently involved in maintenance of normal growth capacity against the gravitational force. To confirm that the hypothesis is applicable to plant resistance to 1 g gravity, we will carry out the space experiment. This experiment, termed Resist Wall, is to be performed on the European Modular Cultivation System onboard the International Space Station (ISS). In the Resist Wall experiment, Arabidopsis mutant strains will be cultivated under microgravity and at 1 g conditions on the ISS up to reproductive stage and phenotypes on growth and development will be compared using video images. Also, we will analyze the levels of gene expression and the cell wall properties of the mutants as well as the wild type, using materials fixed on orbit and collected to earth. The results obtained in this space experiment will also be presented.

  13. Altered Fermentative Metabolism in Chlamydomonas reinhardtii Mutants Lacking Pyruvate Formate Lyase and Both Pyruvate Formate Lyase and Alcohol Dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Catalanotti, C.; Dubini, A.; Subramanian, V.

    2012-02-01

    Chlamydomonas reinhardtii, a unicellular green alga, often experiences hypoxic/anoxic soil conditions that activate fermentation metabolism. We isolated three Chlamydomonas mutants disrupted for the pyruvate formate lyase (PFL1) gene; the encoded PFL1 protein catalyzes a major fermentative pathway in wild-type Chlamydomonas cells. When the pfl1 mutants were subjected to dark fermentative conditions, they displayed an increased flux of pyruvate to lactate, elevated pyruvate decarboxylation, ethanol accumulation, diminished pyruvate oxidation by pyruvate ferredoxin oxidoreductase, and lowered H2 production. The pfl1-1 mutant also accumulated high intracellular levels of lactate, succinate, alanine, malate, and fumarate. To further probe the system, we generated a doublemore » mutant (pfl1-1 adh1) that is unable to synthesize both formate and ethanol. This strain, like the pfl1 mutants, secreted lactate, but it also exhibited a significant increase in the levels of extracellular glycerol, acetate, and intracellular reduced sugars and a decrease in dark, fermentative H2 production. Whereas wild-type Chlamydomonas fermentation primarily produces formate and ethanol, the double mutant reroutes glycolytic carbon to lactate and glycerol. Although the metabolic adjustments observed in the mutants facilitate NADH reoxidation and sustained glycolysis under dark, anoxic conditions, the observed changes could not have been predicted given our current knowledge of the regulation of fermentation metabolism.« less

  14. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  15. A Novel Point Mutation at Position 156 of Reverse Transcriptase from Feline Immunodeficiency Virus Confers Resistance to the Combination of (−)-β-2′,3′-Dideoxy-3′-Thiacytidine and 3′-Azido-3′-Deoxythymidine

    PubMed Central

    Smith, Robert A.; Remington, Kathryn M.; Preston, Bradley D.; Schinazi, Raymond F.; North, Thomas W.

    1998-01-01

    Mutants of feline immunodeficiency virus (FIV) resistant to (−)-β-2′,3′-dideoxy-3′-thiacytidine (3TC) were selected by culturing virus in the presence of increasing stepwise concentrations of 3TC. Two plaque-purified variants were isolated from the original mutant population, and both of these mutants were resistant to 3TC. Surprisingly, these mutants were also phenotypically resistant to 3′-azido-3′-deoxythymidine (AZT) and to the combination of 3TC and AZT. Purified reverse transcriptase (RT) from one of these plaque-purified mutants was resistant to the 5′-triphosphates of 3TC and AZT. DNA sequence analysis of the RT-encoding region of the pol gene amplified from the plaque-purified mutants revealed a Pro-to-Ser mutation at position 156 of RT. A site-directed mutant of FIV engineered to contain this Pro-156-Ser mutation was resistant to 3TC, AZT, and the combination of 3TC and AZT, confirming the role of the Pro-156-Ser mutation in the resistance of FIV to these two nucleoside analogs. This represents the first report of a lentiviral mutant resistant to the combination of AZT and 3TC due to a single, unique point mutation. PMID:9499094

  16. Efficient production of infectious viruses requires enzymatic activity of Epstein-Barr virus protein kinase.

    PubMed

    Murata, Takayuki; Isomura, Hiroki; Yamashita, Yoriko; Toyama, Shigenori; Sato, Yoshitaka; Nakayama, Sanae; Kudoh, Ayumi; Iwahori, Satoko; Kanda, Teru; Tsurumi, Tatsuya

    2009-06-20

    The Epstein-Barr virus (EBV) BGLF4 gene product is the only protein kinase encoded by the virus genome. In order to elucidate its physiological roles in viral productive replication, we here established a BGLF4-knockout mutant and a revertant virus. While the levels of viral DNA replication of the deficient mutant were equivalent to those of the wild-type and the revertant, virus production was significantly impaired. Expression of the BGLF4 protein in trans fully complemented the low yield of the mutant virus, while expression of a kinase-dead (K102I) form of the protein failed to restore the virus titer. These results demonstrate that BGLF4 plays a significant role in production of infectious viruses and that the kinase activity is crucial.

  17. Tryptophan 32 potentiates aggregation and cytotoxicity of a copper/zinc superoxide dismutase mutant associated with familial amyotrophic lateral sclerosis.

    PubMed

    Taylor, David M; Gibbs, Bernard F; Kabashi, Edor; Minotti, Sandra; Durham, Heather D; Agar, Jeffrey N

    2007-06-01

    One familial form of the neurodegenerative disease, amyotrophic lateral sclerosis, is caused by gain-of-function mutations in the gene encoding copper/zinc superoxide dismutase (SOD-1). This study provides in vivo evidence that normally occurring oxidative modification to SOD-1 promotes aggregation and toxicity of mutant proteins. The oxidation of Trp-32 was identified as a normal modification being present in both wild-type enzyme and SOD-1 with the disease-causing mutation, G93A, isolated from erythrocytes. Mutating Trp-32 to a residue with a slower rate of oxidative modification, phenylalanine, decreased both the cytotoxicity of mutant SOD-1 and its propensity to form cytoplasmic inclusions in motor neurons of dissociated mouse spinal cord cultures.

  18. Essential roles for Cdx in murine primitive hematopoiesis.

    PubMed

    Brooke-Bisschop, Travis; Savory, Joanne G A; Foley, Tanya; Ringuette, Randy; Lohnes, David

    2017-02-15

    The Cdx transcription factors play essential roles in primitive hematopoiesis in the zebrafish where they exert their effects, in part, through regulation of hox genes. Defects in hematopoiesis have also been reported in Cdx mutant murine embryonic stem cell models, however, to date no mouse model reflecting the zebrafish Cdx mutant hematopoietic phenotype has been described. This is likely due, in part, to functional redundancy among Cdx members and the early lethality of Cdx2 null mutants. To circumvent these limitations, we used Cre-mediated conditional deletion to assess the impact of concomitant loss of Cdx1 and Cdx2 on murine primitive hematopoiesis. We found that Cdx1/Cdx2 double mutants exhibited defects in primitive hematopoiesis and yolk sac vasculature concomitant with reduced expression of several genes encoding hematopoietic transcription factors including Scl/Tal1. Chromatin immunoprecipitation analysis revealed that Scl was occupied by Cdx2 in vivo, and Cdx mutant hematopoietic yolk sac differentiation defects could be rescued by expression of exogenous Scl. These findings demonstrate critical roles for Cdx members in murine primitive hematopoiesis upstream of Scl. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Csf3r mutations in mice confer a strong clonal HSC advantage via activation of Stat5

    PubMed Central

    Liu, Fulu; Kunter, Ghada; Krem, Maxwell M.; Eades, William C.; Cain, Jennifer A.; Tomasson, Michael H.; Hennighausen, Lothar; Link, Daniel C.

    2008-01-01

    A fundamental property of leukemic stem cells is clonal dominance of the bone marrow microenvironment. Truncation mutations of CSF3R, which encodes the G-CSF receptor (G-CSFR), are implicated in leukemic progression in patients with severe congenital neutropenia. Here we show that expression of a truncated mutant Csf3r in mice confers a strong clonal advantage at the HSC level that is dependent upon exogenous G-CSF. G-CSF–induced proliferation, phosphorylation of Stat5, and transcription of Stat5 target genes were increased in HSCs isolated from mice expressing the mutant Csf3r. Conversely, the proliferative advantage conferred by the mutant Csf3r was abrogated in myeloid progenitors lacking both Stat5A and Stat5B, and HSC function was reduced in mice expressing a truncated mutant Csf3r engineered to have impaired Stat5 activation. These data indicate that in mice, inappropriate Stat5 activation plays a key role in establishing clonal dominance by stem cells expressing mutant Csf3r. PMID:18292815

  20. Phenotypic Characterization of a copA Mutant of Neisseria gonorrhoeae Identifies a Link between Copper and Nitrosative Stress

    PubMed Central

    Djoko, Karrera Y.; Franiek, Jessica A.; Edwards, Jennifer L.; Falsetta, Megan L.; Kidd, Stephen P.; Potter, Adam J.; Chen, Nathan H.; Apicella, Michael A.; Jennings, Michael P.

    2012-01-01

    NGO0579 is annotated copA in the Neisseria gonorrhoeae chromosome, suggesting that it encodes a cation-transporting ATPase specific for copper ions. Compared to wild-type cells, a copA mutant was more sensitive to killing by copper ions but not to other transition metals. The mutant also accumulated a greater amount of copper, consistent with the predicted role of CopA as a copper efflux pump. The copA mutant showed a reduced ability to invade and survive within human cervical epithelial cells, although its ability to form a biofilm on the surface of these cells was not significantly different from that of the wild type. In the presence of copper, the copA mutant exhibited increased sensitivity to killing by nitrite or nitric oxide. Therefore, we concluded that copper ion efflux catalyzed by CopA is linked to the nitrosative stress defense system of Neisseria gonorrhoeae. These observations suggest that copper may exert its effects as an antibacterial agent in the innate immune system via an interaction with reactive nitrogen species. PMID:22184419

  1. Inactivation of the Haemophilus ducreyi luxS gene affects the virulence of this pathogen in human subjects.

    PubMed

    Labandeira-Rey, Maria; Janowicz, Diane M; Blick, Robert J; Fortney, Kate R; Zwickl, Beth; Katz, Barry P; Spinola, Stanley M; Hansen, Eric J

    2009-08-01

    Haemophilus ducreyi 35000HP contains a homologue of the luxS gene, which encodes an enzyme that synthesizes autoinducer 2 (AI-2) in other gram-negative bacteria. H. ducreyi 35000HP produced AI-2 that functioned in a Vibrio harveyi-based reporter system. A H. ducreyi luxS mutant was constructed by insertional inactivation of the luxS gene and lost the ability to produce AI-2. Provision of the H. ducreyi luxS gene in trans partially restored AI-2 production by the mutant. The luxS mutant was compared with its parent for virulence in the human challenge model of experimental chancroid. The pustule-formation rate in 5 volunteers was 93.3% (95% confidence interval, 81.7%-99.9%) at 15 parent sites and 60.0% (95% confidence interval, 48.3%-71.7%) at 15 mutant sites (1-tailed P < .001). Thus, the luxS mutant was partially attenuated for virulence. This is the first report of AI-2 production contributing to the pathogenesis of a genital ulcer disease.

  2. Mutant fatty acid desaturase

    DOEpatents

    Shanklin, John; Cahoon, Edgar B.

    2004-02-03

    The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

  3. Mutation of the ptsG Gene Results in Increased Production of Succinate in Fermentation of Glucose by Escherichia coli

    PubMed Central

    Chatterjee, Ranjini; Millard, Cynthia Sanville; Champion, Kathleen; Clark, David P.; Donnelly, Mark I.

    2001-01-01

    Escherichia coli NZN111 is blocked in the ability to grow fermentatively on glucose but gave rise spontaneously to a mutant that had this ability. The mutant carries out a balanced fermentation of glucose to give approximately 1 mol of succinate, 0.5 mol of acetate, and 0.5 mol of ethanol per mol of glucose. The causative mutation was mapped to the ptsG gene, which encodes the membrane-bound, glucose-specific permease of the phosphotransferase system, protein EIICBglc. Replacement of the chromosomal ptsG gene with an insertionally inactivated form also restored growth on glucose and resulted in the same distribution of fermentation products. The physiological characteristics of the spontaneous and null mutants were consistent with loss of function of the ptsG gene product; the mutants possessed greatly reduced glucose phosphotransferase activity and lacked normal glucose repression. Introduction of the null mutant into strains not blocked in the ability to ferment glucose also increased succinate production in those strains. This phenomenon was widespread, occurring in different lineages of E. coli, including E. coli B. PMID:11133439

  4. Alteration in levels of unsaturated fatty acids in mutants of Escherichia coli defective in DNA replication.

    PubMed

    Suzuki, E; Kondo, T; Makise, M; Mima, S; Sakamoto, K; Tsuchiya, T; Mizushima, T

    1998-07-01

    We previously reported that mutations in the dnaA gene which encodes the initiator of chromosomal DNA replication in Escherichia coli caused an alteration in the levels of unsaturated fatty acids of phospholipids in membranes. In this study, we examined fatty acid compositions in other mutants which are defective in DNA replication. As in the case of temperature-sensitive dnaA mutants, temperature-sensitive dnaC and dnaE mutants, which have defects in initiation and elongation, respectively, of DNA replication showed a lower level of unsaturation of fatty acids (ratio of unsaturated to saturated fatty acids) compared with the wild-type strain, especially at high temperatures. On the other hand, temperature-sensitive mutants defective in cellular processes other than DNA replication, such as RNA synthesis and cell division, did not show a lower level of unsaturation of fatty acids compared with the wild-type strain. These results suggest that the inhibition of DNA replication causes a lower level of unsaturation of fatty acids in Escherichia coli cells.

  5. Mutational analysis of the glycosylphosphatidylinositol (GPI) anchor pathway demonstrates that GPI-anchored proteins are required for cell wall biogenesis and normal hyphal growth in Neurospora crassa.

    PubMed

    Bowman, Shaun M; Piwowar, Amy; Al Dabbous, Mash'el; Vierula, John; Free, Stephen J

    2006-03-01

    Using mutational and proteomic approaches, we have demonstrated the importance of the glycosylphosphatidylinositol (GPI) anchor pathway for cell wall synthesis and integrity and for the overall morphology of the filamentous fungus Neurospora crassa. Mutants affected in the gpig-1, gpip-1, gpip-2, gpip-3, and gpit-1 genes, which encode components of the N. crassa GPI anchor biosynthetic pathway, have been characterized. GPI anchor mutants exhibit colonial morphologies, significantly reduced rates of growth, altered hyphal growth patterns, considerable cellular lysis, and an abnormal "cell-within-a-cell" phenotype. The mutants are deficient in the production of GPI-anchored proteins, verifying the requirement of each altered gene for the process of GPI-anchoring. The mutant cell walls are abnormally weak, contain reduced amounts of protein, and have an altered carbohydrate composition. The mutant cell walls lack a number of GPI-anchored proteins, putatively involved in cell wall biogenesis and remodeling. From these studies, we conclude that the GPI anchor pathway is critical for proper cell wall structure and function in N. crassa.

  6. Seedling lethality in Nicotiana plumbaginifolia conferred by Ds transposable element insertion into a plant-specific gene.

    PubMed

    Majira, Amel; Domin, Monique; Grandjean, Olivier; Gofron, Krystyna; Houba-Hérin, Nicole

    2002-10-01

    A seedling lethal mutant of Nicotiana plumbaginifolia (sdl-1) was isolated by transposon tagging using a maize Dissociation (Ds) element. The insertion mutation was produced by direct co-transformation of protoplasts with two plasmids: one containing Ds and a second with an Ac transposase gene. sdl-1 seedlings exhibit several phenotypes: swollen organs, short hypocotyls in light and dark conditions, and enlarged and multinucleated cells, that altogether suggest cell growth defects. Mutant cells are able to proliferate under in vitro culture conditions. Genomic DNA sequences bordering the transposon were used to recover cDNA from the normal allele. Complementation of the mutant phenotype with the cDNA confirmed that the transposon had caused the mutation. The Ds element was inserted into the first exon of the open reading frame and the homozygous mutant lacked detectable transcript. Phenocopies of the mutant were obtained by an antisense approach. SDL-1 encodes a novel protein found in several plant genomes but apparently missingfrom animal and fungal genomes; the protein is highly conserved and has a potential plastid targeting motif.

  7. Mutational analysis of the major soybean UreF paralogue involved in urease activation.

    PubMed

    Polacco, Joe C; Hyten, David L; Medeiros-Silva, Mônica; Sleper, David A; Bilyeu, Kristin D

    2011-06-01

    The soybean genome duplicated ∼14 and 45 million years ago and has many paralogous genes, including those in urease activation (emplacement of Ni and CO(2) in the active site). Activation requires the UreD and UreF proteins, each encoded by two paralogues. UreG, a third essential activation protein, is encoded by the single-copy Eu3, and eu3 mutants lack activity of both urease isozymes. eu2 has the same urease-negative phenotype, consistent with Eu2 being a single-copy gene, possibly encoding a Ni carrier. Unexpectedly, two eu2 alleles co-segregated with missense mutations in the chromosome 2 UreF paralogue (Ch02UreF), suggesting lack of expression/function of Ch14UreF. However, Ch02UreF and Ch14UreF transcripts accumulate at the same level. Further, it had been shown that expression of the Ch14UreF ORF complemented a fungal ureF mutant. A third, nonsense (Q2*) allelic mutant, eu2-c, exhibited 5- to 10-fold more residual urease activity than missense eu2-a or eu2-b, though eu2-c should lack all Ch02UreF protein. It is hypothesized that low-level activation by Ch14UreF is 'spoiled' by the altered missense Ch02UreF proteins ('epistatic dominant-negative'). In agreement with active 'spoiling' by eu2-b-encoded Ch02UreF (G31D), eu2-b/eu2-c heterozygotes had less than half the urease activity of eu2-c/eu2-c siblings. Ch02UreF (G31D) could spoil activation by Chr14UreF because of higher affinity for the activation complex, or because Ch02UreF (G31D) is more abundant than Ch14UreF. Here, the latter is favoured, consistent with a reported in-frame AUG in the 5' leader of Chr14UreF transcript. Translational inhibition could represent a form of 'functional divergence' of duplicated genes.

  8. Mutational analysis of the major soybean UreF paralogue involved in urease activation

    PubMed Central

    Polacco, Joe C.; Hyten, David L.; Medeiros-Silva, Mônica; Sleper, David A.; Bilyeu, Kristin D.

    2011-01-01

    The soybean genome duplicated ∼14 and 45 million years ago and has many paralogous genes, including those in urease activation (emplacement of Ni and CO2 in the active site). Activation requires the UreD and UreF proteins, each encoded by two paralogues. UreG, a third essential activation protein, is encoded by the single-copy Eu3, and eu3 mutants lack activity of both urease isozymes. eu2 has the same urease-negative phenotype, consistent with Eu2 being a single-copy gene, possibly encoding a Ni carrier. Unexpectedly, two eu2 alleles co-segregated with missense mutations in the chromosome 2 UreF paralogue (Ch02UreF), suggesting lack of expression/function of Ch14UreF. However, Ch02UreF and Ch14UreF transcripts accumulate at the same level. Further, it had been shown that expression of the Ch14UreF ORF complemented a fungal ureF mutant. A third, nonsense (Q2*) allelic mutant, eu2-c, exhibited 5- to 10-fold more residual urease activity than missense eu2-a or eu2-b, though eu2-c should lack all Ch02UreF protein. It is hypothesized that low-level activation by Ch14UreF is ‘spoiled’ by the altered missense Ch02UreF proteins (‘epistatic dominant-negative’). In agreement with active ‘spoiling’ by eu2-b-encoded Ch02UreF (G31D), eu2-b/eu2-c heterozygotes had less than half the urease activity of eu2-c/eu2-c siblings. Ch02UreF (G31D) could spoil activation by Chr14UreF because of higher affinity for the activation complex, or because Ch02UreF (G31D) is more abundant than Ch14UreF. Here, the latter is favoured, consistent with a reported in-frame AUG in the 5' leader of Chr14UreF transcript. Translational inhibition could represent a form of ‘functional divergence’ of duplicated genes. PMID:21430294

  9. Tuning of RNA editing by ADAR is required in Drosophila

    PubMed Central

    Keegan, Liam P; Brindle, James; Gallo, Angela; Leroy, Anne; Reenan, Robert A; O'Connell, Mary A

    2005-01-01

    RNA editing increases during development in more than 20 transcripts encoding proteins involved in rapid synaptic neurotransmission in Drosophila central nervous system and muscle. Adar (adenosine deaminase acting on RNA) mutant flies expressing only genome-encoded, unedited isoforms of ion-channel subunits are viable but show severe locomotion defects. The Adar transcript itself is edited in adult wild-type flies to generate an isoform with a serine to glycine substitution close to the ADAR active site. We show that editing restricts ADAR function since the edited isoform of ADAR is less active in vitro and in vivo than the genome-encoded, unedited isoform. Ubiquitous expression in embryos and larvae of an Adar transcript that is resistant to editing is lethal. Expression of this transcript in embryonic muscle is also lethal, with above-normal, adult-like levels of editing at sites in a transcript encoding a muscle voltage-gated calcium channel. PMID:15920480

  10. Vacuolar amino acid transporter Avt5p is responsible for lithium uptake in Schizosaccharomyces pombe.

    PubMed

    Iwaki, Tomoko; Sekito, Takayuki; Kakinuma, Yoshimi

    2010-01-01

    The fission yeast Schizosaccharomyces pombe was sensitive to salinity; cell growth was stopped by 0.5 M NaCl and by 10 mM LiCl. The avt5+ gene encodes a vacuolar transporter with a broad specificity for amino acids. We found that the avt5Delta mutant became highly tolerant of Li+ and Na+ in growth. Concanamycin A-sensitive Li+ uptake as well as cellular Li+ content was lower in the avt5 mutant, suggesting a role of Avt5p in cellular uptake of toxic Li+.

  11. The gravitropism defective 2 Mutants of Arabidopsis Are Deficient in a Protein Implicated in Endocytosis in Caenorhabditis elegans1[w

    PubMed Central

    Silady, Rebecca A.; Kato, Takehide; Lukowitz, Wolfgang; Sieber, Patrick; Tasaka, Masao; Somerville, Chris R.

    2004-01-01

    The gravitropism defective 2 (grv2) mutants of Arabidopsis show reduced shoot phototropism and gravitropism. Amyloplasts in the shoot endodermal cells of grv2 do not sediment to the same degree as in wild type. The GRV2 gene encodes a 277-kD polypeptide that is 42% similar to the Caenorhabditis elegans RME-8 protein, which is required for endocytosis. We hypothesize that a defect in endocytosis may affect both the initial gravity sensing via amyloplasts sedimentation and the subsequent more general tropic growth response. PMID:15466218

  12. Identification of New Virulence Factors and Vaccine Candidates for Yersinia pestis

    PubMed Central

    Andersson, Jourdan A.; Sha, Jian; Erova, Tatiana E.; Fitts, Eric C.; Ponnusamy, Duraisamy; Kozlova, Elena V.; Kirtley, Michelle L.; Chopra, Ashok K.

    2017-01-01

    Earlier, we reported the identification of new virulence factors/mechanisms of Yersinia pestis using an in vivo signature-tagged mutagenesis (STM) screening approach. From this screen, the role of rbsA, which encodes an ATP-binding protein of ribose transport system, and vasK, an essential component of the type VI secretion system (T6SS), were evaluated in mouse models of plague and confirmed to be important during Y. pestis infection. However, many of the identified genes from the screen remained uncharacterized. In this study, in-frame deletion mutants of ypo0815, ypo2884, ypo3614-3168 (cyoABCDE), and ypo1119-1120, identified from the STM screen, were generated. While ypo0815 codes for a general secretion pathway protein E (GspE) of the T2SS, the ypo2884-encoded protein has homology to the βγ crystallin superfamily, cyoABCDE codes for the cytochrome o oxidase operon, and the ypo1119-1120 genes are within the Tol-Pal system which has multiple functions. Additionally, as our STM screen identified three T6SS-associated genes, and, based on in silico analysis, six T6SS clusters and multiple homologs of the T6SS effector hemolysin-coregulated protein (Hcp) exist in Y. pestis CO92, we also targeted these T6SS clusters and effectors for generating deletion mutants. These deletion mutant strains exhibited varying levels of attenuation (up to 100%), in bubonic or pneumonic murine infection models. The attenuation could be further augmented by generation of combinatorial deletion mutants, namely ΔlppΔypo0815, ΔlppΔypo2884, ΔlppΔcyoABCDE, ΔvasKΔhcp6, and Δypo2720-2733Δhcp3. We earlier showed that deletion of the lpp gene, which encodes Braun lipoprotein (Lpp) and activates Toll-like receptor-2, reduced virulence of Y. pestis CO92 in murine models of bubonic and pneumonic plague. The surviving mice infected with ΔlppΔcyoABCDE, ΔvasKΔhcp6, and Δypo2720-2733Δhcp3 mutant strains were 55–100% protected upon subsequent re-challenge with wild-type CO92 in a pneumonic model. Further, evaluation of the attenuated T6SS mutant strains in vitro revealed significant alterations in phagocytosis, intracellular survival in murine macrophages, and their ability to induce cytotoxic effects on macrophages. The results reported here provide further evidence of the utility of the STM screening approach for the identification of novel virulence factors and to possibly target such genes for the development of novel live-attenuated vaccine candidates for plague. PMID:29090192

  13. Identification of New Virulence Factors and Vaccine Candidates for Yersinia pestis.

    PubMed

    Andersson, Jourdan A; Sha, Jian; Erova, Tatiana E; Fitts, Eric C; Ponnusamy, Duraisamy; Kozlova, Elena V; Kirtley, Michelle L; Chopra, Ashok K

    2017-01-01

    Earlier, we reported the identification of new virulence factors/mechanisms of Yersinia pestis using an in vivo signature-tagged mutagenesis (STM) screening approach. From this screen, the role of rbsA , which encodes an ATP-binding protein of ribose transport system, and vasK , an essential component of the type VI secretion system (T6SS), were evaluated in mouse models of plague and confirmed to be important during Y. pestis infection. However, many of the identified genes from the screen remained uncharacterized. In this study, in-frame deletion mutants of ypo0815, ypo2884, ypo3614-3168 (cyoABCDE) , and ypo1119-1120 , identified from the STM screen, were generated. While ypo0815 codes for a general secretion pathway protein E (GspE) of the T2SS, the ypo2884 -encoded protein has homology to the βγ crystallin superfamily, cyoABCDE codes for the cytochrome o oxidase operon, and the ypo1119-1120 genes are within the Tol-Pal system which has multiple functions. Additionally, as our STM screen identified three T6SS-associated genes, and, based on in silico analysis, six T6SS clusters and multiple homologs of the T6SS effector hemolysin-coregulated protein (Hcp) exist in Y. pestis CO92, we also targeted these T6SS clusters and effectors for generating deletion mutants. These deletion mutant strains exhibited varying levels of attenuation (up to 100%), in bubonic or pneumonic murine infection models. The attenuation could be further augmented by generation of combinatorial deletion mutants, namely Δ lpp Δ ypo0815 , Δ lpp Δ ypo2884 , Δ lpp Δ cyoABCDE , Δ vasK Δ hcp6 , and Δ ypo2720-2733 Δ hcp3 . We earlier showed that deletion of the lpp gene, which encodes Braun lipoprotein (Lpp) and activates Toll-like receptor-2, reduced virulence of Y. pestis CO92 in murine models of bubonic and pneumonic plague. The surviving mice infected with Δ lpp Δ cyoABCDE , Δ vasK Δ hcp6 , and Δ ypo2720-2733 Δ hcp3 mutant strains were 55-100% protected upon subsequent re-challenge with wild-type CO92 in a pneumonic model. Further, evaluation of the attenuated T6SS mutant strains in vitro revealed significant alterations in phagocytosis, intracellular survival in murine macrophages, and their ability to induce cytotoxic effects on macrophages. The results reported here provide further evidence of the utility of the STM screening approach for the identification of novel virulence factors and to possibly target such genes for the development of novel live-attenuated vaccine candidates for plague.

  14. Cloning and expression of clostridium acetobutylicum ATCC 824 acetoacetyl-coenzyme A:acetate/butyrate:coenzyme A-transferase in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cary, J.W.; Petersen, D.J.; Bennett, G.N.

    1990-06-01

    Coenzyme A (CoA)-transferase (acetoacetyl-CoA:acetate/butyrate:CoA-transferase (butyrate-acetoacetate CoA-transferase) (EC 2.8.3.9)) of Clostridium acetobutylicum ATCC 824 is an important enzyme in the metabolic shift between the acid-producing and solvent-forming states of this organism. The genes encoding the two subunits of this enzyme have been cloned and subsequent subcloning experiments established the position of the structural genes for CoA-transferase. Complementation of Escherichia coli ato mutants with the recombinant plasmid pCoAT4 (pUC19 carrying a 1.8-kilobase insert of C. acetobutylicum DNA encoding CoA-transferase activity) enabled the transformants to grow on butyrate as a sole carbon source. Despite the ability of CoA-transferase to complement the ato defectmore » in E. coli mutants, Southern blot and Western blot (immunoblot) analyses showed showed that neither the C. acetobutylicum genes encoding CoA-transferase nor the enzyme itself shared any apparent homology with its E. coli counterpart. Polypeptides of M{sub r} of the purified CoA-transferase subunits were observed by Western blot and maxicell analysis of whole-cell extracts of E.coli harboring pCoAT4. The proximity and orientation of the genes suggest that the genes encoding the two subunits of CoA-transferase may form an operon similar to that found in E. coli. In the plasmid, however, transcription appears to be primarily from the lac promoter of the vector.« less

  15. Identification and Cloning of gusA, Encoding a New β-Glucuronidase from Lactobacillus gasseri ADH†

    PubMed Central

    Russell, W. M.; Klaenhammer, T. R.

    2001-01-01

    The gusA gene, encoding a new β-glucuronidase enzyme, has been cloned from Lactobacillus gasseri ADH. This is the first report of a β-glucuronidase gene cloned from a bacterial source other than Escherichia coli. A plasmid library of L. gasseri chromosomal DNA was screened for complementation of an E. coli gus mutant. Two overlapping clones that restored β-glucuronidase activity in the mutant strain were sequenced and revealed three complete and two partial open reading frames. The largest open reading frame, spanning 1,797 bp, encodes a 597-amino-acid protein that shows 39% identity to β-glucuronidase (GusA) of E. coli K-12 (EC 3.2.1.31). The other two complete open reading frames, which are arranged to be separately transcribed, encode a putative bile salt hydrolase and a putative protein of unknown function with similarities to MerR-type regulatory proteins. Overexpression of GusA was achieved in a β-glucuronidase-negative L. gasseri strain by expressing the gusA gene, subcloned onto a low-copy-number shuttle vector, from the strong Lactobacillus P6 promoter. GusA was also expressed in E. coli from a pET expression system. Preliminary characterization of the GusA protein from crude cell extracts revealed that the enzyme was active across an acidic pH range and a broad temperature range. An analysis of other lactobacilli identified β-glucuronidase activity and gusA homologs in other L. gasseri isolates but not in other Lactobacillus species tested. PMID:11229918

  16. Enterococcus faecalis utilizes maltose by connecting two incompatible metabolic routes via a novel maltose-6’-phosphate phosphatase (MapP)

    PubMed Central

    Mokhtari, Abdelhamid; Blancato, Víctor S.; Repizo, Guillermo; Henry, Céline; Pikis, Andreas; Bourand, Alexa; de Fátima Álvarez, María; Immel, Stefan; Mechakra-Maza, Aicha; Hartke, Axel; Thompson, John; Magni, Christian; Deutscher, Josef

    2013-01-01

    Summary Similar to Bacillus subtilis, Enterococcus faecalis transports and phosphorylates maltose via a phosphoenolpyruvate (PEP):maltose phosphotransferase system (PTS). The maltose-specific PTS permease is encoded by the malT gene. However, E. faecalis lacks a malA gene encoding a 6-phospho-α-glucosidase which in B. subtilis hydrolyses maltose-6’-P into glucose and glucose-6-P. Instead, an operon encoding a maltose phosphorylase (MalP), a phosphoglucomutase and a mutarotase starts upstream from malT. MalP was suggested to split maltose-6-P into glucose-1-P and glucose-6-P. However, purified MalP phosphorolyses maltose but not maltose-6’-P. We discovered that the gene downstream from malT encodes a novel enzyme (MapP) that dephosphorylates maltose-6’-P formed by the PTS. The resulting intracellular maltose is cleaved by MalP into glucose and glucose-1-P. Slow uptake of maltose probably via a maltodextrin ABC transporter allows poor growth for the mapP but not the malP mutant. Synthesis of MapP in a B. subtilis mutant accumulating maltose-6’-P restored growth on maltose. MapP catalyzes the dephosphorylation of intracellular maltose-6’-P, and the resulting maltose is converted by the B. subtilis maltose phosphorylase into glucose and glucose-1-P. MapP therefore connects PTS-mediated maltose uptake to maltose phosphorylase-catalyzed metabolism. Dephosphorylation assays with a wide variety of phospho-substrates revealed that MapP preferably dephosphorylates disaccharides containing an O-α-glycosyl linkage. PMID:23490043

  17. The Gene YALI0E20207g from Yarrowia lipolytica Encodes an N-Acetylglucosamine Kinase Implicated in the Regulated Expression of the Genes from the N-Acetylglucosamine Assimilatory Pathway

    PubMed Central

    Flores, Carmen-Lisset; Gancedo, Carlos

    2015-01-01

    The non-conventional yeast Yarrowia lipolytica possesses an ORF, YALI0E20207g, which encodes a protein with an amino acid sequence similar to hexokinases from different organisms. We have cloned that gene and determined several enzymatic properties of its encoded protein showing that it is an N-acetylglucosamine (NAGA) kinase. This conclusion was supported by the lack of growth in NAGA of a strain carrying a YALI0E20207g deletion. We named this gene YlNAG5. Expression of YlNAG5 as well as that of the genes encoding the enzymes of the NAGA catabolic pathway—identified by a BLAST search—was induced by this sugar. Deletion of YlNAG5 rendered that expression independent of the presence of NAGA in the medium and reintroduction of the gene restored the inducibility, indicating that YlNag5 participates in the transcriptional regulation of the NAGA assimilatory pathway genes. Expression of YlNAG5 was increased during sporulation and homozygous Ylnag5/Ylnag5 diploid strains sporulated very poorly as compared with a wild type isogenic control strain pointing to a participation of the protein in the process. Overexpression of YlNAG5 allowed growth in glucose of an Ylhxk1glk1 double mutant and produced, in a wild type background, aberrant morphologies in different media. Expression of the gene in a Saccharomyces cerevisiae hxk1 hxk2 glk1 triple mutant restored ability to grow in glucose. PMID:25816199

  18. MicroRNA172 plays a critical role in wheat spike morphogenesis and grain threshability

    USDA-ARS?s Scientific Manuscript database

    Wheat domestication from wild species involved mutations in the Q gene. The q allele (wild wheats) is associated with elongated spikes and hulled grains, whereas the mutant Q allele (domesticated wheats) confers subcompact spikes and free-threshing grains. Previous studies showed that Q encodes an ...

  19. Mutants of feline immunodeficiency virus resistant to 2',3'-dideoxy-2',3'-didehydrothymidine.

    PubMed Central

    Zhu, Y Q; Remington, K M; North, T W

    1996-01-01

    We selected mutants of feline immunodeficiency virus (FIV) that are resistant to 2',3'-dideoxy-2',3'-didehydrothymidine (d4T). Two mutants were selected in cultured cells with a stepwise increase in d4T concentration, resulting in mutants able to replicate in 100 microM d4T. These mutants were three- to sixfold more resistant to d4T than wild-type FIV. They were also cross-resistant to 3'-azido-3'-deoxythymidine (AZT), 3'-fluoro-2',3'-dideoxythymidine, 2',3'-dideoxycytidine, 2',3'-dideoxyinosine, and 9-(2-phosphonylmethoxyethyl)adenine, and they were highly resistant to phosphonoformic acid (PFA). Plaque-purified mutants were isolated from each of the mutant populations. The mutant phenotype was stable, because both of the plaque-purified mutants remained d4T resistant even after three passages in the absence of d4T. One of the plaque-purified mutants, designated D4R-3c, was further characterized. Compared with wild-type reverse transcriptase (RT), RT purified from D4R-3c was 3-fold resistant to inhibition by the 5'-triphosphate of d4T, 10-fold resistant to inhibition by the 5'-triphosphate of AZT, and 6-fold resistant to PFA. D4R-3c had a single point mutation in the RT-encoding region of the pol gene at position 2474, resulting in a Val to Ile mutation at codon 47 of the FIV RT. The role of this mutation in d4T resistance was confirmed by site-directed mutagenesis. PMID:8878567

  20. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    PubMed

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

  1. ChIP-Seq and RNA-Seq Reveal an AmrZ-Mediated Mechanism for Cyclic di-GMP Synthesis and Biofilm Development by Pseudomonas aeruginosa

    PubMed Central

    Jones, Christopher J.; Newsom, David; Kelly, Benjamin; Irie, Yasuhiko; Jennings, Laura K.; Xu, Binjie; Limoli, Dominique H.; Harrison, Joe J.; Parsek, Matthew R.; White, Peter; Wozniak, Daniel J.

    2014-01-01

    The transcription factor AmrZ regulates genes important for P. aeruginosa virulence, including type IV pili, extracellular polysaccharides, and the flagellum; however, the global effect of AmrZ on gene expression remains unknown, and therefore, AmrZ may directly regulate many additional genes that are crucial for infection. Compared to the wild type strain, a ΔamrZ mutant exhibits a rugose colony phenotype, which is commonly observed in variants that accumulate the intracellular second messenger cyclic diguanylate (c-di-GMP). Cyclic di-GMP is produced by diguanylate cyclases (DGC) and degraded by phosphodiesterases (PDE). We hypothesized that AmrZ limits the intracellular accumulation of c-di-GMP through transcriptional repression of gene(s) encoding a DGC. In support of this, we observed elevated c-di-GMP in the ΔamrZ mutant compared to the wild type strain. Consistent with other strains that accumulate c-di-GMP, when grown as a biofilm, the ΔamrZ mutant formed larger microcolonies than the wild-type strain. This enhanced biofilm formation was abrogated by expression of a PDE. To identify potential target DGCs, a ChIP-Seq was performed and identified regions of the genome that are bound by AmrZ. RNA-Seq experiments revealed the entire AmrZ regulon, and characterized AmrZ as an activator or repressor at each binding site. We identified an AmrZ-repressed DGC-encoding gene (PA4843) from this cohort, which we named AmrZ dependent cyclase A (adcA). PAO1 overexpressing adcA accumulates 29-fold more c-di-GMP than the wild type strain, confirming the cyclase activity of AdcA. In biofilm reactors, a ΔamrZ ΔadcA double mutant formed smaller microcolonies than the single ΔamrZ mutant, indicating adcA is responsible for the hyper biofilm phenotype of the ΔamrZ mutant. This study combined the techniques of ChIP-Seq and RNA-Seq to define the comprehensive regulon of a bifunctional transcriptional regulator. Moreover, we identified a c-di-GMP mediated mechanism for AmrZ regulation of biofilm formation and chronicity. PMID:24603766

  2. Identification of Atg2 and ArfGAP1 as Candidate Genetic Modifiers of the Eye Pigmentation Phenotype of Adaptor Protein-3 (AP-3) Mutants in Drosophila melanogaster.

    PubMed

    Rodriguez-Fernandez, Imilce A; Dell'Angelica, Esteban C

    2015-01-01

    The Adaptor Protein (AP)-3 complex is an evolutionary conserved, molecular sorting device that mediates the intracellular trafficking of proteins to lysosomes and related organelles. Genetic defects in AP-3 subunits lead to impaired biogenesis of lysosome-related organelles (LROs) such as mammalian melanosomes and insect eye pigment granules. In this work, we have performed a forward screening for genetic modifiers of AP-3 function in the fruit fly, Drosophila melanogaster. Specifically, we have tested collections of large multi-gene deletions--which together covered most of the autosomal chromosomes-to identify chromosomal regions that, when deleted in single copy, enhanced or ameliorated the eye pigmentation phenotype of two independent AP-3 subunit mutants. Fine-mapping led us to define two non-overlapping, relatively small critical regions within fly chromosome 3. The first critical region included the Atg2 gene, which encodes a conserved protein involved in autophagy. Loss of one functional copy of Atg2 ameliorated the pigmentation defects of mutants in AP-3 subunits as well as in two other genes previously implicated in LRO biogenesis, namely Blos1 and lightoid, and even increased the eye pigment content of wild-type flies. The second critical region included the ArfGAP1 gene, which encodes a conserved GTPase-activating protein with specificity towards GTPases of the Arf family. Loss of a single functional copy of the ArfGAP1 gene ameliorated the pigmentation phenotype of AP-3 mutants but did not to modify the eye pigmentation of wild-type flies or mutants in Blos1 or lightoid. Strikingly, loss of the second functional copy of the gene did not modify the phenotype of AP-3 mutants any further but elicited early lethality in males and abnormal eye morphology when combined with mutations in Blos1 and lightoid, respectively. These results provide genetic evidence for new functional links connecting the machinery for biogenesis of LROs with molecules implicated in autophagy and small GTPase regulation.

  3. A Novel fry1 Allele Reveals the Existence of a Mutant Phenotype Unrelated to 5′->3′ Exoribonuclease (XRN) Activities in Arabidopsis thaliana Roots

    PubMed Central

    Hirsch, Judith; Estavillo, Gonzalo M.; Javot, Hélène; Chiarenza, Serge; Mallory, Allison C.; Maizel, Alexis; Declerck, Marie; Pogson, Barry J.; Vaucheret, Hervé; Crespi, Martin; Desnos, Thierry; Thibaud, Marie-Christine; Nussaume, Laurent; Marin, Elena

    2011-01-01

    Background Mutations in the FRY1/SAL1 Arabidopsis locus are highly pleiotropic, affecting drought tolerance, leaf shape and root growth. FRY1 encodes a nucleotide phosphatase that in vitro has inositol polyphosphate 1-phosphatase and 3′,(2′),5′-bisphosphate nucleotide phosphatase activities. It is not clear which activity mediates each of the diverse biological functions of FRY1 in planta. Principal Findings A fry1 mutant was identified in a genetic screen for Arabidopsis mutants deregulated in the expression of Pi High affinity Transporter 1;4 (PHT1;4). Histological analysis revealed that, in roots, FRY1 expression was restricted to the stele and meristems. The fry1 mutant displayed an altered root architecture phenotype and an increased drought tolerance. All of the phenotypes analyzed were complemented with the AHL gene encoding a protein that converts 3′-polyadenosine 5′-phosphate (PAP) into AMP and Pi. PAP is known to inhibit exoribonucleases (XRN) in vitro. Accordingly, an xrn triple mutant with mutations in all three XRNs shared the fry1 drought tolerance and root architecture phenotypes. Interestingly these two traits were also complemented by grafting, revealing that drought tolerance was primarily conferred by the rosette and that the root architecture can be complemented by long-distance regulation derived from leaves. By contrast, PHT1 expression was not altered in xrn mutants or in grafting experiments. Thus, PHT1 up-regulation probably resulted from a local depletion of Pi in the fry1 stele. This hypothesis is supported by the identification of other genes modulated by Pi deficiency in the stele, which are found induced in a fry1 background. Conclusions/Significance Our results indicate that the 3′,(2′),5′-bisphosphate nucleotide phosphatase activity of FRY1 is involved in long-distance as well as local regulatory activities in roots. The local up-regulation of PHT1 genes transcription in roots likely results from local depletion of Pi and is independent of the XRNs. PMID:21304819

  4. Mapped Clone and Functional Analysis of Leaf-Color Gene Ygl7 in a Rice Hybrid (Oryza sativa L. ssp. indica)

    PubMed Central

    Deng, Xiao-juan; Zhang, Hai-qing; Wang, Yue; He, Feng; Liu, Jin-ling; Xiao, Xiao; Shu, Zhi-feng; Li, Wei; Wang, Guo-huai; Wang, Guo-liang

    2014-01-01

    Leaf-color is an effective marker to identify the hybridization of rice. Leaf-color related genes function in chloroplast development and the photosynthetic pigment biosynthesis of higher plants. The ygl7 (yellow-green leaf 7) is a mutant with spontaneous yellow-green leaf phenotype across the whole lifespan but with no change to its yield traits. We cloned gene Ygl7 (Os03g59640) which encodes a magnesium-chelatase ChlD protein. Expression of ygl7 turns green-leaves to yellow, whereas RNAi-mediated silence of Ygl7 causes a lethal phenotype of the transgenic plants. This indicates the importance of the gene for rice plant. On the other hand, it corroborates that ygl7 is a non-null mutants. The content of photosynthetic pigment is lower in Ygl7 than the wild type, but its light efficiency was comparatively high. All these results indicated that the mutational YGL7 protein does not cause a complete loss of original function but instead acts as a new protein performing a new function. This new function partially includes its preceding function and possesses an additional feature to promote photosynthesis. Chl1, Ygl98, and Ygl3 are three alleles of the OsChlD gene that have been documented previously. However, mutational sites of OsChlD mutant gene and their encoded protein products were different in the three mutants. The three mutants have suppressed grain output. In our experiment, plant materials of three mutants (ygl7, chl1, and ygl98) all exhibited mutational leaf-color during the whole growth period. This result was somewhat different from previous studies. We used ygl7 as female crossed with chl1 and ygl98, respectively. Both the F1 and F2 generation display yellow-green leaf phenotype with their chlorophyll and carotenoid content falling between the values of their parents. Moreover, we noted an important phenomenon: ygl7-NIL's leaf-color is yellow, not yellowy-green, and this is also true of all back-crossed offspring with ygl7. PMID:24932524

  5. Mapped clone and functional analysis of leaf-color gene Ygl7 in a rice hybrid (Oryza sativa L. ssp. indica).

    PubMed

    Deng, Xiao-juan; Zhang, Hai-qing; Wang, Yue; He, Feng; Liu, Jin-ling; Xiao, Xiao; Shu, Zhi-feng; Li, Wei; Wang, Guo-huai; Wang, Guo-liang

    2014-01-01

    Leaf-color is an effective marker to identify the hybridization of rice. Leaf-color related genes function in chloroplast development and the photosynthetic pigment biosynthesis of higher plants. The ygl7 (yellow-green leaf 7) is a mutant with spontaneous yellow-green leaf phenotype across the whole lifespan but with no change to its yield traits. We cloned gene Ygl7 (Os03g59640) which encodes a magnesium-chelatase ChlD protein. Expression of ygl7 turns green-leaves to yellow, whereas RNAi-mediated silence of Ygl7 causes a lethal phenotype of the transgenic plants. This indicates the importance of the gene for rice plant. On the other hand, it corroborates that ygl7 is a non-null mutants. The content of photosynthetic pigment is lower in Ygl7 than the wild type, but its light efficiency was comparatively high. All these results indicated that the mutational YGL7 protein does not cause a complete loss of original function but instead acts as a new protein performing a new function. This new function partially includes its preceding function and possesses an additional feature to promote photosynthesis. Chl1, Ygl98, and Ygl3 are three alleles of the OsChlD gene that have been documented previously. However, mutational sites of OsChlD mutant gene and their encoded protein products were different in the three mutants. The three mutants have suppressed grain output. In our experiment, plant materials of three mutants (ygl7, chl1, and ygl98) all exhibited mutational leaf-color during the whole growth period. This result was somewhat different from previous studies. We used ygl7 as female crossed with chl1 and ygl98, respectively. Both the F1 and F2 generation display yellow-green leaf phenotype with their chlorophyll and carotenoid content falling between the values of their parents. Moreover, we noted an important phenomenon: ygl7-NIL's leaf-color is yellow, not yellowy-green, and this is also true of all back-crossed offspring with ygl7.

  6. The rice GERMINATION DEFECTIVE 1, encoding a B3 domain transcriptional repressor, regulates seed germination and seedling development by integrating GA and carbohydrate metabolism

    PubMed Central

    Guo, Xiaoli; Hou, Xiaomei; Fang, Jun; Wei, Piwei; Xu, Bo; Chen, Mingluan; Feng, Yuqi; Chu, Chengcai

    2013-01-01

    It has been shown that seed development is regulated by a network of transcription factors in Arabidopsis including LEC1 (LEAFY COTYLEDON1), L1L (LEC1-like) and the B3 domain factors LEC2, FUS3 (FUSCA3) and ABI3 (ABA-INSENSITIVE3); however, molecular and genetic regulation of seed development in cereals is poorly understood. To understand seed development and seed germination in cereals, a large-scale screen was performed using our T–DNA mutant population, and a mutant germination-defective1 (gd1) was identified. In addition to the severe germination defect, the gd1 mutant also shows a dwarf phenotype and abnormal flower development. Molecular and biochemical analyses revealed that GD1 encodes a B3 domain-containing transcription factor with repression activity. Consistent with the dwarf phenotype of gd1, expression of the gibberelic acid (GA) inactivation gene OsGA2ox3 is increased dramatically, accompanied by reduced expression of GA biosynthetic genes including OsGA20ox1, OsGA20ox2 and OsGA3ox2 in gd1, resulting in a decreased endogenous GA4 level. Exogenous application of GA not only induced GD1 expression, but also partially rescued the dwarf phenotype of gd1. Furthermore, GD1 binds to the promoter of OsLFL1, a LEC2/FUS3-like gene of rice, via an RY element, leading to significant up-regulation of OsLFL1 and a large subset of seed maturation genes in the gd1 mutant. Plants over-expressing OsLFL1 partly mimic the gd1 mutant. In addition, expression of GD1 was induced under sugar treatment, and the contents of starch and soluble sugar are altered in the gd1 mutant. These data indicate that GD1 participates directly or indirectly in regulating GA and carbohydrate homeostasis, and further regulates rice seed germination and seedling development. PMID:23581288

  7. CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula.

    PubMed

    Curtin, Shaun J; Xiong, Yer; Michno, Jean-Michel; Campbell, Benjamin W; Stec, Adrian O; Čermák, Tomas; Starker, Colby; Voytas, Daniel F; Eamens, Andrew L; Stupar, Robert M

    2018-06-01

    Processing of double-stranded RNA precursors into small RNAs is an essential regulator of gene expression in plant development and stress response. Small RNA processing requires the combined activity of a functionally diverse group of molecular components. However, in most of the plant species, there are insufficient mutant resources to functionally characterize each encoding gene. Here, mutations in loci encoding protein machinery involved in small RNA processing in soya bean and Medicago truncatula were generated using the CRISPR/Cas9 and TAL-effector nuclease (TALEN) mutagenesis platforms. An efficient CRISPR/Cas9 reagent was used to create a bi-allelic double mutant for the two soya bean paralogous Double-stranded RNA-binding2 (GmDrb2a and GmDrb2b) genes. These mutations, along with a CRISPR/Cas9-generated mutation of the M. truncatula Hua enhancer1 (MtHen1) gene, were determined to be germ-line transmissible. Furthermore, TALENs were used to generate a mutation within the soya bean Dicer-like2 gene. CRISPR/Cas9 mutagenesis of the soya bean Dicer-like3 gene and the GmHen1a gene was observed in the T 0 generation, but these mutations failed to transmit to the T 1 generation. The irregular transmission of induced mutations and the corresponding transgenes was investigated by whole-genome sequencing to reveal a spectrum of non-germ-line-targeted mutations and multiple transgene insertion events. Finally, a suite of combinatorial mutant plants were generated by combining the previously reported Gmdcl1a, Gmdcl1b and Gmdcl4b mutants with the Gmdrb2ab double mutant. Altogether, this study demonstrates the synergistic use of different genome engineering platforms to generate a collection of useful mutant plant lines for future study of small RNA processing in legume crops. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. Biosynthesis of branched-chain amino acids is essential for effective symbioses between betarhizobia and Mimosa pudica.

    PubMed

    Chen, Wen-Ming; Prell, Jurgen; James, Euan K; Sheu, Der-Shyan; Sheu, Shih-Yi

    2012-07-01

    Burkholderia phymatum STM815 and Cupriavidus taiwanensis LMG19424 are betaproteobacterial strains that can effectively nodulate several species of the large legume genus Mimosa. A Tn5 mutant, derived from B. phymatum STM815 (KM60), and another derived from C. taiwanensis LMG19424 (KM184-55) induced Fix(-) nodules on Mimosa pudica. The Tn5-interrupted genes of the mutants showed strong homologies to ilvE, which encodes a branched-chain amino acid aminotransferase, and leuC, which encodes the large subunit of isopropylmalate isomerase. Both enzymes are known to be involved in the biosynthetic pathways for branched-chain amino acids (BCAAs) (leucine, valine and isoleucine). The B. phymatum ilvE mutant, KM60, was not auxotrophic for BCAAs and could grow well on minimal medium with pyruvate as a carbon source and ammonia as a nitrogen source. However, it grew less efficiently than the wild-type (WT) strain when ammonia was substituted with valine or isoleucine as a nitrogen source. The BCAA aminotransferase activity of KM60 was significantly reduced relative to the WT strain, especially with isoleucine and valine as amino group donors. The C. taiwanensis leuC mutant, KM184-55, could not grow on a minimal medium with pyruvate as a carbon source and ammonia as a nitrogen source, but its growth was restored when leucine was added to the medium. The isopropylmalate isomerase activity of KM184-55 was completely lost compared with the WT strain. Both mutants recovered their respective enzyme activities after complementation with the WT ilvE or leuC genes and were subsequently able to grow as well as their parental strains on minimal medium. They were also able to form nitrogen-fixing nodules on M. pudica. We conclude that the biosynthesis of BCAAs is essential for the free-living growth of betarhizobia, as well as for their ability to form effective symbioses with their host plant.

  9. Light Regulation of Swarming Motility in Pseudomonas syringae Integrates Signaling Pathways Mediated by a Bacteriophytochrome and a LOV Protein

    PubMed Central

    Wu, Liang; McGrane, Regina S.; Beattie, Gwyn A.

    2013-01-01

    ABSTRACT The biological and regulatory roles of photosensory proteins are poorly understood for nonphotosynthetic bacteria. The foliar bacterial pathogen Pseudomonas syringae has three photosensory protein-encoding genes that are predicted to encode the blue-light-sensing LOV (light, oxygen, or voltage) histidine kinase (LOV-HK) and two red/far-red-light-sensing bacteriophytochromes, BphP1 and BphP2. We provide evidence that LOV-HK and BphP1 form an integrated network that regulates swarming motility in response to multiple light wavelengths. The swarming motility of P. syringae B728a deletion mutants indicated that LOV-HK positively regulates swarming motility in response to blue light and BphP1 negatively regulates swarming motility in response to red and far-red light. BphP2 does not detectably regulate swarming motility. The histidine kinase activity of each LOV-HK and BphP1 is required for this regulation based on the loss of complementation upon mutation of residues key to their kinase activity. Surprisingly, mutants lacking both lov and bphP1 were similar in motility to a bphP1 single mutant in blue light, indicating that the loss of bphP1 is epistatic to the loss of lov and also that BphP1 unexpectedly responds to blue light. Moreover, whereas expression of bphP1 did not alter motility under blue light in a bphP1 mutant, it reduced motility in a mutant lacking lov and bphP1, demonstrating that LOV-HK positively regulates motility by suppressing negative regulation by BphP1. These results are the first to show cross talk between the LOV protein and phytochrome signaling pathways in bacteria, and the similarity of this regulatory network to that of photoreceptors in plants suggests a possible common ancestry. PMID:23760465

  10. Calcineurin plays key roles in the dimorphic transition and virulence of the human pathogenic zygomycete Mucor circinelloides.

    PubMed

    Lee, Soo Chan; Li, Alicia; Calo, Silvia; Heitman, Joseph

    2013-01-01

    Many pathogenic fungi are dimorphic and switch between yeast and filamentous states. This switch alters host-microbe interactions and is critical for pathogenicity. However, in zygomycetes, whether dimorphism contributes to virulence is a central unanswered question. The pathogenic zygomycete Mucor circinelloides exhibits hyphal growth in aerobic conditions but switches to multi-budded yeast growth under anaerobic/high CO₂ conditions. We found that in the presence of the calcineurin inhibitor FK506, Mucor exhibits exclusively multi-budded yeast growth. We also found that M. circinelloides encodes three calcineurin catalytic A subunits (CnaA, CnaB, and CnaC) and one calcineurin regulatory B subunit (CnbR). Mutations in the latch region of CnbR and in the FKBP12-FK506 binding domain of CnaA result in hyphal growth of Mucor in the presence of FK506. Disruption of the cnbR gene encoding the sole calcineurin B subunit necessary for calcineurin activity yielded mutants locked in permanent yeast phase growth. These findings reveal that the calcineurin pathway plays key roles in the dimorphic transition from yeast to hyphae. The cnbR yeast-locked mutants are less virulent than the wild-type strain in a heterologous host system, providing evidence that hyphae or the yeast-hyphal transition are linked to virulence. Protein kinase A activity (PKA) is elevated during yeast growth under anaerobic conditions, in the presence of FK506, or in the yeast-locked cnbR mutants, suggesting a novel connection between PKA and calcineurin. cnaA mutants lacking the CnaA catalytic subunit are hypersensitive to calcineurin inhibitors, display a hyphal polarity defect, and produce a mixture of yeast and hyphae in aerobic culture. The cnaA mutants also produce spores that are larger than wild-type, and spore size is correlated with virulence potential. Our results demonstrate that the calcineurin pathway orchestrates the yeast-hyphal and spore size dimorphic transitions that contribute to virulence of this common zygomycete fungal pathogen.

  11. Mutations in Genes Involved in the Flagellar Export Apparatus of the Solvent-Tolerant Pseudomonas putida DOT-T1E Strain Impair Motility and Lead to Hypersensitivity to Toluene Shocks

    PubMed Central

    Segura, Ana; Duque, Estrella; Hurtado, Ana; Ramos, Juan L.

    2001-01-01

    Pseudomonas putida DOT-T1E is a solvent-tolerant strain able to grow in the presence of 1% (vol/vol) toluene in the culture medium. Random mutagenesis with mini-Tn5-′phoA-Km allowed us to isolate a mutant strain (DOT-T1E-42) that formed blue colonies on Luria-Bertani medium supplemented with 5-bromo-4-chloro-3-indolylphosphate and that, in contrast to the wild-type strain, was unable to tolerate toluene shocks (0.3%, vol/vol). The mutant strain exhibited patterns of tolerance or sensitivity to a number of antibiotics, detergents, and chelating agents similar to those of the wild-type strain. The mutation in this strain therefore seemed to specifically affect toluene tolerance. Cloning and sequencing of the mutation revealed that the mini-Tn5-′phoA-Km was inserted within the fliP gene, which is part of the fliLMNOPQRflhBA cluster, a set of genes that encode flagellar structure components. FliP is involved in the export of flagellar proteins, and in fact, the P. putida fliP mutant was nonmotile. The finding that, after replacing the mutant allele with the wild-type one, the strain recovered the wild-type pattern of toluene tolerance and motility unequivocally assigned FliP a function in solvent resistance. An flhB knockout mutant, another gene component of the flagellar export apparatus, was also nonmotile and hypersensitive to toluene. In contrast, a nonpolar mutation at the fliL gene, which encodes a cytoplasmic membrane protein associated with the flagellar basal body, yielded a nonmotile yet toluene-resistant strain. The results are discussed regarding a possible role of the flagellar export apparatus in the transport of one or more proteins necessary for toluene tolerance in P. putida DOT-T1E to the periplasm. PMID:11418551

  12. EPHA2 MUTATIONS CONTRIBUTE TO CONGENITAL CATARACT THROUGH DIVERSE MECHANISMS.

    PubMed

    Dave, Alpana; Martin, Sarah; Kumar, Raman; Craig, Jamie E; Burdon, Kathryn P; Sharma, Shiwani

    2016-01-01

    Congenital cataract is a leading cause of childhood blindness. Mutations in the EPHA2 gene are one of the causes of inherited congenital cataract. The EPHA2 gene encodes a membrane-bound tyrosine kinase receptor and is highly expressed in epithelial cells, including in the ocular lens. Signaling through the EPHA2 receptor plays a pivotal role in epithelial cell homeostasis. The aim of this study was to determine the effect of congenital cataract causing mutations in the EPHA2 gene on the encoded protein in epithelial cells. The effect of five disease-causing mutations, p.P584L (c.1751C>T), p.T940I (c.2819C>T), p.D942fsXC71 (c.2826-9G>A), p.A959T (c.2875G>A), and p.V972GfsX39 (c.2915_2916delTG), on localization of the protein was examined in two in vitro epithelial cell culture systems: Madin-Darby Canine Kidney (MDCK) and human colorectal adenocarcinoma (Caco-2) epithelial cells. Myc-tagged mutant constructs were generated by polymerase chain reaction (PCR)-based mutagenesis. The Myc-tagged wild-type construct was used as a control. The Myc-tagged wild-type and mutant proteins were ectopically expressed and detected by immunofluorescence labeling. Two of the mutations, p.T940I and p.D942fsXC71, located within the cytoplasmic sterile-α-motif (SAM) domain of EPHA2, led to mis-localization of the protein to the perinuclear space and co-localization with the cis-golgi apparatus, indicating sub-organellar/cellular retention of the mutant proteins. The mutant proteins carrying the remaining three mutations, similar to the wild-type EPHA2, localized to the cell membrane. Mis-localization of two of the mutant proteins in epithelial cells suggests that some disease-causing mutations in EPHA2 likely affect lens epithelial cell homeostasis and contribute to cataract. This study suggests that mutations in EPHA2 contribute to congenital cataract through diverse mechanisms.

  13. Mutation of adjacent cysteine residues in the NSs protein of Rift Valley fever virus results in loss of virulence in mice.

    PubMed

    Monteiro, Gaby E R; Jansen van Vuren, Petrus; Wichgers Schreur, Paul J; Odendaal, Lieza; Clift, Sarah J; Kortekaas, Jeroen; Paweska, Janusz T

    2018-04-02

    The NSs protein encoded by the S segment of Rift Valley fever virus (RVFV) is the major virulence factor, counteracting the host innate antiviral defence. It contains five highly conserved cysteine residues at positions 39, 40, 149, 178 and 194, which are thought to stabilize the tertiary and quaternary structure of the protein. Here, we report significant differences between clinical, virological, histopathological and host gene responses in BALB/c mice infected with wild-type RVFV (wtRVFV) or a genetic mutant having a double cysteine-to-serine substitution at residues 39 and 40 of the NSs protein (RVFV-C39S/C40S). Mice infected with the wtRVFV developed a fatal acute disease; characterized by high levels of viral replication, severe hepatocellular necrosis, and massive up-regulation of transcription of genes encoding type I and -II interferons (IFN) as well as pro-apoptotic and pro-inflammatory cytokines. The RVFV-C39S/C40S mutant did not cause clinical disease and its attenuated virulence was consistent with virological, histopathological and host gene expression findings in BALB/c mice. Clinical signs in mice infected with viruses containing cysteine-to-serine substitutions at positions 178 or 194 were similar to those occurring in mice infected with the wtRVFV, while a mutant containing a substitution at position 149 caused mild, non-fatal disease in mice. As mutant RVFV-C39S/C40S showed an attenuated phenotype in mice, the molecular mechanisms behind this attenuation were further investigated. The results show that two mechanisms are responsible for the attenuation; (1) loss of the IFN antagonistic propriety characteristic of the wtRVFV NSs and (2) the inability of the attenuated mutant to degrade Proteine Kinase R (PKR). Copyright © 2018. Published by Elsevier B.V.

  14. Alteration of cell wall xylan acetylation triggers defense responses that counterbalance the immune deficiencies of plants impaired in the β-subunit of the heterotrimeric G-protein.

    PubMed

    Escudero, Viviana; Jordá, Lucía; Sopeña-Torres, Sara; Mélida, Hugo; Miedes, Eva; Muñoz-Barrios, Antonio; Swami, Sanjay; Alexander, Danny; McKee, Lauren S; Sánchez-Vallet, Andrea; Bulone, Vincent; Jones, Alan M; Molina, Antonio

    2017-11-01

    Arabidopsis heterotrimeric G-protein complex modulates pathogen-associated molecular pattern-triggered immunity (PTI) and disease resistance responses to different types of pathogens. It also plays a role in plant cell wall integrity as mutants impaired in the Gβ- (agb1-2) or Gγ-subunits have an altered wall composition compared with wild-type plants. Here we performed a mutant screen to identify suppressors of agb1-2 (sgb) that restore susceptibility to pathogens to wild-type levels. Out of the four sgb mutants (sgb10-sgb13) identified, sgb11 is a new mutant allele of ESKIMO1 (ESK1), which encodes a plant-specific polysaccharide O-acetyltransferase involved in xylan acetylation. Null alleles (sgb11/esk1-7) of ESK1 restore to wild-type levels the enhanced susceptibility of agb1-2 to the necrotrophic fungus Plectosphaerella cucumerina BMM (PcBMM), but not to the bacterium Pseudomonas syringae pv. tomato DC3000 or to the oomycete Hyaloperonospora arabidopsidis. The enhanced resistance to PcBMM of the agb1-2 esk1-7 double mutant was not the result of the re-activation of deficient PTI responses in agb1-2. Alteration of cell wall xylan acetylation caused by ESK1 impairment was accompanied by an enhanced accumulation of abscisic acid, the constitutive expression of genes encoding antibiotic peptides and enzymes involved in the biosynthesis of tryptophan-derived metabolites, and the accumulation of disease resistance-related secondary metabolites and different osmolites. These esk1-mediated responses counterbalance the defective PTI and PcBMM susceptibility of agb1-2 plants, and explain the enhanced drought resistance of esk1 plants. These results suggest that a deficient PTI-mediated resistance is partially compensated by the activation of specific cell-wall-triggered immune responses. © 2017 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  15. The Chromatin Remodeler SPLAYED Negatively Regulates SNC1-Mediated Immunity.

    PubMed

    Johnson, Kaeli C M; Xia, Shitou; Feng, Xiaoqi; Li, Xin

    2015-08-01

    SNC1 (SUPPRESSOR OF NPR1, CONSTITUTIVE 1) is one of a suite of intracellular Arabidopsis NOD-like receptor (NLR) proteins which, upon activation, result in the induction of defense responses. However, the molecular mechanisms underlying NLR activation and the subsequent provocation of immune responses are only partially characterized. To identify negative regulators of NLR-mediated immunity, a forward genetic screen was undertaken to search for enhancers of the dwarf, autoimmune gain-of-function snc1 mutant. To avoid lethality resulting from severe dwarfism, the screen was conducted using mos4 (modifier of snc1, 4) snc1 plants, which display wild-type-like morphology and resistance. M2 progeny were screened for mutant, snc1-enhancing (muse) mutants displaying a reversion to snc1-like phenotypes. The muse9 mos4 snc1 triple mutant was found to exhibit dwarf morphology, elevated expression of the pPR2-GUS defense marker reporter gene and enhanced resistance to the oomycete pathogen Hyaloperonospora arabidopsidis Noco2. Via map-based cloning and Illumina sequencing, it was determined that the muse9 mutation is in the gene encoding the SWI/SNF chromatin remodeler SYD (SPLAYED), and was thus renamed syd-10. The syd-10 single mutant has no observable alteration from wild-type-like resistance, although the syd-4 T-DNA insertion allele displays enhanced resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326. Transcription of SNC1 is increased in both syd-4 and syd-10. These data suggest that SYD plays a subtle, specific role in the regulation of SNC1 expression and SNC1-mediated immunity. SYD may work with other proteins at the chromatin level to repress SNC1 transcription; such regulation is important for fine-tuning the expression of NLR-encoding genes to prevent unpropitious autoimmunity. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Sialidases affect the host cell adherence and epsilon toxin-induced cytotoxicity of Clostridium perfringens type D strain CN3718.

    PubMed

    Li, Jihong; Sayeed, Sameera; Robertson, Susan; Chen, Jianming; McClane, Bruce A

    2011-12-01

    Clostridium perfringens type B or D isolates, which cause enterotoxemias or enteritis in livestock, produce epsilon toxin (ETX). ETX is exceptionally potent, earning it a listing as a CDC class B select toxin. Most C. perfringens strains also express up to three different sialidases, although the possible contributions of those enzymes to type B or D pathogenesis remain unclear. Type D isolate CN3718 was found to carry two genes (nanI and nanJ) encoding secreted sialidases and one gene (nanH) encoding a cytoplasmic sialidase. Construction in CN3718 of single nanI, nanJ and nanH null mutants, as well as a nanI/nanJ double null mutant and a triple sialidase null mutant, identified NanI as the major secreted sialidase of this strain. Pretreating MDCK cells with NanI sialidase, or with culture supernatants of BMC206 (an isogenic CN3718 etx null mutant that still produces sialidases) enhanced the subsequent binding and cytotoxic effects of purified ETX. Complementation of BMC207 (an etx/nanH/nanI/nanJ null mutant) showed this effect is mainly attributable to NanI production. Contact between BMC206 and certain mammalian cells (e.g., enterocyte-like Caco-2 cells) resulted in more rapid sialidase production and this effect involved increased transcription of BMC206 nanI gene. BMC206 was shown to adhere to some (e.g. Caco-2 cells), but not all mammalian cells, and this effect was dependent upon sialidase, particularly NanI, expression. Finally, the sialidase activity of NanI (but not NanJ or NanH) could be enhanced by trypsin. Collectively these in vitro findings suggest that, during type D disease originating in the intestines, trypsin may activate NanI, which (in turn) could contribute to intestinal colonization by C. perfringens type D isolates and also increase ETX action.

  17. Bm-muted, orthologous to mouse muted and encoding a subunit of the BLOC-1 complex, is responsible for the otm translucent mutation of the silkworm Bombyx mori.

    PubMed

    Zhang, Haokun; Kiuchi, Takashi; Wang, Lingyan; Kawamoto, Munetaka; Suzuki, Yutaka; Sugano, Sumio; Banno, Yutaka; Katsuma, Susumu; Shimada, Toru

    2017-09-20

    "Tanaka's mottled translucent" (otm) is a mutation of the silkworm Bombyx mori that exhibits translucent skin during larval stages. We performed positional cloning of the gene responsible for otm and mapped it to a 364-kb region on chromosome 5 that contains 22 hypothetical protein-coding genes. We performed RNA-seq analysis of the epidermis and fat body of otm larvae and determined that the gene BGIBMGA002619 may be responsible for the otm mutation. BGIBMGA002619 encodes the biosynthesis of lysosome-related organelles complex 1 (BLOC-1) subunit 5, whose ortholog is responsible for the Muted mutant in mouse. Accordingly, we named this gene Bm-muted. We discovered that the expression of Bm-muted in the epidermis and fat body of otm mutants was dramatically suppressed compared with the wild type. We determined the nucleotide sequences of the full-length cDNA and genomic region corresponding to Bm-muted and found that a 538-bp long DNA sequence similar to B. mori transposon Organdy was inserted into the 3' end of the first intron of Bm-muted in two otm strains. The Bm-muted cDNA of otm mutants lacked exon 2, and accordingly generated a premature stop codon in exon 3. In addition, short interfering RNA (siRNA)-mediated knockdown of this gene caused localized partial translucency of larval skin. These data indicate that the mutation in Bm-muted caused the otm-mutant phenotype. We propose that the insertion of Organdy caused a splicing disorder in Bm-muted in the otm mutant, resulting in a null mutation of Bm-muted. This mutation is likely to cause deficiencies in urate granule formation in epidermal cells that result in translucent larval skin. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Secreted Citrate Serves as Iron Carrier for the Marine Pathogen Photobacterium damselae subsp damselae

    PubMed Central

    Balado, Miguel; Puentes, Beatriz; Couceiro, Lucía; Fuentes-Monteverde, Juan C.; Rodríguez, Jaime; Osorio, Carlos R.; Jiménez, Carlos; Lemos, Manuel L.

    2017-01-01

    Photobacterium damselae subsp damselae (Pdd) is a Vibrionaceae that has a wide pathogenic potential against many marine animals and also against humans. Some strains of this bacterium acquire iron through the siderophore vibrioferrin. However, there are virulent strains that do not produce vibrioferrin, but they still give a strong positive reaction in the CAS test for siderophore production. In an in silico search on the genome sequences of this type of strains we could not find any ORF which could be related to a siderophore system. To identify genes that could encode a siderophore-mediated iron acquisition system we used a mini-Tn10 transposon random mutagenesis approach. From more than 1,400 mutants examined, we could isolate a mutant (BP53) that showed a strong CAS reaction independently of the iron levels of the medium. In this mutant the transposon was inserted into the idh gene, which encodes an isocitrate dehydrogenase that participates in the tricarboxylic acid cycle. The mutant did not show any growth impairment in rich or minimal media, but it accumulated a noticeable amount of citrate (around 7 mM) in the culture medium, irrespective of the iron levels. The parental strain accumulated citrate, but in an iron-regulated fashion, being citrate levels 5–6 times higher under iron restricted conditions. In addition, a null mutant deficient in citrate synthase showed an impairment for growth at high concentrations of iron chelators, and showed almost no reaction in the CAS test. Chemical analysis by liquid chromatography of the iron-restricted culture supernatants resulted in a CAS-positive fraction with biological activity as siderophore. HPLC purification of that fraction yielded a pure compound which was identified as citrate from its MS and NMR spectral data. Although the production of another citrate-based compound with siderophore activity cannot be ruled out, our results suggest that Pdd secretes endogenous citrate and use it for iron scavenging from the cell environment. PMID:28848719

  19. Characterization of the Bacillus stearothermophilus manganese superoxide dismutase gene and its ability to complement copper/zinc superoxide dismutase deficiency in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowler, C.; Inze, D.; Van Camp, W.

    1990-03-01

    Recombinant clones containing the manganese superoxide dismutase (MnSOD) gene of Bacillus stearothermophilus were isolated with an oligonucleotide probe designed to match a part of the previously determined amino acid sequence. Complementation analyses, performed by introducing each plasmid into a superoxide dismutase-deficient mutant of Escherichia coli, allowed us to define the region of DNA which encodes the MnSOD structural gene and to identify a promoter region immediately upstream from the gene. These data were subsequently confirmed by DNA sequencing. Since MnSOD is normally restricted to the mitochondria in eucaryotes, we were interested (i) in determining whether B. stearothermophilus MnSOD could functionmore » in eucaryotic cytosol and (ii) in determining whether MnSOD could replace the structurally unrelated copper/zinc superoxide dismutase (Cu/ZnSOD) which is normally found there. To test this, the sequence encoding bacterial MnSOD was cloned into a yeast expression vector and subsequently introduced into a Cu/ZnSOD-deficient mutant of the yeast Saccharomyces cerevisiae. Functional expression of the protein was demonstrated, and complementation tests revealed that the protein was able to provide tolerance at wild-type levels to conditions which are normally restrictive for this mutant. Thus, in spite of the evolutionary unrelatedness of these two enzymes, Cu/ZnSOD can be functionally replaced by MnSOD in yeast cytosol.« less

  20. The maize lilliputian1 (lil1) gene, encoding a brassinosteroid cytochrome P450 C-6 oxidase, is involved in plant growth and drought response.

    PubMed

    Castorina, Giulia; Persico, Martina; Zilio, Massimo; Sangiorgio, Stefano; Carabelli, Laura; Consonni, Gabriella

    2018-05-16

    Brassinosteroids (BRs) are plant hormones involved in many developmental processes as well as in plant-environment interactions. Their role was investigated in this study through the analysis of lilliputian1-1 (lil1-1), a dwarf mutant impaired in BR biosynthesis in maize (Zea mays). We isolated lil1-1 through transposon tagging in maize. The action of lil1 was investigated through morphological and genetic analysis. Moreover, by comparing lil1-1 mutant and wild-type individuals grown under drought stress, the effect of BR reduction on the response to drought stress was examined. lil1-1 is a novel allele of the brassinosteroid-deficient dwarf1 (brd1) gene, encoding a brassinosteroid C-6 oxidase. We show in this study that lil1 is epistatic to nana plant1 (na1), a BR gene involved in earlier steps of the pathway. The lill-1 mutation causes alteration in the root gravitropic response, leaf epidermal cell density, epicuticular wax deposition and seedling adaptation to water scarcity conditions. Lack of active BR molecules in maize causes a pleiotropic effect on plant development and improves seedling tolerance of drought. BR-deficient maize mutants can thus be instrumental in unravelling novel mechanisms on which plant adaptations to abiotic stress are based.

  1. Multiple ABC glucoside transporters mediate sugar-stimulated growth in the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120.

    PubMed

    Nieves-Morión, Mercedes; Flores, Enrique

    2018-02-01

    Cyanobacteria are generally capable of photoautotrophic growth and are widely distributed on Earth. The model filamentous, heterocyst-forming strain Anabaena sp. PCC 7120 has long been considered as a strict photoautotroph but is now known to be able to assimilate fructose. We have previously described two components of ABC glucoside uptake transporters from Anabaena that are involved in uptake of the sucrose analog esculin: GlsC [a nucleotide-binding domain subunit (NBD)] and GlsP [a transmembrane component (TMD)]. Here, we created Anabaena mutants of genes encoding three further ABC transporter components needed for esculin uptake: GlsD (NBD), GlsQ (TMD) and GlsR (periplasmic substrate-binding protein). Phototrophic growth of Anabaena was significantly stimulated by sucrose, fructose and glucose. Whereas the glsC and glsD mutants were drastically hampered in sucrose-stimulated growth, the different gls mutants were generally impaired in sugar-dependent growth. Our results suggest the participation of Gls and other ABC transporters encoded in the Anabaena genome in sugar-stimulated growth. Additionally, Gls transporter components influence the function of septal junctions in the Anabaena filament. We suggest that mixotrophic growth is important in cyanobacterial physiology and may be relevant for the wide success of these organisms in diverse environments. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. tRNA nuclear export in saccharomyces cerevisiae: in situ hybridization analysis.

    PubMed

    Sarkar, S; Hopper, A K

    1998-11-01

    To understand the factors specifically affecting tRNA nuclear export, we adapted in situ hybridization procedures to locate endogenous levels of individual tRNA families in wild-type and mutant yeast cells. Our studies of tRNAs encoded by genes lacking introns show that nucleoporin Nup116p affects both poly(A) RNA and tRNA export, whereas Nup159p affects only poly(A) RNA export. Los1p is similar to exportin-t, which facilitates vertebrate tRNA export. A los1 deletion mutation affects tRNA but not poly(A) RNA export. The data support the notion that Los1p and exportin-t are functional homologues. Because LOS1 is nonessential, tRNA export in vertebrate and yeast cells likely involves factors in addition to exportin-t. Mutation of RNA1, which encodes RanGAP, causes nuclear accumulation of tRNAs and poly(A) RNA. Many yeast mutants, including those with the rna1-1 mutation, affect both pre-tRNA splicing and RNA export. Our studies of the location of intron-containing pre-tRNAs in the rna1-1 mutant rule out the possibility that this results from tRNA export occurring before splicing. Our results also argue against inappropriate subnuclear compartmentalization causing defects in pre-tRNA splicing. Rather, the data support "feedback" of nucleus/cytosol exchange to the pre-tRNA splicing machinery.

  3. tRNA Nuclear Export in Saccharomyces cerevisiae: In Situ Hybridization Analysis

    PubMed Central

    Sarkar, Srimonti; Hopper, Anita K.

    1998-01-01

    To understand the factors specifically affecting tRNA nuclear export, we adapted in situ hybridization procedures to locate endogenous levels of individual tRNA families in wild-type and mutant yeast cells. Our studies of tRNAs encoded by genes lacking introns show that nucleoporin Nup116p affects both poly(A) RNA and tRNA export, whereas Nup159p affects only poly(A) RNA export. Los1p is similar to exportin-t, which facilitates vertebrate tRNA export. A los1 deletion mutation affects tRNA but not poly(A) RNA export. The data support the notion that Los1p and exportin-t are functional homologues. Because LOS1 is nonessential, tRNA export in vertebrate and yeast cells likely involves factors in addition to exportin-t. Mutation of RNA1, which encodes RanGAP, causes nuclear accumulation of tRNAs and poly(A) RNA. Many yeast mutants, including those with the rna1-1 mutation, affect both pre-tRNA splicing and RNA export. Our studies of the location of intron-containing pre-tRNAs in the rna1-1 mutant rule out the possibility that this results from tRNA export occurring before splicing. Our results also argue against inappropriate subnuclear compartmentalization causing defects in pre-tRNA splicing. Rather, the data support “feedback” of nucleus/cytosol exchange to the pre-tRNA splicing machinery. PMID:9802895

  4. Organization of K88ac-encoded polypeptides in the Escherichia coli cell envelope: use of minicells and outer membrane protein mutants for studying assembly of pili.

    PubMed

    Dougan, G; Dowd, G; Kehoe, M

    1983-01-01

    Escherichia coli K-12 minicells, harboring recombinant plasmids encoding polypeptides involved in the expression of K88ac adhesion pili on the bacterial cell surface, were labeled with [35S]methionine and fractionated by a variety of techniques. A 70,000-dalton polypeptide, the product of the K88ac adhesion cistron adhA, was primarily located in the outer membrane of minicells, although it was less clearly associated with this membrane than the classical outer membrane proteins OmpA and matrix protein. Two polypeptides of molecular weights 26,000 and 17,000 (the products of adhB and adhC, respectively) were located in significant amounts in the periplasmic space. The 29,000-dalton polypeptide was shown to be processed in E. coli minicells. The 23.500-dalton K88ac pilus subunit (the product of adhD) was detected in both inner and outer membrane fractions. E. coli mutants defective in the synthesis of murein lipoprotein or the major outer membrane polypeptide OmpA were found to express normal amounts of K88ac antigen on the cell surface, whereas expression of the K88ac antigen was greatly reduced in perA mutants. The possible functions of the adh cistron products are discussed.

  5. Arabidopsis LEAFY COTYLEDON1 controls cell fate determination during post-embryonic development

    PubMed Central

    Huang, Mingkun; Hu, Yilong; Liu, Xu; Li, Yuge; Hou, Xingliang

    2015-01-01

    Arabidopsis LEAFY COTYLEDON1 (LEC1) transcription factor is a master regulator that shapes plant embryo development and post-embryonic seedling establishment. Loss-of-function of LEC1 alters the cotyledon identity, causing the formation of ectopic trichomes, which does not occur in wild-type seedlings, implying that LEC1 might regulate embryonic cell fate determination during post-embryonic development. To test this hypothesis, we compared the expression of trichome development-related genes between the wild-type and the lec1 mutant. We observed that transcripts of GLABROUS1 (GL1), GL2, and GL3, genes encoding the positive regulators in trichome development, were significantly upregulated, while the TRICHOMELESS1 (TCL2), ENHANCER OF TRY AND CPC1 (ETC1), and ETC2 genes, encoding the negative regulators in trichome development, were downregulated in the lec1 mutant. Furthermore, overexpression of LEC1 activated the expressions of TCL2, CAPPICE (CPC), and ETC1, resulting in production of cotyledonary leaves with no or fewer trichomes during vegetative development. In addition, we demonstrated that LEC1 interacts with TCL2 in yeast and in vitro. A genetic experiment showed that loss-of-function of GL2 rescued the ectopic trichome formation in the lec1 mutant. These findings strongly support that LEC1 regulates trichome development, providing direct evidence for the role of LEC1 in cell fate determination during post-embryonic development. PMID:26579186

  6. Intrajugular Vein Delivery of AAV9-RNAi Prevents Neuropathological Changes and Weight Loss in Huntington's Disease Mice

    PubMed Central

    Dufour, Brett D; Smith, Catherine A; Clark, Randall L; Walker, Timothy R; McBride, Jodi L

    2014-01-01

    Huntington's disease (HD) is a fatal neurological disorder caused by a CAG repeat expansion in the HTT gene, which encodes a mutant huntingtin protein (mHTT). The mutation confers a toxic gain of function on huntingtin, leading to widespread neurodegeneration and inclusion formation in many brain regions. Although the hallmark symptom of HD is hyperkinesia stemming from striatal degeneration, several other brain regions are affected which cause psychiatric, cognitive, and metabolic symptoms. Additionally, mHTT expression in peripheral tissue is associated with skeletal muscle atrophy, cardiac failure, weight loss, and diabetes. We, and others, have demonstrated a prevention of motor symptoms in HD mice following direct striatal injection of adeno-associated viral vector (AAV) serotype 1 encoding an RNA interference (RNAi) construct targeting mutant HTT mRNA (mHTT). Here, we expand these efforts and demonstrate that an intrajugular vein injection of AAV serotype 9 (AAV9) expressing a mutant HTT-specific RNAi construct significantly reduced mHTT expression in multiple brain regions and peripheral tissues affected in HD. Correspondingly, this approach prevented atrophy and inclusion formation in key brain regions as well as the severe weight loss germane to HD transgenic mice. These results demonstrate that systemic delivery of AAV9-RNAi may provide more widespread clinical benefit for patients suffering from HD. PMID:24390280

  7. The TRANSPARENT TESTA16 Locus Encodes the ARABIDOPSIS BSISTER MADS Domain Protein and Is Required for Proper Development and Pigmentation of the Seed Coat

    PubMed Central

    Nesi, Nathalie; Debeaujon, Isabelle; Jond, Clarisse; Stewart, Amanda J.; Jenkins, Gareth I.; Caboche, Michel; Lepiniec, Loïc

    2002-01-01

    Screening for seed pigmentation phenotypes in Arabidopsis led to the isolation of three allelic yellow-seeded mutants, which defined the novel TRANSPARENT TESTA16 (TT16) locus. Cloning of TT16 was performed by T-DNA tagging and confirmed by genetic complementation and sequencing of two mutant alleles. TT16 encodes the ARABIDOPSIS BSISTER (ABS) MADS domain protein. ABS belongs to the recently identified “B-sister” (BS) clade, which contains genes of unknown function that are expressed mainly in female organs. Phylogenetic analyses using a maximum parsimony approach confirmed that TT16/ABS and related proteins form a monophyletic group. TT16/ABS was expressed mainly in the ovule, as are the other members of the BS clade. TT16/ABS is necessary for BANYULS expression and proanthocyanidin accumulation in the endothelium of the seed coat, with the exception of the chalazal-micropylar area. In addition, mutant phenotype and ectopic expression analyses suggested that TT16/ABS also is involved in the specification of endothelial cells. Nevertheless, TT16/ABS apparently is not required for proper ovule function. We report the functional characterization of a member of the BS MADS box gene subfamily, demonstrating its involvement in endothelial cell specification as well as in the increasingly complex genetic control of flavonoid biosynthesis in the Arabidopsis seed coat. PMID:12368498

  8. Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans

    PubMed Central

    Mitrovich, Quinn M.; Anderson, Philip

    2000-01-01

    Messenger RNA surveillance, the selective and rapid degradation of mRNAs containing premature stop codons, occurs in all eukaryotes tested. The biological role of this decay pathway, however, is not well understood. To identify natural substrates of mRNA surveillance, we used a cDNA-based representational difference analysis to identify mRNAs whose abundance increases in Caenorhabditis elegans smg(−) mutants, which are deficient for mRNA surveillance. Alternatively spliced mRNAs of genes encoding ribosomal proteins L3, L7a, L10a, and L12 are abundant natural targets of mRNA surveillance. Each of these genes expresses two distinct mRNAs. A productively spliced mRNA, whose abundance does not change in smg(−) mutants, encodes a normal, full-length, ribosomal protein. An unproductively spliced mRNA, whose abundance increases dramatically in smg(−) mutants, contains premature stop codons because of incomplete removal of an alternatively spliced intron. In transgenic animals expressing elevated quantities of RPL-12, a greater proportion of endogenous rpl-12 transcript is spliced unproductively. Thus, RPL-12 appears to autoregulate its own splicing, with unproductively spliced mRNAs being degraded by mRNA surveillance. We demonstrate further that alternative splicing of rpl introns is conserved among widely diverged nematodes. Our results suggest that one important role of mRNA surveillance is to eliminate unproductive by-products of gene regulation. PMID:10970881

  9. The pro1(+) gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development.

    PubMed Central

    Masloff, S; Pöggeler, S; Kück, U

    1999-01-01

    During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes. PMID:10224253

  10. The pro1(+) gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development.

    PubMed

    Masloff, S; Pöggeler, S; Kück, U

    1999-05-01

    During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes.

  11. ELONGATED UPPERMOST INTERNODE Encodes a Cytochrome P450 Monooxygenase That Epoxidizes Gibberellins in a Novel Deactivation Reaction in RiceW⃞

    PubMed Central

    Zhu, Yongyou; Nomura, Takahito; Xu, Yonghan; Zhang, Yingying; Peng, Yu; Mao, Bizeng; Hanada, Atsushi; Zhou, Haicheng; Wang, Renxiao; Li, Peijin; Zhu, Xudong; Mander, Lewis N.; Kamiya, Yuji; Yamaguchi, Shinjiro; He, Zuhua

    2006-01-01

    The recessive tall rice (Oryza sativa) mutant elongated uppermost internode (eui) is morphologically normal until its final internode elongates drastically at the heading stage. The stage-specific developmental effect of the eui mutation has been used in the breeding of hybrid rice to improve the performance of heading in male sterile cultivars. We found that the eui mutant accumulated exceptionally large amounts of biologically active gibberellins (GAs) in the uppermost internode. Map-based cloning revealed that the Eui gene encodes a previously uncharacterized cytochrome P450 monooxygenase, CYP714D1. Using heterologous expression in yeast, we found that EUI catalyzed 16α,17-epoxidation of non-13-hydroxylated GAs. Consistent with the tall and dwarfed phenotypes of the eui mutant and Eui-overexpressing transgenic plants, respectively, 16α,17-epoxidation reduced the biological activity of GA4 in rice, demonstrating that EUI functions as a GA-deactivating enzyme. Expression of Eui appeared tightly regulated during plant development, in agreement with the stage-specific eui phenotypes. These results indicate the existence of an unrecognized pathway for GA deactivation by EUI during the growth of wild-type internodes. The identification of Eui as a GA catabolism gene provides additional evidence that the GA metabolism pathway is a useful target for increasing the agronomic value of crops. PMID:16399803

  12. Wolbachia Protein TomO Targets nanos mRNA and Restores Germ Stem Cells in Drosophila Sex-lethal Mutants.

    PubMed

    Ote, Manabu; Ueyama, Morio; Yamamoto, Daisuke

    2016-09-12

    Wolbachia, endosymbiotic bacteria prevalent in invertebrates, manipulate their hosts in a variety of ways: they induce cytoplasmic incompatibility, male lethality, male-to-female transformation, and parthenogenesis. However, little is known about the molecular basis for host manipulation by these bacteria. In Drosophila melanogaster, Wolbachia infection makes otherwise sterile Sex-lethal (Sxl) mutant females capable of producing mature eggs. Through a functional genomic screen for Wolbachia genes with growth-inhibitory effects when expressed in cultured Drosophila cells, we identified the gene WD1278 encoding a novel protein we call toxic manipulator of oogenesis (TomO), which phenocopies some of the Wolbachia effects in Sxl mutant D. melanogaster females. We demonstrate that TomO enhances the maintenance of germ stem cells (GSCs) by elevating Nanos (Nos) expression via its interaction with nos mRNA, ultimately leading to the restoration of germ cell production in Sxl mutant females that are otherwise without GSCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Functional domains of the poliovirus receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koike, Satoshi; Ise, Iku; Nomoto, Akio

    1991-05-15

    A number of mutant cDNAs of the human poliovirus receptor were constructed to identify essential regions of the molecule as the receptor. All mutant cDNAs carrying the sequence coding for the entire N-terminal immunoglobulin-like domain (domain I) confer permissiveness for poliovirus to mouse L cells, but a mutant cDNA lacking the sequence for domain I does not. The transformants permissive for poliovirus were able to bind the virus and were also recognized by monoclonal antibody D171, which competes with poliovirus for the cellular receptor. These results strongly suggest that the poliovirus binding site resides in domain I of the receptor.more » Mutant cDNAs for the sequence encoding the intracellular peptide were also constructed and expressed in mouse L cells. Susceptibility of these cells to poliovirus revealed that the entire putative cytoplasmic domain is not essential for virus infection. Thus, the cytoplasmic domain of the molecule appears not to play a role in the penetration of poliovirus.« less

  14. Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies

    PubMed Central

    Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran

    2015-01-01

    Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610

  15. CCDC103 mutations cause primary ciliary dyskinesia by disrupting assembly of ciliary dynein arms

    PubMed Central

    Panizzi, Jennifer R.; Becker-Heck, Anita; Castleman, Victoria H.; Al-Mutairi, Dalal; Liu, Yan; Loges, Niki T.; Pathak, Narendra; Austin-Tse, Christina; Sheridan, Eamonn; Schmidts, Miriam; Olbrich, Heike; Werner, Claudius; Häffner, Karsten; Hellman, Nathan; Chodhari, Rahul; Gupta, Amar; Kramer-Zucker, Albrecht; Olale, Felix; Burdine, Rebecca D.; Schier, Alexander F.; O’Callaghan, Christopher; Chung, Eddie MK; Reinhardt, Richard; Mitchison, Hannah M.; King, Stephen M.; Omran, Heymut; Drummond, Iain A.

    2012-01-01

    Cilia are essential for fertilization, respiratory clearance, cerebrospinal fluid circulation, and to establish laterality1. Cilia motility defects cause Primary Ciliary Dyskinesia (PCD, MIM 242650), a disorder affecting 1:15-30,000 births. Cilia motility requires the assembly of multisubunit dynein arms that drive cilia bending2. Despite progress in understanding the genetic basis of PCD, mutations remain to be identified for several PCD linked loci3. Here we show that the zebrafish cilia paralysis mutant schmalhanstn222 (smh) mutant encodes the coiled-coil domain containing 103 protein (Ccdc103), a foxj1a regulated gene. Screening 146 unrelated PCD families identified patients in six families with reduced outer dynein arms, carrying mutations in CCDC103. Dynein arm assembly in smh mutant zebrafish was rescued by wild-type but not mutant human CCDC103. Chlamydomonas Ccdc103 functions as a tightly bound, axoneme-associated protein. The results identify Ccdc103 as a novel dynein arm attachment factor that when mutated causes Primary Ciliary Dyskinesia. PMID:22581229

  16. Rhodobacter sphaeroides spd mutations allow cytochrome c2-independent photosynthetic growth.

    PubMed Central

    Rott, M A; Donohue, T J

    1990-01-01

    In Rhodobacter sphaeroides, cytochrome c2 (cyt c2) is a periplasmic redox protein required for photosynthetic electron transfer. cyt c2-deficient mutants created by replacing the gene encoding the apoprotein for cyt c2 (cycA) with a kanamycin resistance cartridge are photosynthetically incompetent. Spontaneous mutations that suppress this photosynthesis deficiency (spd mutants) arise at a frequency of 1 to 10 in 10(7). We analyzed the cytochrome content of several spd mutants spectroscopically and by heme peroxidase assays. These suppressors lacked detectable cyt c2, but they contained a new soluble cytochrome which was designated isocytochrome c2 (isocyt c2) that was not detectable in either cycA+ or cycA mutant cells. When spd mutants were grown photosynthetically, isocyt c2 was present at approximately 20 to 40% of the level of cyt c2 found in photosynthetically grown wild type cells, and it was found in the periplasm with cytochromes c' and c554. These spd mutants also had several other pleiotropic phenotypes. Although photosynthetic growth rates of the spd mutants were comparable to those of wild-type strains at all light intensities tested, they contained elevated levels of B800-850 pigment-protein complexes. Several spd mutants contained detectable amounts of isocyt c2 under aerobic conditions. Finally, heme peroxidase assays indicated that, under anaerobic conditions, the spd mutants may contain another new cytochrome in addition to isocyt c2. These pleiotropic phenotypes, the frequency at which the spd mutants arise, and the fact that a frameshift mutagen is very effective in generating the spd phenotype suggest that some spd mutants contain a mutation in loci which regulate cytochrome synthesis. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 PMID:2156806

  17. Glucose Metabolism in Legionella pneumophila: Dependence on the Entner-Doudoroff Pathway and Connection with Intracellular Bacterial Growth† ▿

    PubMed Central

    Harada, Eiji; Iida, Ken-Ichiro; Shiota, Susumu; Nakayama, Hiroaki; Yoshida, Shin-Ichi

    2010-01-01

    Glucose metabolism in Legionella pneumophila was studied by focusing on the Entner-Doudoroff (ED) pathway with a combined genetic and biochemical approach. The bacterium utilized exogenous glucose for synthesis of acid-insoluble cell components but manifested no discernible increase in the growth rate. Assays with permeabilized cell preparations revealed the activities of three enzymes involved in the pathway, i.e., glucokinase, phosphogluconate dehydratase, and 2-dehydro-3-deoxy-phosphogluconate aldolase, presumed to be encoded by the glk, edd, and eda genes, respectively. Gene-disrupted mutants for the three genes and the ywtG gene encoding a putative sugar transporter were devoid of the ability to metabolize exogenous glucose, indicating that the pathway is almost exclusively responsible for glucose metabolism and that the ywtG gene product is the glucose transporter. It was also established that these four genes formed part of an operon in which the gene order was edd-glk-eda-ywtG, as predicted by genomic information. Intriguingly, while the mutants exhibited no appreciable change in growth characteristics in vitro, they were defective in multiplication within eukaryotic cells, strongly indicating that the ED pathway must be functional for the intracellular growth of the bacterium to occur. Curiously, while the deficient glucose metabolism of the ywtG mutant was successfully complemented by the ywtG+ gene supplied in trans via plasmid, its defect in intracellular growth was not. However, the latter defect was also manifested in wild-type cells when a plasmid carrying the mutant ywtG gene was introduced. This phenomenon, resembling so-called dominant negativity, awaits further investigation. PMID:20363943

  18. Electron Transport Chain Is Biochemically Linked to Pilus Assembly Required for Polymicrobial Interactions and Biofilm Formation in the Gram-Positive Actinobacterium Actinomyces oris

    PubMed Central

    Sanchez, Belkys C.; Chang, Chungyu; Wu, Chenggang; Tran, Bryan

    2017-01-01

    ABSTRACT The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans-acting factors contributing to these processes. We report here a large-scale Tn5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis. We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis, and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn5 insertions in fimA, cafA, or srtC2, as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE, a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding. PMID:28634238

  19. Pseudomonas syringae pv. tomato DC3000 CmaL (PSPTO4723), a DUF1330 Family Member, Is Needed To Produce l-allo-Isoleucine, a Precursor for the Phytotoxin Coronatine

    PubMed Central

    Worley, Jay N.; Russell, Alistair B.; Wexler, Aaron G.; Bronstein, Philip A.; Kvitko, Brian H.; Krasnoff, Stuart B.; Munkvold, Kathy R.; Swingle, Bryan

    2013-01-01

    Pseudomonas syringae pv. tomato DC3000 produces the phytotoxin coronatine, a major determinant of the leaf chlorosis associated with DC3000 pathogenesis. The DC3000 PSPTO4723 (cmaL) gene is located in a genomic region encoding type III effectors; however, it promotes chlorosis in the model plant Nicotiana benthamiana in a manner independent of type III secretion. Coronatine is produced by the ligation of two moieties, coronafacic acid (CFA) and coronamic acid (CMA), which are produced by biosynthetic pathways encoded in separate operons. Cross-feeding experiments, performed in N. benthamiana with cfa, cma, and cmaL mutants, implicate CmaL in CMA production. Furthermore, analysis of bacterial supernatants under coronatine-inducing conditions revealed that mutants lacking either the cma operon or cmaL accumulate CFA rather than coronatine, supporting a role for CmaL in the regulation or biosynthesis of CMA. CmaL does not appear to regulate CMA production, since the expression of proteins with known roles in CMA production is unaltered in cmaL mutants. Rather, CmaL is needed for the first step in CMA synthesis, as evidenced by the fact that wild-type levels of coronatine production are restored to a ΔcmaL mutant when it is supplemented with 50 μg/ml l-allo-isoleucine, the starting unit for CMA production. cmaL is found in all other sequenced P. syringae strains with coronatine biosynthesis genes. This characterization of CmaL identifies a critical missing factor in coronatine production and provides a foundation for further investigation of a member of the widespread DUF1330 protein family. PMID:23144243

  20. Effects of three different nucleoid-associated proteins encoded on IncP-7 plasmid pCAR1 on host Pseudomonas putida KT2440.

    PubMed

    Suzuki-Minakuchi, Chiho; Hirotani, Ryusuke; Shintani, Masaki; Takeda, Toshiharu; Takahashi, Yurika; Matsui, Kazuhiro; Vasileva, Delyana; Yun, Choong-Soo; Okada, Kazunori; Yamane, Hisakazu; Nojiri, Hideaki

    2015-04-01

    Nucleoid-associated proteins (NAPs), which fold bacterial DNA and influence gene transcription, are considered to be global transcriptional regulators of genes on both plasmids and the host chromosome. Incompatibility P-7 group plasmid pCAR1 carries genes encoding three NAPs: H-NS family protein Pmr, NdpA-like protein Pnd, and HU-like protein Phu. In this study, the effects of single or double disruption of pmr, pnd, and phu were assessed in host Pseudomonas putida KT2440. When pmr and pnd or pmr and phu were simultaneously disrupted, both the segregational stability and the structural stability of pCAR1 were markedly decreased, suggesting that Pmr, Pnd, and Phu act as plasmid-stabilizing factors in addition to their established roles in replication and partition systems. The transfer frequency of pCAR1 was significantly decreased in these double mutants. The segregational and structural instability of pCAR1 in the double mutants was recovered by complementation of pmr, whereas no recovery of transfer deficiency was observed. Comprehensive phenotype comparisons showed that the host metabolism of carbon compounds, which was reduced by pCAR1 carriage, was restored by disruption of the NAP gene(s). Transcriptome analyses of mutants indicated that transcription of genes for energy production, conversion, inorganic ion transport, and metabolism were commonly affected; however, how their products altered the phenotypes of mutants was not clear. The findings of this study indicated that Pmr, Pnd, and Phu act synergistically to affect pCAR1 replication, maintenance, and transfer, as well as to alter the host metabolic phenotype. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Top