Trans-nipple double Z-plasty for benign periareolar disease with inverted nipple.

PubMed

Lee, Jeeyeon; Lee, Seokwon; Bae, Youngtae

2013-04-01

Various surgical procedures have been reported for correction of inverted nipples. The authors herein report a new procedure, "the trans-nipple double Z-plasty," for correction of inverted nipples combined with periareolar disease requiring excision. From July 2010 to June 2012, 11 unilateral inverted nipples with other benign periareolar diseases were treated with this technique. A midline incision and 5-mm Z-incisions were designed on the nipple-areola complex toward the direction of the combined breast disease. After removal of combined benign disease through the trans-nipple double Z-plasty incision, the defect was filled with surrounding breast tissue, and the inverted nipple was corrected. One case of partial necrosis improved with conservative treatment. No recurrence was reported during the follow-up period. Five patients each assessed the cosmetic result as excellent and good. The trans-nipple double Z-plasty is an easy and useful technique for simultaneous management of periareolar disease with an inverted nipple. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Analysis of High Switching Frequency Quasi-Z-Source Photovoltaic Inverter Using Wide Bandgap Devices

NASA Astrophysics Data System (ADS)

Kayiranga, Thierry

Power inverters continue to play a key role in todays electrical system more than ever. Power inverters employ power semiconductors to converter direct current (DC) into alternating current (AC). The performance of the semiconductors is based on speed and efficiency. Until recently, Silicon (Si) semiconductors had been established as mature. However, the continuous optimization and improvements in the production process of Si to meet today technology requirements have pushed Si materials to their theoretical limits. In an effort to find a suitable replacement, wide bandgap devices mainly Gallium Nitride (GaN) and Silicon Carbide (SiC), have proved to be excellent candidates offering high operation temperature, high blocking voltage and high switching frequency; of which the latter makes GaN a better candidate in high switching low voltage in Distributed Generations (DG). The single stage Quasi-Z-Source Inverter (qZSI) is also able to draw continuous and constant current from the source making ideal for PV applications in addition to allowing shoot-through states. The qZSI find best applications in medium level ranges where multiples qZS inverters can be cascaded (qZS-CMI) by combining the benefit of the qZSI, boost capabilities and continuous and constant input current, and those of the CMI, low output harmonic content and independent MPPT. When used with GaN devices operating at very high frequency, the qZS network impedance can be significantly reduced. However, the impedance network becomes asymmetric. The asymmetric impedance network (AIN-qZSI) has several advantages such as increased power density, increases system lifetime, small size volume and size making it more attractive for module integrated converter (MIC) concepts. However, there are technical challenges. With asymmetric component, resonance is introduced in the system leading to more losses and audible noise. With small inductances, new operation states become available further increasing the system complexity. This report investigates the AIN-qZSI and present solutions to aforementioned issues.

Variation with interplanetary sector of the total magnetic field measured at the OGO 2, 4, and 6 satellites

NASA Technical Reports Server (NTRS)

Langel, R. A.

1973-01-01

Variations in the scalar magnetic field (delta B) from the polar orbiting OGO 2, 4, and 6 spacecraft are examined as a function of altitude for times when the interplanetary magnetic field is toward the sun and for times when the interplanetary magnetic field away from the sun. This morphology is basically the same as that found when all data, irrespective of interplanetary magnetic sector, are averaged together. Differences in delta B occur, both between sectors and between seasons, which are similar in nature to variations in the surface delta Z found by Langel (1973c). The altitude variation of delta B at sunlit local times, together with delta Z at the earth's surface, demonstrates that the delta Z and delta B which varies with sector has an ionospheric source. Langel (1973b) showed that the positive delta B region in the dark portion of the hemisphere is due to at least two sources, the westward electrojet and an unidentified non-ionospheric source(s). Comparison of magnetic variations between season/sector at the surface and at the satellite, in the dark portion of the hemisphere, indicates that these variations are caused by variations in the latitudinally narrow electrojet currents and not by variations in the non-ionospheric source of delta B.

Detection of active noise control on the standard motorcycle exhaust Supra X 125 D using PVC pipe technique form Y

NASA Astrophysics Data System (ADS)

Isranuri, I.; Alfisyahrin; Nasution, A. R.

2018-02-01

This detection aims to obtain noise reduction on the supra X 125D motorcycle exhaust by using the Active Noise Control Method. The technique is done using a Y-shaped PVC pipe to be bolted on the exhaust, which then branch Y PVC is placed loudspeaker with impermeable conditions. The function of this loudspeaker is as a secondary noise to counter the primary noise of the sound of exhaust motorcycle Supra X 125D. The sound generator in this study is the ISD 4004 module, which serves to generate noise to counter the source noise. How this ISD 4004 module works is by recording source noise then recording the source noise and then reversed the phase 180° by phase reversing circuit. So that, the noise generated by the sound generator will hit the source noise and encounter or such as addition of two different phase of sound will result in noise reduction when detected at the end of the Y-shaped PVC pipe. Inverted phase reversed using feed-back resistor 1 kΩ and 2 kΩ input resistors, 16V capacitor 2500μf and as amplifier using ICL 7660 and TL 702 CP. Test results on the highest 1000 rpm rotation engine speed on the Z axis of 2 dB, and at the highest 2000 rpm rotation engine speed also occurs on the Z axis of 1.5 dB.

Double-Line-Frequency Ripple Model, Analysis & Impedance Design for Energy Stored Single-Phase Quasi-Z Source Photovoltaic System

DOE PAGES

Liang, Weihua; Liu, Yushan; Ge, Baoming; ...

2017-09-08

The battery energy stored quasi-Z-source (BESqZS) based photovoltaic (PV) power generation system combines advantages of the qZS inverter and the battery energy storage system. But, the second harmonic (2ω) power ripple degrades the system’s performance and affects the system’s design. An accurate model to analyze the 2ω ripple is very important. The existing models did not consider the battery, or assumed a symmetric qZS network with L 1=L 2 and C 1=C 2, which limits the design freedom and causes oversized impedance parameters. Our paper proposes a comprehensive model for the single-phase BES-qZS-PV inverter system, where the battery is consideredmore » and there is no restriction of L 1=L 2 and C 1=C 2. Based on the built model, a BES-qZS impedance design method is proposed to mitigate the 2ω ripple with asymmetric qZS network. Simulation and experimental results verify the proposed 2ω ripple model and impedance design method.« less

Voltage control in Z-source inverter using low cost microcontroller for undergraduate approach

NASA Astrophysics Data System (ADS)

Zulkifli, Shamsul Aizam; Sewang, Mohd Rizal; Salimin, Suriana; Shah, Noor Mazliza Badrul

2017-09-01

This paper is focussing on controlling the output voltage of Z-Source Inverter (ZSI) using a low cost microcontroller with MATLAB-Simulink that has been used for interfacing the voltage control at the output of ZSI. The key advantage of this system is the ability of a low cost microcontroller to process the voltage control blocks based on the mathematical equations created in MATLAB-Simulink. The Proportional Integral (PI) control equations are been applied and then, been downloaded to the microcontroller for observing the changes on the voltage output regarding to the changes on the reference on the PI. The system has been simulated in MATLAB and been verified with the hardware setup. As the results, the Raspberry Pi and Arduino that have been used in this work are able to respond well when there is a change of ZSI output. It proofed that, by applying/introducing this method to student in undergraduate level, it will help the student to understand more on the process of the power converter combine with a control feedback function that can be applied at low cost microcontroller.

Double-Line-Frequency Ripple Model, Analysis & Impedance Design for Energy Stored Single-Phase Quasi-Z Source Photovoltaic System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Weihua; Liu, Yushan; Ge, Baoming

The battery energy stored quasi-Z-source (BESqZS) based photovoltaic (PV) power generation system combines advantages of the qZS inverter and the battery energy storage system. But, the second harmonic (2ω) power ripple degrades the system’s performance and affects the system’s design. An accurate model to analyze the 2ω ripple is very important. The existing models did not consider the battery, or assumed a symmetric qZS network with L 1=L 2 and C 1=C 2, which limits the design freedom and causes oversized impedance parameters. Our paper proposes a comprehensive model for the single-phase BES-qZS-PV inverter system, where the battery is consideredmore » and there is no restriction of L 1=L 2 and C 1=C 2. Based on the built model, a BES-qZS impedance design method is proposed to mitigate the 2ω ripple with asymmetric qZS network. Simulation and experimental results verify the proposed 2ω ripple model and impedance design method.« less

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS.

PubMed

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H(2)O, NH(3), CH(2)O (from serine), C2H4O (from threonine), and H(3)PO(4), whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H](+) and [M + H - H](-) within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS

NASA Astrophysics Data System (ADS)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H2O, NH3, CH2O (from serine), C2H4O (from threonine), and H3PO4, whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H]+ and [M + H - H]- within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Microseismic imaging using a source function independent full waveform inversion method

NASA Astrophysics Data System (ADS)

Wang, Hanchen; Alkhalifah, Tariq

2018-07-01

At the heart of microseismic event measurements is the task to estimate the location of the source microseismic events, as well as their ignition times. The accuracy of locating the sources is highly dependent on the velocity model. On the other hand, the conventional microseismic source locating methods require, in many cases, manual picking of traveltime arrivals, which do not only lead to manual effort and human interaction, but also prone to errors. Using full waveform inversion (FWI) to locate and image microseismic events allows for an automatic process (free of picking) that utilizes the full wavefield. However, FWI of microseismic events faces incredible nonlinearity due to the unknown source locations (space) and functions (time). We developed a source function independent FWI of microseismic events to invert for the source image, source function and the velocity model. It is based on convolving reference traces with these observed and modelled to mitigate the effect of an unknown source ignition time. The adjoint-state method is used to derive the gradient for the source image, source function and velocity updates. The extended image for the source wavelet in Z axis is extracted to check the accuracy of the inverted source image and velocity model. Also, angle gathers are calculated to assess the quality of the long wavelength component of the velocity model. By inverting for the source image, source wavelet and the velocity model simultaneously, the proposed method produces good estimates of the source location, ignition time and the background velocity for synthetic examples used here, like those corresponding to the Marmousi model and the SEG/EAGE overthrust model.

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B.

Sulfur, most abundantly found in the environment as sulfate (SO 4 2-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO 4 2- at the molecular level is limited. CysZ has been described as a SO 4 2- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO 4 2- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO 4 2- across membranes. CysZ structures from three different bacterial speciesmore » display a hitherto unknown fold and have subunits organized with inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. In conclusion, mutational studies highlight the functional relevance of conserved CysZ residues.« less

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

DOE PAGES

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B.; ...

2018-05-24

Sulfur, most abundantly found in the environment as sulfate (SO 4 2-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO 4 2- at the molecular level is limited. CysZ has been described as a SO 4 2- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO 4 2- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO 4 2- across membranes. CysZ structures from three different bacterial speciesmore » display a hitherto unknown fold and have subunits organized with inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. In conclusion, mutational studies highlight the functional relevance of conserved CysZ residues.« less

Basis set expansion for inverse problems in plasma diagnostic analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, B.; Ruiz, C. L.

A basis set expansion method [V. Dribinski, A. Ossadtchi, V. A. Mandelshtam, and H. Reisler, Rev. Sci. Instrum. 73, 2634 (2002)] is applied to recover physical information about plasma radiation sources from instrument data, which has been forward transformed due to the nature of the measurement technique. This method provides a general approach for inverse problems, and we discuss two specific examples relevant to diagnosing fast z pinches on the 20–25 MA Z machine [M. E. Savage, L. F. Bennett, D. E. Bliss, W. T. Clark, R. S. Coats, J. M. Elizondo, K. R. LeChien, H. C. Harjes, J. M.more » Lehr, J. E. Maenchen, D. H. McDaniel, M. F. Pasik, T. D. Pointon, A. C. Owen, D. B. Seidel, D. L. Smith, B. S. Stoltzfus, K. W. Struve, W. A. Stygar, L. K. Warne, J. R. Woodworth, C. W. Mendel, K. R. Prestwich, R. W. Shoup, D. L. Johnson, J. P. Corley, K. C. Hodge, T. C. Wagoner, and P. E. Wakeland, in Proceedings of the Pulsed Power Plasma Sciences Conference (IEEE, 2007), p. 979]. First, Abel inversion of time-gated, self-emission x-ray images from a wire array implosion is studied. Second, we present an approach for unfolding neutron time-of-flight measurements from a deuterium gas puff z pinch to recover information about emission time history and energy distribution. Through these examples, we discuss how noise in the measured data limits the practical resolution of the inversion, and how the method handles discontinuities in the source function and artifacts in the projected image. We add to the method a propagation of errors calculation for estimating uncertainties in the inverted solution.« less

Basis set expansion for inverse problems in plasma diagnostic analysis

NASA Astrophysics Data System (ADS)

Jones, B.; Ruiz, C. L.

2013-07-01

A basis set expansion method [V. Dribinski, A. Ossadtchi, V. A. Mandelshtam, and H. Reisler, Rev. Sci. Instrum. 73, 2634 (2002)], 10.1063/1.1482156 is applied to recover physical information about plasma radiation sources from instrument data, which has been forward transformed due to the nature of the measurement technique. This method provides a general approach for inverse problems, and we discuss two specific examples relevant to diagnosing fast z pinches on the 20-25 MA Z machine [M. E. Savage, L. F. Bennett, D. E. Bliss, W. T. Clark, R. S. Coats, J. M. Elizondo, K. R. LeChien, H. C. Harjes, J. M. Lehr, J. E. Maenchen, D. H. McDaniel, M. F. Pasik, T. D. Pointon, A. C. Owen, D. B. Seidel, D. L. Smith, B. S. Stoltzfus, K. W. Struve, W. A. Stygar, L. K. Warne, J. R. Woodworth, C. W. Mendel, K. R. Prestwich, R. W. Shoup, D. L. Johnson, J. P. Corley, K. C. Hodge, T. C. Wagoner, and P. E. Wakeland, in Proceedings of the Pulsed Power Plasma Sciences Conference (IEEE, 2007), p. 979]. First, Abel inversion of time-gated, self-emission x-ray images from a wire array implosion is studied. Second, we present an approach for unfolding neutron time-of-flight measurements from a deuterium gas puff z pinch to recover information about emission time history and energy distribution. Through these examples, we discuss how noise in the measured data limits the practical resolution of the inversion, and how the method handles discontinuities in the source function and artifacts in the projected image. We add to the method a propagation of errors calculation for estimating uncertainties in the inverted solution.

Electromagnetics and Electrothermal Approach to Evaluate Failures in Microelectronic Devices Caused by Electrostatic Discharges: Stochastical Aspects of the Device Reliability.

DTIC Science & Technology

1987-08-01

C C CALL THE ELSV SUBROUTINE TO INVERT THE MATRIX. EPO .1D-09 . CALL ELSV(Z,AUX1,AUX2,tN, DE ,EP) WRITE(93,118) DE 118 FORMAT(5X,’ DE -,1E) C C MULTIPLY...IFCABS(W).LT.EP)GO TO 17 DO 13 I=1,N Y’=A( I,K)/W DO 13 J=1,N 13 AC I,J)=A(I,J)-B(J)*Y DE =O.DO DO.15 J=1,N B(J)0O.DO DO 16 I=1,N 16 B(J)=B(J)+A(I,J...15 DE - DE +C(J)*B(J) RETURN 1. DE -1.DO RETURN -18- IMPLICIT COMPLEX*16 (C) IMPLICIT REAL*8 (A-B,E-H,P-z) C C C THIS PROGRAM GIVES THE POTENTIAL AND THE

Theoretical and Experimental Study of Deep-Based Structures in Intact and Jointed Rock.

DTIC Science & Technology

1979-09-01

PRESSURE, PV ksi (X 6.9 = MpaI FIGURE A.65 CROWN-INVERT TUNNEL CLOSURE VERSUS VERTICAL PRESSURE - TEST LSUJX-21 231 QO2 wd 0 -J0 z -2 S-4 510 15 2 VERTICAL...J "A’ %V-FW ’-’X 2530I • 10- - - - - - -0, I 8 C- uj C,, (4 z 0 1 2 VERTICAL PRESSURE, Pv - ksi (X 6.9 = MPaI MA-5762-200 FIGURE A.91 LATERAL

Micro-seismic imaging using a source function independent full waveform inversion method

NASA Astrophysics Data System (ADS)

Wang, Hanchen; Alkhalifah, Tariq

2018-03-01

At the heart of micro-seismic event measurements is the task to estimate the location of the source micro-seismic events, as well as their ignition times. The accuracy of locating the sources is highly dependent on the velocity model. On the other hand, the conventional micro-seismic source locating methods require, in many cases manual picking of traveltime arrivals, which do not only lead to manual effort and human interaction, but also prone to errors. Using full waveform inversion (FWI) to locate and image micro-seismic events allows for an automatic process (free of picking) that utilizes the full wavefield. However, full waveform inversion of micro-seismic events faces incredible nonlinearity due to the unknown source locations (space) and functions (time). We developed a source function independent full waveform inversion of micro-seismic events to invert for the source image, source function and the velocity model. It is based on convolving reference traces with these observed and modeled to mitigate the effect of an unknown source ignition time. The adjoint-state method is used to derive the gradient for the source image, source function and velocity updates. The extended image for the source wavelet in Z axis is extracted to check the accuracy of the inverted source image and velocity model. Also, angle gathers is calculated to assess the quality of the long wavelength component of the velocity model. By inverting for the source image, source wavelet and the velocity model simultaneously, the proposed method produces good estimates of the source location, ignition time and the background velocity for synthetic examples used here, like those corresponding to the Marmousi model and the SEG/EAGE overthrust model.

Effects of inoculation with organic-phosphorus-mineralizing bacteria on soybean (Glycine max) growth and indigenous bacterial community diversity.

PubMed

Sun, Wei; Qian, Xun; Gu, Jie; Wang, Xiao-Juan; Li, Yang; Duan, Man-Li

2017-05-01

Three different organic-phosphorus-mineralizing bacteria (OPMB) strains were inoculated to soil planted with soybean (Glycine max), and their effects on soybean growth and indigenous bacterial community diversity were investigated. Inoculation with Pseudomonas fluorescens Z4-1 and Brevibacillus agri L7-1 increased organic phosphorus degradation by 22% and 30%, respectively, compared with the control at the mature stage. Strains P. fluorescens Z4-1 and B. agri L7-1 significantly improved the soil alkaline phosphatase activity, average well color development, and the soybean root activity. Terminal restriction fragment length polymorphism analysis demonstrated that P. fluorescens Z4-1 and B. agri L7-1 could persist in the soil at relative abundances of 2.0%-6.4% throughout soybean growth. Thus, P. fluorescens Z4-1 and B. agri L7-1 could potentially be used in organic-phosphorus-mineralizing biofertilizers. OPMB inoculation altered the genetic structure of the soil bacterial communities but had no apparent influence on the carbon source utilization profiles of the soil bacterial communities. Principal components analysis showed that the changes in the carbon source utilization profiles of bacterial community depended mainly on the plant growth stages rather than inoculation with OPMB. The results help to understand the evolution of the soil bacterial community after OPMB inoculation.

B And V Photometry Of A Inverted-spectrum And Flat-spectrum Radio Sources With The Rowan 0.4-meter Telescope

NASA Astrophysics Data System (ADS)

Guerra, Erick; Pultar, R.

2010-05-01

Several galaxies have been selected for an exploratory campaign with 0.4-meter telescope atop Science Hall at Rowan University. These galaxies exhibit inverted radio spectra on the basis of fluxes in the GB6 and VLA FIRST catalogs and have SDSS magnitudes in g-band less than 15.5. The results of V and R band photometry of theses galaxies are presented. Photometry from multiple nights will be examined to explore variability on the timescales of days or weeks. Targets in the sample include Markarian 668 and NGC 5635. These are the first results from an ongoing campaign to expand the function of the observatory atop Science Hall. The authors would like to acknowledge Ric and Jean Edelman for their gift that funded the 0.4-meter telescope.

Electron-transporting small molecule/ o-xylene hybrid additives to boost the performance of simplified inverted polymer solar cells

NASA Astrophysics Data System (ADS)

Qin, Dashan; Cao, Huan; Zhang, Jidong

2017-05-01

Electron-transporting small molecule bathophenanthroline (Bphen) together with o-xylene has been used as hybrid additives to improve the performance of simplified inverted polymer solar cells employing ITO alone as cathode and photoactive layer based on polymer [[2,6'-4,8-di(5-ethylhexylthienyl)benzo[1,2-b;3,3-b] dithiophene] [3-fluoro-2[(2-ethylhexyl)carbonyl]thieno[3,4-b]thiophenediyl

The Nature of Radio Emission from Distant Galaxies: The 1.4 GHZ Observations

NASA Astrophysics Data System (ADS)

Richards, E. A.

2000-04-01

We have conducted a deep radio survey with the Very Large Array at 1.4 GHz of a region containing the Hubble Deep Field (HDF). This survey overlaps previous observations at 8.5 GHz allowing us to investigate the radio spectral properties of microjansky sources to flux densities greater than 40 μJy at 1.4 GHz and greater than 8 μJy at 8.5 GHz. A total of 371 sources have been cataloged at 1.4 GHz as part of a complete sample within 20' of the HDF. The differential source count for this region is only marginally sub-Euclidean and is given by n(S)=(8.3+/-0.4)S-2.4+/-0.1 sr-1 Jy-1. Above about 100 μJy the radio source count is systematically lower in the HDF as compared to other fields. We conclude that there is clustering in our radio sample on size scales of 1'-40'. The 1.4 GHz-selected sample shows that the radio spectral indices are preferentially steep (α1.4=0.85) and that the sources are moderately extended with average angular size θ=1.8". Optical identification with disk-type systems at z~0.1-1 suggests that synchrotron emission, produced by supernovae remnants, is powering the radio emission in the majority of sources. The 8.5 GHz sample contains primarily moderately flat spectrum sources (α8.5=0.35), with less than 15% inverted. We argue that we may be observing an increased fraction of optically thin bremsstrahlung over synchrotron radiation in these distant star-forming galaxies.

A non cool-core 4.6-keV cluster around the bright nearby radio galaxy PKS B1416-493

NASA Astrophysics Data System (ADS)

Worrall, D. M.; Birkinshaw, M.

2017-05-01

We present new X-ray (Chandra) and radio (ATCA) observations of the z = 0.09 radio galaxy PKS B1416-493, a member of the southern equivalent of the 3CRR sample. We find the source to be embedded in a previously unrecognized bright kT = 4.6-keV non cool-core cluster. The discovery of new clusters of such high temperature and luminosity within z = 0.1 is rare. The radio source was chosen for observation based on its intermediate FR I/II morphology. We identify a cavity coincident with the northeast lobe, and excess counts associated with the southwest lobe that we interpret as inverse-Compton X-ray emission. The jet power, at 5.3 × 1044 erg s-1, when weighted by radio source density, supports suggestions that radio sources of intermediate morphology and radio power may dominate radio-galaxy heating in the local Universe.

Conditions for the invertibility of the nonlinear difference operator (\\mathscr Rx)(n)=H(x(n),x(n+1)), n\\in\\mathbb Z, in the space of bounded number sequences

NASA Astrophysics Data System (ADS)

Slyusarchuk, Vasilii E.

2009-02-01

Necessary and sufficient conditions are found for the invertibility of the nonlinear difference operator \\displaystyle (\\mathscr Rx)(n)=H(x(n),x(n+1)),\\qquad n\\in\\mathbb Z, in the space of bounded two-sided number sequences. Here H\\colon \\mathbb R^2\\to \\mathbb R is a continuous function. Bibliography: 29 titles.

10 CFR 851.27 - Reference sources.

Code of Federal Regulations, 2012 CFR

2012-01-01

... National Standards Institute (ANSI) Z88.2, “American National Standard for Respiratory Protection,” (1992...) B31.4—2002—Pipeline Transportation Systems for Liquid Hydrocarbons and Other Liquids; (v) B31.5—2001...—Gas Transmission and Distribution Piping Systems; (vii) B31.8S—2001—Managing System Integrity of Gas...

An Inverse Method for Obtaining the Attenuation Profile and Small Variations in the Sound Speed and Density Profiles of the Ocean Bottom.

DTIC Science & Technology

1985-05-01

Source level in decibels SBL Sub-bottom loss TL Transmission loss of signal going through the water/sediment interface -- 4 - • .’ I.. zL...explained in the legend to figure 3-1. ’-4 RLb - S-BL-2Oog2D-2aD (3.1) RL8b S- TLb- SBL -TLW-2az-2Olog(D+z)-2aD (3.2) jZ h𔃾 -57- OCEAN SURFACE...RLb -RLab= SBL + [TL,+TL,-BL-201og2D" + 2az + 20log(D+z). (3.3) Assuming that the term within the bracket remains constant for the entire wedge, we

Highly efficient inverted polymer solar cells based on a cross-linkable water-/alcohol-soluble conjugated polymer interlayer.

PubMed

Zhang, Kai; Zhong, Chengmei; Liu, Shengjian; Mu, Cheng; Li, Zhengke; Yan, He; Huang, Fei; Cao, Yong

2014-07-09

A cross-linkable water/alcohol soluble conjugated polymer (WSCP) material poly[9,9-bis(6'-(N,N-diethylamino)propyl)-fluorene-alt-9,9-bis(3-ethyl(oxetane-3-ethyloxy)-hexyl) fluorene] (PFN-OX) was designed. The cross-linkable nature of PFN-OX is good for fabricating inverted polymer solar cells (PSCs) with well-defined interface and investigating the detailed working mechanism of high-efficiency inverted PSCs based on poly[4,8-bis(2-ethylhexyloxyl)benzo[1,2-b:4,5-b']dithio-phene-2,6-diyl-alt-ethylhexyl-3-fluorothithieno[3,4-b]thiophene-2-carboxylate-4,6-diyl] (PTB7) and (6,6)-phenyl-C71-butyric acid methyl ester (PC71BM) blend active layer. The detailed working mechanism of WSCP materials in high-efficiency PSCs were studied and can be summarized into the following three effects: a) PFN-OX tunes cathode work function to enhance open-circuit voltage (Voc); b) PFN-OX dopes PC71BM at interface to facilitate electron extraction; and c) PFN-OX extracts electrons and blocks holes to enhance fill factor (FF). On the basis of this understanding, the hole-blocking function of the PFN-OX interlayer was further improved with addition of a ZnO layer between ITO and PFN-OX, which led to inverted PSCs with a power conversion efficiency of 9.28% and fill factor high up to 74.4%.

Use of a Tn5-based transposon system to create a cost-effective Zymomonas mobilis for ethanol production from lignocelluloses

PubMed Central

2013-01-01

Background Current methods of ethanol production from lignocelluloses generate a mixture of sugars, primarily glucose and xylose; the fermentation cells are always exposed to stresses like high temperature and low nutritional conditions that affect their growth and productivity. Stress-tolerant strains capable of using both glucose and xylose to produce ethanol with high yield are highly desirable. Results A recombinant Zymomonas mobilis (Z. mobilis) designated as HYMX was constructed by integrating seven genes (Pfu-sHSP, yfdZ, metB, xylA, xylB, tktA and talB) into the genome of Z. mobilis CP4 (CP4) via Tn5 transposon in the present study. The small heat shock protein gene (Pfu-sHSP) from Pyrococcus furious (P. furious) was used to increase the heat-tolerance, the yfdZ and metB genes from E. coli were used to decrease the nutritional requirement. To overcome the bottleneck of CP4 being unable to use pentose, xylose catabolic genes (xylA, xylB, tktA and talB) from E. coli were integrated into CP4 also for construction of the xylose utilizing metabolic pathway. Conclusions The genomic integration confers on Z. mobilis the ability to grow in medium containing xylose as the only carbon source, and to grow in simple chemical defined medium without addition of amino acid. The HYMX demonstrated not only the high tolerance to unfavorable stresses like high temperature and low nutrient, but also the capability of converting both glucose and xylose to ethanol with high yield at high temperature. What’s more, these genetic characteristics were stable up to 100 generations on nonselective medium. Although significant improvements were achieved, yeast extract is needed for ethanol production. PMID:23635356

Evolution of the dusty infrared luminosity function from z = 0 to z = 2.3 using observations from Spitzer

NASA Astrophysics Data System (ADS)

Magnelli, B.; Elbaz, D.; Chary, R. R.; Dickinson, M.; Le Borgne, D.; Frayer, D. T.; Willmer, C. N. A.

2011-04-01

Aims: We derive the evolution of the infrared luminosity function (LF) over the last 4/5ths of cosmic time using deep 24 and 70 μm imaging of the GOODS North and South fields. Methods: We use an extraction technique based on prior source positions at shorter wavelengths to build the 24 and 70 μm source catalogs. The majority (93%) of the sources have a spectroscopic (39%) or a photometric redshift (54%) and, in our redshift range of interest (i.e., 1.3 < z < 2.3) s20% of the sources have a spectroscopic redshift. To extend our study to lower 70 μm luminosities we perform a stacking analysis and we characterize the observed L24/(1 + z) vs. L70/(1 + z) correlation. Using spectral energy distribution (SED) templates which best fit this correlation, we derive the infrared luminosity of individual sources from their 24 and 70 μm luminosities. We then compute the infrared LF at zs1.55 ± 0.25 and zs2.05 ± 0.25. Results: We observe the break in the infrared LF up to zs2.3. The redshift evolution of the infrared LF from z = 1.3 to z = 2.3 is consistent with a luminosity evolution proportional to (1 + z)1.0 ± 0.9 combined with a density evolution proportional to (1 + z)-1.1 ± 1.5. At zs2, luminous infrared galaxies (LIRGs: 1011L⊙ < LIR < 1012 L⊙) are still the main contributors to the total comoving infrared luminosity density of the Universe. At zs2, LIRGs and ultra-luminous infrared galaxies (ULIRGs: 1012L⊙ < LIR) account for s49% and s17% respectively of the total comoving infrared luminosity density of the Universe. Combined with previous results using the same strategy for galaxies at z < 1.3 and assuming a constant conversion between the infrared luminosity and star-formation rate (SFR) of a galaxy, we study the evolution of the SFR density of the Universe from z = 0 to z = 2.3. We find that the SFR density of the Universe strongly increased with redshift from z = 0 to z = 1.3, but is nearly constant at higher redshift out to z = 2.3. As part of the online material accompanying this article, we present source catalogs at 24 μm and 70 μm for both the GOODS-North and -South fields. Appendices are only available in electronic form at http://www.aanda.orgFull Tables B1-B4 are only available in electronic form at CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/528/A35

Causality and Information Dynamics in Networked Systems with Many Agents

DTIC Science & Technology

2017-05-11

representation, the LSI filter given by A(τ) must be invertible, and a sufficient condition for this invertibility is that there is some c > 0 such that the...linear shift-invariant (LSI) filter B̃ij(z) = ∑p τ=1Bij(τ)z −τ whose coefficients are arranged into a column vector B̃ij = (Bij(1), . . . , Bij(p)). In...to the adjacency matrix of the underlying graph, so that looking “depth-wise” at location ij gives the coefficients B̃ij ∈ IRp of the LSI filter from

Multilevel cascade voltage source inverter with seperate DC sources

DOEpatents

Peng, Fang Zheng; Lai, Jih-Sheng

1997-01-01

A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.

Multilevel cascade voltage source inverter with seperate DC sources

DOEpatents

Peng, Fang Zheng; Lai, Jih-Sheng

2002-01-01

A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.

Multilevel cascade voltage source inverter with seperate DC sources

DOEpatents

Peng, Fang Zheng; Lai, Jih-Sheng

2001-04-03

A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.

Multilevel cascade voltage source inverter with separate DC sources

DOEpatents

Peng, F.Z.; Lai, J.S.

1997-06-24

A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations. 15 figs.

Catalog of candidates for quasars at 3 < z < 5.5 selected among X-Ray sources from the 3XMM-DR4 survey of the XMM-Newton observatory

NASA Astrophysics Data System (ADS)

Khorunzhev, G. A.; Burenin, R. A.; Meshcheryakov, A. V.; Sazonov, S. Yu.

2016-05-01

We have compiled a catalog of 903 candidates for type 1 quasars at redshifts 3 < z < 5.5 selected among the X-ray sources of the "serendipitous" XMM-Newton survey presented in the 3XMMDR4 catalog (the median X-ray flux is ≈5 × 10-15 erg s-1 cm-2 in the 0.5-2 keV energy band) and located at high Galactic latitudes | b| > 20° in Sloan Digital Sky Survey (SDSS) fields with a total area of about 300 deg2. Photometric SDSS data as well infrared 2MASS and WISE data were used to select the objects. We selected the point sources from the photometric SDSS catalog with a magnitude error δ mz' < 0.2 and a color i' - z' < 0.6 (to first eliminate the M-type stars). For the selected sources, we have calculated the dependences χ2( z) for various spectral templates from the library that we compiled for these purposes using the EAZY software. Based on these data, we have rejected the objects whose spectral energy distributions are better described by the templates of stars at z = 0 and obtained a sample of quasars with photometric redshift estimates 2.75 < z phot < 5.5. The selection completeness of known quasars at z spec > 3 in the investigated fields is shown to be about 80%. The normalized median absolute deviation (Δ z = | z spec - z phot|) is σ Δ z /(1+ z spec) = 0.07, while the outlier fraction is η = 9% when Δ z/(1 + z cпek.) > 0.2. The number of objects per unit area in our sample exceeds the number of quasars in the spectroscopic SDSS sample at the same redshifts approximately by a factor of 1.5. The subsequent spectroscopic testing of the redshifts of our selected candidates for quasars at 3 < z < 5.5 will allow the purity of this sample to be estimated more accurately.

Searching for MeV-scale gauge bosons with IceCube

DOE PAGES

DiFranzo, Anthony; Hooper, Dan

2015-11-05

Light gauge bosons can lead to resonant interactions between high-energy astrophysical neutrinos and the cosmic neutrino background. We study this possibility in detail, considering the ability of IceCube to probe such scenarios. We also find the most dramatic effects in models with a very light Z' (m Z'≲10 MeV), which can induce a significant absorption feature at E ν~5–10 TeV×(m Z'/MeV) 2. In the case of the inverted hierarchy and a small sum of neutrino masses, such a light Z' can result in a broad and deep spectral feature at ~0.1–10 PeV×(m Z'/MeV) 2. Current IceCube data already excludes thismore » case for a Z' lighter than a few MeV and couplings greater than g~10 -4. Furthermore, we emphasize that the ratio of neutrino flavors observed by IceCube can be used to further increase their sensitivity to Z' models and to other exotic physics scenarios.« less

Assessing Diversity of DNA Structure-Related Sequence Features in Prokaryotic Genomes

PubMed Central

Huang, Yongjie; Mrázek, Jan

2014-01-01

Prokaryotic genomes are diverse in terms of their nucleotide and oligonucleotide composition as well as presence of various sequence features that can affect physical properties of the DNA molecule. We present a survey of local sequence patterns which have a potential to promote non-canonical DNA conformations (i.e. different from standard B-DNA double helix) and interpret the results in terms of relationships with organisms' habitats, phylogenetic classifications, and other characteristics. Our present work differs from earlier similar surveys not only by investigating a wider range of sequence patterns in a large number of genomes but also by using a more realistic null model to assess significant deviations. Our results show that simple sequence repeats and Z-DNA-promoting patterns are generally suppressed in prokaryotic genomes, whereas palindromes and inverted repeats are over-represented. Representation of patterns that promote Z-DNA and intrinsic DNA curvature increases with increasing optimal growth temperature (OGT), and decreases with increasing oxygen requirement. Additionally, representations of close direct repeats, palindromes and inverted repeats exhibit clear negative trends with increasing OGT. The observed relationships with environmental characteristics, particularly OGT, suggest possible evolutionary scenarios of structural adaptation of DNA to particular environmental niches. PMID:24408877

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharp, D.J.; Panitz, J.K.G.; Mattox, D.M.

The erosion of materials by low energy ions is of concern in fusion reactors since high Z impurities in the plasma cause radiation cooling. Ion bombardment of the fusion reactor chamber walls arises from ions of fuel (D, T) material, gaseous impurities (O, C), and impurities from eroded components (Fe, Co, Ni, C, Mo, etc.) being accelerated across the wall sheath potential (0.1 to 1 keV). A Kaufman type ion source has been characterized for use with hydrogen, and subsequently used to determine the relative erosion rates of bulk Mo, C, Cu, coating of TiB/sub 2/, B/sub 4/C, Be, VBe/submore » 12/ and other materials. Ions of hydrogen (Z=1), argon (Z=18), and xenon (Z=54) at acceleration potentials of 250, 500, and 1000 V have been used to determine erosion yields.« less

Crystal structure and phase transformations of calcium yttrium orthophosphate, Ca 3Y(PO 4) 3

NASA Astrophysics Data System (ADS)

Fukuda, Koichiro; Iwata, Tomoyuki; Niwa, Takahiro

2006-11-01

Crystal structure and phase transformations of calcium yttrium orthophosphate Ca 3Y(PO 4) 3 were investigated by X-ray powder diffraction, selected-area electron diffraction, transmission electron microscopy and optical microscopy. The high-temperature phase is isostructural with eulytite, cubic (space group I4¯3d) with a=0.983320(5) nm, V=0.950790(8) nm 3, Z=4 and D x=3.45 Mg m -3. The crystal structure was refined with a split-atom model, in which the oxygen atoms are distributed over two partially occupied sites. Below the stable temperature range of eulytite, the crystal underwent a martensitic transformation, which is accompanied by the formation of platelike surface reliefs. The inverted crystal is triclinic (space group P1) with a=1.5726(1) nm, b=0.84267(9) nm, c=0.81244(8) nm, α=109.739(4)°, β=90.119(5)°, γ=89.908(7)°, V=1.0134(1) nm 3, Z=4 and D x=3.24 Mg m -3. The crystal grains were composed of pseudo-merohedral twins. The adjacent twin domains were related by the pseudo-symmetry mirror planes parallel to {101¯} with the composition surface {101¯}. When the eulytite was cooled relatively slowly from the stable temperature range, the decomposition reaction of Ca 3Y(PO 4) 3→ β-Ca 3(PO 4) 2+YPO 4 occurred.

Worldwide U.S. Active Duty Military Deaths: Alphabetical Index by Name, (Aakhus Daniel Joseph - Zysk Carol Rose), October 1, 1979 thru September 30, 1993

DTIC Science & Technology

1994-03-01

0 w -’-wwI 0 x j- j 00-j4"Zw:3 w 0( 4 0o -J -J -oe-o 4z £0 wZ OO z£𔃾 wix 0wx 0LU ’-4 £0I-41-4000 n 4 0C L 00)1 0 Z0 - - - J z 441 3A cc’-j4A aA CL...4 0 I-4 0oZ.j". o 0 X 0 < oo0 0 w w < " I.- 5 i- I..l34 Z- w - 44. x w 0m -44 41 4 z .444.. wIx 0U) 0 _jZ00 Z00_ jw< e< c J- w 4 . .. z-Cc w w "x w...W >> 0 00 1.-)-) :1-- x I-- ww>3 n9N14 wwmOwmOwb bEbEbE E UbEbE -414 bE ULJ E LU uE wEb EU b Eb EU b Eb Eb Eb Eb 00 0 0 w w 0c ~)00 00 0 0 P4 U- A

Formation of crystalline phase in the glass matrix of Zr-Co-Al glass-matrix composites and its effect on their mechanical properties

NASA Astrophysics Data System (ADS)

Kim, Woo Chul; Kim, Kang Chul; Na, Min Young; Jeong, Seok Hoan; Kim, Won Tae; Kim, Do Hyang

2017-11-01

The microstructural evolution and mechanical properties of Zr-Co-Al alloys, with compositions of (Zr50Co50)x (Zr56Co26Al18)1-x (x = 1/6, 2/6, 3/6, 4/6, 5/6, 1) and Zr54Co35Al11, (referred to as Z1, Z2, Z3, Z4, Z5, Z6, and Z4.5), were investigated. Alloys Z1-Z3 consisted of crystalline phases, while alloys Z4 and Z4.5 consisted of crystalline phase particles ( 3 vol% and 35 vol%, respectively) embedded within the glassy matrix. Alloys Z5 and Z6 consisted of a monolithic glass phase. The crystalline phase of alloys Z1-Z4.5 consisted of primary B2-ZrCo dendrite and an interdendritic B2-ZrCo/Zr6CoAl2 eutectic phase. The B2-ZrCo dendritic phase exhibited a high work-hardening rate, which originated from the deformation-induced B2-to-B33 martensitic transformation. However, when the brittle interdendritic B2-ZrCo/Zr6CoAl2 eutectic phase fraction increased, the work-hardening rate significantly decreased. The ductility of the glass-matrix composites was significantly impaired by the presence of the interdendritic eutectic phase in the crystalline phase. The results indicate that the design of the crystalline particle microstructure is important with regard to enhancing the plasticity of glass-matrix composites.

Joint Inversion of Source Location and Source Mechanism of Induced Microseismics

NASA Astrophysics Data System (ADS)

Liang, C.

2014-12-01

Seismic source mechanism is a useful property to indicate the source physics and stress and strain distribution in regional, local and micro scales. In this study we jointly invert source mechanisms and locations for microseismics induced in fluid fracturing treatment in the oil and gas industry. For the events that are big enough to see waveforms, there are quite a few techniques can be applied to invert the source mechanism including waveform inversion, first polarity inversion and many other methods and variants based on these methods. However, for events that are too small to identify in seismic traces such as the microseismics induced by the fluid fracturing in the Oil and Gas industry, a source scanning algorithms (SSA for short) with waveform stacking are usually applied. At the same time, a joint inversion of location and source mechanism are possible but at a cost of high computation budget. The algorithm is thereby called Source Location and Mechanism Scanning Algorithm, SLMSA for short. In this case, for given velocity structure, all possible combinations of source locations (X,Y and Z) and source mechanism (Strike, Dip and Rake) are used to compute travel-times and polarities of waveforms. Correcting Normal moveout times and polarities, and stacking all waveforms, the (X, Y, Z , strike, dip, rake) combination that gives the strongest stacking waveform is identified as the solution. To solve the problem of high computation problem, CPU-GPU programing is applied. Numerical datasets are used to test the algorithm. The SLMSA has also been applied to a fluid fracturing datasets and reveal several advantages against the location only method: (1) for shear sources, the source only program can hardly locate them because of the canceling out of positive and negative polarized traces, but the SLMSA method can successfully pick up those events; (2) microseismic locations alone may not be enough to indicate the directionality of micro-fractures. The statistics of source mechanisms can certainly provide more knowledges on the orientation of fractures; (3) in our practice, the joint inversion method almost always yield more events than the source only method and for those events that are also picked by the SSA method, the stacking power of SLMSA are always higher than the ones obtained in SSA.

Nature of the Diffuse Source and Its Central Point-like Source in SNR 0509–67.5

DOE Office of Scientific and Technical Information (OSTI.GOV)

Litke, Katrina C.; Chu, You-Hua; Holmes, Abigail

We examine a diffuse emission region near the center of SNR 0509−67.5 to determine its nature. Within this diffuse region we observe a point-like source that is bright in the near-IR, but is not visible in the B and V bands. We consider an emission line observed at 6766 Å and the possibilities that it is Ly α , H α , and [O ii] λ 3727. We examine the spectral energy distribution (SED) of the source, comprised of Hubble Space Telescope B , V , I , J , and H bands in addition to Spitzer /IRAC 3.6, 4.5,more » 5.8, and 8 μ m bands. The peak of the SED is consistent with a background galaxy at z ≈ 0.8 ± 0.2 and a possible Balmer jump places the galaxy at z ≈ 0.9 ± 0.3. These SED considerations support the emission line’s identification as [O ii] λ 3727. We conclude that the diffuse source in SNR 0509−67.5 is a background galaxy at z ≈ 0.82. Furthermore, we identify the point-like source superposed near the center of the galaxy as its central bulge. Finally, we find no evidence for a surviving companion star, indicating a double-degenerate origin for SNR 0509−67.5.« less

Improvement of inverted organic solar cells using acetic acid as an additive for ZnO layer processing

NASA Astrophysics Data System (ADS)

Li, Yang; Liu, Yawen; Liu, Zhihai; Xie, Xiaoyin; Lee, Eun-Cheol

2018-02-01

In this work, we used acetic acid as an additive for the preparation of ZnO layers and improved the performance of poly{4,8-bis[(2-ethylhexyl)-oxy]benzo[1,2-b:4,5-b'] dithiophene-2,6-diyl-alt-3-fluoro-2-[(2-ethylhexyl)carbonyl]thieno[3,4-b]thiophene- 4,6-diyl} (PTB7)-based inverted organic solar cells. The addition of acetic acid to the ZnO precursor solution improved the transparency and conductivity of the sol-gel-synthesized ZnO film, by increasing the grain size of the film. Accordingly, the power conversion efficiency (PCE) of the organic solar cells was improved from 6.42% to 7.55%, which was mainly caused by the enhanced current density and fill factor. The best sample demonstrated a high PCE of 7.85% with negligible hysteresis and good stability. Our results indicate that using acetic acid as an additive for the preparation of ZnO is a simple and effective way of fabricating high-performance inverted organic solar cells.

Inverter for Interchangeable Use as Current Source Inverter and Voltage Source Inverter for Interconnecting to Grid

NASA Astrophysics Data System (ADS)

Teruya, Daisuke; Masukawa, Shigeo; Iida, Shoji

We propose a novel inverter that can be operated either as a Current Source Inverter (CSI) or as a Voltage Source Inverter (VSI) by changing only the control signals. It is proper to apply it to the interconnecting system with renewal energy, such as photovoltaic cells or wind generation systems, to a grid. This inverter is usually operated as the CSI connected to the grid. Even if the energy source has a lower voltage than the grid, the energy can be supplied to the grid through the proposed inverter. The power factor can be briefly maintained at almost unity. When power supply from the grid is interrupted, the proposed circuit should be operated as the VSI in the stand-alone operation mode. In this way, the circuit can maintain a constant output voltage to the loads. In this paper, the proposed circuit configuration and the control schemes for both the CSI and the VSI are described. Further, the circuit characteristics for both are discussed experimentally.

Non-B DB: a database of predicted non-B DNA-forming motifs in mammalian genomes.

PubMed

Cer, Regina Z; Bruce, Kevin H; Mudunuri, Uma S; Yi, Ming; Volfovsky, Natalia; Luke, Brian T; Bacolla, Albino; Collins, Jack R; Stephens, Robert M

2011-01-01

Although the capability of DNA to form a variety of non-canonical (non-B) structures has long been recognized, the overall significance of these alternate conformations in biology has only recently become accepted en masse. In order to provide access to genome-wide locations of these classes of predicted structures, we have developed non-B DB, a database integrating annotations and analysis of non-B DNA-forming sequence motifs. The database provides the most complete list of alternative DNA structure predictions available, including Z-DNA motifs, quadruplex-forming motifs, inverted repeats, mirror repeats and direct repeats and their associated subsets of cruciforms, triplex and slipped structures, respectively. The database also contains motifs predicted to form static DNA bends, short tandem repeats and homo(purine•pyrimidine) tracts that have been associated with disease. The database has been built using the latest releases of the human, chimp, dog, macaque and mouse genomes, so that the results can be compared directly with other data sources. In order to make the data interpretable in a genomic context, features such as genes, single-nucleotide polymorphisms and repetitive elements (SINE, LINE, etc.) have also been incorporated. The database is accessed through query pages that produce results with links to the UCSC browser and a GBrowse-based genomic viewer. It is freely accessible at http://nonb.abcc.ncifcrf.gov.

Toward a Universal Sea Spray Source Function (UNISOURCE)

DTIC Science & Technology

2005-09-30

Toward a Universal Sea Spray Source Function ( UNISOURCE ) Gerrit de Leeuw TNO Defense, Safety and Security P.O. Box 96864 2509 JG The Hague...2005 to 00-00-2005 4. TITLE AND SUBTITLE Toward a Universal Sea Spray Source Function ( UNISOURCE ) 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 APPROACH As part of UNISOURCE , field

Na+/H+ and Na+/NH4+ exchange activities of zebrafish NHE3b expressed in Xenopus oocytes

PubMed Central

Ito, Yusuke; Kato, Akira; Hirata, Taku; Hirose, Shigehisa

2014-01-01

Zebrafish Na+/H+ exchanger 3b (zNHE3b) is highly expressed in the apical membrane of ionocytes where Na+ is absorbed from ion-poor fresh water against a concentration gradient. Much in vivo data indicated that zNHE3b is involved in Na+ absorption but not leakage. However, zNHE3b-mediated Na+ absorption has not been thermodynamically explained, and zNHE3b activity has not been measured. To address this issue, we overexpressed zNHE3b in Xenopus oocytes and characterized its activity by electrophysiology. Exposure of zNHE3b oocytes to Na+-free media resulted in significant decrease in intracellular pH (pHi) and intracellular Na+ activity (aNai). aNai increased significantly when the cytoplasm was acidified by media containing CO2-HCO3− or butyrate. Activity of zNHE3b was inhibited by amiloride or 5-ethylisopropyl amiloride (EIPA). Although the activity was accompanied by a large hyperpolarization of ∼50 mV, voltage-clamp experiments showed that Na+/H+ exchange activity of zNHE3b is electroneutral. Exposure of zNHE3b oocytes to medium containing NH3/NH4+ resulted in significant decreases in pHi and aNai and significant increase in intracellular NH4+ activity, indicating that zNHE3b mediates the Na+/NH4+ exchange. In low-Na+ (0.5 mM) media, zNHE3b oocytes maintained aNai of 1.3 mM, and Na+-influx was observed when pHi was decreased by media containing CO2-HCO3− or butyrate. These results provide thermodynamic evidence that zNHE3b mediates Na+ absorption from ion-poor fresh water by its Na+/H+ and Na+/NH4+ exchange activities. PMID:24401990

Steep radio spectra in high-redshift radio galaxies

NASA Technical Reports Server (NTRS)

Krolik, Julian H.; Chen, Wan

1991-01-01

The generic spectrum of an optically thin synchrotron source steepens by 0.5 in spectral index from low frequencies to high whenever the source lifetime is greater than the energy-loss timescale for at least some of the radiating electrons. Three effects tend to decrease the frequency nu(b) of this spectral bend as the source redshift increases: (1) for fixed bend frequency nu* in the rest frame, nu(b) = nu*/(1 + z); (2) losses due to inverse Compton scattering the microwave background rise with redshift as (1 + z) exp 4, so that, for fixed residence time in the radiating region, the energy of the lowest energy electron that can cool falls rapidly with increasing redshift; and (3) if the magnetic field is proportional to the equipartition field and the emitting volume is fixed or slowly varying, flux-limited samples induce a selection effect favoring low nu* at high z because higher redshift sources require higher emissivity to be included in the sample, and hence have stronger implied fields and more rapid synchrotron losses. A combination of these effects may explain the trend observed in the 3CR sample for higher redshift radio galaxies to have steeper spectra, and the successful use of ultrasteep spectrum surveys to locate high-redshift galaxies.

The clustering and bias of radio-selected AGN and star-forming galaxies in the COSMOS field

NASA Astrophysics Data System (ADS)

Hale, C. L.; Jarvis, M. J.; Delvecchio, I.; Hatfield, P. W.; Novak, M.; Smolčić, V.; Zamorani, G.

2018-03-01

Dark matter haloes in which galaxies reside are likely to have a significant impact on their evolution. We investigate the link between dark matter haloes and their constituent galaxies by measuring the angular two-point correlation function of radio sources, using recently released 3 GHz imaging over ˜2 deg2 of the Cosmological Evolution Survey (COSMOS) field. We split the radio source population into star-forming galaxies (SFGs) and active galactic nuclei (AGN), and further separate the AGN into radiatively efficient and inefficient accreters. Restricting our analysis to z < 1, we find SFGs have a bias, b = 1.5 ^{+0.1}_{-0.2}, at a median redshift of z = 0.62. On the other hand, AGN are significantly more strongly clustered with b = 2.1 ± 0.2 at a median redshift of 0.7. This supports the idea that AGN are hosted by more massive haloes than SFGs. We also find low accretion rate AGN are more clustered (b = 2.9 ± 0.3) than high accretion rate AGN (b = 1.8^{+0.4}_{-0.5}) at the same redshift (z ˜ 0.7), suggesting that low accretion rate AGN reside in higher mass haloes. This supports previous evidence that the relatively hot gas that inhabits the most massive haloes is unable to be easily accreted by the central AGN, causing them to be inefficient. We also find evidence that low accretion rate AGN appear to reside in halo masses of Mh ˜ 3-4 × 1013 h-1 M⊙ at all redshifts. On the other hand, the efficient accreters reside in haloes of Mh ˜ 1-2 × 1013 h-1 M⊙ at low redshift but can reside in relatively lower mass haloes at higher redshifts. This could be due to the increased prevalence of cold gas in lower mass haloes at z ≥ 1 compared to z < 1.

Printed 2 V-operating organic inverter arrays employing a small-molecule/polymer blend.

PubMed

Shiwaku, Rei; Takeda, Yasunori; Fukuda, Takashi; Fukuda, Kenjiro; Matsui, Hiroyuki; Kumaki, Daisuke; Tokito, Shizuo

2016-10-04

Printed organic thin-film transistors (OTFTs) are well suited for low-cost electronic applications, such as radio frequency identification (RFID) tags and sensors. Achieving both high carrier mobility and uniform electrical characteristics in printed OTFT devices is essential in these applications. Here, we report on printed high-performance OTFTs and circuits using silver nanoparticle inks for the source/drain electrodes and a blend of dithieno[2,3-d;2',3'-d']benzo[1,2-b;4,5-b']dithiophene (DTBDT-C 6 ) and polystyrene for the organic semiconducting layer. A high saturation region mobility of 1.0 cm 2  V -1  s -1 at low operation voltage of -5 V was obtained for relatively short channel lengths of 9 μm. All fifteen of the printed pseudo-CMOS inverter circuits were formed on a common substrate and operated at low operation voltage of 2 V with the total variation in threshold voltage of 0.35 V. Consequently, the printed OTFT devices can be used in more complex integrated circuit applications requiring low manufacturing cost over large areas.

Submerged Arc Welding Control via Arc Sensing.

DTIC Science & Technology

1986-01-31

B . NARROW- GAP...processing. 17 %7 z >- OD Z zO a, 0 "rn0 0 0)0 01 b 3- 00 o 00 0Lz i- >-,N 0 J - i z %a 0 00 .0. 0 ----- 0 0 0 00 " 0 >,. 0(050:J Ow U,)coW 0~ ~ 0D 0 04 24 w...By 29 * °° () 4-4 30 -4- .4 9- ____ ___3 C.- 4~JGo ;,a C3- 4- 4-s L 0 C3 4-4 ( L >’. L L U)0 -- -- LL b 0 -410 41 .,1 41i a cc (4- 4.: m- . if

Radio polarization properties of quasars and active galaxies at high redshifts

NASA Astrophysics Data System (ADS)

Vernstrom, T.; Gaensler, B. M.; Vacca, V.; Farnes, J. S.; Haverkorn, M.; O'Sullivan, S. P.

2018-04-01

We present the largest ever sample of radio polarization properties for z > 4 sources, with 14 sources having significant polarization detections. Using wide-band data from the Karl G. Jansky Very Large Array, we obtained the rest-frame total intensity and polarization properties of 37 radio sources, nine of which have spectroscopic redshifts in the range 1 ≤ z ≤ 1.4, with the other 28 having spectroscopic redshifts in the range 3.5 ≤ z ≤ 6.21. Fits are performed for the Stokes I and fractional polarization spectra, and Faraday rotation measures are derived using rotation measure synthesis and QU fitting. Using archival data of 476 polarized sources, we compare high-redshift (z > 3) source properties to a 15 GHz rest-frame luminosity matched sample of low-redshift (z < 3) sources to investigate if the polarization properties of radio sources at high redshifts are intrinsically different than those at low redshift. We find a mean of the rotation measure absolute values, corrected for Galactic rotation, of 50 ± 22 rad m-2 for z > 3 sources and 57 ± 4 rad m-2 for z < 3. Although there is some indication of lower intrinsic rotation measures at high-z possibly due to higher depolarization from the high-density environments, using several statistical tests we detect no significant difference between low- and high-redshift sources. Larger samples are necessary to determine any true physical difference.

Constraints on z~10 Galaxies from the Deepest Hubble Space Telescope NICMOS Fields

NASA Astrophysics Data System (ADS)

Bouwens, R. J.; Illingworth, G. D.; Thompson, R. I.; Franx, M.

2005-05-01

We use all available fields with deep NICMOS imaging to search for J110-dropouts (H160,AB<~28) at z~10. Our primary data set for this search is the two J110+H160 NICMOS fields taken in parallel with the Advanced Camera for Surveys (ACS) Hubble Ultra Deep Field (UDF). The 5 σ limiting magnitudes were ~28.6 in J110 and ~28.5 in H160 (0.6" apertures). Several shallower fields were also used: J110+H160 NICMOS frames available over the Hubble Deep Field (HDF) North, the HDF-South NICMOS parallel, and the ACS UDF (with 5 σ limiting magnitudes in J110 and H160 ranging from 27.0 to 28.2). The primary selection criterion was (J110-H160)AB>1.8. Eleven such sources were found in all search fields using this criterion. Eight of these are clearly ruled out as credible z~10 sources, either as a result of detections (>2 σ) blueward of J110 or their colors redward of the break (H160-K~1.5) (redder than >~98% of lower redshift dropouts). The nature of the three remaining sources could not be determined from the data. This number appears consistent with the expected contamination from low-redshift interlopers. Analysis of the stacked images for the three candidates also suggests some contamination. Regardless of their true redshifts, the actual number of z~10 sources must be three or fewer. To assess the significance of these results, two lower redshift samples (a z~3.8 B-dropout and z~6 i-dropout sample) were projected to z~7-13 using a (1+z)-1 size scaling (for fixed luminosity). They were added to the image frames and the selection was repeated, giving 15.6 and 4.8 J110-dropouts, respectively. This suggests that to the limit of this probe (~0.3L*z=3), there has been evolution from z~3.8 and possibly from z~6. This is consistent with the strong evolution already noted at z~6 and z~7.5 relative to z~3-4. Even assuming that three sources from this probe are at z~10, the rest-frame continuum UV (~1500 Å) luminosity density at z~10 (integrated down to 0.3L*z=3) is just 0.19+0.13-0.09 times that at z~3.8 (or 0.19+0.15-0.10 times, including the small effect from cosmic variance). However, if none of our sources are at z~10, this ratio has a 1 σ upper limit of 0.07. Based on observations made with the NASA/ESA Hubble Space Telescope, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555.

Inhibition of growth of Zymomonas mobilis by model compounds found in lignocellulosic hydrolysates

PubMed Central

2013-01-01

Background During the pretreatment of biomass feedstocks and subsequent conditioning prior to saccharification, many toxic compounds are produced or introduced which inhibit microbial growth and in many cases, production of ethanol. An understanding of the toxic effects of compounds found in hydrolysate is critical to improving sugar utilization and ethanol yields in the fermentation process. In this study, we established a useful tool for surveying hydrolysate toxicity by measuring growth rates in the presence of toxic compounds, and examined the effects of selected model inhibitors of aldehydes, organic and inorganic acids (along with various cations), and alcohols on growth of Zymomonas mobilis 8b (a ZM4 derivative) using glucose or xylose as the carbon source. Results Toxicity strongly correlated to hydrophobicity in Z. mobilis, which has been observed in Escherichia coli and Saccharomyces cerevisiae for aldehydes and with some exceptions, organic acids. We observed Z. mobilis 8b to be more tolerant to organic acids than previously reported, although the carbon source and growth conditions play a role in tolerance. Growth in xylose was profoundly inhibited by monocarboxylic organic acids compared to growth in glucose, whereas dicarboxylic acids demonstrated little or no effects on growth rate in either substrate. Furthermore, cations can be ranked in order of their toxicity, Ca++ > > Na+ > NH4+ > K+. HMF (5-hydroxymethylfurfural), furfural and acetate, which were observed to contribute to inhibition of Z. mobilis growth in dilute acid pretreated corn stover hydrolysate, do not interact in a synergistic manner in combination. We provide further evidence that Z. mobilis 8b is capable of converting the aldehydes furfural, vanillin, 4-hydroxybenzaldehyde and to some extent syringaldehyde to their alcohol forms (furfuryl, vanillyl, 4-hydroxybenzyl and syringyl alcohol) during fermentation. Conclusions Several key findings in this report provide a mechanism for predicting toxic contributions of inhibitory components of hydrolysate and provide guidance for potential process development, along with potential future strain improvement and tolerance strategies. PMID:23837621

Experimental and Analytical Investigation of the Vibration Characteristics of a Remotely Piloted Helicopter

DTIC Science & Technology

1992-06-01

IQ Z -104.9* 171: .0471 6/LB XP11 ) EXP N I SETUP W TF DUAL v, 400 CHAB FR 200HZ 0:30:to * /A AIS ’"TS.H A S 8 -IV ISO -10 •]’Ft B/A AY6 IL TEý . 2 " N C...4 A. SOURCES OF HELICOPTER VIBRATION .... ..... 4 B. VIBRATION REDUCTION TECHNIQUES ..... ...... 6 1. Passive Systems .......... ............ 6 2 ...EXCITATION SYSTEM ...... ............. 22 C. DATA ACQUISITION SYSTEM .... .......... 27 1. Components ......... .............. 27 2 . System Operation

Silicon controlled rectifier polyphase bridge inverter commutated with gate-turn-off thyristor

NASA Technical Reports Server (NTRS)

Edwards, Dean B. (Inventor); Rippel, Wally E. (Inventor)

1986-01-01

A polyphase SCR inverter (10) having N switching poles, each comprised of two SCR switches (1A, 1B; 2A, 2B . . . NA, NB) and two diodes (D1B; D1B; D2A, D2B . . . DNA, DNB) in series opposition with saturable reactors (L1A, L1B; L2A, L2B . . . LNA, LNB) connecting the junctions between the SCR switches and diodes to an output terminal (1, 2 . . . 3) is commutated with only one GTO thyristor (16) connected between the common negative terminal of a dc source and a tap of a series inductor (14) connected to the positive terminal of the dc source. A clamp winding (22) and diode (24) are provided, as is a snubber (18) which may have its capacitance (c) sized for maximum load current divided into a plurality of capacitors (C.sub.1, C.sub.2 . . . C.sub.N), each in series with an SCR switch S.sub.1, S.sub.2 . . . S.sub.N). The total capacitance may be selected by activating selected switches as a function of load current. A resistor 28 and SCR switch 26 shunt reverse current when the load acts as a generator, such as a motor while braking.

A Single-Phase Current Source Solar Inverter with Constant Instantaneous Power, Improved Reliability, and Reduced-Size DC-Link Filter

NASA Astrophysics Data System (ADS)

Bush, Craig R.

This dissertation presents a novel current source converter topology that is primarily intended for single-phase photovoltaic (PV) applications. In comparison with the existing PV inverter technology, the salient features of the proposed topology are: a) the low frequency (double of line frequency) ripple that is common to single-phase inverters is greatly reduced; b) the absence of low frequency ripple enables significantly reduced size pass components to achieve necessary DC-link stiffness and c) improved maximum power point tracking (MPPT) performance is readily achieved due to the tightened current ripple even with reduced-size passive components. The proposed topology does not utilize any electrolytic capacitors. Instead an inductor is used as the DC-link filter and reliable AC film capacitors are utilized for the filter and auxiliary capacitor. The proposed topology has a life expectancy on par with PV panels. The proposed modulation technique can be used for any current source inverter where an unbalanced three-phase operation is desires such as active filters and power controllers. The proposed topology is ready for the next phase of microgrid and power system controllers in that it accepts reactive power commands. This work presents the proposed topology and its working principle supported by with numerical verifications and hardware results. Conclusions and future work are also presented.

Radiological analysis of plutonium glass batches with natural/enriched boron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rainisch, R.

2000-06-22

The disposition of surplus plutonium inventories by the US Department of Energy (DOE) includes the immobilization of certain plutonium materials in a borosilicate glass matrix, also referred to as vitrification. This paper addresses source terms of plutonium masses immobilized in a borosilicate glass matrix where the glass components include both natural boron and enriched boron. The calculated source terms pertain to neutron and gamma source strength (particles per second), and source spectrum changes. The calculated source terms corresponding to natural boron and enriched boron are compared to determine the benefits (decrease in radiation source terms) for to the use ofmore » enriched boron. The analysis of plutonium glass source terms shows that a large component of the neutron source terms is due to (a, n) reactions. The Americium-241 and plutonium present in the glass emit alpha particles (a). These alpha particles interact with low-Z nuclides like B-11, B-10, and O-17 in the glass to produce neutrons. The low-Z nuclides are referred to as target particles. The reference glass contains 9.4 wt percent B{sub 2}O{sub 3}. Boron-11 was found to strongly support the (a, n) reactions in the glass matrix. B-11 has a natural abundance of over 80 percent. The (a, n) reaction rates for B-10 are lower than for B-11 and the analysis shows that the plutonium glass neutron source terms can be reduced by artificially enriching natural boron with B-10. The natural abundance of B-10 is 19.9 percent. Boron enriched to 96-wt percent B-10 or above can be obtained commercially. Since lower source terms imply lower dose rates to radiation workers handling the plutonium glass materials, it is important to know the achievable decrease in source terms as a result of boron enrichment. Plutonium materials are normally handled in glove boxes with shielded glass windows and the work entails both extremity and whole-body exposures. Lowering the source terms of the plutonium batches will make the handling of these materials less difficult and will reduce radiation exposure to operating workers.« less

Well-Balanced Ambipolar Conjugated Polymers Featuring Mild Glass Transition Temperatures Toward High-Performance Flexible Field-Effect Transistors.

PubMed

Shi, Keli; Zhang, Weifeng; Gao, Dong; Zhang, Shiying; Lin, Zuzhang; Zou, Ye; Wang, Liping; Yu, Gui

2018-03-01

Conjugated polymers, which can be fabricated by simple processing techniques and possess excellent electrical performance, are key to the fabrication of flexible polymer field-effect transistors (PFETs) and integrated circuits. Herein, two ambipolar conjugated polymers based on (3E,7E)-3,7-bis(2-oxo-1H-pyrrolo[2,3-b]pyridin-3(2H)-ylidene)benzo[1,2-b:4,5-b']difuran-2,6(3H,7H)-dione and dithienylbenzothiadiazole units, namely PNBDOPV-DTBT and PNBDOPV-DTF2BT, are developed. Both copolymers possess almost planar conjugated backbone conformations and suitable highest occupied molecular orbital (HOMO)/lowest unoccupied molecular orbital (LUMO) energy levels (-5.64/-4.38 eV for PNBDOPV-DTBT and -5.79/-4.48 eV for PNBDOPV-DTF2BT). Note that PNBDOPV-DTBT has a glass transition temperature (140 °C) lower than the deformation temperature of polyethylene terephthalate (PET), meaning well-ordered molecular packing can be obtained on PET substrate before its deformation in mild thermal annealing process. Flexible PFETs based on PNBDOPV-DTBT fabricated on PET substrates exhibit high and well-balanced hole/electron mobilities of 4.68/4.72 cm 2 V -1 s -1 under ambient conditions. After the further modification of Au source/drain electrodes with 1-octanethiol self-assembled monolayers, impressively high and well-balanced hole/electron mobilities up to 5.97/7.07 cm 2 V -1 s -1 are achieved in the flexible PFETs. Meanwhile, flexible complementary-like inverters based on PNBDOPV-DTBT on PET substrate also afford a much high gain of 148. The device performances of both the PFETs and inverters are among the highest values for ambipolar conjugated polymers reported to date. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Geodesy and Cartography (Selected Articles),

DTIC Science & Technology

1979-08-10

C-OO/b73 GEODESY AND CARTOGRAPHY (SELECTED ARTICLES) English pages: 40 Source: GeodezJa i Kartografia, Vol. 27, Nr. 1, 1978, PP. 3-27 Country of...1976. 14) kledzixski, J., Zibek, Z., Czarnecki, K., Rogowski, J.B., Problems in Using Satellite Surveys in an Astronomical-Geodesic Network, Geodezja i...Based on Observations of Low-Low Satellites Using Collocation Methods, Geodezja i Kartografia, Vol. XXVI, No. 4, 1977. [-7. Krynski, J., Schwarz, K.P

Jet Noise Shielding Provided by a Hybrid Wing Body Aircraft

NASA Technical Reports Server (NTRS)

Doty, Michael J.; Brooks, Thomas F.; Burley, Casey L.; Bahr, Christopher J.; Pope, Dennis S.

2014-01-01

One approach toward achieving NASA's aggressive N+2 noise goal of 42 EPNdB cumulative margin below Stage 4 is through the use of novel vehicle configurations like the Hybrid Wing Body (HWB). Jet noise measurements from an HWB acoustic test in NASA Langley's 14- by 22-Foot Subsonic Tunnel are described. Two dual-stream, heated Compact Jet Engine Simulator (CJES) units are mounted underneath the inverted HWB model on a traversable support to permit measurement of varying levels of shielding provided by the fuselage. Both an axisymmetric and low noise chevron nozzle set are investigated in the context of shielding. The unshielded chevron nozzle set shows 1 to 2 dB of source noise reduction (relative to the unshielded axisymmetric nozzle set) with some penalties at higher frequencies. Shielding of the axisymmetric nozzles shows up to 6.5 dB of reduction at high frequency. The combination of shielding and low noise chevrons shows benefits beyond the expected additive benefits of the two, up to 10 dB, due to the effective migration of the jet source peak noise location upstream for increased shielding effectiveness. Jet noise source maps from phased array results processed with the Deconvolution Approach for the Mapping of Acoustic Sources (DAMAS) algorithm reinforce these observations.

Power conversion apparatus and method

DOEpatents

Su, Gui-Jia [Knoxville, TN

2012-02-07

A power conversion apparatus includes an interfacing circuit that enables a current source inverter to operate from a voltage energy storage device (voltage source), such as a battery, ultracapacitor or fuel cell. The interfacing circuit, also referred to as a voltage-to-current converter, transforms the voltage source into a current source that feeds a DC current to a current source inverter. The voltage-to-current converter also provides means for controlling and maintaining a constant DC bus current that supplies the current source inverter. The voltage-to-current converter also enables the current source inverter to charge the voltage energy storage device, such as during dynamic braking of a hybrid electric vehicle, without the need of reversing the direction of the DC bus current.

PHOTOMETRIC REDSHIFTS IN THE HAWAII-HUBBLE DEEP FIELD-NORTH (H-HDF-N)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, G.; Xue, Y. Q.; Kong, X.

2015-01-01

We derive photometric redshifts (z {sub phot}) for sources in the entire (∼0.4 deg{sup 2}) Hawaii-Hubble Deep Field-North (H-HDF-N) field with the EAzY code, based on point-spread-function-matched photometry of 15 broad bands from the ultraviolet (U band) to mid-infrared (IRAC 4.5 μm). Our catalog consists of a total of 131,678 sources. We evaluate the z {sub phot} quality by comparing z {sub phot} with spectroscopic redshifts (z {sub spec}) when available, and find a value of normalized median absolute deviation σ{sub NMAD} = 0.029 and an outlier fraction of 5.5% (outliers are defined as sources having |z{sub phot} – z{sub spec} |/(1more » + z{sub spec} ) > 0.15) for non-X-ray sources. More specifically, we obtain σ{sub NMAD} = 0.024 with 2.7% outliers for sources brighter than R = 23 mag, σ{sub NMAD} = 0.035 with 7.4% outliers for sources fainter than R = 23 mag, σ{sub NMAD} = 0.026 with 3.9% outliers for sources having z < 1, and σ{sub NMAD} = 0.034 with 9.0% outliers for sources having z > 1. Our z {sub phot} quality shows an overall improvement over an earlier z {sub phot} work that focused only on the central H-HDF-N area. We also classify each object as a star or galaxy through template spectral energy distribution fitting and complementary morphological parameterization, resulting in 4959 stars and 126,719 galaxies. Furthermore, we match our catalog with the 2 Ms Chandra Deep Field-North main X-ray catalog. For the 462 matched non-stellar X-ray sources (281 having z {sub spec}), we improve their z {sub phot} quality by adding three additional active galactic nucleus templates, achieving σ{sub NMAD} = 0.035 and an outlier fraction of 12.5%. We make our catalog publicly available presenting both photometry and z {sub phot}, and provide guidance on how to make use of our catalog.« less

Reionization in a cold dark matter universe: The feedback of galaxy formation on the intergalactic medium

NASA Technical Reports Server (NTRS)

Shapiro, Paul R.; Giroux, Mark L.; Babul, Arif

1994-01-01

We study the coupled evolution of the intergalactic medium (IGM) and the emerging structure in the universe in the context of the cold dark matter (CDM) model, with a special focus on the consequences of imposing reionization and the Gunn-Peterson constraint as a boundary condition on the model. We have calculated the time-varying density of the IGM by coupling our detailed, numerical calculations of the thermal and ionization balance and radiative transfer in a uniform, spatially averaged IGM of H and He, including the mean opacity of an evolving distribution of gas clumps which correspond to quasar absorption line clouds, to the linearized equations for the growth of density fluctuations in both the gaseous and dark matter components in a CDM universe. We use the linear growth equations to identify the fraction of the gas which must have collapsed out at each epoch, an approach similar in spirit to the so-called Press-Schechter formalism. We identify the IGM density with the uncollapsed baryon fraction. The collapsed fraction is postulated to be a source of energy injection into the IGM, by radiation or bulk hydrodynamical heating (e.g., via shocks) or both, at a rate which is marginally enough to satisfy the Gunn-Peterson constraint at z less than 5. Our results include the following: (1) We find that the IGM in a CDM model must have contained a substantial fraction of the total baryon density of the universe both during and after its reionization epoch. (2) As a result, our previous conclusion that the observed Quasi-Stellar Objects (QSOs) at high redshift are not sufficient to ionize the IGM enough to satisfy the Gunn-Peterson constraint is confirmed. (3) We predict a detectable He II Gunn-Peterson effect at 304(1 + z) A in the spectra of quasars at a range of redshift z greater than or approx. 3, depending on the nature of the sources of IGM reionization. (4) We find, moreover, that a CDM model with high bias parameter b (i.e., b greater than or approx. 2) cannot account for the baryon content of the universe at z approximately 3 observed in quasar absorption line gas unless Omega (sub B) significantly exceeds the maximum value allowed by big bang nucleocynthesis. (5) For a CDM model with bias parameter within the allowed range of (lower) values, the lower limit to Omega(sub B) imposed by big bang nucleosynthesis (Omega(sub B) h(sup 2) greater than or equal to 0.01) combines with our results to yield the minimum IGM density for the CDM fodel. For CDM with b = 1 (Cosmic Background Explorer (COBE) normalization), we find Omega(sub IGM)(sup min) (z approximately 4) approx. equal 0.02-0.03, and Omega(sub IGM)(sup min)(z approximately 0) approx. equal 0.005-0.03, depending upon the nature of the sources of IGM reionization. (6) In general, we find that self-consistent reionization of the IGM by the collapsed baryon fraction has a strong effect on the rate of collapse. (7) As a further example, we show that the feedback effect on the IGM of energy release by the collapsed baryon fraction may explain the slow evolution of the observed comoving QSO number density between z = 5 and z = 2, followed by the sharp decline after z = 2.

Proceedings of the 8th Matched-Field Processing Workshop, 12-14 June 1996,

DTIC Science & Technology

1996-10-01

and M. B. Porter Active Matched-Field Tracking (AMFT) ............................................ 29 Homer Bucker Matched-Field Track - Before - Detect (TBD...CD I- z - .4 U) - U :T 0 4,) 0j w CfI -ID 0 ci) CD) CD CD o0 0 C 0D CD 0C o 00 Matched-Field Track - Before - Detect (TBD) Processing using SWellEX...surfaces are used in a source-track search. Track - before - detect (TBD) processing makes use of this technique to extract source track information so that the

Group Sparse Optimization by Alternating Direction Method

DTIC Science & Technology

2012-11-22

to solving the following linear system: (β1G TG+ β2A TA)x = β1G T z −GTλ1 + β2AT b+ATλ2. (3.5) Note that GTG ∈ Rn×n is a diagonal matrix whose i-th...diagonal entry is the number of repetitions of xi in x̃. When the groups form an complete cover of the solution, the diagonal entries of GTG will be...positive, so GTG is invertible. In the next subsection, we will show that an incomplete cover case can be converted to a complete cover case by

Identifications and Photometric Redshifts of the 2 Ms Chandra Deep Field-South Sources

NASA Astrophysics Data System (ADS)

Luo, B.; Brandt, W. N.; Xue, Y. Q.; Brusa, M.; Alexander, D. M.; Bauer, F. E.; Comastri, A.; Koekemoer, A.; Lehmer, B. D.; Mainieri, V.; Rafferty, D. A.; Schneider, D. P.; Silverman, J. D.; Vignali, C.

2010-04-01

We present reliable multiwavelength identifications and high-quality photometric redshifts for the 462 X-ray sources in the ≈2 Ms Chandra Deep Field-South (CDF-S) survey. Source identifications are carried out using deep optical-to-radio multiwavelength catalogs, and are then combined to create lists of primary and secondary counterparts for the X-ray sources. We identified reliable counterparts for 442 (95.7%) of the X-ray sources, with an expected false-match probability of ≈ 6.2%; we also selected four additional likely counterparts. The majority of the other 16 X-ray sources appear to be off-nuclear sources, sources associated with galaxy groups and clusters, high-redshift active galactic nuclei (AGNs), or spurious X-ray sources. A likelihood-ratio method is used for source matching, which effectively reduces the false-match probability at faint magnitudes compared to a simple error-circle matching method. We construct a master photometric catalog for the identified X-ray sources including up to 42 bands of UV-to-infrared data, and then calculate their photometric redshifts (photo-z's). High accuracy in the derived photo-z's is accomplished owing to (1) the up-to-date photometric data covering the full spectral energy distributions (SEDs) of the X-ray sources, (2) more accurate photometric data as a result of source deblending for ≈10% of the sources in the infrared bands and a few percent in the optical and near-infrared bands, (3) a set of 265 galaxy, AGN, and galaxy/AGN hybrid templates carefully constructed to best represent all possible SEDs, (4) the Zurich Extragalactic Bayesian Redshift Analyzer used to derive the photo-z's, which corrects the SED templates to best represent the SEDs of real sources at different redshifts and thus improves the photo-z quality. The reliability of the photo-z's is evaluated using the subsample of 220 sources with secure spectroscopic redshifts. We achieve an accuracy of |Δz|/(1 + z) ≈ 1% and an outlier [with |Δz|/(1 + z)>0.15] fraction of ≈1.4% for sources with spectroscopic redshifts. We performed blind tests to derive a more realistic estimate of the photo-z quality for sources without spectroscopic redshifts. We expect there are ≈9% outliers for the relatively brighter sources (R <~ 26), and the outlier fraction will increase to ≈15%-25% for the fainter sources (R >~ 26). The typical photo-z accuracy is ≈6%-7%. The outlier fraction and photo-z accuracy do not appear to have a redshift dependence (for z ≈ 0-4). These photo-z's appear to be the best obtained so far for faint X-ray sources, and they have been significantly (gsim50%) improved compared to previous estimates of the photo-z's for the X-ray sources in the ≈2 Ms Chandra Deep Field-North and ≈1 Ms CDF-S.

Deep 20-GHz survey of the Chandra Deep Field South and SDSS Stripe 82: source catalogue and spectral properties

NASA Astrophysics Data System (ADS)

Franzen, Thomas M. O.; Sadler, Elaine M.; Chhetri, Rajan; Ekers, Ronald D.; Mahony, Elizabeth K.; Murphy, Tara; Norris, Ray P.; Waldram, Elizabeth M.; Whittam, Imogen H.

2014-04-01

We present a source catalogue and first results from a deep, blind radio survey carried out at 20 GHz with the Australia Telescope Compact Array, with follow-up observations at 5.5, 9 and 18 GHz. The Australia Telescope 20 GHz (AT20G) deep pilot survey covers a total area of 5 deg2 in the Chandra Deep Field South and in Stripe 82 of the Sloan Digital Sky Survey. We estimate the survey to be 90 per cent complete above 2.5 mJy. Of the 85 sources detected, 55 per cent have steep spectra (α _{1.4}^{20} < -0.5) and 45 per cent have flat or inverted spectra (α _{1.4}^{20} ≥ -0.5). The steep-spectrum sources tend to have single power-law spectra between 1.4 and 18 GHz, while the spectral indices of the flat- or inverted-spectrum sources tend to steepen with frequency. Among the 18 inverted-spectrum (α _{1.4}^{20} ≥ 0.0) sources, 10 have clearly defined peaks in their spectra with α _{1.4}^{5.5} > 0.15 and α 9^{18} < -0.15. On a 3-yr time-scale, at least 10 sources varied by more than 15 per cent at 20 GHz, showing that variability is still common at the low flux densities probed by the AT20G-deep pilot survey. We find a strong and puzzling shift in the typical spectral index of the 15-20-GHz source population when combining data from the AT20G, Ninth Cambridge and Tenth Cambridge surveys: there is a shift towards a steeper-spectrum population when going from ˜1 Jy to ˜5 mJy, which is followed by a shift back towards a flatter-spectrum population below ˜5 mJy. The 5-GHz source-count model by Jackson & Wall, which only includes contributions from FRI and FRII sources, and star-forming galaxies, does not reproduce the observed flattening of the flat-spectrum counts below ˜5 mJy. It is therefore possible that another population of sources is contributing to this effect.

Non-B DB v2.0: a database of predicted non-B DNA-forming motifs and its associated tools.

PubMed

Cer, Regina Z; Donohue, Duncan E; Mudunuri, Uma S; Temiz, Nuri A; Loss, Michael A; Starner, Nathan J; Halusa, Goran N; Volfovsky, Natalia; Yi, Ming; Luke, Brian T; Bacolla, Albino; Collins, Jack R; Stephens, Robert M

2013-01-01

The non-B DB, available at http://nonb.abcc.ncifcrf.gov, catalogs predicted non-B DNA-forming sequence motifs, including Z-DNA, G-quadruplex, A-phased repeats, inverted repeats, mirror repeats, direct repeats and their corresponding subsets: cruciforms, triplexes and slipped structures, in several genomes. Version 2.0 of the database revises and re-implements the motif discovery algorithms to better align with accepted definitions and thresholds for motifs, expands the non-B DNA-forming motifs coverage by including short tandem repeats and adds key visualization tools to compare motif locations relative to other genomic annotations. Non-B DB v2.0 extends the ability for comparative genomics by including re-annotation of the five organisms reported in non-B DB v1.0, human, chimpanzee, dog, macaque and mouse, and adds seven additional organisms: orangutan, rat, cow, pig, horse, platypus and Arabidopsis thaliana. Additionally, the non-B DB v2.0 provides an overall improved graphical user interface and faster query performance.

Prime Contract Awards Alphabetically by Contractor, by State or Country, and Place. Part 2. (American Nucleonics Corp.-Beachler Mark Associates)

DTIC Science & Technology

1989-01-01

Inn In -4 MOI -e4.~~3fm >U 6-z a ~ Wz ;w<<* -4.c 00)00 P.U~ 11.0U 22 02A4UZ z222 >Z 2222 02 * 00 U 0.-411)M)00 P. 0) U)n In C0U)M)004 0o RtO P 0)1a L o...z2 22222222zzz B 40 I W) 11 222 2 222 Z 222zz Z zzzzz2ZZZZ 11 1 Com 00n00 IV0) rto 04 l (0-4q O0 ()N04 0 ) I 0(0-4in0)-0000 B- >I woo B 11400) Rt...400o cc00. C X a vs I M-4 N X LU 4 0ULI L.. I.L. g,-4N-41U’I 4 N x 0U 5 cc N .40-4 N 2NGO(0 U-4 <-4 0)4 k ~N00004 (1 X wo Cci *00 IT4000 If .0 I 0-4

Design and Implementation of nine level multilevel Inverter

NASA Astrophysics Data System (ADS)

Dhineshkumar, K.; Subramani, C.

2018-04-01

In this paper the solar based boost converter integrated Nine level multilevel inverter presented. It uses 7 switches to produce nine level output stepped waveform. The aim of the work to produce 9 level wave form using solar and boost converter. The conventional inverter has multiple sources and has 16 switches are required and also more number of voltage sources required. The proposed inverter required single solar panel and reduced number of switches and integrated boost converter which increase the input voltage of the inverter. The proposed inverter simulated and compared with R load using Mat lab and prototype model experimentally verified. The proposed inverter can be used in n number of solar applications.

A single-chain variable fragment intrabody prevents intracellular polymerization of Z α1-antitrypsin while allowing its antiproteinase activity.

PubMed

Ordóñez, Adriana; Pérez, Juan; Tan, Lu; Dickens, Jennifer A; Motamedi-Shad, Neda; Irving, James A; Haq, Imran; Ekeowa, Ugo; Marciniak, Stefan J; Miranda, Elena; Lomas, David A

2015-06-01

Mutant Z α1-antitrypsin (E342K) accumulates as polymers within the endoplasmic reticulum (ER) of hepatocytes predisposing to liver disease, whereas low levels of circulating Z α1-antitrypsin lead to emphysema by loss of inhibition of neutrophil elastase. The ideal therapy should prevent polymer formation while preserving inhibitory activity. Here we used mAb technology to identify interactors with Z α1-antitrypsin that comply with both requirements. We report the generation of an mAb (4B12) that blocked α1-antitrypsin polymerization in vitro at a 1:1 molar ratio, causing a small increase of the stoichiometry of inhibition for neutrophil elastase. A single-chain variable fragment (scFv) intrabody was generated based on the sequence of mAb4B12. The expression of scFv4B12 within the ER (scFv4B12KDEL) and along the secretory pathway (scFv4B12) reduced the intracellular polymerization of Z α1-antitrypsin by 60%. The scFv4B12 intrabody also increased the secretion of Z α1-antitrypsin that retained inhibitory activity against neutrophil elastase. MAb4B12 recognized a discontinuous epitope probably located in the region of helices A/C/G/H/I and seems to act by altering protein dynamics rather than binding preferentially to the native state. This novel approach could reveal new target sites for small-molecule intervention that may block the transition to aberrant polymers without compromising the inhibitory activity of Z α1-antitrypsin. © FASEB.

Bartonella vinsonii subsp. berkhoffii and B. henselae in dogs.

PubMed

Müller, A; Soto, F; Sepúlveda, M; Bittencourt, P; Benevenute, J L; Ikeda, P; Machado, R Z; André, M R

2018-05-06

This study aimed to molecularly survey Bartonella in dogs from Chile. Quantitative real-time PCR (qPCR) for Bartonella spp. based on nuoG gene was performed in 139 blood samples taken from dogs belonging to rural localities of the Valdivia Province, Los Ríos region, southern Chile. nuoG qPCR-positive samples were submitted to conventional PCR assays for ftsZ, gltA, rpoB and nuoG genes and sequencing for speciation and phylogenetic analysis. Based upon qPCR results, Bartonella spp. occurrence in dogs was 4.3% (6/139). Out of six nuoG qPCR-positive samples, six, three, two and none showed positive results in cPCR assays based on gltA, ftsZ, rpoB and nuoG genes, respectively. Consistent sequencing results were obtained only for the ftsZ gene from sample #1532 (GeneBank accession number: MG252491), and gltA gene from samples #1535 (MG252490) and #1532 (148 bp fragment that was not deposited in GenBank). Phylogenetic analysis of ftsZ and gltA genes allowed speciation of two nuoG-positive samples, one as Bartonella vinsonii subsp. berkhoffii and the other as B. henselae. Bartonella vinsonii subsp. berkhoffii and B. henselae are detected for the first time in dogs from Chile, highlighting the importance of the canine population as a source of zoonotic agents and potential infection risk to humans.

Enhancement of electron injection in inverted bottom-emitting organic light-emitting diodes using Al/LiF compound thin film

NASA Astrophysics Data System (ADS)

Nie, Qu-yang; Zhang, Fang-hui

2018-05-01

The inverted bottom-emitting organic light-emitting devices (IBOLEDs) were prepared, with the structure of ITO/Al ( x nm)/LiF (1 nm)/Bphen (40 nm)/CBP: GIr1 (14%):R-4b (2%) (10 nm)/BCP (3 nm)/CBP:GIr1 (14%):R-4b (2%) (20 nm)/TCTA (10 nm)/NPB (40 nm)/MoO3 (40 nm)/Al (100 nm), where the thickness of electron injection layer Al ( x) are 0 nm, 2 nm, 3 nm, 4 nm and 5 nm, respectively. In this paper, the electron injection condition and luminance properties of inverted devices were investigated by changing the thickness of Al layer in Al/LiF compound thin film. It turns out that the introduction of Al layer can improve electron injection of the devices dramatically. Furthermore, the device exerts lower driving voltage and higher current efficiency when the thickness of electron injection Al layer is 3 nm. For example, the current efficiency of the device with 3-nm-thick Al layer reaches 19.75 cd·A-1 when driving voltage is 7 V, which is 1.24, 1.17 and 17.03 times larger than those of the devices with 2 nm, 4 nm and 5 nm Al layer, respectively. The device property reaches up to the level of corresponding conventional device. In addition, all inverted devices with electron injection Al layer show superior stability of color coordinate due to the adoption of co-evaporation emitting layer and BCP spacer-layer, and the color coordinate of the inverted device with 3-nm-thick Al layer only changes from (0.580 6, 0.405 6) to (0.532 8, 0.436 3) when driving voltage increases from 6 V to 10 V.

Correlation of interplanetary-space B sub z field fluctuations and trapped-particle redistribution.

NASA Technical Reports Server (NTRS)

Parks, G. K.; Pellat, R.

1972-01-01

Observations of interplanetary magnetic field fluctuations in correlation with trapped particle fluctuations are discussed. From observations of particle-redistribution effects, properties of the magnetospheric electric field are derived. The obtained results suggest that the interplanetary B(sub z) field fluctuations might represent a strong driving source for particle diffusion.

The influence of CYP2B6, CYP2C9 and CYP2D6 genotypes on the formation of the potent antioestrogen Z-4-hydroxy-tamoxifen in human liver.

PubMed

Coller, Janet K; Krebsfaenger, Niels; Klein, Kathrin; Endrizzi, Karin; Wolbold, Renzo; Lang, Thomas; Nüssler, Andreas; Neuhaus, Peter; Zanger, Ulrich M; Eichelbaum, Michel; Mürdter, Thomas E

2002-08-01

To investigate in a large panel of 50 human liver samples the contribution of CYP2C9, CYP2D6, and CYP3A4 to the overall formation of the potent antioestrogen Z-4-hydroxy-tamoxifen, and how various genotypes affect its formation from tamoxifen. The formation of Z-4-hydroxy-tamoxifen from 10 microm tamoxifen was studied in human liver microsomes (n=50), characterized for CYP2B6, CYP2C9, CYP2D6 and CYP3A4 expression, and CYP2B6, CYP2C9 and CYP2D6 genotype. The effect of chemical and monoclonal antibody inhibitors, and the formation in supersomes expressing recombinant CYP isoforms was also investigated. Z-4-hydroxy-tamoxifen was quantified using LC-MS analysis. Z-4-hydroxy-tamoxifen was formed by supersomes expressing CYP2B6, CYP2C9, CYP2C19 and CYP2D6, but not CYP3A4. In agreement with these data, the mean formation of Z-4-hydroxy-tamoxifen was inhibited 49% by sulphaphenazole (P=0.001), 38% by quinidine (P<0.05) and 13% by monoclonal antibody against CYP2B6 (MAB-2B6, P<0.05). Furthermore, Z-4-hydroxy-tamoxifen formation significantly correlated with both CYP2C9 expression (r(s)=0.256, P<0.05) and CYP2D6 expression (r(s)=0.309, P<0.05). Genotypes of CYP2D6, CYP2B6 and CYP2C9 had an effect on metabolite formation in such a way that samples with two nonfunctional CYP2D6, or two variant CYP2C9 or CYP2B6 alleles, showed lower enzyme activity compared with those with two functional or wild-type alleles, (5.0 vs 9.9 pmol mg(-1) protein min(-1), P=0.046, 5.1 vs 9.9 pmol mg(-1) protein min(-1), P=0.053, and 6.8 vs 9.4 pmol mg(-1) protein min(-1), P=0.054, respectively). CYP2D6 and CYP2C9 contribute on average 45 and 46%, respectively, to the overall formation of Z-4-hydroxy-tamoxifen. CYP2B6, CYP2C9 and CYP2D6 genotypes all affected Z-4-hydroxy-tamoxifen formation and can predict individual ability to catalyse this reaction.

Cascaded H-bridge multilevel inverter for renewable energy generation

NASA Astrophysics Data System (ADS)

Pandey, Ravikant; Nath Tripathi, Ravi; Hanamoto, Tsuyoshi

2016-04-01

In this paper cascaded H-bridge multilevel inverter (CHBMLI) has been investigated for the application of renewable energy generation. Energy sources like solar, wind, hydro, biomass or combination of these can be manipulated to obtain alternative sources for renewable energy generation. These renewable energy sources have different electrical characteristics like DC or AC level so it is challenging to use generated power by connecting to grid or load directly. The renewable energy source require specific power electronics converter as an interface for conditioning generated power .The multilevel inverter can be utilized for renewable energy sources in two different modes, the power generation mode (stand-alone mode), and compensator mode (statcom). The performance of the multilevel inverter has been compared with two level inverter. In power generation mode CHBMLI supplies the active and reactive power required by the different loads. For operation in compensator mode the indirect current control based on synchronous reference frame theory (SRFT) ensures the grid operating in unity power factor and compensate harmonics and reactive power.

Energy and pitch angle-dispersed auroral electrons suggesting a time-variable, inverted-V potential structure

NASA Astrophysics Data System (ADS)

Arnoldy, R. L.; Lynch, K. A.; Austin, J. B.; Kintner, P. M.

1999-10-01

High temporal resolution electron detectors aboard the PHAZE II rocket flight have shown that the energy-dispersed, field-aligned bursts (FABs) are time coincident with pitch angle-dispersed electrons having energies at the maximum voltage of the inverted-V potential. This modulation of the energetic inverted-V electrons is superimposed upon an energy-diffused background resulting in a peak-to-valley ratio of ~2 for the pitch angle-dispersed electrons. Since the characteristic energy of the FABs, the order of an eV, is considerably less than that of the plasma sheet electrons (the order of a keV) presumably falling through the inverted-V potential to create the discrete aurora, the modulation mechanism has to be independent of the electron temperature. The mechanism must accelerate the cold electrons over a range of energies from the inverted-V energy down to a few tens of eV. It must do this at the same time it is creating a population of hot, pitch angle-dispersed electrons at the inverted-V energy. Both the energy dispersion of the FABs and the pitch angle dispersion of the inverted-V electrons can be used to determine a source height assuming both populations start from the same source region at the same time. These calculations give source heights between 3500 and 5300 km for various events and disagreement between the two methods the order of 20%, which is within the rather substantial error limits of both calculations. A simple mechanism of providing a common start time for both populations of electrons would be a turning on/off of a spatially limited (vertically), inverted-V potential. The energy-dispersed FABs can be reconstructed at rocket altitudes if one assumes that cold electrons are accelerated to an energy determined by how much of the inverted-V potential they fall through when it is turned on. Similarly, the pitch angle-dispersed, inverted-V electrons can be modeled at rocket altitudes if one assumes that the plasma sheet electrons falling through the entire potential drop all start to do so at the same time when the potential is turned on. The FABs seem to fluctuate at either ~10 Hz or near 100 Hz. An important constraint of the on/off mechanism is whether cold electrons (1 eV) can fill the inverted-V volume during the off cycle. The maximum vertical height of the 10 kV potential region for the 10 Hz events would be the order of 100 and 10 km for the 100 Hz events. To get 10 kV, these heights require parallel electric fields of 0.1 and 1 V/m respectively for the 10 and 100 Hz events assuming that the filling is along B from below the inverted-V potential. Alternative mechanisms are also discussed in the light of the data presented.

Inversion of sonobuoy data from shallow-water sites with simulated annealing.

PubMed

Lindwall, Dennis; Brozena, John

2005-02-01

An enhanced simulated annealing algorithm is used to invert sparsely sampled seismic data collected with sonobuoys to obtain seafloor geoacoustic properties at two littoral marine environments as well as for a synthetic data set. Inversion of field data from a 750-m water-depth site using a water-gun sound source found a good solution which included a pronounced subbottom reflector after 6483 iterations over seven variables. Field data from a 250-m water-depth site using an air-gun source required 35,421 iterations for a good inversion solution because 30 variables had to be solved for, including the shot-to-receiver offsets. The sonobuoy derived compressional wave velocity-depth (Vp-Z) models compare favorably with Vp-Z models derived from nearby, high-quality, multichannel seismic data. There are, however, substantial differences between seafloor reflection coefficients calculated from field models and seafloor reflection coefficients based on commonly used Vp regression curves (gradients). Reflection loss is higher at one field site and lower at the other than predicted from commonly used Vp gradients for terrigenous sediments. In addition, there are strong effects on reflection loss due to the subseafloor interfaces that are also not predicted by Vp gradients.

The electronic, structural and magnetic properties of Heusler compounds ZrCrCoZ(Z=B, Al, Ga, In): A first-principles study

NASA Astrophysics Data System (ADS)

Guo, R. K.; Liu, G. D.; Lin, T. T.; Wang, W.; Wang, L. Y.; Dai, X. F.

2018-02-01

It is predicted that the ZrCrCoZ(Z=B, Al, Ga, In) compounds with LiMnPbSn-type structure are half-metallic ferrimagnets with a large half-metallic gap by the first-principles calculations. The half-metallicity of the ZrCrCoZ(Z=B, Al, Ga, In) compounds are quite robust to the axial and uniaxial strain. The total magnetic moments in per unit cell are 4 μB for the ZrCrCoZ(Z=B, Al, Ga, In) compounds and follow the Slater-Pauling rule, which can be attributed to the great spin-splitting. The calculated formation energies are negative for all the ZrCrCoZ(Z=B, Al, Ga, In) compounds, which indicates that those compounds are in the thermodynamic stability and the possibility of synthesis in experiment.

Tactical Symbology Catalog

DTIC Science & Technology

1983-05-01

FM 7.8.1 COMMUJICATIOIV FM 21-30 Te lephone/ Q ( 54 164 CATEGORY/CONCEPT/ SYMBOL SOURCE AMFV W 7.8.2 COMMUN4ICATION/ FM 21-30 Telephone/ center - not...I.7. Z LL ?. .F ’l 21-30B, YCC Ji. 7.3 FmPv ’n2-3, TO recoilless, heavq 11.8.1 * " TOS iuncifferentiated I Mr~ CATEGORYCOrNCEPT/ SYMIDOL SOLIRCE AMFV

A single-chain variable fragment intrabody prevents intracellular polymerization of Z α1-antitrypsin while allowing its antiproteinase activity

PubMed Central

Ordóñez, Adriana; Pérez, Juan; Tan, Lu; Dickens, Jennifer A.; Motamedi-Shad, Neda; Irving, James A.; Haq, Imran; Ekeowa, Ugo; Marciniak, Stefan J.; Miranda, Elena; Lomas, David A.

2015-01-01

Mutant Z α1-antitrypsin (E342K) accumulates as polymers within the endoplasmic reticulum (ER) of hepatocytes predisposing to liver disease, whereas low levels of circulating Z α1-antitrypsin lead to emphysema by loss of inhibition of neutrophil elastase. The ideal therapy should prevent polymer formation while preserving inhibitory activity. Here we used mAb technology to identify interactors with Z α1-antitrypsin that comply with both requirements. We report the generation of an mAb (4B12) that blocked α1-antitrypsin polymerization in vitro at a 1:1 molar ratio, causing a small increase of the stoichiometry of inhibition for neutrophil elastase. A single-chain variable fragment (scFv) intrabody was generated based on the sequence of mAb4B12. The expression of scFv4B12 within the ER (scFv4B12KDEL) and along the secretory pathway (scFv4B12) reduced the intracellular polymerization of Z α1-antitrypsin by 60%. The scFv4B12 intrabody also increased the secretion of Z α1-antitrypsin that retained inhibitory activity against neutrophil elastase. MAb4B12 recognized a discontinuous epitope probably located in the region of helices A/C/G/H/I and seems to act by altering protein dynamics rather than binding preferentially to the native state. This novel approach could reveal new target sites for small-molecule intervention that may block the transition to aberrant polymers without compromising the inhibitory activity of Z α1-antitrypsin.—Ordóñez, A., Pérez, J., Tan, L., Dickens, J. A., Motamedi-Shad, N., Irving, J. A., Haq, I., Ekeowa, U., Marciniak, S. J., Miranda, E., Lomas, D. A. A single-chain variable fragment intrabody prevents intracellular polymerization of Z α1-antitrypsin while allowing its antiproteinase activity. PMID:25757566

Modeling Continuous-Time Random Processes in Digital Computer Simulations of Physical Systems

DTIC Science & Technology

1986-08-27

hf) + BD1QD1B31 + BD2QD2B62 + BD3QD3BZ3 + BD4QD4BZ4 (51) where ODk = E[NDk-_•k] for k = 1 to 4. Note that PD(ti+l) has four BDiQDiBZi terms, one from...3 , collecting terms, and rearrang- ing equation (95), results in (aUz 3 + a 2 z 2 + a3z + ag4)hBV(z)Xlz) , (96) z 4 - alhAz 3 - (1 + a2 hA)z 2 - a 3...approximate the Taylor series form of I(h,I)? To answer this question, expand equation (1ll) in a series form , collect terms and compare it to 1(hI) . EhA

Pyongtaek AB, Camp Humphries, Korea. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

DTIC Science & Technology

1978-10-20

61.0 61.0 7 . b7., , 7.< AT 6 U7 6-- ’.3 . I- .6 5’. 1- t6.i t .1 O.~ L 1~I. LA) td .1 I F v 6 7 uo 07 .b1. .6 1 -1 .2 A2.-1 , 9 ! u’) ZI&.2 .Z U’ .z...84.6 8 . 6 6 86. 86.6 86 bo 6o6 R6.6 86o6 A6.6 86.6’ *% 76,9 OR, 8 p.IS.88.9 88 .9! 88 sa jt9! l | 1 76. 0 ao.,] Bbd 139.1i r i.2 I lo 91 .5 91.o5 5 91...55,955.-5. 51� 55.1~ 55.?. 9 ’-5.7 51.7 52.1 55.1 5h.4 9’.1 57’ 57.4 574 57.4 57.4 z7.4 57.4 57.4 57.4 *P 57o4 57 t 6Z td b~,zLt,- , h4~~th 4..i y

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silva, E.R.C. da; Filho, B.J.C.

This paper presents a PWM current clamping circuit for improving a series resonant DC link converter. This circuit is capable of reducing current peaks to about 1.2--1.4 times the DC bias current. When desired, resonant transition creates notches in the dc link current, allowing the converter`s switches to synchronize with external PWM strategy. A regulated DC current source may be obtained--by using a conventional rectifier source--to feed a DC load or a current source inverter. Phase plane approach makes ease the understanding the operation, control and design procedure of the circuit. Another topology is derived and its features compared tomore » the first circuit. Simulation results for the simplified circuit and for a three-phase induction motor driven by such inverter will be presented. Moreover, the principle is corroborated by experimental results.« less

Method for the production of wideband THz radiation

DOEpatents

Krafft, Geoffrey A [Newport News, VA

2008-01-01

A method for the production of extremely wide bandwidth THz radiation comprising: delivering an electron beam from a source to an undulator that does not deflect the angle or transversely move the electron beam; and optimizing the undulator to yield peak emission in the middle of the THz band (1 THz). These objectives are accomplished by magnetically bending the orbit of the incoming electron beam in the undulator according to the function x(z)=x.sub.o exp(-z.sup.2/2.sigma..sup.2) and controlling the transverse magnetic field to be B(z)=B.sub.0(1-z.sup.2/.sigma..sup.2)exp(-z.sup.2/2.sigma..sup.2).

A new balancing three level three dimensional space vector modulation strategy for three level neutral point clamped four leg inverter based shunt active power filter controlling by nonlinear back stepping controllers.

PubMed

Chebabhi, Ali; Fellah, Mohammed Karim; Kessal, Abdelhalim; Benkhoris, Mohamed F

2016-07-01

In this paper is proposed a new balancing three-level three dimensional space vector modulation (B3L-3DSVM) strategy which uses a redundant voltage vectors to realize precise control and high-performance for a three phase three-level four-leg neutral point clamped (NPC) inverter based Shunt Active Power Filter (SAPF) for eliminate the source currents harmonics, reduce the magnitude of neutral wire current (eliminate the zero-sequence current produced by single-phase nonlinear loads), and to compensate the reactive power in the three-phase four-wire electrical networks. This strategy is proposed in order to gate switching pulses generation, dc bus voltage capacitors balancing (conserve equal voltage of the two dc bus capacitors), and to switching frequency reduced and fixed of inverter switches in same times. A Nonlinear Back Stepping Controllers (NBSC) are used for regulated the dc bus voltage capacitors and the SAPF injected currents to robustness, stabilizing the system and to improve the response and to eliminate the overshoot and undershoot of traditional PI (Proportional-Integral). Conventional three-level three dimensional space vector modulation (C3L-3DSVM) and B3L-3DSVM are calculated and compared in terms of error between the two dc bus voltage capacitors, SAPF output voltages and THDv, THDi of source currents, magnitude of source neutral wire current, and the reactive power compensation under unbalanced single phase nonlinear loads. The success, robustness, and the effectiveness of the proposed control strategies are demonstrated through simulation using Sim Power Systems and S-Function of MATLAB/SIMULINK. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

In situ measurement of low-Z material coating thickness on high Z substrate for tokamaks.

PubMed

Mueller, D; Roquemore, A L; Jaworski, M; Skinner, C H; Miller, J; Creely, A; Raman, P; Ruzic, D

2014-11-01

Rutherford backscattering of energetic particles can be used to determine the thickness of a coating of a low-Z material over a heavier substrate. Simulations indicate that 5 MeV alpha particles from an (241)Am source can be used to measure the thickness of a Li coating on Mo tiles between 0.5 and 15 μm thick. Using a 0.1 mCi source, a thickness measurement can be accomplished in 2 h of counting. This technique could be used to measure any thin, low-Z material coating (up to 1 mg/cm(2) thick) on a high-Z substrate, such as Be on W, B on Mo, or Li on Mo. By inserting a source and detector on a moveable probe, this technique could be used to provide an in situ measurement of the thickness of Li coating on NSTX-U Mo tiles. A test stand with an alpha source and an annular solid-state detector was used to investigate the measurable range of low-Z material thicknesses on Mo tiles.

In situ measurement of low-Z material coating thickness on high Z substrate for tokamaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, D., E-mail: dmueller@pppl.gov; Roquemore, A. L.; Jaworski, M.

Rutherford backscattering of energetic particles can be used to determine the thickness of a coating of a low-Z material over a heavier substrate. Simulations indicate that 5 MeV alpha particles from an {sup 241}Am source can be used to measure the thickness of a Li coating on Mo tiles between 0.5 and 15 μm thick. Using a 0.1 mCi source, a thickness measurement can be accomplished in 2 h of counting. This technique could be used to measure any thin, low-Z material coating (up to 1 mg/cm{sup 2} thick) on a high-Z substrate, such as Be on W, B on Mo, or Limore » on Mo. By inserting a source and detector on a moveable probe, this technique could be used to provide an in situ measurement of the thickness of Li coating on NSTX-U Mo tiles. A test stand with an alpha source and an annular solid-state detector was used to investigate the measurable range of low-Z material thicknesses on Mo tiles.« less

An Optical Waveguide Humidity Detector.

DTIC Science & Technology

1985-10-31

films: (1) AB#11; (2) AB#13-, (3) AB#14. 14 ............................................... nl ,, I ,, . . . . m 1500 S1000- w z b. os,, ooo 0 500 -b...4c are for the following films: (1) AB#11. (2) AB#13; (3) AB#14. -1 15 1500 a. b. < 1000- w C. z o 500 0~0 w 20 40 60 80 REL. HUMIDITY (%) (c) Fig. 4...400*- . . . . . . . . . . * .\\ 2787 6- // CL 74 z 0 72 A I’- ., / // _0 .- O - IL, - f 7 I I I II .2 .4 .6 .8 1 NORM. FACTOR (N.F.) Fig. 6

Attractiveness of a Four-component Pheromone Blend to Male Navel Orangeworm Moths

PubMed Central

Kanno, Hiroo; Kuenen, L. P. S.; Klingler, Kimberly A.; Millar, Jocelyn G.

2010-01-01

The attractiveness to male navel orangeworm moth, Amyelois transitella, of various combinations of a four-component pheromone blend was measured in wind-tunnel bioassays. Upwind flight along the pheromone plume and landing on the odor source required the simultaneous presence of two components, (11Z,13Z)-hexadecadienal and (3Z,6Z,9Z,12Z,15Z)-tricosapentaene, and the addition of either (11Z,13Z)-hexadecadien-1-ol or (11Z,13E)-hexadecadien-1-ol. A mixture of all four components produced the highest levels of rapid source location and source contact. In wind-tunnel assays, males did not seem to distinguish among a wide range of ratios of any of the three components added to (11Z,13Z)-hexadecadienal. Dosages of 10 and 100 ng of the 4-component blend produced higher levels of source location than dosages of 1 and 1,000 ng. Electronic supplementary material The online version of this article (doi:10.1007/s10886-010-9799-x) contains supplementary material, which is available to authorized users. PMID:20473710

Control method for peak power delivery with limited DC-bus voltage

DOEpatents

Edwards, John; Xu, Longya; Bhargava, Brij B.

2006-09-05

A method for driving a neutral point-clamped multi-level voltage source inverter supplying a synchronous motor is provided. A DC current is received at a neutral point-clamped multi-level voltage source inverter. The inverter has first, second, and third output nodes. The inverter also has a plurality of switches. A desired speed of a synchronous motor connected to the inverter by the first second and third nodes is received by the inverter. The synchronous motor has a rotor and the speed of the motor is defined by the rotational rate of the rotor. A position of the rotor is sensed, current flowing to the motor out of at least two of the first, second, and third output nodes is sensed, and predetermined switches are automatically activated by the inverter responsive to the sensed rotor position, the sensed current, and the desired speed.

Prime Contract Awards Alphabetically by Contractor, by State or Country, and Place. Part 3. (Beachy Lumber Co.-Campanova, Richard MD)

DTIC Science & Technology

1989-01-01

34ᝰ >w 00 C In --4 C4 -ONN4r- N0-0 11 a M-0 cg< i 1.10 -4 l 9 1 L go ~t00 -40 B LA. ZEZ Z Z Z Z Z Z Z ZZ Z L to01000 z 2 Z0ZZZZZZZZ, (00~t II0. O)41...00 0) 0) 07 ’) n N0) C) 0) 44r- 0 M’ U.n U dw01 44 I -4 000 0OC 0D 0 00 0 0 Is4 ( 9 O J WIn 114IC tax H UJ WC) :14 H WCJ 44 2Z2 2 Z 22 z Z z H 000 4’ M0...4 -4-4 m -4 .- 4 .- 4 -4 -4 -4 -4 -4 404 4- 4W 0000 WWWWWW C(((0000(( u0 N - (0 ) -0)0) 0000 ~--CL If to I 0000 W 4 00000000to "D 00 MC0 -4 .- 4 . 9

Printed 2 V-operating organic inverter arrays employing a small-molecule/polymer blend

NASA Astrophysics Data System (ADS)

Shiwaku, Rei; Takeda, Yasunori; Fukuda, Takashi; Fukuda, Kenjiro; Matsui, Hiroyuki; Kumaki, Daisuke; Tokito, Shizuo

2016-10-01

Printed organic thin-film transistors (OTFTs) are well suited for low-cost electronic applications, such as radio frequency identification (RFID) tags and sensors. Achieving both high carrier mobility and uniform electrical characteristics in printed OTFT devices is essential in these applications. Here, we report on printed high-performance OTFTs and circuits using silver nanoparticle inks for the source/drain electrodes and a blend of dithieno[2,3-d2‧,3‧-d‧]benzo[1,2-b4,5-b‧]dithiophene (DTBDT-C6) and polystyrene for the organic semiconducting layer. A high saturation region mobility of 1.0 cm2 V-1 s-1 at low operation voltage of -5 V was obtained for relatively short channel lengths of 9 μm. All fifteen of the printed pseudo-CMOS inverter circuits were formed on a common substrate and operated at low operation voltage of 2 V with the total variation in threshold voltage of 0.35 V. Consequently, the printed OTFT devices can be used in more complex integrated circuit applications requiring low manufacturing cost over large areas.

Integration of supercapacitive storage in renewable energy system to compare the response of two level and five level inverter with RL type load

NASA Astrophysics Data System (ADS)

Jana, Suman; Biswas, Pabitra Kumar; Das, Upama

2018-04-01

The analytical and simulation-based study in this presented paper shows a comparative report between two level inverter and five-level inverter with the integration of Supercapacitive storage in Renewable Energy system. Sometime dependent numerical models are used to measure the voltage and current response of two level and five level inverter in MATLAB Simulink based environment. In this study supercapacitive sources, which are fed by solar cells are used as input sources to experiment the response of multilevel inverter with integration of su-percapacitor as a storage device of Renewable Energy System. The RL load is used to compute the time response in MATLABSimulink based environment. With the simulation results a comparative study has been made of two different level types of inverters. Two basic types of inverter are discussed in the study with reference to their electrical behavior. It is also simulated that multilevel inverter can convert stored energy within supercapacitor which is extracted from Renewable Energy System.

A Method of Maximum Power Control in Single-phase Utility Interactive Photovoltaic Generation System by using PWM Current Source Inverter

NASA Astrophysics Data System (ADS)

Neba, Yasuhiko

This paper deals with a maximum power point tracking (MPPT) control of the photovoltaic generation with the single-phase utility interactive inverter. The photovoltaic arrays are connected by employing the PWM current source inverter to the utility. The use of the pulsating dc current and voltage allows the maximum power point to be searched. The inverter can regulate the array voltage and keep the arrays to the maximum power. This paper gives the control method and the experimental results.

Design, Development and Fabrication of Training Round to Simulate Projectile, 155-mm, HE, M107 (XM804) (Phase 1)

DTIC Science & Technology

1979-05-01

29.1.1, It’, 4B, P11F X,4804 W/INKRT 5 "LOADED.I M107 BOY +140"F TEMP. CONDITION fl HEAVY WAL.L I. MWA SEA-IA, XMSO4 FORED 2B,C,1, IP ’* "U " 32 " 4A A 3C1...8217 zloco~ .q 01 Io - eel- 4:, . HL Voz Z~ o-.. fo. LL w ri IO 0 041 to7 tieV z I - 00 ac fl JL ~5)*j’ 4 t fl:Z 0 N L - v--oL .~~~ . .i - 4 .z It- I I

FET commutated current-FED inverter

NASA Technical Reports Server (NTRS)

Rippel, Wally E. (Inventor); Edwards, Dean B. (Inventor)

1983-01-01

A shunt switch comprised of a field-effect transistor (Q.sub.1) is employed to commutate a current-fed inverter (10) using thyristors (SCR1, SCR2) or bijunction transistors (Q.sub.2, Q.sub.3) in a full bridge (1, 2, 3, 4) or half bridge (5, 6) and transformer (T.sub.1) configuration. In the case of thyristors, a tapped inverter (12) is employed to couple the inverter to a dc source to back bias the thyristors during commutation. Alternatively, a commutation power supply (20) may be employed for that purpse. Diodes (D.sub.1, D.sub.2) in series with some voltage dropping element (resistor R.sub.12 or resistors R.sub.1, R.sub.2 or Zener diodes D.sub.4, D.sub.5) are connected in parallel with the thyristors in the half bridge and transformer configuration to assure sharing the back bias voltage. A clamp circuit comprised of a winding (18) negatively coupled to the inductor and a diode (D.sub.3) return stored energy from the inductor to the power supply for efficient operation with buck or boost mode.

Sources and Nature of Cost Analysis Data Base Reference Manual.

DTIC Science & Technology

1983-07-01

COVERED Sources and Nature of Cost Analysis Data Base Interim Report (Update) Reference Manual 6 . PERFORMING ORG. REPORT NUMBER USAAVRADCOM TM 83-F-3 7 ...SECTION 6 - DATA FOR MULTIPLE APPLICATIONS 6.0.0 7.0.0 SECTION 7 - GLOSSARY OF COST ANALYSIS TERMS SECTION 8 - REFERENCES 8.0.0 SECTION 9 - BIBLIOGRAPHY...Relationsh-;ips Manual for the Army 1.14. 1 Yateri ci Command, TP-449, Mla; 1912 ( 7 21 RACKFORS JiR 1CO(PTER, INC. xlB.Aii- 6 -4A 1.15. 1 Z FNE>:THj MUNSON

Reflection second harmonic generation on a z -cut congruent lithium niobate crystal

NASA Astrophysics Data System (ADS)

Sono, T. J.; Scott, J. G.; Sones, C. L.; Valdivia, C. E.; Mailis, S.; Eason, R. W.; Frey, J. G.; Danos, L.

2006-11-01

Reflection second harmonic generation experiments were performed on z -cut congruent lithium niobate crystals (LiNbO3) to reveal the interfacial layer symmetry as the crystal is rotated around the z axis. To suppress the bulk contribution, the fundamental wavelength was selected to be 532nm , resulting in second harmonic generation at a wavelength within the absorption region of the crystal. The polarity of the direction of the y -axis was determined from second harmonic generation data and used to show that this direction also inverts during domain inversion.

Workspace Design Handbook for Standardized Command Posts

DTIC Science & Technology

1990-09-01

b02 a. 4 2 20. 4P =U & u 00 -AR 2 MO Z.-aa a W 0 w 2q ____q_>_P. ’U Z~ -~~$ U~. hhIZf- - do 4 a: 0 ~ ~~~ L0; M; R-- IU 9 9- ~ KR 5B-4K z~ ~ 1 IM 2Sw...safety training to prevent accidents. N(ot all users get such training, even when it is "required." Some users will kave had outdated training, or

Radio spectra of bright compact sources at z > 4.5

NASA Astrophysics Data System (ADS)

Coppejans, Rocco; van Velzen, Sjoert; Intema, Huib T.; Müller, Cornelia; Frey, Sándor; Coppejans, Deanne L.; Cseh, Dávid; Williams, Wendy L.; Falcke, Heino; Körding, Elmar G.; Orrú, Emanuela; Paragi, Zsolt; Gabányi, Krisztina É.

2017-05-01

High-redshift quasars are important to study galaxy and active galactic nuclei evolution, test cosmological models and study supermassive black hole growth. Optical searches for high-redshift sources have been very successful, but radio searches are not hampered by dust obscuration and should be more effective at finding sources at even higher redshifts. Identifying high-redshift sources based on radio data is, however, not trivial. Here we report on new multifrequency Giant Metrewave Radio Telescope observations of eight z > 4.5 sources previously studied at high angular resolution with very long baseline interferometry (VLBI). Combining these observations with those from the literature, we construct broad-band radio spectra of all 30 z > 4.5 sources that have been observed with VLBI. In the sample we found flat, steep and peaked spectra in approximately equal proportions. Despite several selection effects, we conclude that the z > 4.5 VLBI (and likely also non-VLBI) sources have diverse spectra and that only about a quarter of the sources in the sample have flat spectra. Previously, the majority of high-redshift radio sources were identified based on their ultrasteep spectra. Recently, a new method has been proposed to identify these objects based on their megahertz-peaked spectra. No method would have identified more than 18 per cent of the high-redshift sources in this sample. More effective methods are necessary to reliably identify complete samples of high-redshift sources based on radio data.

MIRADCOM/AFATL Hybrid Simulation Facility Compatibility Study. Volume 1

DTIC Science & Technology

1977-02-08

34» " GO TO HnNIltlR": (50 TO AtmiUF.R VIR MEM FILE": DUMP ALL PARTS TO MAG TAPE": DUMP All PARTS TO SOURCE FILE DN DISC 1": MAKE LISTING ÜF ALL...8600,9500^ DHHCF3 = 0 0MNCF6=ti "ÜMPi^ZTT^T?, OHP <,P2=1.0613 ,3,5 ŕ Z7T Fl(DUHN) 62577 = 1.00 ,i5,ZC,Zl,Zg,23,Z’>,^b,Z6,Zy.Z«,ü’J,^y.b,3l

Source Header List. Volume 2. L through Z

DTIC Science & Technology

1998-07-01

U 2-- 2- o-h 2-2 W- 1- 2- V) 2- aJ w- 2 w 22 2 - 3 - 2- 1-U.M0 .1- .1-0 IU LL. 1-W ILLJW tun wWA 1-WN 2 W U lox W -W 1W O WE CoO 0o oU- 0Co0100I C...0.4z a.U-W Z<. a-C a. a. ZAw a. a-I- a 1- UC I4 M M0 14 04 _ 4 " ( M Z 0 "( X 4 " ~ 14 < "U " 4 - 0.U_ Z1-0 1- 1- LU LU Wz z WE W z LUz Z W" ZU -J 2...34j1.4 >In >’-’ m130 >w.-Ia aW w44 40 40 <W~ <W ~ 0 41~ <W <Z <ZW 4z Z444 zaw a UI z K za Z- n I- 20 9a3 ZI aI- OIw OIm2 >- Z 2 2 Z 2 2 2 Z 2 2 Z 2 2

Lightweight Towed Howitzer Demonstrator. Phase 1 and Partial Phase 2. Volume B. Technical Presentations - Part 1.

DTIC Science & Technology

1987-04-01

tray hsg assy 1 85 5 62360 . ..Frame 1 TRAD Ti 70 0.16 281 45 6 G2370 . ..Wrap 1 Kevlar/epoxy 70 0.05 700 35 6 62380 . ..Coating 1 Urethane 70 0.05...CL -4L- I-J .4cm=CLC ~LU LAJL~ I.-- LL== L6 0 - -JA z ~ LA =c = La z 4c > =w ZwI . z C/)-- oc W LA. 0z C 0 CI. CC Z u z LJ -6 C-.- -4 mAC. L6 w z 4c0

Power conditioning system for energy sources

DOEpatents

Mazumder, Sudip K [Chicago, IL; Burra, Rajni K [Chicago, IL; Acharya, Kaustuva [Chicago, IL

2008-05-13

Apparatus for conditioning power generated by an energy source includes an inverter for converting a DC input voltage from the energy source to a square wave AC output voltage, and a converter for converting the AC output voltage from the inverter to a sine wave AC output voltage.

Efficient/reliable dc-to-dc inverter circuit

NASA Technical Reports Server (NTRS)

Pasciutti, E. R.

1970-01-01

Feedback loop, which contains an inductor in series with a saturable reactor, is added to a standard inverter circuit to permit the inverter power transistors to be switched in a controlled and efficient manner. This inverter is applicable where the power source has either high or low impedance properties.

Integrated Inverter For Driving Multiple Electric Machines

DOEpatents

Su, Gui-Jia [Knoxville, TN; Hsu, John S [Oak Ridge, TN

2006-04-04

An electric machine drive (50) has a plurality of inverters (50a, 50b) for controlling respective electric machines (57, 62), which may include a three-phase main traction machine (57) and two-phase accessory machines (62) in a hybrid or electric vehicle. The drive (50) has a common control section (53, 54) for controlling the plurality of inverters (50a, 50b) with only one microelectronic processor (54) for controlling the plurality of inverters (50a, 50b), only one gate driver circuit (53) for controlling conduction of semiconductor switches (S1-S10) in the plurality of inverters (50a, 50b), and also includes a common dc bus (70), a common dc bus filtering capacitor (C1) and a common dc bus voltage sensor (67). The electric machines (57, 62) may be synchronous machines, induction machines, or PM machines and may be operated in a motoring mode or a generating mode.

Divergent Effects of Arsenic on NF-κB Signaling in Different Cells or Tissues: A Systematic Review and Meta-Analysis.

PubMed

Wei, Meng; Liu, Jiaming; Xu, Mengchuan; Rui, Dongsheng; Xu, Shangzhi; Feng, Gangling; Ding, Yusong; Li, Shugang; Guo, Shuxia

2016-01-26

Arsenic is ubiquitously present in human lives, including in the environment and organisms, and has divergent effects between different cells and tissues and between different exposure times and doses. These observed effects have been attributed to the nuclear transcription factor kappa B(NF-κB) signaling pathway. Herein, a meta-analysis was performed by independently searching databases including the Cochrane Library, PubMed, Springer, Embase, and China National Knowledge Infrastructure, to analyze effects of arsenic exposure on NF-κB signaling. Compared to controls, in the exposed group, p-IκB levels were found to be 8.13-fold higher (95% CI, 2.40-13.85; Z = 2.78; p = 0.005), IκB levels were 16.19-fold lower (95% CI, -27.44--4.94; Z = 2.78; p = 0.005), and NF-κBp65 levels were 0.77-fold higher (95% CI, 0.13-1.42; Z = 2.34; p = 0.02) for normal cells and tissue, while NF-κBp65 levels were 4.90-fold lower (95% CI, -8.49-1.31; Z = 2.62; p = 0.009), NF-κB activity was 2.45-fold lower (95% CI, -3.66-1.25; Z = 4.00; p < 0.0001), and DNA-binding activity of NF-κB was 9.75-fold lower (95% CI, -18.66-4.54; Z = 2.15; p = 0.03) for abnormal cells and tissue. Short exposure to high arsenic doses activated the NF-κB signaling pathway, while long exposure to low arsenic doses suppressed NF-κB signaling pathway activation. These findings may provide a theoretical basis for injurious and therapeutic mechanisms of divergent effects of arsenic.

Applied axial magnetic field effects on laboratory plasma jets: Density hollowing, field compression, and azimuthal rotation

DOE PAGES

Byvank, T.; Banasek, J. T.; Potter, W. M.; ...

2017-12-07

We experimentally measure the effects of an applied axial magnetic field (B z) on laboratory plasma jets and compare experimental results with numerical simulations using an extended magnetohydrodynamics code. A 1 MA peak current, 100 ns rise time pulse power machine is used to generate the plasma jet. On application of the axial field, we observe on-axis density hollowing and a conical formation of the jet using interferometry, compression of the applied B z using magnetic B-dot probes, and azimuthal rotation of the jet using Thomson scattering. Experimentally, we find densities ≤ 5×10 17 cm -3 on-axis relative to jetmore » densities of ≥ 3×10 18 cm -3. For aluminum jets, 6.5 ± 0.5 mm above the foil, we find on-axis compression of the applied 1.0 ± 0.1 T B z to a total 2.4 ± 0.3 T, while simulations predict a peak compression to a total 3.4 T at the same location. On the aluminum jet boundary, we find ion azimuthal rotation velocities of 15-20 km/s, while simulations predict 14 km/s at the density peak. We discuss possible sources of discrepancy between the experiments and simulations, including: surface plasma on B-dot probes, optical fiber spatial resolution, simulation density floors, and 2D vs. 3D simulation effects. Lastly, this quantitative comparison between experiments and numerical simulations helps elucidate the underlying physics that determine the plasma dynamics of magnetized plasma jets.« less

Applied axial magnetic field effects on laboratory plasma jets: Density hollowing, field compression, and azimuthal rotation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byvank, T.; Banasek, J. T.; Potter, W. M.

We experimentally measure the effects of an applied axial magnetic field (B z) on laboratory plasma jets and compare experimental results with numerical simulations using an extended magnetohydrodynamics code. A 1 MA peak current, 100 ns rise time pulse power machine is used to generate the plasma jet. On application of the axial field, we observe on-axis density hollowing and a conical formation of the jet using interferometry, compression of the applied B z using magnetic B-dot probes, and azimuthal rotation of the jet using Thomson scattering. Experimentally, we find densities ≤ 5×10 17 cm -3 on-axis relative to jetmore » densities of ≥ 3×10 18 cm -3. For aluminum jets, 6.5 ± 0.5 mm above the foil, we find on-axis compression of the applied 1.0 ± 0.1 T B z to a total 2.4 ± 0.3 T, while simulations predict a peak compression to a total 3.4 T at the same location. On the aluminum jet boundary, we find ion azimuthal rotation velocities of 15-20 km/s, while simulations predict 14 km/s at the density peak. We discuss possible sources of discrepancy between the experiments and simulations, including: surface plasma on B-dot probes, optical fiber spatial resolution, simulation density floors, and 2D vs. 3D simulation effects. Lastly, this quantitative comparison between experiments and numerical simulations helps elucidate the underlying physics that determine the plasma dynamics of magnetized plasma jets.« less

Significantly improved efficiency of organic solar cells incorporating Co3O4 NPs in the active layer

NASA Astrophysics Data System (ADS)

Yousaf, S. Amber; Ikram, M.; Ali, S.

2018-03-01

Effect of various concentrations of fabricated cobalt oxide (Co3O4) nanoparticles (NPs) in the active layer of different donors and acceptors based hybrid organic bulk heterojunction-BHJ devices were investigated using inverted architecture. The organic active layer comprising different donors P3HT (poly(3-hexylthiophene-2,5-diyl) and PTB7 (Poly[[4,8-bis[(2-ethylhexyl)oxy]benzo[1,2-b:4,5-b']dithiophene-2,6-diyl][3-fluoro-2-[(2-ethylhexyl)carbonyl]thieno[3,4-b] thiophenediyl

Installation Restoration Program. Phase II. Confirmation/Quantification. Stage 1 for Air Force Plant 6, Cobb County, Georgia. Volume 2.

DTIC Science & Technology

1985-08-09

FL UNLSSIFIED C R NEFF ET AL 99 AUG 95 F33615-84-D-4491 F/O 13/2 NLEmhANNE.mmmmhhhhl smhmhhhhmmhhls mhmmhmmhhhhhl...Occupational and Environmental Gainesville, FL 32602-3052 Health Laboratory I Brookq -kir ForrA R"Pn ’’y 1:;~ Sa. NAME OF FUNOINGiSPONSORING 8b. OFFICE...z ul N z~ I. * 4 11 z z 41 ( z a FL - pJ 0 :, w I.. 0 I z. z w \\, Cl) - u zzw JJ 4,..- 4.0 .J.. a A7 0 z I .4-i~ I _ _ __ _ _ C4.. % 0- .1 z IH~ID3M A

Neural expression and post-transcriptional dosage compensation of the steroid metabolic enzyme 17β-HSD type 4

PubMed Central

2010-01-01

Background Steroids affect many tissues, including the brain. In the zebra finch, the estrogenic steroid estradiol (E2) is especially effective at promoting growth of the neural circuit specialized for song. In this species, only the males sing and they have a much larger and more interconnected song circuit than females. Thus, it was surprising that the gene for 17β-hydroxysteroid dehydrogenase type 4 (HSD17B4), an enzyme that converts E2 to a less potent estrogen, had been mapped to the Z sex chromosome. As a consequence, it was likely that HSD17B4 was differentially expressed in males (ZZ) and females (ZW) because dosage compensation of Z chromosome genes is incomplete in birds. If a higher abundance of HSD17B4 mRNA in males than females was translated into functional enzyme in the brain, then contrary to expectation, males could produce less E2 in their brains than females. Results Here, we used molecular and biochemical techniques to confirm the HSD17B4 Z chromosome location in the zebra finch and to determine that HSD17B4 mRNA and activity were detectable in the early developing and adult brain. As expected, HSD17B4 mRNA expression levels were higher in males compared to females. This provides further evidence of the incomplete Z chromosome inactivation mechanisms in birds. We detected HSD17B4 mRNA in regions that suggested a role for this enzyme in the early organization and adult function of song nuclei. We did not, however, detect significant sex differences in HSD17B4 activity levels in the adult brain. Conclusions Our results demonstrate that the HSD17B4 gene is expressed and active in the zebra finch brain as an E2 metabolizing enzyme, but that dosage compensation of this Z-linked gene may occur via post-transcriptional mechanisms. PMID:20359329

Evolution of the Blue and Far-Infrared Galaxy Luminosity Functions

NASA Technical Reports Server (NTRS)

Lonsdale, Carol J.; Chokshi, Arati

1993-01-01

The space density of blue-selected galaxies at moderate redshifts is determined here directly by deriving the luminosity function. Evidence is found for density evolution for moderate luminosity galaxies at a rate of (1+z) exp delta, with a best fit of delta + 4 +/- 2, between the current epoch and Z greater than about 0.1. At M(b) less than -22 evidence is found for about 0.5-1.5 mag of luminosity evolution in addition to the density evolution, corresponding to an evolutionary rate of about (1+z) exp gamma, with gamma = 0.5-2.5, but a redshift of about 0.4. Assuming a steeper faint end slope of alpha = -1.3 similar to that observed in the Virgo cluster, could explain the data with a luminosity evolution rate of gamma = 1-2, without need for any density evolution. Acceptable fits are found by comparing composite density and luminosity evolution models to faint IRAS 60 micron source counts, implying that the blue and far-IR evolutionary rates may be similar.

Applicability of SREM to the Verification of Management Information System Software Requirements. Volume II.

DTIC Science & Technology

1981-04-30

f --tlu Final-Report: Applicability of SREM to the Verification of Management Information System Software Requirements, wtch was prepared for the Army...MA _________ TO ________ UTA 1ASE ___________ StMZ25. 70.aC. .. 3CA, c(ie m(Sl f :~ rin I : ruq in SBII Z tSI. M 4.7/.3 69.9 . MA S U/WA0 1.241.5 96.8...IR.D iTEM B-2 C4 .4 . I.I z- 0 44 f - U l c- I ao V. a, I. vv!N0 ~ q * a - i= - a ~ ePcu m ~ bft 0 = z z z z z Uz 4 P4 -F5 zz - -4 zzz z C6 z c. 0. 4 4 v

Libby Dam and Lake Koocanusa Project, Montana Left Bank Slope.

DTIC Science & Technology

1984-04-01

cut prior to a shower of minor rockfall which characterized the cut slope during morning thawing. He had fortunately overslept. With the loss of site...WZuO-OZ -Z Qzmn omwoo B-20 I z Z- U. I-i *i w w 20 * ~’ Iz In v CY w i li gi f+ + + *x-ZOO -ZJZU 0.&MOO B-21I r~*w u OD x le 0z _ _ _ - - - - - 4cj LIj...i -4i UI Z 00Z - uIwu) u r-w o C-46 ’Ii, ii 0 L U Gi 4 II’ U II :1 - J IIlill U I w ",h "I w1! - -I Nil I >.- 1 • l ( -- 9 -- % II ,r 11 at 0 - i i a

The Mpc-scale radio source associated with the GPS galaxy B1144+352

NASA Astrophysics Data System (ADS)

Schoenmakers, A. P.; de Bruyn, A. G.; Röttgering, H. J. A.; van der Laan, H.

1999-01-01

We present the results of new observations of the enigmatic radio source B1144+352 with the WSRT at 1.4 GHz. This source is hosted by an m_r = 14.3 +/- 0.1 galaxy at a redshift of z=0.063 +/- 0.002 and is one of the lowest redshift Gigahertz Peaked Spectrum (GPS) sources known. It has been known to show radio structure on pc-scale in the radio core and on 20-60 kpc-scale in two jet-like radio structures. The WENSS and NVSS surveys have now revealed faint extended radio structures on an even much larger scale. We have investiga ted these large-scale radio components with new 1.4-GHz WSRT observations. Our radio data indicate that the eastern radio structure has a leading hotspot and we conclude that this structure is a radio lobe originating in the galaxy hosting the GPS source. The western radio structure contains two separate radio sources which are superposed on the sky. The first is a low-power radio source, hosted by a m_R = 15.3 +/- 0.5 galaxy at a similar redshift (z=0.065+/-0.001) to the GPS host galaxy; the second is an extended radio lobe, which we believe is associated with the GPS host galaxy and which contains an elongated tail. The total projected linear size of the extended radio structure associated with B1144+352 is ~ 1.2 Mpc. The core of B1144+353 is a known variable radio source: its flux density at 1.4 GHz has increased continuously between 1974 and 1994. We have measured the flux density of the core in our WSRT observations (epoch 1997.7) and find a value of 541+/-10 mJy This implies that its flux density has decreased by ~ 70 mJy between 1994 and 1997. Further, we have retrieved unpublished archival ROSAT HRI data of B1144+352. The source has been detected and appears to be slightly extended in X-rays. We find a luminosity of (1.26 +/- 0.15)*E(43) erg s(-1) between 0.1 and 2.4 keV, assumin that the X-ray emission is due to an AGN with a powerlaw spectrum with photon index 1.8, or (0.95 +/- 0.11) *E(43) erg s(-1) if it is due to thermal bremsstrahlung at T=10(7) K. The detection of the X-ray source suggests that the intrinsic Hi column density cannot be much larger than a few times 10(21) cm(-2) . The non-detection of an extended X-ray halo in a radius of 250 kpc around the host galaxy limits the X-ray luminosity of an intra-cluster gas component within this radius to <~2.3 x 10(42) erg s(-1) (1sigma upper limit). This is below the luminosity of an X-ray luminous cluster and is more comparable to that of poor groups of galaxies. Also the optical data show no evidence for a rich cluster around the host galaxy. B1144+352 is the second GPS galaxy known to be associated with a Mpc-sized radio source, the other being B1245+676. We argue that the observed structure in both these GPS radio sources must be the result of an interrupted central jet-activity, and that a such they may well be the progenitors of sources belonging to the class of double-double radio galaxy.

Rectangular Microstrip Antenna with Slot Embedded Geometry

NASA Astrophysics Data System (ADS)

Ambresh, P. A.; Hadalgi, P. M.; Hunagund, P. V.; Sujata, A. A.

2014-09-01

In this paper, a novel design that improves the performance of conventional rectangular microstrip antenna is discussed. Design adopts basic techniques such as probe feeding technique with rectangular inverted patch structure as superstrate, air filled dielectric medium as substrate and slot embedded patch. Prototype of the proposed antenna has been fabricated and various antenna performance parameters such as impedance bandwidth, return loss, radiation pattern and antenna gain are considered for Electromagnetic-study. The antennas are designed for the wireless application operating in the frequency range of 3.3 GHz to 3.6 GHz, and UK based fixed satellite service application (3 GHz to 4 GHz), and are named as single inverted patch conventional rectangular microstrip antenna (SIP-CRMSA) and slots embedded inverted patch rectangular microstrip antenna (SEIP-RMSA), respectively. Measurement outcomes for SEIP-RMSA1 and SEIP-RMSA2 showed the satisfactory performance with an achievable impedance bandwidth of 260 MHz (7 %) and 250 MHz (6.72 %), with return loss (RL) of -11.06 dB and -17.98 dB, achieved gain of 8.17 dB and 5.17 dB with 10% and 8% size reduction in comparison with the conventional patch antenna.

The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix B. Hydraulic Research.

DTIC Science & Technology

1981-12-01

Veiga da. 1973 (Sep). "Discussion of Erosion of Sand Beds Around Spur Dikes," Journal, Hydraulics Division, ASCE, Vol 98, q No. HY9...OF w w w w 0ɘ 0uJ, fl - ~ \\ja< 00 S - 0 o 0 0 0 0*ri z 8 z ’u 4L zz 0 0O z0 ., I 14-1 0 PLATE B-4 -7 w ww w w w w w w 0w z LLLL. 00 ’Lz-w ’U<U, U 0u...w Wo’L16~ I 0 0 0 0 CS33l!JQ) NOISN~dX3 NOISOU3 -40 31VNV 4B-4-81 PLATE 11 4 Fwwwww w w I w w ww w -30 T70 EXSIG SON OFL rGR -/N W E TO FL . .~ .-

Protective Effect of Zingiber Officinale against CCl4-Induced Liver Fibrosis Is Mediated through Downregulating the TGF-β1/Smad3 and NF-ĸB/IĸB Pathways.

PubMed

Hasan, Iman H; El-Desouky, M A; Hozayen, Walaa G; Abd el Aziz, Ghada M

2016-01-01

No ideal hepatoprotective agents are available in modern medicine to effectively prevent liver disorders. In this study, we aimed at evaluating the potential of Zingiber officinale in the regression of liver fibrosis and its underlining mechanism of action. To induce liver fibrosis, male Wistar rats received CCl4 (2 ml/kg/2 times/week; i.p.), with and without 300 or 600 mg/kg Z. officinale extract daily through oral gavage. To assess the protective effect of Z. officinale, liver function parameters, histopathology, inflammatory markers and gene expression of transforming growth factor-beta 1 (TGF-β1)/Smad3 and nuclear factor-kappa B (NF-ĸB)/IĸB pathways were analyzed. Results demonstrate that Z. officinale extract markedly prevented liver injury as evident by the decreased liver marker enzymes. Concurrent administration of Z. officinale significantly protected against the CCl4-induced inflammation as showed by the decreased pro-inflammatory cytokine levels as well as the downregulation of the NF-ĸB)/IĸB and TGF-β1/Smad3 pathways in CCl4-administered rats. In conclusion, our study provides evidence that the protective effect of Z. officinale against rat liver fibrosis could be explained through its ability to modulate the TGF-β1/Smad3 and NF-ĸB)/IĸB signaling pathways. © 2015 S. Karger AG, Basel.

VTVH-MCD study of the Delta nifB Delta nifZ MoFe protein from Azotobacter vinelandii.

PubMed

Cotton, Marcia S; Rupnik, Kresimir; Broach, Robyn B; Hu, Yilin; Fay, Aaron W; Ribbe, Markus W; Hales, Brian J

2009-04-08

NifZ is a member of a series of proteins associated with the maturation of the nitrogenase MoFe protein. An MCD spectroscopic study was undertaken on the Delta nifB Delta nifZ MoFe protein generated in the absence of both NifZ and NifB (deletion of NifB generates an apo-MoFe protein lacking the FeMo cofactor). Results presented here show that, in the absence of NifZ, only one of the two P-clusters of the MoFe protein is matured to the ultimate [8Fe-7S] structure. The other P-cluster site in the protein contains a [4Fe-4S] cluster pair, representing a P-cluster precursor that is electronically identical to the analogous clusters observed in the Delta nifH MoFe protein. These results suggest that the MoFe protein is synthesized in a stepwise fashion where NifZ is specifically required for the formation of the second P-cluster.

Observation of a resonancelike structure in the pi +- psi' mass distribution in exclusive B-->Kpi +- psi' decays.

PubMed

Choi, S-K; Olsen, S L; Adachi, I; Aihara, H; Aulchenko, V; Aushev, T; Aziz, T; Bakich, A M; Balagura, V; Bedny, I; Bitenc, U; Bondar, A; Bozek, A; Bracko, M; Brodzicka, J; Browder, T E; Chang, P; Chao, Y; Chen, A; Chen, K-F; Chen, W T; Cheon, B G; Chistov, R; Choi, Y; Dalseno, J; Danilov, M; Dash, M; Eidelman, S; Gabyshev, N; Golob, B; Haba, J; Hara, T; Hayasaka, K; Hayashii, H; Hazumi, M; Heffernan, D; Hoshi, Y; Hou, W-S; Hyun, H J; Iijima, T; Inami, K; Ishikawa, A; Ishino, H; Itoh, R; Iwasaki, M; Iwasaki, Y; Kah, D H; Kang, J H; Katayama, N; Kawai, H; Kawasaki, T; Kichimi, H; Kim, H O; Kim, S K; Kim, Y J; Kinoshita, K; Krizan, P; Krokovny, P; Kumar, R; Kuo, C C; Kuzmin, A; Kwon, Y-J; Lange, J S; Lee, J S; Lee, M J; Lee, S E; Lesiak, T; Limosani, A; Lin, S-W; Liu, Y; Liventsev, D; Mandl, F; Matyja, A; McOnie, S; Medvedeva, T; Mitaroff, W; Miyabayashi, K; Miyake, H; Miyata, H; Miyazaki, Y; Mizuk, R; Moloney, G R; Nakano, E; Nakao, M; Nishida, S; Nitoh, O; Nozaki, T; Ogawa, S; Ohshima, T; Okuno, S; Ozaki, H; Pakhlov, P; Pakhlova, G; Park, C W; Park, H; Peak, L S; Pestotnik, R; Piilonen, L E; Sahoo, H; Sakai, Y; Schneider, O; Schwartz, A J; Senyo, K; Shapkin, M; Shen, C P; Shibuya, H; Shwartz, B; Singh, J B; Somov, A; Stanic, S; Staric, M; Sumiyoshi, T; Suzuki, S Y; Takasaki, F; Tamai, K; Tanaka, M; Teramoto, Y; Tikhomirov, I; Uehara, S; Uglov, T; Unno, Y; Uno, S; Urquijo, P; Varner, G; Vervink, K; Villa, S; Wang, C H; Wang, M-Z; Wang, P; Wang, X L; Watanabe, Y; Wedd, R; Won, E; Yabsley, B D; Yamashita, Y; Yuan, C Z; Zhang, Z P; Zhulanov, V; Zupanc, A; Zyukova, O

2008-04-11

A distinct peak is observed in the pi +/- psi' invariant mass distribution near 4.43 GeV in B-->K pi +/- psi' decays. A fit using a Breit-Wigner resonance shape yields a peak mass and width of M=4433+/-4(stat)+/-2(syst) MeV and Gamma=45-13+18(stat)-13+30(syst) MeV. The product branching fraction is determined to be B(B 0-->K -/+Z+/-(4430)) x B(Z+/-(4430)-->pi+/-psi')=(4.1+/-1.0(stat)+/-1.4(syst)) x 10(-5), where Z+/-(4430) is used to denote the observed structure. The statistical significance of the observed peak is 6.5 sigma. These results are obtained from a 605 fb(-1) data sample that contains 657 x 10(6) BB pairs collected near the Upsilon(4S) resonance with the Belle detector at the KEKB asymmetric energy e+ e- collider.

Feasibility of Equivalent Dipole Models for Electroencephalogram-Based Brain Computer Interfaces.

PubMed

Schimpf, Paul H

2017-09-15

This article examines the localization errors of equivalent dipolar sources inverted from the surface electroencephalogram in order to determine the feasibility of using their location as classification parameters for non-invasive brain computer interfaces. Inverse localization errors are examined for two head models: a model represented by four concentric spheres and a realistic model based on medical imagery. It is shown that the spherical model results in localization ambiguity such that a number of dipolar sources, with different azimuths and varying orientations, provide a near match to the electroencephalogram of the best equivalent source. No such ambiguity exists for the elevation of inverted sources, indicating that for spherical head models, only the elevation of inverted sources (and not the azimuth) can be expected to provide meaningful classification parameters for brain-computer interfaces. In a realistic head model, all three parameters of the inverted source location are found to be reliable, providing a more robust set of parameters. In both cases, the residual error hypersurfaces demonstrate local minima, indicating that a search for the best-matching sources should be global. Source localization error vs. signal-to-noise ratio is also demonstrated for both head models.

BVR Photometry Of An Inverted-spectrum, Flat-spectrum Radio Source With The Rowan 0.4-meter Telescope

NASA Astrophysics Data System (ADS)

Guerra, Erick; Diekewicz, A.

2012-01-01

Several galaxies have been selected for an exploratory campaign with 0.4-meter telescope atop Science Hall at Rowan University. These galaxies exhibit inverted radio spectra on the basis of fluxes in the GB6 and VLA FIRST catalogs and have SDSS magnitudes in g-band less than 15.5. The results of BVR photometry of one of these galaxies, CGCG 215-024, are presented. These are the first results from an ongoing campaign to expand the function of the observatory atop Science Hall. Efforts to mitigate bulding vibration and light pollution in future work will be presented. The authors would like to acknowledge Ric and Jean Edelman for their gift that funded the 0.4-meter telescope.

Salmonella infection in healthy pet reptiles: Bacteriological isolation and study of some pathogenic characters.

PubMed

Bertelloni, Fabrizio; Chemaly, Marianne; Cerri, Domenico; Gall, Françoise Le; Ebani, Valentina Virginia

2016-06-01

The fecal samples from 213 captive reptiles were examined, and 29 (13.61%) Salmonella enterica isolates were detected: 14/62 (22.58%) from chelonians, 14/135 (10.37%) from saurians, and 1/16 (6.25%) from ophidians. The isolates were distributed among 14 different serotypes: Miami, Ebrie, Hermannsweder, Tiergarten, Tornov, Pomona, Poona, Goteborg, Abaetetube, Nyanza, Kumasi, Typhimurium, 50:b:z6, 9,12:z29:1,5, and a non-motile serotype with antigenic formula 1,4,[5],12:-:-. Salmonella typhimurium and 50:b:z6 isolates showed the spv plasmid virulence genes, responsible of the capability to induce extra-intestinal infections. In some cases, pulsed field gel electrophoresis revealed different profiles for the strains of the same serotypes, showing different origins, whereas a common source of infection was supposed when one pulsotype had been observed for isolates of a serovar. Twenty-seven (93.10%) isolates showed resistance to one or more antibiotics. Ceftazidime was active to all the tested isolates, whereas the highest percentages of strains were no susceptible to tigecycline (93.10%), streptomycin (89.66%), and sulfonamide (86.21%).

Installation Restoration Program. Phase 2. Confirmation/Quantification. Stage 2. Duluth International Airport, Duluth, Minnesota. Appendix

DTIC Science & Technology

1988-05-26

tD o 11 11 11 -l m N1 -0 e a, 1 0...2E z z z z 2 z z z S SO, EB S IED O-. CDI z C z z z CP TD gD 2 i 2Qaniz z z z sa -@ 2N’. Us(~ -- (XJ 3 gN( C’Ea - 2E S00 0 00 00 00 00 00 00 00 0 a 4...dr.f mm, 10 fd, I---_1_~a -- ______________0 5;’~ SOAP- bAL -ft VU.-a& 44L PUMPING LXVEL 4bd .’ lM" -- ) fI ... ______ @-Ph. " o0 3s....4..0 a ir a.m

DoD Prime Contractors Receiving Awards over $25,000. FY 1992 (102 Construction Inc -- ZZYZX)

DTIC Science & Technology

1993-01-01

0E n- r4 N-N 0Z4 22-.0 02Cx)𔃾 b w0 DI20 0 00 0 r-) ) z0 0ýýP Ni, 000u M Z W M -I ɜ~ .~ 02 x 0 200t 0 ~ ~ H 0 002U "Il. . z-t 0 -: zaw wý0z ’-4...0 0 0 Q tun - -14-1-14-1-14-1-14-1-14-"-14- 00 "Z Z - a 4-.0 0 : 44: Q< 0 00 0 g 4 - 0 0 0 U t-4 x O u : U ( 0 H H1 m x En 00 )0 z IHQ E 0 0 z 0 -En- u

Dual-Modality Prostate Imaging with PET and Transrectal Ultrasound

DTIC Science & Technology

2009-04-01

TD (e<@?<K(a4S6(<B8R<%R(#M(A$#@Ŝ"&(*8%*&$(Q@<%R(*8$=#%0>>0 *?#:<%&Kb(!"#$%&"’()K(F#:D(JIK(AAD...1( BBD (\\=](O#N<M<&N(;SO!(^a4&$M#$B8%*&(O&8@Q$&B&%"@(#M(4#@<"$#%(SB<@@<#%( 6#B#R$8A?@Kb(;8"<#%8:(S:&*"$<*8:(O8%QM8*"Q$&$@(!@@#*ɠ"<#%(\\;SO!](V&A...34<#%(<%("?&(=8*+R$#Q%N(A&:F<@($&R<#%D(.B8R&( $&A$&@&%"@(GJG(O(*#Q%"@(\\+-(-=(13(B<%Q"&@(#M(N8Ŝ]D(6?&(F#Z&:(@<j&(<@(>D2W(BB(Z(>D2W(BB(Z(JD>J( BBD

Mechanism of inverted-chirp infrasonic radiation from sprites

NASA Astrophysics Data System (ADS)

de Larquier, Sebastien; Pasko, Victor P.

2010-12-01

Farges and Blanc (2010) reported inverted-chirp infrasonic signals with high frequencies arriving before low frequencies, possibly emitted by sprite discharges and observed on the ground at close range (<100 km) from the source. In the present work a parallel version of a 2-D FDTD model of infrasound propagation in a realistic atmosphere is applied to demonstrate that the observed morphology of infrasound signals is consistent with general scaling of diameters of sprite streamers inversely proportionally to the air density. The smaller structures at lower altitudes radiate higher infrasonic frequencies that arrive first at the observational point on the ground, while the low frequency components are delayed because they originate at lower air densities at higher altitudes. The results demonstrate that strong absorption of high frequency infrasonic components at high altitudes (i.e., ˜0.2 dB/km for 8 Hz at 70 km) may also contribute to formation of inverted-chirp signals observed on the ground at close range.

The Temperature-Density Relation in the Intergalactic Medium at Redshift langzrang = 2.4

NASA Astrophysics Data System (ADS)

Rudie, Gwen C.; Steidel, Charles C.; Pettini, Max

2012-10-01

We present new measurements of the temperature-density (T-ρ) relation for neutral hydrogen in the 2.0 < z < 2.8 intergalactic medium (IGM) using a sample of ~6000 individual H I absorbers fitted with Voigt profiles constrained in all cases by multiple Lyman series transitions. We find model-independent evidence for a positive correlation between the column density of H I (N H I ) and the minimum observed velocity width of absorbers (b min). With minimal interpretation, this implies that the T-ρ relation in the IGM is not "inverted," contrary to many recent studies. Fitting b min as a function of N H I results in line-width-column-density dependence of the form b min = b 0(N H I /N H I,0)Γ-1 with a minimum line width at mean density (\\rho /\\bar{\\rho }= 1, N_H\\,\\mathsc{i, 0} = 10^{13.6} cm-2) of b 0 = 17.9 ± 0.2 km s-1 and a power-law index of (Γ - 1) = 0.15 ± 0.02. Using analytic arguments, these measurements imply an "equation of state" for the IGM at langzrang = 2.4 of the form T=T_0 \\left(\\rho /\\bar{\\rho }\\right)^{\\gamma -1} with a temperature at mean density of T 0 = [1.94 ± 0.05] × 104 K and a power-law index (γ - 1) = 0.46 ± 0.05. Based on data obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration, and was made possible by the generous financial support of the W. M. Keck Foundation.

Tyndall AFB, Florida. Revised Uniform Summary of Surface Weather Observations. Parts A-F.

DTIC Science & Technology

1987-07-24

OF RECORD: 71 -86 MONTHz DEC RAIN FRZIHN SNOW t OS SMOKE DUST % 08S HOURS I TSTMS LIOR RAIN cIOR MAIL WITH FOG C/OR BLOWING L/OR W/0BST TOTAL ILSTI I...1 133S1 5.71 23.60 .00 OCT 71 .b i 8.21 1.3 1 2.51 1.41 2.81 Z.51 ?.4 1 2.3 1 .7 1 -1 1 1 I 16.0 1 13871 3.12 16.11 .0c NOV 66.2 1 6.31 1.1 1 6.31...ae 2.C9 .76 1.66 Y.7- 1.6! *3.79 4.33 1.61 2.10 $4.33 b5 I .67 1.S!5 Z. 71 2.51; TRACE 4.4b 2.--- 2.bS 2.62 3.341 .95 2.14 4.46 66 1 1.32 Z.42 ’.’L

All Prime Contract Awards by State or Country, Place, and Contractor. Part 18 (Elmo Texas-San Saba Texas)

DTIC Science & Technology

1990-01-01

01D I0 WN 00 40C4 00 00 0 2 -i iniin moon 1-1 in0 0 0 -~i of 1-4 It1.0. 9- ) 0 r- 0L U. td ) U- 0- z r- ɘ C C 0 Qt I 10- 0 < xr4I NN 00) N j C" 000...p- co. 0-4 itBOOC 0. 40 aOO B-OO OOO Z B-B-B 00 C> W-4 B-B COB0-4 3H. 0 ) I.-0 UB U 000)-4 WO04L000000000 20 WOO P- C in fa 00-4 BBD ~ ~0 ccCe 00 00

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

PubMed Central

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B; Belcher-Dufrisne, Meagan; Wiriyasermkul, Pattama; Giese, M Hunter; Leal-Pinto, Edgar; Kloss, Brian; Tabuso, Shantelle; Love, James; Punta, Marco; Banerjee, Surajit; Rajashankar, Kanagalaghatta R; Rost, Burkhard; Logothetis, Diomedes; Quick, Matthias; Hendrickson, Wayne A

2018-01-01

Sulfur, most abundantly found in the environment as sulfate (SO42-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO42- at the molecular level is limited. CysZ has been described as a SO42- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO42- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO42- across membranes. CysZ structures from three different bacterial species display a hitherto unknown fold and have subunits organized with inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. Mutational studies highlight the functional relevance of conserved CysZ residues. PMID:29792261

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B.

Sulfur, most abundantly found in the environment as sulfate (SO42-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO42- at the molecular level is limited. CysZ has been described as a SO42- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO42- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO42- across membranes. CysZ structures from three different bacterial species display a hitherto unknown fold and have subunits organized withmore » inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. Mutational studies highlight the functional relevance of conserved CysZ residues.« less

Test Results MM Stage 1, S/N 0012199

DTIC Science & Technology

1988-10-01

D k LUULIJ " - en) L C -q -L LN - 0 2 LU O)iLf)0 L)U-LiU C) C: )u C r- ~ N 0 - ) $ CY)z zZ D O : lz bo1 LL J d ) C:, U (Do~ LL~o LL v L.O... D 4c b. 0 0 a 0 0 00 Q. 9 00e O , .4 Ok ;. -u - -q f- . P .4 t- j . P -W) c. U. .0 0 0 0 00 ’ O~ . ..... LL 0 0 0 00 0 0 0 0 9 ul . J .. . .++++ l z P...00I t0,00r4 0 0 0, 000 a % C " r C 4 0 ULLJ LAj It 0) 0 r-~uu 0’ o _C CV) .0cn L 0 - z~a u IS a: *I - D r Goraa -r b-LLL ZL - j uj w _L

Non-Abelian string and particle braiding in topological order: Modular SL (3 ,Z ) representation and (3 +1 ) -dimensional twisted gauge theory

NASA Astrophysics Data System (ADS)

Wang, Juven C.; Wen, Xiao-Gang

2015-01-01

String and particle braiding statistics are examined in a class of topological orders described by discrete gauge theories with a gauge group G and a 4-cocycle twist ω4 of G 's cohomology group H4(G ,R /Z ) in three-dimensional space and one-dimensional time (3 +1 D ) . We establish the topological spin and the spin-statistics relation for the closed strings and their multistring braiding statistics. The 3 +1 D twisted gauge theory can be characterized by a representation of a modular transformation group, SL (3 ,Z ) . We express the SL (3 ,Z ) generators Sx y z and Tx y in terms of the gauge group G and the 4-cocycle ω4. As we compactify one of the spatial directions z into a compact circle with a gauge flux b inserted, we can use the generators Sx y and Tx y of an SL (2 ,Z ) subgroup to study the dimensional reduction of the 3D topological order C3 D to a direct sum of degenerate states of 2D topological orders Cb2 D in different flux b sectors: C3 D=⊕bCb2 D . The 2D topological orders Cb2 D are described by 2D gauge theories of the group G twisted by the 3-cocycle ω3 (b ), dimensionally reduced from the 4-cocycle ω4. We show that the SL (2 ,Z ) generators, Sx y and Tx y, fully encode a particular type of three-string braiding statistics with a pattern that is the connected sum of two Hopf links. With certain 4-cocycle twists, we discover that, by threading a third string through two-string unlink into a three-string Hopf-link configuration, Abelian two-string braiding statistics is promoted to non-Abelian three-string braiding statistics.

Physical Nature of the Processes in Structure Forming, Phase and Chemical Composition of pipe Permanent Joints when MMA Welding

NASA Astrophysics Data System (ADS)

Il'yaschenko, D. P.; Chinakhov, D. A.; Danilov, V. I.; Sadykov, I. D.

2016-04-01

The paper outlines peculiarities of structure formation, phase and chemical composition in regard to heat content in molten electrode metal beads when pipe steel (steel 09G2S) welding using power sources with various energy characteristics. Mathematical calculations indicate an inverter power source provides minor heat content into the bead of electrode metal when welding. Experimental research has pointed at 4-9 % increase in impact strength of joints produced using an inverter power source in comparison with samples produced applying a diode rectifier. The following factors can possibly give rise to the increasing impact strength: difference in microstructures of weld joints, up to 50% shortening ferritic plates in metal of weld joint, change in dimensions of ferritic grains in the heat-affected zone by as much as 17.5 %, and decrease in the extent of heat-affected zone by 50%.

The QCD corrections of the process h → ηbZ

NASA Astrophysics Data System (ADS)

Zhu, Rong-Fei; Feng, Tai-Fu; Zhang, Hai-Bin

2018-05-01

We investigate the 125 GeV Higgs boson decay to a pseudoscalar quarkonium ηb and Z boson. We calculate the quantum chromodynamics (QCD) one-loop corrections to the branching ratio of the process, Br(h → ηbZ), both in the Standard Model (SM) and in the two Higgs double models (THDM). Adding the QCD one-loop corrections, the branching ratio of h → ηbZ in the SM is Br(h → ηbZ) = (4.739‑0.244+0.276) × 10‑5. The relative correction of that QCD one-loop level relative to the tree level of Br(h → ηbZ) is around 76% in the SM. Similarly, the relative correction in the THDM also can be around 75%. The key parameter, tan β, can affect the relative correction in the THDM.

Hydrothermal synthesis and characterization of the first mixed alkali borate-nitrate K{sub 3}Na[B{sub 6}O{sub 9}(OH){sub 3}]NO{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ortner, Teresa S.; Wurst, Klaus; Perfler, Lukas

2015-01-15

The first mixed alkali borate-nitrate K{sub 3}Na[B{sub 6}O{sub 9}(OH){sub 3}]NO{sub 3} was synthesized under hydrothermal conditions from Na{sub 2}B{sub 4}O{sub 7}·10H{sub 2}O and K{sub 2}B{sub 4}O{sub 7}·4H{sub 2}O using KNO{sub 3} as a nitrate source. The compound crystallizes in the space group Pnnm (no. 58) with the lattice parameters a=1320.8(3), b=910.7(2), and c=1232.5(3) pm (Z=4). Isolated Sechserrings formed by BO{sub 4} and BO{sub 3} groups are linked through hydrogen bridges to form a three-dimensional network. - Graphical abstract: The first mixed alkali borate-nitrate K{sub 3}Na[B{sub 6}O{sub 9}(OH){sub 3}]NO{sub 3} was synthesized under hydrothermal conditions from Na{sub 2}B{sub 4}O{sub 7}·10H{sub 2}Omore » and K{sub 2}B{sub 4}O{sub 7}·4H{sub 2}O using KNO{sub 3} as a nitrate source. - Highlights: • The first mixed alkali borate-nitrate K{sub 3}Na[B{sub 6}O{sub 9}(OH){sub 3}]NO{sub 3} is reported. • Hydrothermal conditions (240 °C, 3d) were used for the synthesis of K{sub 3}Na[B{sub 6}O{sub 9}(OH){sub 3}]NO{sub 3}. • Borate Sechserrings are interconnected through hydrogen-bonding.« less

Molecular Beam Epitaxial Regrowth of Antimonide-Based Semiconductors

DTIC Science & Technology

2011-01-01

Molecular Beam Epitaxial Regrowth of Antimonide-Based Semiconductors MATTHEW REASON,1 BRIAN R. BENNETT,1,2 RICHARD MAGNO,1 and J. BRAD BOOS1 1...2010 to 00-00-2010 4. TITLE AND SUBTITLE Molecular Beam Epitaxial Regrowth of Antimonide-Based Semiconductors 5a. CONTRACT NUMBER 5b. GRANT...Prescribed by ANSI Std Z39-18 EXPERIMENTAL PROCEDURES The samples reported in this work were grown by solid-source molecular - beam epitaxy (MBE) with

First observation of forward Z → b b bar production in pp collisions at √{ s } = 8 TeV

NASA Astrophysics Data System (ADS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Alfonso Albero, A.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Balagura, V.; Baldini, W.; Baranov, A.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Beiter, A.; Bel, L. J.; Beliy, N.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Beranek, S.; Berezhnoy, A.; Bernet, R.; Berninghoff, D.; Bertholet, E.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M.-O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Birnkraut, A.; Bitadze, A.; Bizzeti, A.; Bjørn, M.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Boettcher, T.; Bondar, A.; Bondar, N.; Bonivento, W.; Bordyuzhin, I.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Britton, T.; Brodzicka, J.; Brundu, D.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Byczynski, W.; Cadeddu, S.; Cai, H.; Calabrese, R.; Calladine, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Castillo Garcia, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Chapman, M. G.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, S. F.; Chitic, S.-G.; Chobanova, V.; Chrzaszcz, M.; Chubykin, A.; Ciambrone, P.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collins, P.; Colombo, T.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Dall'Occo, E.; Dalseno, J.; Davis, A.; De Aguiar Francisco, O.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C. T.; Decamp, D.; Del Buono, L.; Dembinski, H.-P.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Nezza, P.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Douglas, L.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Durante, P.; Dzhelyadin, R.; Dziewiecki, M.; Dziurda, A.; Dzyuba, A.; Easo, S.; Ebert, M.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fazzini, D.; Federici, L.; Ferguson, D.; Fernandez, G.; Fernandez Declara, P.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiore, M.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K.; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Furfaro, E.; Färber, C.; Gabriel, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Garsed, P. J.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Grabowski, J. P.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greim, R.; Griffith, P.; Grillo, L.; Gruber, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hamilton, B.; Han, X.; Hancock, T. H.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; Hasse, C.; Hatch, M.; He, J.; Hecker, M.; Heinicke, K.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hombach, C.; Hopchev, P. H.; Huard, Z. C.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Ibis, P.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kazeev, N.; Kecke, M.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Klimkovich, T.; Koliiev, S.; Kolpin, M.; Komarov, I.; Kopecna, R.; Koppenburg, P.; Kosmyntseva, A.; Kotriakhova, S.; Kozeiha, M.; Kravchuk, L.; Kreps, M.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kurek, K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, P.-R.; Li, T.; Li, Y.; Li, Z.; Likhomanenko, T.; Lindner, R.; Lionetto, F.; Lisovskyi, V.; Liu, X.; Loh, D.; Loi, A.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Macko, V.; Mackowiak, P.; Maddrell-Mander, S.; Maev, O.; Maguire, K.; Maisuzenko, D.; Majewski, M. W.; Malde, S.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Manning, P.; Marangotto, D.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Mead, J. V.; Meadows, B.; Meaux, C.; Meier, F.; Meinert, N.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Millard, E.; Minard, M.-N.; Minzoni, L.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Mombächer, T.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morello, M. J.; Morgunova, O.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Nogay, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Ossowska, A.; Otalora Goicochea, J. M.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palutan, M.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pisani, F.; Pistone, A.; Piucci, A.; Placinta, V.; Playfer, S.; Plo Casasus, M.; Polci, F.; Poli Lener, M.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Ponce, S.; Popov, A.; Popov, D.; Poslavskii, S.; Potterat, C.; Price, E.; Prisciandaro, J.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Pullen, H.; Punzi, G.; Qian, W.; Quagliani, R.; Quintana, B.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Ravonel Salzgeber, M.; Reboud, M.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Robert, A.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rodriguez Perez, P.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Ronayne, J. W.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Valls, P.; Ruiz Vidal, J.; Saborido Silva, J. J.; Sadykhov, E.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarpis, G.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schreiner, H. F.; Schubert, K.; Schubiger, M.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepulveda, E. S.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J.; Smith, M.; Soares Lavra, l.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stepanova, M.; Stevens, H.; Stone, S.; Storaci, B.; Stracka, S.; Stramaglia, M. E.; Straticiuc, M.; Straumann, U.; Sun, J.; Sun, L.; Sutcliffe, W.; Swientek, K.; Syropoulos, V.; Szczekowski, M.; Szumlak, T.; Szymanski, M.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Toriello, F.; Tourinho Jadallah Aoude, R.; Tournefier, E.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Usachov, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagner, A.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Verlage, T. A.; Vernet, M.; Vesterinen, M.; Viana Barbosa, J. V.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wang, J.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Winn, M.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wyllie, K.; Xie, Y.; Xu, Z.; Yang, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zonneveld, J. B.; Zucchelli, S.; LHCb Collaboration

2018-01-01

The decay Z → b b bar is reconstructed in pp collision data, corresponding to 2 fb-1 of integrated luminosity, collected by the LHCb experiment at a centre-of-mass energy of √{ s } = 8 TeV. The product of the Z production cross-section and the Z → b b bar branching fraction is measured for candidates in the fiducial region defined by two particle-level b-quark jets with pseudorapidities in the range 2.2 < η < 4.2, with transverse momenta pT > 20 GeV and dijet invariant mass in the range 45

Exploratory X-ray Monitoring of z>4 Radio-Quiet Quasars

NASA Astrophysics Data System (ADS)

Shemmer, Ohad

2017-09-01

We propose to extend our exploratory X-ray monitoring project of some of the most distant radio-quiet quasars by obtaining one snapshot observation per Cycle for each of four sources at z>4. Combining these observations with six available X-ray epochs per source will provide basic temporal information over rest-frame timescales of 3-5 yr. We are supporting this project with Swift monitoring of luminous radio-quiet quasars at z=1.3-2.7 to break the L-z degeneracy and test evolutionary scenarios of the central engine in active galactic nuclei. Our ultimate goal is to provide a basic assessment of the X-ray variability properties of luminous quasars at the highest accessible redshifts that will serve as the benchmark for X-ray variability studies of such sources with future X-ray missions.

Collaborative Studies of Polar Cap Ionospheric Dynamics.

DTIC Science & Technology

1987-10-12

AQOIIRISS ICity. State ed Zip Code , 10. SOURCE OF PUNOING NOS. PROGRAM PROJECT TASK WORK .jNir ILE MgtNT NO. NO. NO. NO I TTL fneud ScuryCjMf,4,0...housing and the 3- stage thermoelectric cooler for the image plane detector. The operational principles that govern the application of the instrument are...Force Geophysics Laboratory 6c AOAGS J~iy. Sart A4 Z’P Cdol b. ADDRIESS (City. fE t ad ZIP Code , Anti Arbor, Mic higa n 4819HncmAFB Massachusetts 01731 A

Variable-frequency inverter controls torque, speed, and braking in ac induction motors

NASA Technical Reports Server (NTRS)

Nola, F. J.

1974-01-01

Dc to ac inverter provides optimum frequency and voltage to ac induction motor, in response to different motor-load and speed requirements. Inverter varies slip frequency of motor in proportion to required torque. Inverter protects motor from high current surges, controls negative slip to apply braking, and returns energy stored in momentum of load to dc power source.

Automation of an RCS (Radar Cross Section) Measurement System and Its Application to Investigate the Electromagnetic Scattering from Scale Model Aircraft Canopies

DTIC Science & Technology

1989-12-01

8217 -E ep IP 760 7v rag-2-t 7 -vet ca vo - a~ .:cz : 112 !] 10 Star-, requency i- -in.- -,,z. 200 :1h too t rouencv, i ax. 210 N T iarizat~on i2:)15. 220... 10 2-3 Pyramidal Radar Absorbing Material (RAM) ... . 11 2-4 Hardware configuration .... ............. 13 2-5 Point source model for phase variation...two plates ....... 51 4- 10 Gated RCS of 4 inch circular flat plate a) time doi. ain and b) frequency response . . . . 52 5-1 Measurement test matrix

Rational approximations of f(R) cosmography through Pad'e polynomials

NASA Astrophysics Data System (ADS)

Capozziello, Salvatore; D'Agostino, Rocco; Luongo, Orlando

2018-05-01

We consider high-redshift f(R) cosmography adopting the technique of polynomial reconstruction. In lieu of considering Taylor treatments, which turn out to be non-predictive as soon as z>1, we take into account the Pad&apose rational approximations which consist in performing expansions converging at high redshift domains. Particularly, our strategy is to reconstruct f(z) functions first, assuming the Ricci scalar to be invertible with respect to the redshift z. Having the so-obtained f(z) functions, we invert them and we easily obtain the corresponding f(R) terms. We minimize error propagation, assuming no errors upon redshift data. The treatment we follow naturally leads to evaluating curvature pressure, density and equation of state, characterizing the universe evolution at redshift much higher than standard cosmographic approaches. We therefore match these outcomes with small redshift constraints got by framing the f(R) cosmology through Taylor series around 0zsimeq . This gives rise to a calibration procedure with small redshift that enables the definitions of polynomial approximations up to zsimeq 10. Last but not least, we show discrepancies with the standard cosmological model which go towards an extension of the ΛCDM paradigm, indicating an effective dark energy term evolving in time. We finally describe the evolution of our effective dark energy term by means of basic techniques of data mining.

Magnetic properties of Zn1-zMnzGa2Se4 alloy system in the temperature range from 2 to 300 K

NASA Astrophysics Data System (ADS)

Morocoima, M.; Quintero, M.; Quintero, E.; Bocaranda, P.; Ruiz, J.; Moreno, E.

2006-10-01

Measurements of low field static magnetic susceptibility and of magnetization with pulsed magnetic fields up to 32T have been made as a function of temperature on polycrystalline samples of the Zn1-zMnzGa2Se4 alloy system, which has a defect tetragonal chalcopyrite structure in the whole composition range. The resulting data have been used to give information on the magnetic spin-flop and magnetic saturation transitions, and details of the magnetic B-T phase diagrams were determined for the phases. The zero-field Néel temperatures TN and triple points, for the Zn1-zMnzGa2Se4 alloy system, have been found to be 8.1K and (7.8K, 2.2T) for z =1, 5.8K and (5.6K, 1.7T) for z =0.85, 4.5K and (4.35K, 1.0T) for z =0.075, and 3.9K and (3.85K, 0.5T) for z =0.7. The susceptibility χ(T ) curves for B =3 and 5T show magnetothermal effects below 4.5K.

Proton radiography measurements and models of ejecta structure in shocked Sn

NASA Astrophysics Data System (ADS)

Hammerberg, J. E.; Buttler, W. T.; Llobet, A.; Morris, C.; Goett, J.; Manzanares, R.; Saunders, A.; Schmidt, D.; Tainter, A.; Vogan-McNeil, W.; Wilde, C.

2017-06-01

We discuss experimental validation of ejecta source mass and velocity models using proton radiography. We have performed ejecta measurements at the Los Alamos proton radiography facility on 7 mm thick 81 mm diameter Sn samples driven with a plane-wave high explosive lens (PBX9501 + TNT). The surface of the Sn, in contact with He gas at an initial pressure of 7 atmospheres, was machined to have 4 concentric sinusoidal features with a wavelength of λ = 2 mm in the radial direction and amplitude h0 = 0.159 mm (kh0 = 2 πh0 / λ = 0.5). The shock pressure was 27 GPa. 42 images were obtained between 0 and 14 μs from the time of shock breakout at 275 and 400 ns intervals. The Abel inverted density profiles evolve to a self-similar density distribution that depends on a scaling variable z /vs t where vs is the spike tip velocity, z is the distance from the free surface and t is the time after shock breakout. Both the density profiles and the time dependence of the mass per unit area in the evolving spikes are in good agreement with a Richtmyer-Meshkov instability based model for ejecta production and evolution. This work was performed under the auspices of the U.S. Dept. of Energy under contract DE-AC52-06NA25396. The support of the LANL ASC-PEM and Science Campaign 2 programs is gratefully acknowledged.

Electric vehicle system for charging and supplying electrical power

DOEpatents

Su, Gui Jia

2010-06-08

A power system that provides power between an energy storage device, an external charging-source/load, an onboard electrical power generator, and a vehicle drive shaft. The power system has at least one energy storage device electrically connected across a dc bus, at least one filter capacitor leg having at least one filter capacitor electrically connected across the dc bus, at least one power inverter/converter electrically connected across the dc bus, and at least one multiphase motor/generator having stator windings electrically connected at one end to form a neutral point and electrically connected on the other end to one of the power inverter/converters. A charging-sourcing selection socket is electrically connected to the neutral points and the external charging-source/load. At least one electronics controller is electrically connected to the charging-sourcing selection socket and at least one power inverter/converter. The switch legs in each of the inverter/converters selected by the charging-source/load socket collectively function as a single switch leg. The motor/generators function as an inductor.

Reactivity of the Ni-->B dative sigma-bond in the nickel boratrane compounds [kappa4-B(mimBut)3]NiX (X=Cl, OAc, NCS, N3): synthesis of a series of B-functionalized tris(2-mercapto-1-tert-butylimidazolyl)borato complexes, [YTmBut)]NiZ.

PubMed

Pang, Keliang; Tanski, Joseph M; Parkin, Gerard

2008-02-28

The nickel boratrane complexes [kappa4-B(mimBut))3]Ni(kappa1-OAc), [kappa4-B(mimBut)3]NiNCS and [kappa4-B(mimBut)3]NiN3 are obtained via metathesis of the chloride ligand of [kappa4-B(mimBut)3]NiCl with TlOAc, KSCN and NaN3, respectively; the Ni-->B bond in these complexes is a site of reactivity, thereby providing a means of synthesizing nickel complexes that feature B-functionalized tris(mercaptoimidazolyl)borate derivatives, [YTmBut]NiZ.

Multi-component hydrogen storage material

DOEpatents

Faheem, Syed A.; Lewis, Gregory J.; Sachtler, J.W. Adriaan; Low, John J.; Lesch, David A.; Dosek, Paul M.; Wolverton, Christopher M.; Siegel, Donald J.; Sudik, Andrea C.; Yang, Jun

2010-09-07

A reversible hydrogen storage composition having an empirical formula of: Li.sub.(x+z)N.sub.xMg.sub.yB.sub.zH.sub.w where 0.4.ltoreq.x.ltoreq.0.8; 0.2.ltoreq.y.ltoreq.0.6; 0

A single-phase multi-level D-STATCOM inverter using modular multi-level converter (MMC) topology for renewable energy sources

NASA Astrophysics Data System (ADS)

Sotoodeh, Pedram

This dissertation presents the design of a novel multi-level inverter with FACTS capability for small to mid-size (10-20kW) permanent-magnet wind installations using modular multi-level converter (MMC) topology. The aim of the work is to design a new type of inverter with D-STATCOM option to provide utilities with more control on active and reactive power transfer of distribution lines. The inverter is placed between the renewable energy source, specifically a wind turbine, and the distribution grid in order to fix the power factor of the grid at a target value, regardless of wind speed, by regulating active and reactive power required by the grid. The inverter is capable of controlling active and reactive power by controlling the phase angle and modulation index, respectively. The unique contribution of the proposed work is to combine the two concepts of inverter and D-STATCOM using a novel voltage source converter (VSC) multi-level topology in a single unit without additional cost. Simulations of the proposed inverter, with 5 and 11 levels, have been conducted in MATLAB/Simulink for two systems including 20 kW/kVAR and 250 W/VAR. To validate the simulation results, a scaled version (250 kW/kVAR) of the proposed inverter with 5 and 11 levels has been built and tested in the laboratory. Experimental results show that the reduced-scale 5- and 11-level inverter is able to fix PF of the grid as well as being compatible with IEEE standards. Furthermore, total cost of the prototype models, which is one of the major objectives of this research, is comparable with market prices.

Reorganization of Damaged Chromatin by the Exchange of Histone Variant H2A.Z-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishibuchi, Ikuno; Department of Radiation Oncology, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima; Department of Radiation Oncology, Hiroshima Prefectural Hospital, Hiroshima

2014-07-15

Purpose: The reorganization of damaged chromatin plays an important role in the regulation of the DNA damage response. A recent study revealed the presence of 2 vertebrate H2A.Z isoforms, H2A.Z-1 and H2A.Z-2. However, the roles of the vertebrate H2A.Z isoforms are still unclear. Thus, in this study we examined the roles of the vertebrate H2A.Z isoforms in chromatin reorganization after the induction of DNA double-strand breaks (DSBs). Methods and Materials: To examine the dynamics of H2A.Z isoforms at damaged sites, we constructed GM0637 cells stably expressing each of the green fluorescent protein (GFP)-labeled H2A.Z isoforms, and performed fluorescence recovery after photobleaching (FRAP)more » analysis and inverted FRAP analysis in combination with microirradiation. Immunofluorescence staining using an anti-RAD51 antibody was performed to study the kinetics of RAD51 foci formation after 2-Gy irradiation of wild-type (WT), H2A.Z-1- and H2A.Z-2-deficient DT40 cells. Colony-forming assays were also performed to compare the survival rates of WT, H2A.Z-1-, and H2A.Z-2-deficient DT40 cells with control, and H2A.Z-1- and H2A.Z-2-depleted U2OS cells after irradiation. Results: FRAP analysis revealed that H2A.Z-2 was incorporated into damaged chromatin just after the induction of DSBs, whereas H2A.Z-1 remained essentially unchanged. Inverted FRAP analysis showed that H2A.Z-2 was released from damaged chromatin. These findings indicated that H2A.Z-2 was exchanged at DSB sites immediately after the induction of DSBs. RAD51 focus formation after ionizing irradiation was disturbed in H2A.Z-2-deficient DT40 cells but not in H2A.Z-1-deficient cells. The survival rate of H2A.Z-2-deficient cells after irradiation was lower than those of WT and H2A.Z-1- DT40 cells. Similar to DT40 cells, H2A.Z-2-depleted U2OS cells were also radiation-sensitive compared to control and H2A.Z-1-depleted cells. Conclusions: We found that vertebrate H2A.Z-2 is involved in the regulation of the DNA damage response at a very early stage, via the damaged chromatin reorganization required for RAD51 focus formation.« less

Voltage balanced multilevel voltage source converter system

DOEpatents

Peng, Fang Zheng; Lai, Jih-Sheng

1997-01-01

A voltage balanced multilevel converter for high power AC applications such as adjustable speed motor drives and back-to-back DC intertie of adjacent power systems. This converter provides a multilevel rectifier, a multilevel inverter, and a DC link between the rectifier and the inverter allowing voltage balancing between each of the voltage levels within the multilevel converter. The rectifier is equipped with at least one phase leg and a source input node for each of the phases. The rectifier is further equipped with a plurality of rectifier DC output nodes. The inverter is equipped with at least one phase leg and a load output node for each of the phases. The inverter is further equipped with a plurality of inverter DC input nodes. The DC link is equipped with a plurality of rectifier charging means and a plurality of inverter discharging means. The plurality of rectifier charging means are connected in series with one of the rectifier charging means disposed between and connected in an operable relationship with each adjacent pair of rectifier DC output nodes. The plurality of inverter discharging means are connected in series with one of the inverter discharging means disposed between and connected in an operable relationship with each adjacent pair of inverter DC input nodes. Each of said rectifier DC output nodes are individually electrically connected to the respective inverter DC input nodes. By this means, each of the rectifier DC output nodes and each of the inverter DC input nodes are voltage balanced by the respective charging and discharging of the rectifier charging means and the inverter discharging means.

Voltage balanced multilevel voltage source converter system

DOEpatents

Peng, F.Z.; Lai, J.S.

1997-07-01

Disclosed is a voltage balanced multilevel converter for high power AC applications such as adjustable speed motor drives and back-to-back DC intertie of adjacent power systems. This converter provides a multilevel rectifier, a multilevel inverter, and a DC link between the rectifier and the inverter allowing voltage balancing between each of the voltage levels within the multilevel converter. The rectifier is equipped with at least one phase leg and a source input node for each of the phases. The rectifier is further equipped with a plurality of rectifier DC output nodes. The inverter is equipped with at least one phase leg and a load output node for each of the phases. The inverter is further equipped with a plurality of inverter DC input nodes. The DC link is equipped with a plurality of rectifier charging means and a plurality of inverter discharging means. The plurality of rectifier charging means are connected in series with one of the rectifier charging means disposed between and connected in an operable relationship with each adjacent pair of rectifier DC output nodes. The plurality of inverter discharging means are connected in series with one of the inverter discharging means disposed between and connected in an operable relationship with each adjacent pair of inverter DC input nodes. Each of said rectifier DC output nodes are individually electrically connected to the respective inverter DC input nodes. By this means, each of the rectifier DC output nodes and each of the inverter DC input nodes are voltage balanced by the respective charging and discharging of the rectifier charging means and the inverter discharging means. 15 figs.

Photometric redshift requirements for lens galaxies in galaxy-galaxy lensing analyses

NASA Astrophysics Data System (ADS)

Nakajima, R.; Mandelbaum, R.; Seljak, U.; Cohn, J. D.; Reyes, R.; Cool, R.

2012-03-01

Weak gravitational lensing is a valuable probe of galaxy formation and cosmology. Here we quantify the effects of using photometric redshifts (photo-z) in galaxy-galaxy lensing, for both sources and lenses, both for the immediate goal of using galaxies with photo-z as lenses in the Sloan Digital Sky Survey (SDSS) and as a demonstration of methodology for large, upcoming weak lensing surveys that will by necessity be dominated by lens samples with photo-z. We calculate the bias in the lensing mass calibration as well as consequences for absolute magnitude (i.e. k-corrections) and stellar mass estimates for a large sample of SDSS Data Release 8 (DR8) galaxies. The redshifts are obtained with the template-based photo-z code ZEBRA on the SDSS DR8 ugriz photometry. We assemble and characterize the calibration samples (˜9000 spectroscopic redshifts from four surveys) to obtain photometric redshift errors and lensing biases corresponding to our full SDSS DR8 lens and source catalogues. Our tests of the calibration sample also highlight the impact of observing conditions in the imaging survey when the spectroscopic calibration covers a small fraction of its footprint; atypical imaging conditions in calibration fields can lead to incorrect conclusions regarding the photo-z of the full survey. For the SDSS DR8 catalogue, we find σΔz/(1+z)= 0.096 and 0.113 for the lens and source catalogues, with flux limits of r= 21 and 21.8, respectively. The photo-z bias and scatter is a function of photo-z and template types, which we exploit to apply photo-z quality cuts. By using photo-z rather than spectroscopy for lenses, dim blue galaxies and L* galaxies up to z˜ 0.4 can be used as lenses, thus expanding into unexplored areas of parameter space. We also explore the systematic uncertainty in the lensing signal calibration when using source photo-z, and both lens and source photo-z; given the size of existing training samples, we can constrain the lensing signal calibration (and therefore the normalization of the surface mass density) to within 2 and 4 per cent, respectively.

Printed 2 V-operating organic inverter arrays employing a small-molecule/polymer blend

PubMed Central

Shiwaku, Rei; Takeda, Yasunori; Fukuda, Takashi; Fukuda, Kenjiro; Matsui, Hiroyuki; Kumaki, Daisuke; Tokito, Shizuo

2016-01-01

Printed organic thin-film transistors (OTFTs) are well suited for low-cost electronic applications, such as radio frequency identification (RFID) tags and sensors. Achieving both high carrier mobility and uniform electrical characteristics in printed OTFT devices is essential in these applications. Here, we report on printed high-performance OTFTs and circuits using silver nanoparticle inks for the source/drain electrodes and a blend of dithieno[2,3-d;2′,3′-d′]benzo[1,2-b;4,5-b′]dithiophene (DTBDT-C6) and polystyrene for the organic semiconducting layer. A high saturation region mobility of 1.0 cm2 V−1 s−1 at low operation voltage of −5 V was obtained for relatively short channel lengths of 9 μm. All fifteen of the printed pseudo-CMOS inverter circuits were formed on a common substrate and operated at low operation voltage of 2 V with the total variation in threshold voltage of 0.35 V. Consequently, the printed OTFT devices can be used in more complex integrated circuit applications requiring low manufacturing cost over large areas. PMID:27698493

Dual-Frequency Observations of 140 Compact, Flat-Spectrum Active Galactic Nuclei for Scintillation-Induced Variability

NASA Technical Reports Server (NTRS)

Koay, J. Y.; Macquart, J.- P.; Rickett, B. J.; Bignall, H. E.; Lovell, J. E. J.; Reynolds, C.; Jauncey, D. L.; Pursimo, T.; Kedziora-Chudczer, L.; Ojha, R.

2012-01-01

The 4.9 GHz Micro-Arcsecond Scintillation-Induced Variability (MASIV) Survey detected a drop in Interstellar Scintillation (ISS) for sources at red shifts z > or approx. 2, indicating an apparent increase in angular diameter or a decrease in flux density of the most compact components of these sources, relative to their extended emission. This can result from intrinsic source size effects or scatter broadening in the Intergalactic Medium (IGM) , in excess of the expected (1+z)1/2 angular diameter scaling of brightness temperature limited sources resulting from cosmological expansion. We report here 4.9 GHz and 8.4 GHz observations and data analysis for a sample of 140 compact, fiat-spectrum sources which may allow us to determine the origin of this angular diameter-redshift relation by exploiting their different wavelength dependences. In addition to using ISS as a cosmological probe, the observations provide additional insight into source morphologies and the characteristics of ISS. As in the MASIV Survey, the variability of the sources is found to be significantly correlated with line-of-sight H(alpha) intensities, confirming its link with ISS. For 25 sources, time delays of about 0.15 to 3 days are observed between the scintillation patterns at both frequencies, interpreted as being caused by a shift in core positions when probed at different optical depths. Significant correlation is found between ISS amplitudes and source spectral index; in particular, a large drop in ISS amplitudes is observed at alpha < -0.4 confirming that steep spectrum sources scintillate less. We detect a weakened redshift dependence of ISS at 8.4 GHz over that at 4.9 GHz, with the mean variance at 4-day timescales reduced by a factor of 1.8 in the z > 2 sources relative to the z < 2 sources, as opposed to the factor of 3 decrease observed at 4.9 GHz. This suggests scatter broadening in the IGM, but the interpretation is complicated by subtle selection effects that will be explored further in a follow-up paper.

Anthropometric Source Book. Volume 2: A Handbook of Anthropometric Data

DTIC Science & Technology

1978-07-01

a.mw* % A W " " -I4 0-4DB~M’a~P Z.=22014 MO ZW=O𔃾WW4L" 0 "OBCOO&WWOWWBAB z z 34 " 14 0-44 BBP o z:.~Bwz 1 Wz0 V1O󈧵 j =P.’)ON- 01-0 e e o 0 t...4 c: P) POP~f pol IV)~) ~ P)V) t) PFrW)WW))m x dCY4 0- -a I.- - 0 ~ ItTt t: 1 1 % t’Q.4 O’*t%if! N D Dc ! 4 1Dff~ ffa ul In .4 NV4 W v4 q4v4 v4 NUM

Dollar Summary of Federal Supply Classification and Service Category by Company. Part 3 (J066-S201)

DTIC Science & Technology

1990-01-01

8217 3’ O 0 Z- I-J 0 0 Q~ ,J< ,0 0 1- 1- u. cn bJb (- Q(< - f a d a U a 0 4< I- L < I 0 0 C 4 I I 0 I- 0 Z 4 0 cc I I- LA 4) w- L - 0 IU < LU 0r C) LA 2...8217 -0 00 m00 C) In0 .4 (o V~ 4t I’. V it 000 f’t m 9 4 ,. 7 𔃾 .4 Go CS 0 4 (0 Hh I .I_ . 14 _’_-_ .4 _4 -4 .4 -4. ’ 4-4 Nt r - up In 0 In o1 l0 I A u Z...m n m - Z = "r i 9. C. ¢/1 IJ Hb 0 LL r,, (a to3. Jb u- -, 0 , I -, w 0- .,1 w- 0/ x0 4) c z- =J 0 0 0 ..4 0"Z o -1 -H ... 4 go Z Z,4 € z- CA ( y 0

Processings of Conference on Dynamics of Precision Gun Weapons (1st), held at Rock Island, Illinois, on January 26-27, 1977

DTIC Science & Technology

1977-02-18

Ji+ k’ W", 0 where T DIO 0 T 1tor _2 f \\ - + _3 Pz~ -dt - t f [2\\1O m+l/ ab + b Jb d and (26) T 3 (T z) i )F k j [2 (f 0i + x ~ A 1 Jd t ,., The terms...I 6b7 + A2 (0+)6 ( bjb 3 ) ItO )T Df + x AT 6b dt The end and jump conditions for A and A are 1 2 1 - A(tl 0 -) = 0 2 [Xi(tlO-) fi(tlO-)] = 0i=l...00 0 c’) 0 C’) 00 c’) 9: IAH HI ON co 0’ c a, - H 0 0 0 0 0H C1 H 0 0 000 0 Z F4 HH o 0 U C4 0 0 ’z AH H I U) -E- z 0 H ~P4 E-4 0 H H C4 C4 14 C4 C w

Dynamics of a Z-pinch x-ray source for heating inertial-confinement-fusion relevant hohlraums to 120-160 eV

NASA Astrophysics Data System (ADS)

Sanford, T. W. L.; Olson, R. E.; Mock, R. C.; Chandler, G. A.; Leeper, R. J.; Nash, T. J.; Ruggles, L. E.; Simpson, W. W.; Struve, K. W.; Peterson, D. L.; Bowers, R. L.; Matuska, W.

2000-11-01

A Z-pinch radiation source has been developed that generates 60±20 kJ of x rays with a peak power of 13±4 TW through a 4-mm-diam axial aperture on the Z facility. The source has heated National Ignition Facility-scale (6-mm-diam by 7-mm-high) hohlraums to 122±6 eV and reduced-scale (4-mm-diam by 4-mm-high) hohlraums to 155±8 eV—providing environments suitable for indirect-drive inertial confinement fusion studies. Eulerian-RMHC (radiation-magnetohydrodynamics code) simulations that take into account the development of the Rayleigh-Taylor instability in the r-z plane provide integrated calculations of the implosion, x-ray generation, and hohlraum heating, as well as estimates of wall motion and plasma fill within the hohlraums. Lagrangian-RMHC simulations suggest that the addition of a 6 mg/cm3 CH2 fill in the reduced-scale hohlraum decreases hohlraum inner-wall velocity by ˜40% with only a 3%-5% decrease in peak temperature, in agreement with measurements.

Inverter communications using output signal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Patrick L.

Technologies for communicating information from an inverter configured for the conversion of direct current (DC) power generated from an alternative source to alternating current (AC) power are disclosed. The technologies include determining information to be transmitted from the inverter over a power line cable connected to the inverter and controlling the operation of an output converter of the inverter as a function of the information to be transmitted to cause the output converter to generate an output waveform having the information modulated thereon.

Electric machine and current source inverter drive system

DOEpatents

Hsu, John S

2014-06-24

A drive system includes an electric machine and a current source inverter (CSI). This integration of an electric machine and an inverter uses the machine's field excitation coil for not only flux generation in the machine but also for the CSI inductor. This integration of the two technologies, namely the U machine motor and the CSI, opens a new chapter for the component function integration instead of the traditional integration by simply placing separate machine and inverter components in the same housing. Elimination of the CSI inductor adds to the CSI volumetric reduction of the capacitors and the elimination of PMs for the motor further improve the drive system cost, weight, and volume.

Cold Lake Airport, Canada. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

DTIC Science & Technology

1983-03-01

b.3 b O.’ 5C.l a:.4 61.?6Z.4 62.7 63.1 63.16 3.. 63.5 * 635 . 63.5 63.5 63.5. 63.S 63.5 63.66 b.,6 65.9 67.8 68.3 68.7 69.8 6 9.8 7’).6 70.1 7".1 7 .1...o Q 99.6 98.5 92.8 1 76.1 , -1.0 86.6 ..- 11 .1 22, -1 z.L i.i i__ .L_ , . 75.3 54.9 3 1 l-J. 7,.. B .1 Z - 14 .1I- 0 - bO*5 43L.I Bi8 1’..3 6.8 5

A search for Fermi bursts associated with supernovae and their frequency of occurrence

NASA Astrophysics Data System (ADS)

Kovacevic, M.; Izzo, L.; Wang, Y.; Muccino, M.; Della Valle, M.; Amati, L.; Barbarino, C.; Enderli, M.; Pisani, G. B.; Li, L.

2014-09-01

Context. Observations suggest that most long duration gamma-ray bursts (GRBs) are connected with broad-line supernovae Ib/c, (SNe-Ibc). The presence of GRB-SNe is revealed by rebrightenings emerging from the optical GRB afterglow 10-15 days, in the rest-frame of the source, after the prompt GRB emission. Aims: Fermi/GBM has a field of view (FoV) about 6.5 times larger than the FoV of Swift, therefore we expect that a number of GRB-SN connections have been missed because of lack of optical and X-ray instruments on board of Fermi, which are essential for revealing SNe associated with GRBs. This has motivated our search in the Fermi catalog for possible GRB-SN events. Methods: The search for possible GRB-SN associations follows two requirements: (1) SNe should fall inside the Fermi/GBM error box of the considered long GRB, and (2) this GRB should occur within 20 days before the SN event. Results: We have found five cases within z< 0.2 fulfilling the above reported requirements. One of them, GRB 130702A-SN 2013dx, was already known to have a GRB-SN association. We have analyzed the remaining four cases and we have concluded that three of them are, very likely, just random coincidences due to the Fermi/GBM large error box associated with each GRB detection. We found one GRB possibly associated with a SN 1998bw-like source, GRB 120121B/SN 2012ba. Conclusions: The very low redshift of GRB 120121B/SN 2012ba (z = 0.017) implies a low isotropic energy of this burst (Eiso = 1.39 × 1048) erg. We then compute the rate of Fermi low-luminosity GRBs connected with SNe to be ρ0,b ≤ 770 Gpc-3 yr-1. We estimate that Fermi/GBM could detect 1-4 GRBs-SNe within z ≤ 0.2 in the next 4 years.

Plume Characterization of Busek 600W Hall Thruster

DTIC Science & Technology

2012-03-09

probe was used to examine the thruster plume current density while the ion species fractions were determined by the ExB probe. The inverted pendulum ...25 A. Inverted Pendulum ...Diagnostic Equipment .....................................................................................45 A. Inverted Pendulum

A New Family of Multilevel Grid Connected Inverters Based on Packed U Cell Topology.

PubMed

Pakdel, Majid; Jalilzadeh, Saeid

2017-09-29

In this paper a novel packed U cell (PUC) based multilevel grid connected inverter is proposed. Unlike the U cell arrangement which consists of two power switches and one capacitor, in the proposed converter topology a lower DC power supply from renewable energy resources such as photovoltaic arrays (PV) is used as a base power source. The proposed topology offers higher efficiency and lower cost using a small number of power switches and a lower DC power source which is supplied from renewable energy resources. Other capacitor voltages are extracted from the base lower DC power source using isolated DC-DC power converters. The operation principle of proposed transformerless multilevel grid connected inverter is analyzed theoretically. Operation of the proposed multilevel grid connected inverter is verified through simulation studies. An experimental prototype using STM32F407 discovery controller board is performed to verify the simulation results.

Signal Processing with Degenerate Four-Wave Mixing.

DTIC Science & Technology

1987-12-07

MONITORING ORGANIZATION Optical Sciences Center j (i applicable) 6c. ADDRESS (City, State, and ZIPCode) 7b. ADDRESS (City, State, and ZIP Cod...apOliable) AFOSR I j AFOSR-84-0277 I, ADDRESS (City, State and ZIP Code) 10. SOURCE OF FUNDING NUMBERS Bulig40PROGRAM IPROJECT TASK I WORK UNIT Buling...5 Accesson Fo I - __ 0 4.Z- NTIS GRA. D__t _______r_!_ ________I,,* k AccessiondFor Dist.~~ .ipe i 45 rix’ _ _____ _____ __ j

Development of Three-Phase Source Inverter for Research and Laboratories

DTIC Science & Technology

2011-03-01

Budget, Paperwork Reduction Project (0704-0188) Washington DC 20503. 1 . AGENCY USE ONLY (Leave blank) 2 . REPORT DATE March 2011 3. REPORT TYPE AND...THEORY OF OPERATION ................................5 1 . Overview ......................................5 2 . Voltage Source Inverter...29 1 . Low Pass Filter MATLAB Code ..................31 2 . Current Sensor ...............................33 3. Optocouplers

Characteristics of extreme ultraviolet emission from high-Z plasmas

NASA Astrophysics Data System (ADS)

Ohashi, H.; Higashiguchi, T.; Suzuki, Y.; Kawasaki, M.; Suzuki, C.; Tomita, K.; Nishikino, M.; Fujioka, S.; Endo, A.; Li, B.; Otsuka, T.; Dunne, P.; O'Sullivan, G.

2016-03-01

We demonstrate the extreme ultraviolet (EUV) and soft x-ray sources in the 2 to 7 nm spectral region related to the beyond EUV (BEUV) question at 6.x nm and the water window source based on laser-produced high-Z plasmas. Resonance emission from multiply charged ions merges to produce intense unresolved transition arrays (UTAs), extending below the carbon K edge (4.37 nm). An outline of a microscope design for single-shot live cell imaging is proposed based on high-Z plasma UTA source, coupled to multilayer mirror optics.

Experimental Testing of Flying Qualities Theories.

DTIC Science & Technology

1982-12-01

z -,.5 Z,2 - * .5 3 : 5. 8 56, akl 57.-o -7) g j * -,j " bl6 1 1D2o.UD :)3o J5 , .. 65.. 23°Z u 7.2,, b ob . Z. : 6 7 J.e2 2 7 1,*23 7. .e23 73. -3...l b5 1 .. ) 1 . 1. ’, 1.60 1.u0 1.c61 1.,62 1.o :).1) 1 .5q 1.59 1 Ib" 1. 1 1.t) 4 ! 1 IC? 1.59 1.62 1 1 6. . b16 l.L6 1.b, l.h- . 1.(02 o~2J o . ] t

Direct Lyman continuum and Ly α escape observed at redshift 4

NASA Astrophysics Data System (ADS)

Vanzella, E.; Nonino, M.; Cupani, G.; Castellano, M.; Sani, E.; Mignoli, M.; Calura, F.; Meneghetti, M.; Gilli, R.; Comastri, A.; Mercurio, A.; Caminha, G. B.; Caputi, K.; Rosati, P.; Grillo, C.; Cristiani, S.; Balestra, I.; Fontana, A.; Giavalisco, M.

2018-05-01

We report on the serendipitous discovery of a z = 4.0, M1500 = -22.20 star-forming galaxy (Ion3) showing copious Lyman continuum (LyC) leakage (˜60 per cent escaping), a remarkable multiple peaked Ly α emission, and significant Ly α radiation directly emerging at the resonance frequency. This is the highest redshift confirmed LyC emitter in which the ionizing and Ly α radiation possibly share a common ionized channel (with NH I < 1017.2 cm-2). Ion3 is spatially resolved, it shows clear stellar winds signatures like the P-Cygni N Vλ1240 profile, and has blue ultraviolet continuum (β = -2.5 ± 0.25, Fλ ˜ λβ) with weak low-ionization interstellar metal lines. Deep VLT/HAWKI Ks and Spitzer/IRAC 3.6 and 4.5μm imaging show a clear photometric signature of the H α line with equivalent width of 1000 Å rest-frame emerging over a flat continuum (Ks - 4.5μm ≃ 0). From the SED fitting, we derive a stellar mass of 1.5 × 109 M⊙, SFR of 140 M⊙ yr-1 and age of ˜10 Myr, with a low dust extinction, E(B - V) ≲ 0.1, placing the source in the starburst region of the SFR-M* plane. Ion3 shows similar properties of another LyC emitter previously discovered (z = 3.21, Ion2, Vanzella et al. 2016). Ion3 (and Ion2) represents ideal high-redshift reference cases to guide the search for reionizing sources at z > 6.5 with JWST.

DUAL-FREQUENCY OBSERVATIONS OF 140 COMPACT, FLAT-SPECTRUM ACTIVE GALACTIC NUCLEI FOR SCINTILLATION-INDUCED VARIABILITY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koay, J. Y.; Macquart, J.-P.; Bignall, H. E.

2011-10-15

The 4.9 GHz Micro-Arcsecond Scintillation-Induced Variability (MASIV) Survey detected a drop in interstellar scintillation (ISS) for sources at redshifts z {approx}> 2, indicating an apparent increase in angular diameter or a decrease in flux density of the most compact components of these sources relative to their extended emission. This can result from intrinsic source size effects or scatter broadening in the intergalactic medium (IGM) in excess of the expected (1 + z){sup 1/2} angular diameter scaling of brightness temperature limited sources resulting from cosmological expansion. We report here 4.9 GHz and 8.4 GHz observations and data analysis for a samplemore » of 140 compact, flat-spectrum sources which may allow us to determine the origin of this angular diameter-redshift relation by exploiting their different wavelength dependences. In addition to using ISS as a cosmological probe, the observations provide additional insight into source morphologies and the characteristics of ISS. As in the MASIV Survey, the variability of the sources is found to be significantly correlated with line-of-sight H{alpha} intensities, confirming its link with ISS. For 25 sources, time delays of about 0.15-3 days are observed between the scintillation patterns at both frequencies, interpreted as being caused by a shift in core positions when probed at different optical depths. Significant correlation is found between ISS amplitudes and source spectral index; in particular, a large drop in ISS amplitudes is observed at {alpha} < -0.4 confirming that steep spectrum sources scintillate less. We detect a weakened redshift dependence of ISS at 8.4 GHz over that at 4.9 GHz, with the mean variance at four-day timescales reduced by a factor of 1.8 in the z > 2 sources relative to the z < 2 sources, as opposed to the factor of three decrease observed at 4.9 GHz. This suggests scatter broadening in the IGM, but the interpretation is complicated by subtle selection effects that will be explored further in a follow-up paper.« less

Emergence of a new human adenovirus type 4 (Ad4) genotype: identification of a novel inverted terminal repeated (ITR) sequence from majority of Ad4 isolates from US military recruits.

PubMed

Houng, Huo-Shu H; Clavio, Sarah; Graham, Katherine; Kuschner, Robert; Sun, Wellington; Russell, Kevin L; Binn, Leonard N

2006-04-01

Ad4 is the principal etiological agent of acute respiratory disease (ARD) in the US military. Discovery of the novel 208bp inverted terminal repeated (ITR) sequence from a recent Ad4 Jax78 field isolate was totally distinct from the analogous 116bp ITR of Ad4 prototype. To investigate the origin and distribution of the novel Ad4 ITR sequence from ARD infections. Direct sequencing of ligated Ad ITR termini. The new Ad4 ITR was highly homologous with the ITRs of human Ad subgroup B. The left post-ITR region of Ad4 Jax78 was found to be highly homologous to the corresponding region of subgroup B Ads: 81% for Ad11 and 98% for Ad3 and Ad7. The right post-ITR region of Ad4 Jax78 contained a truncated classic ITR of the Ad4 prototype. The Ad4 Jax78 ITR most likely evolved from Ad4 prototype by substituting the Ad4 prototype ITR with the subgroup B Ads ITR. The ITR-based PCR assays developed from this study can be used to distinguish the new Ad4 genotype from the classical Ad4 prototype. The new Ad4 genotype was first detected in 1976 from Georgia, USA, and is the main causative agent of ARD infections in US military population.

Fusion barrier characteristics of actinides

NASA Astrophysics Data System (ADS)

Manjunatha, H. C.; Sridhar, K. N.

2018-03-01

We have studied fusion barrier characteristics of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations. After the calculation of fusion barrier heights and positions, we have searched for their parameterization. We have achieved the empirical formula for fusion barrier heights (VB), positions (RB), curvature of the inverted parabola (ħω) of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations (6

Observation of Z_{b}(10610) and Z_{b}(10650) Decaying to B Mesons.

PubMed

Garmash, A; Abdesselam, A; Adachi, I; Aihara, H; Asner, D M; Aushev, T; Ayad, R; Aziz, T; Babu, V; Badhrees, I; Bakich, A M; Behera, P; Bhardwaj, V; Bhuyan, B; Bobrov, A; Bondar, A; Bonvicini, G; Bozek, A; Bračko, M; Browder, T E; Červenkov, D; Chekelian, V; Chen, A; Cheon, B G; Chilikin, K; Cho, K; Chobanova, V; Choi, Y; Cinabro, D; Dalseno, J; Danilov, M; Dash, N; Doležal, Z; Drutskoy, A; Dutta, D; Eidelman, S; Epifanov, D; Farhat, H; Fast, J E; Ferber, T; Fulsom, B G; Gaur, V; Gabyshev, N; Gillard, R; Goh, Y M; Goldenzweig, P; Golob, B; Hara, T; Hayasaka, K; Hayashii, H; Iijima, T; Ishikawa, A; Itoh, R; Iwasaki, Y; Jaegle, I; Joffe, D; Joo, K K; Julius, T; Kang, K H; Kato, E; Kawasaki, T; Kim, D Y; Kim, J B; Kim, K T; Kim, M J; Kim, S H; Kim, Y J; Kinoshita, K; Korpar, S; Križan, P; Krokovny, P; Kuhr, T; Kuzmin, A; Kwon, Y-J; Lange, J S; Lee, I S; Li, C; Li, H; Li, L; Li Gioi, L; Libby, J; Liventsev, D; Lukin, P; Masuda, M; Matvienko, D; Miyabayashi, K; Miyata, H; Mizuk, R; Mohanty, G B; Moll, A; Mori, T; Mussa, R; Nakano, E; Nakao, M; Nanut, T; Natkaniec, Z; Nishida, S; Olsen, S L; Pakhlov, P; Pakhlova, G; Pal, B; Park, H; Pedlar, T K; Pestotnik, R; Petrič, M; Piilonen, L E; Pulvermacher, C; Ribežl, E; Ritter, M; Rostomyan, A; Sahoo, H; Sakai, Y; Sandilya, S; Sanuki, T; Savinov, V; Schneider, O; Schnell, G; Schwanda, C; Seino, Y; Semmler, D; Senyo, K; Seong, I S; Sevior, M E; Shebalin, V; Shen, C P; Shibata, T-A; Shiu, J-G; Shwartz, B; Simon, F; Sohn, Y-S; Solovieva, E; Starič, M; Sumiyoshi, T; Tamponi, U; Tanida, K; Teramoto, Y; Trabelsi, K; Uchida, M; Uehara, S; Uglov, T; Uno, S; Van Hulse, C; Vanhoefer, P; Varner, G; Vorobyev, V; Wagner, M N; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; Williams, K M; Won, E; Yamamoto, H; Yamaoka, J; Yashchenko, S; Yelton, J; Yook, Y; Yuan, C Z; Zhang, Z P; Zhilich, V; Zhulanov, V; Zupanc, A

2016-05-27

We report the analysis of the three-body e^{+}e^{-}→BB[over ¯]π^{±}, BB[over ¯]^{*}π^{±}, and B^{*}B[over ¯]^{*}π^{±} processes, including the first observations of the Z_{b}^{±}(10610)→[BB[over ¯]^{*}+c.c.]^{±} and Z_{b}^{±}(10650)→[B^{*}B[over ¯]^{*}]^{±} transitions that are found to dominate the corresponding final states. We measure Born cross sections for the three-body production of σ(e^{+}e^{-}→[BB[over ¯]^{*}+c.c.]^{±}π^{∓})=[17.4±1.6(stat)±1.9(syst)]  pb and σ(e^{+}e^{-}→[B^{*}B[over ¯]^{*}]^{±}π^{∓})=[8.75±1.15(stat)±1.04(syst)]  pb and set a 90% C.L. upper limit of σ(e^{+}e^{-}→[BB[over ¯

Assumption or Fact? Line-to-Neutral Voltage Expression in an Unbalanced 3-Phase Circuit during Inverter Switching

ERIC Educational Resources Information Center

Masrur, M. A.

2009-01-01

This paper discusses the situation in a 3-phase motor or any other 3-phase system operating under unbalanced operating conditions caused by an open fault in an inverter switch. A dc voltage source is assumed as the input to the inverter, and under faulty conditions of the inverter switch, the actual voltage applied between the line to neutral…

Crystal structures of (Z)-5-[2-(benzo[b]thio-phen-2-yl)-1-(3,5-di-meth-oxy-phen-yl)ethen-yl]-1H-tetra-zole and (Z)-5-[2-(benzo[b]thio-phen-3-yl)-1-(3,4,5-tri-meth-oxy-phen-yl)ethen-yl]-1H-tetra-zole.

PubMed

Penthala, Narsimha Reddy; Yadlapalli, Jaishankar K B; Parkin, Sean; Crooks, Peter A

2016-05-01

(Z)-5-[2-(Benzo[b]thio-phen-2-yl)-1-(3,5-di-meth-oxy-phen-yl)ethen-yl]-1H-tetrazole methanol monosolvate, C19H16N4O2S·CH3OH, (I), was prepared by the reaction of (Z)-3-(benzo[b]thio-phen-2-yl)-2-(3,5-di-meth-oxy-phen-yl)acrylo-nitrile with tri-butyl-tin azide via a [3 + 2]cyclo-addition azide condensation reaction. The structurally related compound (Z)-5-[2-(benzo[b]thio-phen-3-yl)-1-(3,4,5-tri-meth-oxy-phen-yl)ethen-yl]-1H-tetra-zole, C20H18N4O3S, (II), was prepared by the reaction of (Z)-3-(benzo[b]thio-phen-3-yl)-2-(3,4,5-tri-meth-oxy-phen-yl)acrylo-nitrile with tri-butyl-tin azide. Crystals of (I) have two mol-ecules in the asymmetric unit (Z' = 2), whereas crystals of (II) have Z' = 1. The benzo-thio-phene rings in (I) and (II) are almost planar, with r.m.s deviations from the mean plane of 0.0084 and 0.0037 Å in (I) and 0.0084 Å in (II). The tetra-zole rings of (I) and (II) make dihedral angles with the mean planes of the benzo-thio-phene rings of 88.81 (13) and 88.92 (13)° in (I), and 60.94 (6)° in (II). The di-meth-oxy-phenyl and tri-meth-oxy-phenyl rings make dihedral angles with the benzo-thio-phene rings of 23.91 (8) and 24.99 (8)° in (I) and 84.47 (3)° in (II). In both structures, mol-ecules are linked into hydrogen-bonded chains. In (I), these chains involve both tetra-zole and methanol, and are parallel to the b axis. In (II), mol-ecules are linked into chains parallel to the a axis by N-H⋯N hydrogen bonds between adjacent tetra-zole rings.

Selective harmonic elimination strategy in eleven level inverter for PV system with unbalanced DC sources

NASA Astrophysics Data System (ADS)

Ghoudelbourk, Sihem.; Dib, D.; Meghni, B.; Zouli, M.

2017-02-01

The paper deals with the multilevel converters control strategy for photovoltaic system integrated in distribution grids. The objective of the proposed work is to design multilevel inverters for solar energy applications so as to reduce the Total Harmonic Distortion (THD) and to improve the power quality. The multilevel inverter power structure plays a vital role in every aspect of the power system. It is easier to produce a high-power, high-voltage inverter with the multilevel structure. The topologies of multilevel inverter have several advantages such as high output voltage, lower total harmonic distortion (THD) and reduction of voltage ratings of the power semiconductor switching devices. The proposed control strategy ensures an implementation of selective harmonic elimination (SHE) modulation for eleven levels. SHE is a very important and efficient strategy of eliminating selected harmonics by judicious selection of the firing angles of the inverter. Harmonics elimination technique eliminates the need of the expensive low pass filters in the system. Previous research considered that constant and equal DC sources with invariant behavior; however, this research extends earlier work to include variant DC sources, which are typical of lead-acid batteries when used in system PV. This Study also investigates methods to minimize the total harmonic distortion of the synthesized multilevel waveform and to help balance the battery voltage. The harmonic elimination method was used to eliminate selected lower dominant harmonics resulting from the inverter switching action.

Electrical conductivity imaging using gradient B, decomposition algorithm in magnetic resonance electrical impedance tomography (MREIT).

PubMed

Park, Chunjae; Kwon, Ohin; Woo, Eung Je; Seo, Jin Keun

2004-03-01

In magnetic resonance electrical impedance tomography (MREIT), we try to visualize cross-sectional conductivity (or resistivity) images of a subject. We inject electrical currents into the subject through surface electrodes and measure the z component Bz of the induced internal magnetic flux density using an MRI scanner. Here, z is the direction of the main magnetic field of the MRI scanner. We formulate the conductivity image reconstruction problem in MREIT from a careful analysis of the relationship between the injection current and the induced magnetic flux density Bz. Based on the novel mathematical formulation, we propose the gradient Bz decomposition algorithm to reconstruct conductivity images. This new algorithm needs to differentiate Bz only once in contrast to the previously developed harmonic Bz algorithm where the numerical computation of (inverted delta)2Bz is required. The new algorithm, therefore, has the important advantage of much improved noise tolerance. Numerical simulations with added random noise of realistic amounts show the feasibility of the algorithm in practical applications and also its robustness against measurement noise.

Thermal stability, structural features, and B-to-Z transition in DNA tetraloop hairpins as determined by optical spectroscopy in d(CG)(3)T(4)(CG)(3) and d(CG)(3)A(4)(CG)(3) oligodeoxynucleotides.

PubMed

Hernández, Belén; Baumruk, Vladimir; Gouyette, Catherine; Ghomi, Mahmoud

2005-05-01

NMR and CD data have previously shown the formation of the T(4) tetraloop hairpin in aqueous solutions, as well as the possibility of the B-to-Z transition in its stem in high salt concentration conditions. It has been shown that the stem B-to-Z transition in T(4) hairpins leads to S (south)- to N (north)-type conformational changes in the loop sugars, as well as anti to syn orientations in the loop bases. In this article, we have compared by means of UV absorption, CD, Raman, and Fourier transform infrared (FTIR), the thermodynamic and structural properties of the T(4) and A(4) tetraloop hairpins formed in 5'-d(CGCGCG-TTTT-CGCGCG)-3' and 5'-d(CGCGCG-AAAA-CGCGCG)-3', respectively. In presence of 5M NaClO(4), a complete B-to-Z transition of the stems is first proved by CD spectra. UV melting profiles are consistent with a higher thermal stability of the T(4) hairpin compared to the A(4) hairpin. Order-to-disorder transition of both hairpins has also been analyzed by means of Raman spectra recorded as a function of temperature. A clear Z-to-B transition of the stem has been confirmed in the T(4) hairpin, and not in the A(4) hairpin. With a right-handed stem, Raman and FTIR spectra have confirmed the C2'-endo/anti conformation for all the T(4) loop nucleosides. With a left-handed stem, a part of the T(4) loop sugars adopt a N-type (C3'-endo) conformation, and the C3'-endo/syn conformation seems to be the preferred one for the dA residues involved in the A(4) tetraloop.

All Prime Contract Awards by State or Country, Place, and Contractor, FY83, Part 8 (Oologah, Oklahoma-Lone Star, Texas).

DTIC Science & Technology

1983-01-01

AUTO BODY WORKS BOYERTOWN PA 130740 0485 39 1 I OADOS 0745 DAAD05-S3-n4413 E C A 5 2 2 23Z0 000 CGE TRUCKS AND TRUCK TRACTORS WH 8 A 3 5 J 0? 1 B J 1...BOYERTOWN AUTO BODY WORKS BOYERTOWN PA 130740 0485 39 1 I OAEO7 6518 DAAE07-62-C5592 D C A 5 2 2 2330 000 A48 TRAILERS 5 A 6 4 J...AND FISH 6 2 4 5 J 09 1 B 3 1 0 27 -DM066 B 0 Z 1 22 8905 000 B2 MEAT POULTRY AND FISH 6 2 4 5 J 09 1 a J D 35 GENERAL ELECTRICO -D05 C Z 1 2 2 6905

Repetitively Pulsed Electric Laser Acoustic Studies. Volume 1.

DTIC Science & Technology

1983-09-01

V a=[I (i/x)CS’]=I+HS’ b=CS1’ C:(z-iHwM)/(z- iwM )=H(x/i) S’=(1-S)/S. S=(D-d)/D=fraction open area of the attenuator. 67 ’-. -, .,"..-/ We note, that...the structure becomes • .’ ~u’:uz/(z- iwm ) (4.2)" where, as before, z=r-iwgHp and u is the average velocity ampli- tude of the gas in the porous...Again, making use of Eq. 4.2, these relations can be summarized as U. :C’u (4.4) pp-iwm1 C’u C’=z/(z- iwm ), z=r-iwgHp 5. Equations of motion. In terms of

Department of Defense Contractor Establishment Code (CEC). Alphabet Listing. Volume 1

DTIC Science & Technology

1992-11-01

Z1. A >W Z O -z OC U Uex0 -M: 8-..0 -a .w3L.PZU IL K4z0. ~ - ~ t IN -a 0U ZUý.U A ýM . 0UW p0.0pc~-~U am1010 Pco 0.~CI2201.4 1 -4 UZ0. w4 l4 1 P o... ERS1 0U 00 O . 0 N C.00 CI0 1O ClC , C 0t5~b. 0~ 0 L" F5 ~-C~1 0 t- ~ 0 ?o: wOO C O 0 O 0 O C~ C8Nt- j- ccC0 10 * CO00 W 0g- ONO inooWON2m r- -- 0 0 N ý...z .~ j~..Z ~ C~.kJ 091.09 5 0 ao~ o W-Z 1 . PCO 0 3J 2 Z .W C" -4 -u 9z z z m -o0 rQ E ~ ~ ~ i iz QzH .9 HUO0 ~ >0 Q 3 02 4 * mQ0 00 M0 rn0 0U

CHARACTERIZING FAINT GALAXIES IN THE REIONIZATION EPOCH: LBT CONFIRMS TWO L < 0.2 L* SOURCES AT z = 6.4 BEHIND THE CLASH/FRONTIER FIELDS CLUSTER MACS0717.5+3745

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanzella, E.; Cusano, F.; Fontana, A.

2014-03-01

We report the LBT/MODS1 spectroscopic confirmation of two images of faint Lyα emitters at z = 6.4 behind the Frontier Fields galaxy cluster MACSJ0717.5+3745. A wide range of lens models suggests that the two images are highly magnified, with a strong lower limit of μ > 5. These are the faintest z > 6 candidates spectroscopically confirmed to date. These may also be multiple images of the same z = 6.4 source as supported by their similar intrinsic properties, but the lens models are inconclusive regarding this interpretation. To be cautious, we derive the physical properties of each image individually.more » Thanks to the high magnification, the observed near-infrared (restframe ultraviolet) part of the spectral energy distributions and Lyα lines are well detected with S/N(m {sub 1500}) ≳ 10 and S/N(Lyα) ≅ 10-15. Adopting μ > 5, the absolute magnitudes, M {sub 1500}, and Lyα fluxes are fainter than –18.7 and 2.8 × 10{sup –18} erg s{sup –1} cm{sup –2}, respectively. We find a very steep ultraviolet spectral slope β = –3.0 ± 0.5 (F {sub λ} = λ{sup β}), implying that these are very young, dust-free, and low metallicity objects, made of standard stellar populations or even extremely metal poor stars (age ≲ 30 Myr, E(B – V) = 0 and metallicity 0.0-0.2 Z/Z {sub ☉}). The objects are compact (<1 kpc{sup 2}) and with a stellar mass M {sub *} < 10{sup 8} M {sub ☉}. The very steep β, the presence of the Lyα line, and the intrinsic FWHM (<300 km s{sup –1}) of these newborn objects do not exclude a possible leakage of ionizing radiation. We discuss the possibility that such faint galaxies may resemble those responsible for cosmic reionization.« less

A new type of single-phase five-level inverter

NASA Astrophysics Data System (ADS)

Xu, Zhi; Li, Shengnan; Qin, Risheng; Zhao, Yanhang

2017-11-01

At present, Neutral Point Clamped (NPC) multilevel inverter is widely applied in new energy field. However, it has some disadvantages including low utilization rate of direct current (DC) voltage source and the unbalance of neutral potential. Therefore, a new single-phase five level inverter is proposed in this paper. It has two stage structure, the former stage is equivalent to three level DC/DC converter, and the back stage uses H bridge to realize inverter. Compared with the original central clamp type inverter, the new five level inverter can improve the utilization of DC voltage, and realize the neutral point potential balance with hysteresis comparator.

DoD Manual for Standard Data Elements

DTIC Science & Technology

1989-07-01

U4W333Iininin0.0. -)-6-6)---6- Z.............Law0C 44-Lawu Inn44....Jým --- ...- ..... -LaWzaýa ZaW aW>u 0 wwJ 22-. - Lawammi nmm4mm m mm awmwwww w2Z...a a 0 ON wzwzn i 0... ta L--za tun w awawww 4 0 UL OOOOO&WO ~ a. 0- C9 w~a 44U - . = X Z~(n~nZZ4 4 0 44 uJ0 - 0.4- 4-4 &. L 0 Z0000U W b, ta atS w xu...Z -a CW 1 04 Il-w lWa-I- - * U.zU 4 000 2 4N00 ZaW --0-aU.Ji.0 4c 0 W W M- o-t M ma- 0a-s--~0U- ZIW 2 j P- 0W I-a >1(AO i 4 U00.4K 11a-I--I-- j~ at

Crystal structure of (E)-13-{4-[(Z)-2-cyano-2-(3,4,5-tri-meth-oxy-phen-yl)ethen-yl]phen-yl}parthenolide methanol hemisolvate.

PubMed

Penthala, Narsimha Reddy; Bommagani, Shobanbabu; Janganati, Venumadhav; Parkin, Sean; Crooks, Peter A

2014-10-01

The title compound, C33H35NO6 [systematic name: (Z)-3-(4-{(E)-[(E)-1a,5-dimethyl-9-oxo-2,3,7,7a-tetra-hydro-oxireno[2',3':9,10]cyclo-deca-[1,2-b]furan-8(1aH,6H,9H,10aH,10bH)-yl-idene]meth-yl}phen-yl)-2-(3,4,5-tri-meth-oxy-phen-yl)acrylo-ni-trile methanol hemisolvate], C33H35NO6·0.5CH3OH, was prepared by the reaction of (Z)-3-(4-iodo-phen-yl)-2-(3,4,5-tri-meth-oxy-phen-yl)acrylo-nitrile with parthenolide [systematic name: (E)-1a,5-dimethyl-8-methyl-ene-2,3,6,7,7a,8,10a,10b-octa-hy-dro-oxireno[2',3':9,10]cyclo-deca-[1,2-b]furan-9(1aH)-one] under Heck reaction conditions. The mol-ecule is built up from fused ten-, five- (lactone) and three-membered (epoxide) rings with a {4-[(Z)-2-cyano-2-(3,4,5-tri-meth-oxy-phen-yl)ethen-yl]phen-yl}methyl-idene group as a substituent. The 4-[(Z)-2-cyano-2-(3,4,5-tri-meth-oxy-phen-yl)ethen-yl]phenyl group on the parthenolide exocyclic double bond is oriented in a trans position to the lactone ring to form the E isomer. The dihedral angle between the benzene ring of the phenyl moiety and the lactone ring mean plane is 21.93 (4)°.

Motorized manipulator for positioning a TEM specimen

DOEpatents

Schmid, Andreas Karl; Andresen, Nord

2010-12-14

The invention relates to a motorized manipulator for positioning a TEM specimen holder with sub-micron resolution parallel to a y-z plane and rotating the specimen holder in the y-z plane, the manipulator comprising a base (2), and attachment means (30) for attaching the specimen holder to the manipulator, characterized in that the manipulator further comprises at least three nano-actuators (3.sup.a, 3.sup.b, 3.sup.c) mounted on the base, each nano-actuator showing a tip (4.sup.a, 4.sup.b, 4.sup.c), the at least three tips defining the y-z plane, each tip capable of moving with respect to the base in the y-z plane; a platform (5) in contact with the tips of the nano-actuators; and clamping means (6) for pressing the platform against the tips of the nano-actuators; as a result of which the nano-actuators can rotate the platform with respect to the base in the y-z plane and translate the platform parallel to the y-z plane.

Use of D(acid)-, D(bile)-, z(acid)-, and z(bile)-values in evaluating Bifidobacteria with regard to stomach pH and bile salt sensitivity.

PubMed

Jia, Li; Shigwedha, Nditange; Mwandemele, Osmund D

2010-01-01

The survival of bifidobacteria in simulated conditions of the gastrointestinal (GI) tract was studied based on the D- and z-value concept. Some Bifidobacterium spp. are probiotics that improve microbial balance in the human GI tract. Because they are sensitive to low pH and bile salt concentrations, their viability in the GI tract is limited. The D- and z-value approach was therefore adopted as a result of observing constant log-cell reduction (90%) when Bifidobacterium spp. were exposed to these 2 different stressing factors. Survivals of one strain each or 4 species of Bifidobacterium was studied at pH between 3.0 and 4.5 and in ox-bile between 0.15% and 0.60% for times up to 41 h. From the D(acid)- and D(bile)-values, the order of resistance to acid and bile was B. bifidum > B. infantis > B. longum > B. adolescentis. While the former 3 strains retained high cell viability at pH 3.5 (>5.5 log CFU/mL after 5 h) and at elevated bile salt concentration of 0.6% (>4.5 log CFU/mL after 3 h), B. adolescentis was less resistant (<3.4 log CFU/mL). The z(acid)- and z(bile)-values calculated from the D(acid)- and D(bile)-values ranged from 1.11 to 1.55 pH units and 0.40% to 0.49%, respectively. The results suggest that the D(acid)-, D(bile)-, z(acid)-, and z(bile)-value approach could be more appropriate than the screening and selection method in evaluating survival of probiotic bacteria, and in measuring their tolerance or resistance to gastric acidity and the associated bile salt concentration in the small intestine. The evaluation of the tolerance of bifidobacteria to bile salts and low pH has been made possible by use of D- and z-value concept. The calculated z(acid)- and z(bile)-values were all fairly similar for the strains used and suggest the effect of increasing the bile salt concentration or decreasing the pH on the D(acid)- and D(bile)-values. This approach would be useful for predicting the suitability of bifidobacteria and other lactic acid bacteria (LAB) as probiotics for use in real-life situations.

Theoretical Investigation of the High-Altitude Cusp Region using Observations from Interball and ISTP Spacecraft

NASA Technical Reports Server (NTRS)

Ashour-Abdalla, Maha

1998-01-01

A fundamental goal of magnetospheric physics is to understand the transport of plasma through the solar wind-magnetosphere-ionosphere system. To attain such an understanding, we must determine the sources of the plasma, the trajectories of the particles through the magnetospheric electric and magnetic fields to the point of observation, and the acceleration processes they undergo enroute. This study employed plasma distributions observed in the near-Earth plasma sheet by Interball and Geotail spacecraft together with theoretical techniques to investigate the ion sources and the transport of plasma. We used ion trajectory calculations in magnetic and electric fields from a global Magnetohydrodynamics (MHD) simulation to investigate the transport and to identify common ion sources for ions observed in the near-Earth magnetotail by the Interball and Geotail spacecraft. Our first step was to examine a number of distribution functions and identify distinct boundaries in both configuration and phase space that are indicative of different plasma sources and transport mechanisms. We examined events from October 26, 1995, November 29-30, 1996, and December 22, 1996. During the first event Interball and Geotail were separated by approximately 10 R(sub E) in z, and during the second event the spacecraft were separated by approximately 4(sub RE). Both of these events had a strong IMF By component pointing toward the dawnside. On October 26, 1995, the IMF B(sub Z) component was northward, and on November 1-9-30, 1996, the IMF B sub Z) component was near 0. During the first event, Geotail was located near the equator on the dawn flank, while Interball was for the most part in the lobe region. The distribution function from the Coral instrument on Interball showed less structure and resembled a drifting Maxwellian. The observed distribution on Geotail, on the other hand, included a great number of structures at both low and high energies. During the third event (December 22, 1996) both spacecraft were in the plasma sheet and were separated bY approximately 20 R(sub E) in the y direction. During this event the IMF was southward.

Measurement of differential production cross-sections for a Z boson in association with b-jets in 7 TeV proton-proton collisions with the ATLAS detector

DOE PAGES

Aad, G.; Abbott, B.; Abdallah, J.; ...

2014-10-24

We report measurements of differential production cross-sections of a Z boson in association with b-jets in pp collisions at √ s = 7 TeV. The data analysed correspond to an integrated luminosity of 4.6 fb -1 recorded with the ATLAS detector at the Large Hadron Collider. Particle-level cross-sections are determined for events with a Z boson decaying into an electron or muon pair, and containing b-jets. For events with at least one b-jet, the cross-section is presented as a function of the Z boson transverse momentum and rapidity, together with the inclusive b-jet cross-section as a function of b-jet transversemore » momentum, rapidity and angular separations between the b-jet and the Z boson. For events with at least two b-jets, the cross-section is determined as a function of the invariant mass and angular separation of the two highest transverse momentum b-jets, and as a function of the Z boson transverse momentum and rapidity. Lastly, results are compared to leading-order and next-to-leading-order perturbative QCD calculations.« less

Camp Casey, Tongduchon, Korea. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

DTIC Science & Technology

1981-02-10

76.,a41 7S.4 ?R.4’ 7B.q. .4 . I 78.uf 7-.t- . .I 2 V_𔃻 77.71 77.71 72.2 f6 . I 7 -.. 4 78. . ,= , 9Ss 7. 7. ’ 7 .Z 7 7 79.Z 79.2 79.1-3; 77. 7 79.a: 75...cof-. .4r E0C >j a- -- =* C.j C . = ± (i3e!’ afl o oc- g Nta.. a .o.r3azdflloD2Coa.aoc a- f~ie~~z. n.!. G a 4 . ACca . . rx Co.--&Z3Er,0C i1DaI Da...6-=.1 66.4 ;-’ -0 o-b 915 c.01 is 99.2i 90.7 99.7 9 9. 1 99.7s. JO 200 1 5 01 6 ,. 1 66.4! .69 F6 . 1 ? 1 .61 976.1if 97.r1 99. 1 9gs 999 .39 a c .3 c

Type A-B carbonate chlorapatite synthesized at high pressure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fleet, Michael E.; Liu, Xi

2008-09-15

Sodium-bearing type A-B carbonate chlorapatites {l_brace}CCLAP; Ca{sub 10-(y+z)}Na{sub y}{open_square}{sub z}[(PO{sub 4}){sub 6-(y+2z)}(CO{sub 3}){sub y+2z}][Cl{sub 2-=} 2{sub x}(CO{sub 3}){sub x}], with x{approx}y{approx}4z{approx}0.4{r_brace} have been synthesized from carbonate-rich melts at 1350-1000 deg. C and 1.0 GPa, and investigated by single-crystal X-ray structure and FTIR spectroscopy. Typical crystal and compositional data are: a=9.5321(4) A, c=6.8448(3) A, space group P6{sub 3}/m, R=0.027, R{sub w}=0.025, x=0.37(3), y=0.57(2). Crystal-chemical features and FTIR spectra are similar to Na-bearing type A-B carbonate hydroxyapatites (CHAP) and fluorapatites (CFAP) reported recently. The molar amounts of Na and channel (type A) carbonate maintain a near 1:1 ratio in all three compositionmore » series, confirming that the Na cation and A and B carbonate ion substituents exist as a defect cluster within the apatite matrix, to facilitate charge compensation and spatial accommodation. Uptake of carbonate is significantly lower in CCLAP than in CHAP for similar conditions of crystal synthesis. - Graphical abstract: Defect cluster (blue) of A carbonate ion in apatite channel, Na{sup +} cation, and B carbonate ion replacing phosphate group, in carbonate chlorapatite synthesized at high pressure.« less

Molecular Level Understanding of Electrocatalysis in High pH Environment

DTIC Science & Technology

2015-07-08

consisting of alkali metal hydroxide doped PBI membrane with 2.0 mgPtRu cm-2 anode and 1.0 mgPt cm-2 loadings at the anode and cathode, respectively...Direct!ethanol!fuel!cells!using!an!anion! exchange!membrane.!J!Power!Sources.!2008;185:621*6.! [4]!Hou!H,!Sun!G,!He!R,!Wu!Z,!Sun!B.!Alkali! doped ...electrocatalysts! for!oxygen!reduction! derived!from!polyaniline,!iron,!and! cobalt .!Science!(Washington,!DC,!U!S).!2011;332:443*7.! [17]! Zagal! JH

A HIGHLY ELONGATED PROMINENT LENS AT z = 0.87: FIRST STRONG-LENSING ANALYSIS OF EL GORDO

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zitrin, Adi; Menanteau, Felipe; Hughes, John P.

We present the first strong-lensing (SL) analysis of the galaxy cluster ACT-CL J0102-4915 (El Gordo), in recent HST/ACS images, revealing a prominent strong lens at a redshift of z = 0.87. This finding adds to the already-established unique properties of El Gordo: it is the most massive, hot, X-ray luminous, and bright Sunyaev-Zeldovich effect cluster at z {approx}> 0.6, and the only {sup b}ullet{sup -}like merging cluster known at these redshifts. The lens consists of two merging massive clumps, where, for a source redshift of z{sub s} {approx} 2, each clump exhibits only a small, separate critical area, with amore » total area of 0.69 {+-} 0.11{open_square}' over the two clumps. For a higher source redshift, z{sub s} {approx} 4, the critical curves of the two clumps merge together into one bigger and very elongated lens (axis ratio {approx_equal} 5.5), enclosing an effective area of 1.44 {+-} 0.22{open_square}'. The critical curves continue expanding with increasing redshift so that for high-redshift sources (z{sub s} {approx}> 9) they enclose an area of {approx}1.91 {+-} 0.30{open_square}' (effective {theta}{sub e} {approx_equal} 46.''8 {+-} 3.''7) and a mass of 6.09 {+-} 1.04 Multiplication-Sign 10{sup 14} M{sub Sun }. According to our model, the area of high magnification ({mu} > 10) for such high-redshift sources is {approx_equal}1.2{open_square}', and the area with {mu} > 5 is {approx_equal}2.3{open_square}', making El Gordo a compelling target for studying the high-redshift universe. We obtain a strong lower limit on the total mass of El Gordo, {approx}> 1.7 Multiplication-Sign 10{sup 15} M{sub Sun} from the SL regime alone, suggesting a total mass of roughly M{sub 200} {approx} 2.3 Multiplication-Sign 10{sup 15} M{sub Sun }. Our results should be revisited when additional spectroscopic and HST imaging data are available.« less

The mitochondrial genome of the ethanol-metabolizing, wine cellar mold Zasmidium cellare is the smallest for a filamentous ascomycete.

PubMed

Goodwin, Stephen B; McCorison, Cassandra B; Cavaletto, Jessica R; Culley, David E; LaButti, Kurt; Baker, Scott E; Grigoriev, Igor V

2016-08-01

Fungi in the class Dothideomycetes often live in extreme environments or have unusual physiology. One of these, the wine cellar mold Zasmidium cellare, produces thick curtains of mycelia in cellars with high humidity, and its ability to metabolize volatile organic compounds is thought to improve air quality. Whether these abilities have affected its mitochondrial genome is not known. To fill this gap, the circular-mapping mitochondrial genome of Z. cellare was sequenced and, at only 23 743 bp, is the smallest reported for a filamentous fungus. Genes were encoded on both strands with a single change of direction, different from most other fungi but consistent with the Dothideomycetes. Other than its small size, the only unusual feature of the Z. cellare mitochondrial genome was two copies of a 110-bp sequence that were duplicated, inverted and separated by approximately 1 kb. This inverted-repeat sequence confused the assembly program but appears to have no functional significance. The small size of the Z. cellare mitochondrial genome was due to slightly smaller genes, lack of introns and non-essential genes, reduced intergenic spacers and very few ORFs relative to other fungi rather than a loss of essential genes. Whether this reduction facilitates its unusual biology remains unknown. Published by Elsevier Ltd.

Status and Needs of Power Electronics for Photovoltaic Inverters

NASA Astrophysics Data System (ADS)

Qin, Y. C.; Mohan, N.; West, R.; Bonn, R.

2002-06-01

Photovoltaics is the utility connected distributed energy resource (DER) that is in widespread use today. It has one element, the inverter, which is common with all DER sources except rotating generators. The inverter is required to transfer dc energy to ac energy. With all the DER technologies, (solar, wind, fuel cells, and microturbines) the inverter is still an immature product that will result in reliability problems in fielded systems. Today, the PV inverter is a costly and complex component of PV systems that produce ac power. Inverter MTFF (mean time to first failure) is currently unacceptable. Low inverter reliability contributes to unreliable fielded systems and a loss of confidence in renewable technology. The low volume of PV inverters produced restricts the manufacturing to small suppliers without sophisticated research and reliability programs or manufacturing methods. Thus, the present approach to PV inverter supply has low probability of meeting DOE reliability goals.

Production of Ξ{_c^0} and Ξ{_b} in Z decays and lifetime measurement of Ξ{_b}

NASA Astrophysics Data System (ADS)

DELPHI Collaboration

2005-11-01

The charmed strange baryon Ξ{_c^0} was searched for in the decay channel Ξ{_c^0} rightarrow Ξ^- π^ + , and the beauty strange baryon Ξ{_b} in the inclusive channel Ξ_b rightarrow Ξ- ell- bar{ν} X, using the 3.5 million hadronic Z events collected by the DELPHI experiment in the years 1992-1995. The Ξ^- was reconstructed through the decay Ξ^- rightarrow Λ π^-, using a constrained fit method for cascade decays. An iterative discriminant analysis was used for the Ξ{_c^0} and Ξ{_b} selection. The production rates were measured to be f_{Ξ{_c^0}} ×BR (Ξ{_c^0} rightarrow Ξ^- π^ + ) = (4.7 ± 1.4 (stat.) ± 1.1 (syst.))× 10^{-4} per hadronic Z decay, and BR (b rightarrow Ξ{_b}) ×BR (Ξ{_b} rightarrow Ξ^- ell^- X) = (3.0 ± 1.0(stat.) ± 0.3(syst.))× 10^{-4} for each lepton species (electron or muon). The lifetime of the Ξ{_b} baryon was measured to be tau_{Ξ{_b}} = 1.45{^{ + 0.55}_{-0.43}} (stat.) ± 0.13 (syst.) ps. A combination with the previous DELPHI lifetime measurement gives tau_{Ξ{_b}} = 1.48{^{ + 0.40}_{-0.31}} (stat.) ± 0.12 (syst.) ps.

On the perturbation of the group generalized inverse for a class of bounded operators in Banach spaces

NASA Astrophysics Data System (ADS)

Castro-González, N.; Vélez-Cerrada, J. Y.

2008-05-01

Given a bounded operator A on a Banach space X with Drazin inverse AD and index r, we study the class of group invertible bounded operators B such that I+AD(B-A) is invertible and . We show that they can be written with respect to the decomposition as a matrix operator, , where B1 and are invertible. Several characterizations of the perturbed operators are established, extending matrix results. We analyze the perturbation of the Drazin inverse and we provide explicit upper bounds of ||B#-AD|| and ||BB#-ADA||. We obtain a result on the continuity of the group inverse for operators on Banach spaces.

Quantification of Explosion Source Characteristics from Near Source, Regional and Teleseismic Distances

DTIC Science & Technology

1989-07-31

may be expressed as a combination of geometrical spreading and anelastic attenuation as, A = e -a I rn where: A = attenuation as a function of...of the source parameter estimates. Similar consistent results are obtained for the vertical component records. 26 . E .- .0 ~ Ub C>2 a) o 0~ M- PC oa -0...U - V9suu) apl)dr F.p LO. ______ ___2 - a. 4) 440 44~ 0 A* 0 4-4 0 uu 14 E 0. 0 w a- .6aa w ad 0 IV E E 28 UCZ 40 F.) o .*L 101 V- z Z. Ica 29 0 Long

Computer Algorithms and Architectures for Three-Dimensional Eddy-Current Nondestructive Evaluation. Volume 2. Chapters 1-5

DTIC Science & Technology

1989-01-20

j(, i’j)d~d 25’ I// .=(z_ .V_ ~ .)Fov(q_ .r-irlz’ ff )( .rl)4Z i/ (25) The sensor is a single filament loop . If the source ring remains stationary...while the sensor loop is moved around, then the electric fields do not change as the sensor loop isI moved. In this case, F0. is a function of 4 and...my) ,,(2,y) = Fo,(=,Y)0𔃼(,Y) 5 On the other hand, if the source ring and the sensor loop always move together (and are concentric), then q = z and

Adjoint-tomography for a Local Surface Structure: Methodology and a Blind Test

NASA Astrophysics Data System (ADS)

Kubina, Filip; Michlik, Filip; Moczo, Peter; Kristek, Jozef; Stripajova, Svetlana

2017-04-01

We have developed a multiscale full-waveform adjoint-tomography method for local surface sedimentary structures with complicated interference wavefields. The local surface sedimentary basins and valleys are often responsible for anomalous earthquake ground motions and corresponding damage in earthquakes. In many cases only relatively small number of records of a few local earthquakes is available for a site of interest. Consequently, prediction of earthquake ground motion at the site has to include numerical modeling for a realistic model of the local structure. Though limited, the information about the local structure encoded in the records is important and irreplaceable. It is therefore reasonable to have a method capable of using the limited information in records for improving a model of the local structure. A local surface structure and its interference wavefield require a specific multiscale approach. In order to verify our inversion method, we performed a blind test. We obtained synthetic seismograms at 8 receivers for 2 local sources, complete description of the sources, positions of the receivers and material parameters of the bedrock. We considered the simplest possible starting model - a homogeneous halfspace made of the bedrock. Using our inversion method we obtained an inverted model. Given the starting model, synthetic seismograms simulated for the inverted model are surprisingly close to the synthetic seismograms simulated for the true structure in the target frequency range up to 4.5 Hz. We quantify the level of agreement between the true and inverted seismograms using the L2 and time-frequency misfits, and, more importantly for earthquake-engineering applications, also using the goodness-of-fit criteria based on the earthquake-engineering characteristics of earthquake ground motion. We also verified the inverted model for other source-receiver configurations not used in the inversion.

Measurement of the Ratio of Inclusive Cross Sections σ(p-$$\\bar{p}$$→Z+b-jet) /σ(p-$$\\bar{p}$$→Z+jet) in the Dilepton Final States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, Kenneth James

2010-10-01

The inclusive production of b-jets with a Z boson is an important background to searches for the Higgs boson in associated ZH → llbmore » $$\\bar{b}$$ production at the Fermilab Tevatron collider. This thesis describes the most precise measurement to date of the ratio of inclusive cross sections σ(p$$\\bar{p}$$ → Z + b-jet)/σ(p$$\\bar{p}$$ → Z + jet) when a Z boson decays into two electrons or muons. The measurement uses a data sample from p$$\\bar{p}$$ collisions at the center of mass energy √s = 1.96 TeV corresponding to an integrated luminosity of 4.2 fb -1 collected by the D0 detector. The measured ratio σ(Z + b-jet)/σ(Z + jet) is 0.0187 ± 0.0021(stat) ± 0.0015(syst) for jets with transverse momentum p T > 20 GeV and pseudorapidity |η| ≤ 2.5. The measurement is compared with the next-to-leading order theoretical predictions from MCFM and is found to be consistent within uncertainties.« less

Gateway to Care Management Analysis Series. Department of Army Health Services Command, Champus Catastrophic Payments for First Quarter, Fiscal Year 1993. Gateway Catchment Areas

DTIC Science & Technology

1993-02-26

CDU *~ IA C, Mt ac ca~ ;-§ = WEBS ~ 2WW -J OWO W W w U .41w 991o 2. Z 9. .J4NUIW fu -W gW atZ W ~~4 uu U~jW * WO W~I WI u at N. 0 0 W W 43I M c MCW4 - IA...t Z --w A -~ 4 -ti LUW C- o.nfl$I-V Pd . - K ~~~s- 5o. In U N U, I.-W cB w o S. -.-Bg a U I N N E % J N*B 0 u ra wz -It- ! - %n .~ *4- De IW. WIx -C

Effect of Food, Diet and Nutrition on Military Readiness and Preparedness of Army Personnel and Dependents in a Peacetime Environment

DTIC Science & Technology

1992-08-15

SETUP 04 Jan 9. •:09 :49 Page S, ;CHRMN VAL5 US•.ER ._-, DE INm-U. C.HOWI;RIES QSýR la;1 Test Name: EWS[ Calculation Factor: 3617 Reaction Type: [RATE i1...4 00 . aWI > Z:Z A M C4 (N0)0) 40 1 W IX I,W LLS ’n +Ix 0. el IL C.) If) a 0. Oc :10 LLI 0 >- 3t b) I 04 Lý C)La > -i -i LAJ -j .9 L" +1 I LLI I C4...kI u~ 1- - S * c2z.a w wa 140 Z M 4-9a % I M aU 1 z 0 Ix (A Z el - HW ix Il- Iz I4 Sw ;w IS I l- I W W O a Z3 ~ 1--W 1. 0. S 4- A z4 Iř 3 1400 =I 1

Programmable LED-based integrating sphere light source for wide-field fluorescence microscopy.

PubMed

Rehman, Aziz Ul; Anwer, Ayad G; Goldys, Ewa M

2017-12-01

Wide-field fluorescence microscopy commonly uses a mercury lamp, which has limited spectral capabilities. We designed and built a programmable integrating sphere light (PISL) source which consists of nine LEDs, light-collecting optics, a commercially available integrating sphere and a baffle. The PISL source is tuneable in the range 365-490nm with a uniform spatial profile and a sufficient power at the objective to carry out spectral imaging. We retrofitted a standard fluorescence inverted microscope DM IRB (Leica) with a PISL source by mounting it together with a highly sensitive low- noise CMOS camera. The capabilities of the setup have been demonstrated by carrying out multispectral autofluorescence imaging of live BV2 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

The SCUBA HAlf Degree Extragalactic Survey (SHADES) - V. Submillimetre properties of near-infrared-selected galaxies in the Subaru/XMM -Newton deep field

NASA Astrophysics Data System (ADS)

Takagi, T.; Mortier, A. M. J.; Shimasaku, K.; Coppin, K.; Pope, A.; Ivison, R. J.; Hanami, H.; Serjeant, S.; Clements, D. L.; Priddey, R. S.; Dunlop, J. S.; Takata, T.; Aretxaga, I.; Chapman, S. C.; Eales, S. A.; Farrah, D.; Granato, G. L.; Halpern, M.; Hughes, D. H.; van Kampen, E.; Scott, D.; Sekiguchi, K.; Smail, I.; Vaccari, M.

2007-11-01

We have studied the submillimetre (submm) properties of the following classes of near-infrared-selected (NIR-selected) massive galaxies at high redshifts: BzK-selected star-forming galaxies (BzKs); distant red galaxies (DRGs); and extremely red objects (EROs). We used the SCUBA HAlf Degree Extragalactic Survey (SHADES), the largest uniform submm survey to date. Partial overlap of SIRIUS/NIR images and SHADES in Subaru/XMM-Newton deep field has allowed us to identify four submm-bright NIR-selected galaxies, which are detected in the mid-IR, 24μ m, and the radio, 1.4GHz. We find that all of our submm-bright NIR-selected galaxies satisfy the BzK selection criteria, i.e. BzK ≡ (z - K)AB - (B - z)AB >= -0.2, except for one galaxy whose B - z and z - K colours are however close to the BzK colour boundary. Two of the submm-bright NIR-selected galaxies satisfy all of the selection criteria we considered, i.e. they belong to the BzK-DRG-ERO overlapping population, or `extremely red' BzKs. Although these extremely red BzKs are rare (0.25 arcmin-2), up to 20 per cent of this population could be submm galaxies. This fraction is significantly higher than that found for other galaxy populations studied here. Via a stacking analysis, we have detected the 850-μ m flux of submm-faint BzKs and EROs in our SCUBA maps. While the contribution of z ~ 2 BzKs to the submm background is about 10-15 per cent and similar to that from EROs typically at z ~ 1, BzKs have a higher fraction (~30 per cent) of submm flux in resolved sources compared with EROs and submm sources as a whole. From the spectral energy distribution (SED) fitting analysis for both submm-bright and submm-faint BzKs, we found no clear signature that submm-bright BzKs are experiencing a specifically luminous evolutionary phase, compared with submm-faint BzKs. An alternative explanation might be that submm-bright BzKs are more massive than submm-faint ones.

Measurement of the ratio of inclusive cross sections sigma(pp going to Z+b-jet)/sigma(pp going to Z+jet) in the dilepton final states

NASA Astrophysics Data System (ADS)

Smith, Kenneth James

The inclusive production of b-jets with a Z boson is an important background to searches for the Higgs boson in associated ZH → llbb¯ production at the Fermilab Tevatron collider. This thesis describes the most precise measurement to date of the ratio of inclusive cross sections sigma( pp¯ → Z +b-jet)/sigma( pp¯ → Z+jet) when a Z boson decays into two electrons or muons. The measurement uses a data sample from pp¯ collisions at the center of mass energy s = 1.96 TeV corresponding to an integrated luminosity of 4.2 fb -1 collected by the D0 detector. The measured ratio sigma( Z + b-jet)/sigma(Z+jet) is 0.0187 +/- 0.0021(stat) +/- 0.0015(syst) for jets with transverse momentum pT > 20 GeV and pseudorapidity |eta| ≤2.5. The measurement is compared with the next-to-leading order theoretical predictions from MCFM and is found to be consistent within uncertainties.

Resolute Apt, Northwest Territories, Canada. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

DTIC Science & Technology

1972-01-17

ITS ASHEVILLE, N. C. II POI L, TD ’ Reiew and-Approval Statement This report is approved for public release. There is no objection to unlimited...14000 -,46 0 t* ski :ph 0 51194 TTj i-ri -T-. _T7. 40( -~677. - Td -. 7.4 12000 40’ aiNb6 5(2,7 03*1 67.0 67*9 7gT) 7Z* 9 7Z*9 70,0 77., 774 70uZ i 1...DEPRESSION (F) TOTAL TOTAL(F I o 1 2 3 4 5 - ..7 - . - 27-..8. .93...B W8- BubWe B.b TD ..ew . (F’ 0 . 2 3-4 ’ 5-6 7.8 9-10 1.12 13-1415-16 17- 819.20 21-22 22

Electrical system for pulse-width modulated control of a power inverter using phase-shifted carrier signals and related operating methods

DOEpatents

Welchko, Brian A [Torrance, CA

2012-02-14

Systems and methods are provided for pulse-width modulated control of power inverter using phase-shifted carrier signals. An electrical system comprises an energy source and a motor. The motor has a first set of windings and a second set of windings, which are electrically isolated from each other. An inverter module is coupled between the energy source and the motor and comprises a first set of phase legs coupled to the first set of windings and a second set of phase legs coupled to the second set of windings. A controller is coupled to the inverter module and is configured to achieve a desired power flow between the energy source and the motor by modulating the first set of phase legs using a first carrier signal and modulating the second set of phase legs using a second carrier signal. The second carrier signal is phase-shifted relative to the first carrier signal.

Development of a Flight Simulation Concept and Aerodynamic Buildup for Investigation of Departure Prevention Systems in Tactical Aircraft.

DTIC Science & Technology

1983-09-01

I - c).Il.- 4 - OIL 1-0 40CA I ..04uLU 1-Z Z ម 00 >O~ 0 CC cc3 0 WCLW X04 g ’"-J0t-0QtcW at Z1--W0Uaow( W" 01- ZZ0Z :3 JCCQ~Aw1-cO 00’-ZI.-0’ Z4... OIL 40 ft.~~L ft t U- U~r ~- b O* - 0 . i 0LL ,;V; 0 O U. W l- oIZ 0U 0 Q W --. " Z-f Ci IL LU - 4 QILL0 - .% 0 (J wU--󈧭- 2 u Q - -JL ZU 0-’ 2 I - w Ow...0 0.440 -0t UI20-.Jc ’A 28.- >.J0Zb4 -JovV-$- UJa 8- C9444L W4-LU 4ao. a L . .4~ 11.0QQ 000002 .U.4’U. z 00".-Po .44in..4 0~4 LUV ., i

SHARDS: constraints on the dust attenuation law of star-forming galaxies at z ˜ 2

NASA Astrophysics Data System (ADS)

Tress, Mónica; Mármol-Queraltó, Esther; Ferreras, Ignacio; Pérez-González, Pablo G.; Barro, Guillermo; Pampliega, Belén Alcalde; Cava, Antonio; Domínguez-Sánchez, Helena; Eliche-Moral, Carmen; Espino-Briones, Néstor; Esquej, Pilar; Hernán-Caballero, Antonio; Rodighiero, Giulia; Rodriguez-Muñoz, Lucía

2018-04-01

We make use of the Survey of High-z Absorption Red and Dead Sources, an ultradeep (<26.5AB) galaxy survey that provides optical photospectra at resolution R ˜ 50, via medium-band filters (FWHM ˜ 150 Å). This data set is combined with ancillary optical and NIR fluxes to constrain the dust attenuation law in the rest-frame NUV region of star-forming galaxies within the redshift window 1.5 < z < 3. We focus on the NUV bump strength (B) and the total-to-selective extinction ratio (RV), targeting a sample of 1753 galaxies. By comparing the data with a set of population synthesis models coupled to a parametric dust attenuation law, we constrain RV and B, as well as the colour excess, E(B - V). We find a correlation between RV and B, which can be interpreted either as a result of the grain size distribution, or a variation of the dust geometry among galaxies. According to the former, small dust grains are associated with a stronger NUV bump. The latter would lead to a range of clumpiness in the distribution of dust within the interstellar medium of star-forming galaxies. The observed wide range of NUV bump strengths can lead to a systematic in the interpretation of the UV slope β typically used to characterize the dust content. In this study, we quantify these variations, concluding that the effects are Δβ ˜ 0.4.

Adaptive Selective Harmonic Minimization Based on ANNs for Cascade Multilevel Inverters With Varying DC Sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filho, Faete; Maia, Helder Z; Mateus, Tiago Henrique D

2013-01-01

A new approach for modulation of an 11-level cascade multilevel inverter using selective harmonic elimination is presented in this paper. The dc sources feeding the multilevel inverter are considered to be varying in time, and the switching angles are adapted to the dc source variation. This method uses genetic algorithms to obtain switching angles offline for different dc source values. Then, artificial neural networks are used to determine the switching angles that correspond to the real-time values of the dc sources for each phase. This implies that each one of the dc sources of this topology can have different valuesmore » at any time, but the output fundamental voltage will stay constant and the harmonic content will still meet the specifications. The modulating switching angles are updated at each cycle of the output fundamental voltage. This paper gives details on the method in addition to simulation and experimental results.« less

Current Source Based on H-Bridge Inverter with Output LCL Filter

NASA Astrophysics Data System (ADS)

Blahnik, Vojtech; Talla, Jakub; Peroutka, Zdenek

2015-09-01

The paper deals with a control of current source with an LCL output filter. The controlled current source is realized as a single-phase inverter and output LCL filter provides low ripple of output current. However, systems incorporating LCL filters require more complex control strategies and there are several interesting approaches to the control of this type of converter. This paper presents the inverter control algorithm, which combines model based control with a direct current control based on resonant controllers and single-phase vector control. The primary goal is to reduce the current ripple and distortion under required limits and provides fast and precise control of output current. The proposed control technique is verified by measurements on the laboratory model.

A New Measurement of the Stellar Mass Density at z~5: Implications for the Sources of Cosmic Reionization

NASA Astrophysics Data System (ADS)

Stark, D. P.; Bunker, A. J.; Ellis, R. S.; Eyles, L. P.; Lacy, M.

2007-04-01

We present a new measurement of the integrated stellar mass per comoving volume at redshift 5 determined via spectral energy fitting drawn from a sample of 214 photometrically selected galaxies with z'850LP<26.5 in the southern GOODS field. Following recent procedures introduced by Eyles et al., we estimate stellar masses for various subsamples for which reliable and unconfused Spitzer IRAC detections are available. A spectroscopic sample of 14 of the most luminous sources with z=4.92 provides a firm lower limit to the stellar mass density of 1×106 Msolar Mpc-3. Several galaxies in this subsample have masses of order 1011 Msolar, implying that significant earlier activity occurred in massive systems. We then consider a larger sample whose photometric redshifts in the publicly available GOODS-MUSIC catalog lie in the range 4.4

Heterogeneity of zeolite combined with biochar properties as a function of sewage sludge composting and production of nutrient-rich compost.

PubMed

Kumar Awasthi, Mukesh; Wang, Meijing; Pandey, Ashok; Chen, Hongyu; Kumar Awasthi, Sanjeev; Wang, Quan; Ren, Xiuna; Hussain Lahori, Altaf; Li, Dong-Sheng; Li, Ronghua; Zhang, Zengqiang

2017-10-01

In the present study, biochar combined with a higher dosage of zeolite (Z) and biochar (B) alone were applied as additives for dewatered fresh sewage sludge (DFSS) composting using 130-L working volume lab-scale reactors. We first observed that the addition of a mixture of B and Z to DFSS equivalent to 12%B+10% (Z-1), 15% (Z-2) and 30% (Z-3) zeolite (dry weight basis) worked synergistically as an amendment and increased the composting efficiency compared with a treatment of 12%B alone amended and a control without any amendment. In a composting reactor, the addition of B+Z may serve as a novel approach for improving DFSS composting and the quality of the end product in terms of the temperature, water-holding capacity, CO 2 emissions, electrical conductivity, water-soluble and total macro-nutrient content and phytotoxicity. The results indicated that during the thermophilic phase, dissolved organic carbon, NH 4 + -N and NO 3 - -N increased drastically in all biochar amended treatments, whereas considerably low water-soluble nutrients were observed in the control treatment throughout and at the end of the composting. Furthermore, the maturity parameters and dissolved organic carbon (DOC) indicated that compost with 12%B+15%Z became more mature and humified within 35days of DFSS composting, with the maturity parameters, such as CO 2 evolution and the concentration of NH 4 + -N in the compost, being within the permissible limits of organic farming in contrast to the control. Furthermore, at the end of composting, the addition of higher dosage of biochar (12%) alone and 12% B+Z lowered the pH by 7.15 to 7.86 and the electrical conductivity by 2.65 to 2.95mScm -1 as compared to the control, while increased the concentrations of water-soluble nutrients (gkg -1 ) including available phosphorus, sodium and potassium. In addition, greenhouse experiments demonstrated that the treatment of 150kgha -1 biochar combined with zeolite and that of 12%B alone improved the yield of Chinese cabbage (Brassica rapa chinensis L.). The highest dry weight biomass (1.41±0.12g/pot) was obtained with 12%B+15%Z amended compost. Therefore, 12%B+15%Z can be potentially applied as an amendment to improve DFSS composting. Copyright © 2017 Elsevier Ltd. All rights reserved.

The formation of shocks and fundamental solution of a fourth-order quasilinear Boussinesq-type equation

NASA Astrophysics Data System (ADS)

Galaktionov, Victor A.

2009-02-01

As a basic higher-order model, the fourth-order Boussinesq-type quasilinear wave equation (the QWE-4) \\[ \\begin{equation*}\\fl u_{tt} = -(|u|^n u)_{xxxx} \\tqs in\\ \\mathbb{R} \\times \\mathbb{R}_+, \\quad with\\ exponent\\ n > 0,\\end{equation*} \\] is considered. Self-similar blow-up solutions \\[ \\begin{eqnarray*}\\tqs\\tqs u_-(x,t)=g(z), \\quad\\, z=\\frac x{\\sqrt{T-t}},\\\\ where\\ g\\ solved\\ the\\ ODE\\ \\frac 14 g'' z^2 + \\frac 34 g'z = -(|g|^n g)^{(4)},\\end{eqnarray*} \\] are shown to exist that generate as t → T- discontinuous shock waves. The QWE-4 is also shown to admit a smooth (for t > 0) global 'fundamental solution' \\[ \\begin{eqnarray*}\\fl b_n(x,t)= t^{\\frac{2}{n+4}} F_n(y),\\ y = x/t^{\\frac{n+2}{n+4}},\\ such\\ that\\ b_{n}(x,0)= 0,\\ b_{nt}(x,0)= {\\delta}(x),\\end{eqnarray*} \\] i.e. having a measure as initial data. A 'homotopic' limit n → 0 is used to get b_0(x,t)= \\sqrt t \\, F_0(x/\\sqrt t) being the classic fundamental solution of the 1D linear beam equation \\[ \\begin{equation*}u_{tt} = -u_{xxxx} \\tqs in\\ \\mathbb{R} \\times \\mathbb{R}_+.\\end{equation*} \\

The Quintessential Bond of Modern Science. The Detection and Characterization of Diatomic Gold Sulfide, AuS.

NASA Astrophysics Data System (ADS)

Kokkin, Damian L.; Zhang, Ruohan; Steimle, Timothy; Pearlman, Bradley W.; Wyse, Ian A.; Varberg, Thomas D.

2015-06-01

The gold sulfur bond is becoming ever more important to a vast range of scientific endeavors. We have recorded the electronic spectrum of gas-phase AuS, at vibrational resolution, over the 440-740 nm wavelength range. By application of a synergy of production techniques, hot hollow-cathode sputtering source and cold laser ablation molecular beam source, excitation from both spin components of the inverted ^2Π ground state is possible. Excitation into four different excited electronic states involving approximately 100 red-degraded bands has been observed. The four excited states have been characterized as a^4σ1/2, A^2σ^+1/2, B^2σ^-1/2 and C^2Δ_i. The observed red-degraded vibronic bands where then globally analyzed to determine an accurate set of term energies and vibrational constants for the excited and ground electronic states. The electronic configurations from which these states arise will be discussed.

Inverted u-shaped purse and rotation flaps: correcting the inferoposterior deformity of reconstructed ears after canaloplasty of the external auditory meatus.

PubMed

Ji, Chenyang; Zhang, Jinming; An, Geng; Liang, Weiqiang; Pan, Shujuan; Chen, Yuhong; Wei, Zhe; Zhang, Ganlin

2012-06-01

After patients with congenital microtia receive external ear canal plasty, the mastoid area usually has insufficient space for ear reconstruction. Hence, after ear reconstruction, an inferoposterior position deformity of the ear appears to some extent. Using inverted U-shaped purse and rotation flaps can correct this deformity effectively. From May of 2009 to September of 2011, five patients received the described procedures in the authors' department. Inverted U-shaped purse and rotation flaps were used for all the patients. The inverted U-shaped purse flap was used to reduce the area of the canal orifice and to lower the position, and the rotation flap was applied to turn the ear in a more superoposterior position. Two patients also received full-thickness skin grafting to cover the secondary wound. In four patients, V-Y-plasty or Z-plasty was used to adjust the flap transition. For the five patients, the distances between the ear antihelix and canal orifice were shortened, and the areas of the canal orifice were diminished. The retroversion of the auricle was corrected in various degrees, and the angles of the long axis of the auricle and the horizontal line were increased an average of 14.4°. The vertical distance between the top of the helix and the center of the canal orifice was increased an average of 15.2 mm. A slight dog ear deformity in front of the crus of the helix was left after the operation, but it was alleviated in the follow-up period. By using inverted U-shaped purse and rotation flaps, the inferoposterior position deformity of the reconstructed ear after external ear canal plasty in congenital microtia can be resolved effectively. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors http://www.springer.com/00266.

Air Force Office of Scientific Research. AFOSR Technical Report Summaries

DTIC Science & Technology

1993-06-01

0..’ w z CA W B mL& L53 )I-t in (3w - J 2.5 W 1I- C12 z. WJO -1 )-. U’.aW 64 1--2 0 .Z 9 0 F- ... w ’.LILOO 4z w W’ IL =Aw M 4%0 J.IZW w . u zw -jO...x &-~ a 4 5 i ɜ (A W CDI- #_ z U r) (j 𔃺 ’- )_ *𔃾 We. a:U IA. aL U 014 U ’A -2 m 0 0 I--U’ o n (A z- w ý4 0 #- $.- U’>- tD I.- z 40 I-. a: x 4z- 0Z...toMM CC 0In L~A001 L - - oc -n C’ -- n x C4 L W - M A ’- 0 l. -A LO C SLS 0&c 0 0 0 0. 0+ a14 SI 41 > -a:I 0 c 1X’ .0 m z tD a1 -_ 1 U 8-01 --. 81 00 C

Land Management Alternatives in the Lake Erie Drainage Basin.

DTIC Science & Technology

1979-03-01

NIB I’ ZhI N a I42 U. ... . " w °A 1 B 1 -A - a4 I B Ck hJ O I / I I ki w I o 0D o • o 0* B B ** .- - Cm Il sD + I rI I tv : LO S A z z 0 0n I o1 I N...4’A SO .Ato C~ Stall - Na.. CaCAO t-.a QC’s Ceaaa a.aa.a Dn..a * 0- - o a.av..aa.-aC, c - a a - 0 a~ S - 0 Uct.toajaO - to. - N C at a -a Ca :a...46 N. 9 . 34.8 0 1 O W"ൈ ftN de a .4 nS Sa o 0 -SIWO * 0 LiS . -’ AL 4Wf w . IS v z -wa u t fm 1- 0, M Is -. 1 , U h.S 84 C: I It C a.. W. o IL 40

A supersymmetric D4 model for μ-τ symmetry

NASA Astrophysics Data System (ADS)

Adulpravitchai, A.; Blum, A.; Hagedorn, C.

2009-03-01

We construct a supersymmeterized version of the model presented by Grimus and Lavoura (GL) in \\cite{GL1} which predicts θ23 maximal and θ13 = 0 in the lepton sector. For this purpose, we extend the flavor group, which is D4 × Z2(aux) in the original model, to D4 × Z5. An additional difference is the absence of right-handed neutrinos. Despite these changes the model is the same as the GL model, since θ23 maximal and θ13 = 0 arise through the same mismatch of D4 subgroups, D2 in the charged lepton and Z2 in the neutrino sector. In our setup D4 is solely broken by gauge singlets, the flavons. We show that their vacuum structure, which leads to the prediction of θ13 and θ23, is a natural result of the scalar potential. We find that the neutrino mass matrix only allows for inverted hierarchy, if we assume a certain form of spontaneous CP violation. The quantity |mee|, measured in neutrinoless double beta decay, is nearly equal to the lightest neutrino mass m3. The Majorana phases phi1 and phi2 are restricted to a certain range for m3lesssim0.06 eV. We discuss the next-to-leading order corrections which give rise to shifts in the vacuum expectation values of the flavons. These induce deviations from maximal atmospheric mixing and vanishing θ13. It turns out that these deviations are smaller for θ23 than for θ13.

detectIR: a novel program for detecting perfect and imperfect inverted repeats using complex numbers and vector calculation.

PubMed

Ye, Congting; Ji, Guoli; Li, Lei; Liang, Chun

2014-01-01

Inverted repeats are present in abundance in both prokaryotic and eukaryotic genomes and can form DNA secondary structures--hairpins and cruciforms that are involved in many important biological processes. Bioinformatics tools for efficient and accurate detection of inverted repeats are desirable, because existing tools are often less accurate and time consuming, sometimes incapable of dealing with genome-scale input data. Here, we present a MATLAB-based program called detectIR for the perfect and imperfect inverted repeat detection that utilizes complex numbers and vector calculation and allows genome-scale data inputs. A novel algorithm is adopted in detectIR to convert the conventional sequence string comparison in inverted repeat detection into vector calculation of complex numbers, allowing non-complementary pairs (mismatches) in the pairing stem and a non-palindromic spacer (loop or gaps) in the middle of inverted repeats. Compared with existing popular tools, our program performs with significantly higher accuracy and efficiency. Using genome sequence data from HIV-1, Arabidopsis thaliana, Homo sapiens and Zea mays for comparison, detectIR can find lots of inverted repeats missed by existing tools whose outputs often contain many invalid cases. detectIR is open source and its source code is freely available at: https://sourceforge.net/projects/detectir.

Limits on the decay-rate difference of neutral B mesons and on CP, T, and CPT violation in B(0-0)B oscillations.

PubMed

Aubert, B; Barate, R; Boutigny, D; Gaillard, J-M; Hicheur, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Zghiche, A; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kral, J F; Kukartsev, G; LeClerc, C; Levi, M E; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Ford, K; Harrison, T J; Hawkes, C M; Knowles, D J; Morgan, S E; Penny, R C; Watson, A T; Watson, N K; Deppermann, T; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Peters, K; Schmuecker, H; Steinke, M; Barlow, N R; Boyd, J T; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Mackay, C; Wilson, F F; Abe, K; Cuhadar-Donszelmann, T; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Kyberd, P; McKemey, A K; Blinov, V E; Bukin, A D; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Shen, B C; del Re, D; Hadavand, H K; Hill, E J; MacFarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Dahmes, B; Levy, S L; Long, O; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Beringer, J; Eisner, A M; Heusch, C A; Lockman, W S; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Turri, M; Walkowiak, W; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Narsky, I; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Abe, T; Blanc, F; Bloom, P; Chen, S; Clark, P J; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Roy, J; Smith, J G; van Hoek, W C; Zhang, L; Harton, J L; Hu, T; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Altenburg, D; Brandt, T; Brose, J; Colberg, T; Dickopp, M; Dubitzky, R S; Hauke, A; Lacker, H M; Maly, E; Müller-Pfefferkorn, R; Nogowski, R; Otto, S; Schubert, J; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Grenier, P; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Khan, A; Lavin, D; Muheim, F; Playfer, S; Swain, J E; Tinslay, J; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Biasini, M; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Pioppi, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Morii, M; Won, E; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gaillard, J R; Morton, G W; Nash, J A; Sanders, P; Taylor, G P; Grenier, G J; Lee, S-J; Mallik, U; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Yi, J; Davier, M; Grosdidier, G; Höcker, A; Laplace, S; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Plaszczynski, S; Schune, M H; Tantot, L; Wormser, G; Brigljević, V; Cheng, C H; Lange, D J; Wright, D M; Bevan, A J; Coleman, J P; Fry, J R; Gabathuler, E; Gamet, R; Kay, M; Parry, R J; Payne, D J; Sloane, R J; Touramanis, C; Back, J J; Harrison, P F; Shorthouse, H W; Strother, P; Vidal, P B; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; George, S; Green, M G; Kurup, A; Marker, C E; McMahon, T R; Ricciardi, S; Salvatore, F; Vaitsas, G; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, R J; Forti, A C; Hart, P A; Jackson, F; Lafferty, G D; Lyon, A J; Weatherall, J H; Williams, J C; Farbin, A; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Mangeol, D J J; Milek, M; Patel, P M; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Cote-Ahern, D; Hast, C; Taras, P; Nicholson, H; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M A; Raven, G; LoSecco, J M; Gabriel, T A; Brau, B; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Wong, Q K; Brau, J; Frey, R; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Tiozzo, G; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de la Vaissière, Ch; Del Buono, L; Hamon, O; John, M J J; Leruste, Ph; Ocariz, J; Pivk, M; Roos, L; Stark, J; T'Jampens, S; Therin, G; Manfredi, P F; Re, V; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Danielson, N; Elmer, P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Tanaka, H A; Varnes, E W; Bellini, F; Cavoto, G; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Mazzoni, M A; Morganti, S; Pierini, M; Piredda, G; Safai Tehrani, F; Voena, C; Christ, S; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Geddes, N I; Gopal, G P; Olaiya, E O; Xella, S M; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel de Monchenault, G; Kozanecki, W; Langer, M; Legendre, M; London, G W; Mayer, B; Schott, G; Vasseur, G; Yeche, Ch; Zito, M; Purohit, M V; Weidemann, A W; Yumiceva, F X; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Convery, M R; Coupal, D P; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Field, R C; Glanzman, T; Gowdy, S J; Granges-Pous, E; Hadig, T; Halyo, V; Hryn'ova, T; Innes, W R; Jessop, C P; Kelsey, M H; Kim, P; Kocian, M L; Langenegger, U; Leith, D W G S; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Petrak, S; Ratcliff, B N; Robertson, S H; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Simi, G; Snyder, A; Soha, A; Stelzer, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Edwards, A J; Meyer, T I; Petersen, B A; Roat, C; Ahmed, M; Ahmed, S; Alam, M S; Ernst, J A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Borean, C; Bosisio, L; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Panvini, R S; Banerjee, Sw; Brown, C M; Fortin, D; Jackson, P D; Kowalewski, R; Roney, J M; Band, H R; Dasu, S; Datta, M; Eichenbaum, A M; Johnson, J R; Kutter, P E; Li, H; Liu, R; Di Lodovico, F; Mihalyi, A; Mohapatra, A K; Pan, Y; Prepost, R; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Neal, H

2004-05-07

Using events in which one of two neutral B mesons from the decay of an Upsilon(4S) meson is fully reconstructed, we determine parameters governing decay (DeltaGamma(d)/Gamma(d)), CP, and T violation (|q/p|), and CP and CPT violation (Re z,Im z). The results, obtained from an analysis of 88 x 10(6) Upsilon(4S) decays recorded by BABAR, are sgn(Re lambda(CP))DeltaGamma(d)/Gamma(d)=-0.008+/-0.037(stat)+/-0.018(syst)[-0.084,0.068],|q/p|=1.029+/-0.013(stat)+/-0.011(syst)[1.001,1.057],(Re lambda(CP)/|lambda(CP)|) Re z=0.014+/-0.035(stat)+/-0.034(syst)[-0.072,0.101],Im z=0.038+/-0.029(stat)+/-0.025(syst)[-0.028,0.104]. The values inside the square brackets indicate the 90% confidence-level intervals. These results are consistent with standard model expectations.

The mechanics of unrest at Long Valley caldera, California: 1. Modeling the geometry of the source using GPS, leveling and two-color EDM data

USGS Publications Warehouse

Battaglia, Maurizio; Segall, P.; Murray, J.; Cervelli, Peter; Langbein, J.

2003-01-01

We surveyed 44 existing leveling monuments in Long Valley caldera in July 1999, using dual frequency global positioning system (GPS) receivers. We have been able to tie GPS and leveling to a common reference frame in the Long Valley area and computed the vertical deformation by differencing GPS-based and leveled orthometric heights. The resurgent dome uplifted 74??7 cm from 1975 to 1999. To define the inflation source, we invert two-color EDM and uplift data from the 1985-1999 unrest period using spherical or ellipsoidal sources. We find that the ellipsoidal source satisfies both the vertical and horizontal deformation data, whereas the spherical point source cannot. According to our analysis of the 1985-1999 data, the main source of deformation is a prolate ellipsoid located beneath the resurgent dome at a depth of 5.9 km (95% bounds of 4.9-7.5 km). This body is vertically elongated, has an aspect ratio of 0.475 (95% bounds are 0.25-0.65) and a volume change of 0.086 km3 (95% bounds are 0.06-0.13 km3). Failure to account for the ellipsoidal nature of the source biases the estimated source depth by 2.1 km (35%), and the source volume by 0.038 km3 (44%). ?? 2003 Elsevier B.V. All rights reserved.

Inverted Nipple Correction with Selective Dissection of Lactiferous Ducts Using an Operative Microscope and a Traction Technique.

PubMed

Sowa, Yoshihiro; Itsukage, Sizu; Morita, Daiki; Numajiri, Toshiaki

2017-10-01

An inverted nipple is a common congenital condition in young women that may cause breastfeeding difficulty, psychological distress, repeated inflammation, and loss of sensation. Various surgical techniques have been reported for correction of inverted nipples, and all have advantages and disadvantages. Here, we report a new technique for correction of an inverted nipple using an operative microscope and traction that results in low recurrence and preserves lactation function and sensation. Between January 2010 and January 2013, we treated eight inverted nipples in seven patients with selective lactiferous duct dissection using an operative microscope. An opposite Z-plasty was added at the junction of the nipple and areola. Postoperatively, traction was applied through an apparatus made from a rubber gasket attached to a sterile syringe. Patients were followed up for 15-48 months. Adequate projection was achieved in all patients, and there was no wound dehiscence or complications such as infection. Three patients had successful pregnancies and subsequent breastfeeding that was not adversely affected by the treatment. There was no loss of sensation in any patient during the postoperative period. Our technique for treating an inverted nipple is effective and preserves lactation function and nipple sensation. The method maintains traction for a longer period, which we believe increases the success rate of the surgery for correction of severely inverted nipples. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Evaluation of quasi-square wave inverter as a power source for induction motors

NASA Technical Reports Server (NTRS)

Guynes, B. V.; Haggard, R. L.; Lanier, J. R., Jr.

1977-01-01

The relative merits of quasi-square wave inverter-motor technology versus a sine wave inverter-motor system were investigated. The empirical results of several tests on various sizes of wye-wound induction motors are presented with mathematical analysis to support the conclusions of the study. It was concluded that, within the limitations presented, the quasi-square wave inverter-motor system is superior to the more complex sine wave system for most induction motor applications in space.

A RUNAWAY BLACK HOLE IN COSMOS: GRAVITATIONAL WAVE OR SLINGSHOT RECOIL?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Civano, F.; Elvis, M.; Lanzuisi, G.

2010-07-01

We present a detailed study of a peculiar source detected in the COSMOS survey at z = 0.359. Source CXOC J100043.1+020637, also known as CID-42, has two compact optical sources embedded in the same galaxy. The distance between the two, measured in the HST/ACS image, is 0.''495 {+-} 0.''005 that, at the redshift of the source, corresponds to a projected separation of 2.46 {+-} 0.02 kpc. A large ({approx}1200 km s{sup -1}) velocity offset between the narrow and broad components of H{beta} has been measured in three different optical spectra from the VLT/VIMOS and Magellan/IMACS instruments. CID-42 is also themore » only X-ray source in COSMOS, having in its X-ray spectra a strong redshifted broad absorption iron line and an iron emission line, drawing an inverted P-Cygni profile. The Chandra and XMM-Newton data show that the absorption line is variable in energy by {Delta}E = 500 eV over four years and that the absorber has to be highly ionized in order not to leave a signature in the soft X-ray spectrum. That these features-the morphology, the velocity offset, and the inverted P-Cygni profile-occur in the same source is unlikely to be a coincidence. We envisage two possible explanations, both exceptional, for this system: (1) a gravitational wave (GW) recoiling black hole (BH), caught 1-10 Myr after merging; or (2) a Type 1/Type 2 system in the same galaxy where the Type 1 is recoiling due to the slingshot effect produced by a triple BH system. The first possibility gives us a candidate GW recoiling BH with both spectroscopic and imaging signatures. In the second case, the X-ray absorption line can be explained as a BAL-like outflow from the foreground nucleus (a Type 2 AGN) at the rearer one (a Type 1 AGN), which illuminates the otherwise undetectable wind, giving us the first opportunity to show that fast winds are present in obscured active galactic nuclei (AGNs), and possibly universal in AGNs.« less

Structures of chloralide, ?-lactic acid chloralide, malic acid chloralide and citric acid chloralide

NASA Astrophysics Data System (ADS)

Koh, L. L.; Huang, H. H.; Chia, L. H. L.; Liang, E. P.

1995-06-01

The crystal and molecular structures of chloralide ( 1), D-lactic acid chloralide ( 2), malic acid chloralide ( 3) and citric acid chloralide ( 4) have been determined by X-ray diffraction methods. Compound 1 crystallizes in the monoclinic space group, {P2 1}/{c}, a = 6.201(2), b = 17.11(2), c = 10.357(6) Å, β = 95.21(4)°, Z = 4; compound 2 in the monoclinic space group P2 1, a = 7.600(4), b = 5.902(4), c = 9.743(6) Å, β = 99.20(5), Z = 2; compound 3 in the monoclinic space group {P2 1}/{c}, a = 16.500(6), b = 5.819(3), c = 10.120(4) Å, β = 91.41(3), Z = 4; compound 4 in the monoclinic space group {P2 1}/{c}, a = 12.041(3), b = 6.1190(10), c = 17.259(4) Å, β = 101.85(2), Z = 4. The five-membered ring systems of all the compounds are slightly twisted out-of-plane, that of compound 4 being the most puckered. The CCl 3 group is trans to the second CCl 3 group in 1, to the CH 3 group in 2 and to the CH 2COOH group in 3. The two CH 2COOH groups in 4 are disposed axially with respect to the ring. Dipole moment and Kerr constant data for D-lactic acid chloralide suggest a structure in solution which is consistent with the X-ray results. The IR spectra of 2, 3 and 4 are discussed in relation to the structures of these compounds.

Determination of hexabromocyclododecane by flowing atmospheric pressure afterglow mass spectrometry.

PubMed

Smoluch, Marek; Silberring, Jerzy; Reszke, Edward; Kuc, Joanna; Grochowalski, Adam

2014-10-01

The first application of a flowing atmospheric-pressure afterglow ion source for mass spectrometry (FAPA-MS) for the chemical characterization and determination of hexabromocyclododecane (HBCD) is presented. The samples of technical HBCD and expanded polystyrene foam (EPS) containing HBCD as a flame retardant were prepared by dissolving the appropriate solids in dichloromethane. The ionization of HBCD was achieved with a prototype FAPA source. The ions were detected in the negative-ion mode. The ions corresponding to a deprotonated HBCD species (m/z 640.7) as well as chlorine (m/z 676.8), nitrite (m/z 687.8) and nitric (m/z 703.8) adducts were observed in the spectra. The observed isotope pattern is characteristic for a compound containing six bromine atoms. This technique is an effective approach to detect HBCD, which is efficiently ionized in a liquid phase, resulting in high detection efficiency and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Nonparametric Estimation of Distribution and Density Functions with Applications.

DTIC Science & Technology

1982-05-01

8 > Z C.. o i, ,- 4 8 ...S C[ 17 : - j 46 0- IA ~ IL ar’ D rn B- - 4 -4A B- 8 ~a *~jai 188 the jackknife may be found in Gray, et al., and Cressie (Refs 15,28). Analogous to...convergence. 21 =7w; Ul I 0083 q C/) 22S , WJ 8 , J035 224 43 UC I a- 04 14 Q) ’I 4 -4a-Q 23z Let R1 be the real line, the borel field on R 1 and P,

Advanced Inverter Technology.

DTIC Science & Technology

1985-10-01

is no longer employed by your organization , please notify AFWAL/POOC, W-PAFB, OH 45433-6563 to help us maintain a current mailing list. Copies of...2b. OECLASSIFICATION/OOWNGRAOING SCHEDULE Distribution unlimited. 4. PERFORMING ORGANIZATION REPORT NUMBER(S) 5. MONITORING ORGANIZATION REPORT NUMBER...S) MCR-85-613 AFWAL-TR-85-2065 G& NAME OF PERFORMING ORGANIZATION b. OFFICE SYMBOL 7. NAME OF MONITORING ORGANIZATIONr(If apptlcablej Martin Marietta

Inverted Signature Trees and Text Searching on CD-ROMs.

ERIC Educational Resources Information Center

Cooper, Lorraine K. D.; Tharp, Alan L.

1989-01-01

Explores the new storage technology of optical data disks and introduces a data structure, the inverted signature tree, for storing data on optical data disks for efficient text searching. The inverted signature tree approach is compared to the use of text signatures and the B+ tree. (22 references) (Author/CLB)

Granzyme B of cytotoxic T cells induces extramitochondrial reactive oxygen species production via caspase-dependent NADPH oxidase activation.

PubMed

Aguiló, Juan I; Anel, Alberto; Catalán, Elena; Sebastián, Alvaro; Acín-Pérez, Rebeca; Naval, Javier; Wallich, Reinhard; Simon, Markus M; Pardo, Julián

2010-07-01

Induction of reactive oxygen species (ROS) is a hallmark of granzyme B (gzmB)-mediated pro-apoptotic processes and target cell death. However, it is unclear to what extent the generated ROS derive from mitochondrial and/or extra-mitochondrial sources. To clarify this point, we have produced a mutant EL4 cell line, termed EL4-rho(0), which lacks mitochondrial DNA, associated with a decreased mitochondrial membrane potential and a defective ROS production through the electron transport chain of oxidative phosphorylation. When incubated with either recombinant gzmB plus streptolysin or ex vivo gzmB(+) cytotoxic T cells, EL4-rho(0) cells showed phosphatydylserine translocation, caspase 3 activation, Bak conformational change, cytochrome c release and apoptotic morphology comparable to EL4 cells. Moreover, EL4-rho(0) cells produced ROS at levels similar to EL4 under these conditions. GzmB-mediated ROS production was almost totally abolished in both cell lines by the pan-caspase inhibitor, Z-VAD-fmk. However, addition of apocynin, a specific inhibitor of nicotinamide adenine dinucleotide phosphate (NADPH) oxidases, led to a significant reduction of ROS production and cell death only in EL4-rho(0) but not EL4 cells. These data suggest that gzmB-induced cell death is accompanied by a caspase-dependent pathway of extra-mitochondrial ROS production, most probably through activation of NADPH oxidase.

Spatial Identification of Passive Radio Frequency Identification Tags Using Software Defined Radios

DTIC Science & Technology

2012-03-01

75 3.4 Experiment Configurations . . . . . . . . . . . . . . . . . . . . 77 4.1 Simulation Enviromental Elements . . . . . . . . . . . . . . . . 79...tabletop zReader 20cm Tag vertical offset from reader z 10 cm 3dB angle of sensor antenna theat3db 0.698 radians Table 4.1: Simulation Enviromental

Manufacturing Methods and Technology. Project Execution Report.

DTIC Science & Technology

1984-05-01

U5/62"/3. 20 "°"’°’. . .. - 2 °* ’%7’. 471 FINAL STATUS REPORTS RLCEIVtD vURINU 2Nv HALF, CY6- . ( LLNT I NUE O) - o aD ’ 281 LUNSLRVATiUi4 bF tNERGY AT...KO IA w. hJO 0. xV W-2 -C -a aZ. 0 0 0 m C9 - I 0 MO m4a. W 19 6u Z ) -- 03. zWI 2 M 3 U- P- OCw 43 3B *u. 00 CKa I.-hAV . 40 2- w cc . U6 U- *~- -02

Foundations for Protecting Renewable-Rich Distribution Systems.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ellis, Abraham; Brahma, Sukumar; Ranade, Satish

High proliferation of Inverter Interfaced Distributed Energy Resources (IIDERs) into the electric distribution grid introduces new challenges to protection of such systems. This is because the existing protection systems are designed with two assumptions: 1) system is single-sourced, resulting in unidirectional fault current, and (2) fault currents are easily detectable due to much higher magnitudes compared to load currents. Due to the fact that most renewables interface with the grid though inverters, and inverters restrict their current output to levels close to the full load currents, both these assumptions are no longer valid - the system becomes multi-sourced, and overcurrent-basedmore » protection does not work. The primary scope of this study is to analyze the response of a grid-tied inverter to different faults in the grid, leading to new guidelines on protecting renewable-rich distribution systems.« less

UV-CONTINUUM SLOPES AT z {approx} 4-7 FROM THE HUDF09+ERS+CANDELS OBSERVATIONS: DISCOVERY OF A WELL-DEFINED UV COLOR-MAGNITUDE RELATIONSHIP FOR z {>=} 4 STAR-FORMING GALAXIES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouwens, R. J.; Franx, M.; Labbe, I.

2012-08-01

Ultra-deep Advanced Camera for Surveys (ACS) and WFC3/IR HUDF+HUDF09 data, along with the wide-area GOODS+ERS+CANDELS data over the CDF-S GOODS field, are used to measure UV colors, expressed as the UV-continuum slope {beta}, of star-forming galaxies over a wide range of luminosity (0.1L*{sub z=3} to 2L*{sub z=3}) at high redshift (z {approx} 7 to z {approx} 4). {beta} is measured using all ACS and WFC3/IR passbands uncontaminated by Ly{alpha} and spectral breaks. Extensive tests show that our {beta} measurements are only subject to minimal biases. Using a different selection procedure, Dunlop et al. recently found large biases in their {beta}more » measurements. To reconcile these different results, we simulated both approaches and found that {beta} measurements for faint sources are subject to large biases if the same passbands are used both to select the sources and to measure {beta}. High-redshift galaxies show a well-defined rest-frame UV color-magnitude (CM) relationship that becomes systematically bluer toward fainter UV luminosities. No evolution is seen in the slope of the UV CM relationship in the first 1.5 Gyr, though there is a small evolution in the zero point to redder colors from z {approx} 7 to z {approx} 4. This suggests that galaxies are evolving along a well-defined sequence in the L{sub UV}-color ({beta}) plane (a 'star-forming sequence'?). Dust appears to be the principal factor driving changes in the UV color {beta} with luminosity. These new larger {beta} samples lead to improved dust extinction estimates at z {approx} 4-7 and confirm that the extinction is essentially zero at low luminosities and high redshifts. Inclusion of the new dust extinction results leads to (1) excellent agreement between the star formation rate (SFR) density at z {approx} 4-8 and that inferred from the stellar mass density; and (2) to higher specific star formation rates (SSFRs) at z {approx}> 4, suggesting that the SSFR may evolve modestly (by factors of {approx}2) from z {approx} 4-7 to z {approx} 2.« less

Tracing Large-Scale Structure with Radio Sources

NASA Astrophysics Data System (ADS)

Lindsay, S. N.

2015-02-01

In this thesis, I investigate the spatial distribution of radio sources, and quantify their clustering strength over a range of redshifts, up to z _ 2:2, using various forms of the correlation function measured with data from several multi-wavelength surveys. I present the optical spectra of 30 radio AGN (S1:4 > 100 mJy) in the GAMA/H-ATLAS fields, for which emission line redshifts could be deduced, from observations of 79 target sources with the EFOSC2 spectrograph on the NTT. The mean redshift of these sources is z = 1:2; 12 were identified as quasars (40 per cent), and 6 redshifts (out of 24 targets) were found for AGN hosts to multiple radio components. While obtaining spectra for hosts of these multi-component sources is possible, their lower success rate highlights the difficulty in acheiving a redshift-complete radio sample. Taking an existing spectroscopic redshift survey (GAMA) and radio sources from the FIRST survey (S1:4 > 1 mJy), I then present a cross-matched radio sample with 1,635 spectroscopic redshifts with a median value of z = 0:34. The spatial correlation function of this sample is used to find the redshiftspace (s0) and real-space correlation lengths (r0 _ 8:2 h Mpc), and a mass bias of _1.9. Insight into the redshift-dependence of these quantities is gained by using the angular correlation function and Limber inversion to measure the same spatial clustering parameters. Photometric redshifts! from SDSS/UKIDSS are incorporated to produce a larger matched radio sample at z ' 0:48 (and low- and high-redshift subsamples at z ' 0:30 and z ' 0:65), while their redshift distribution is subtracted from that taken from the SKADS radio simulations to estimate the redshift distribution of the remaining unmatched sources (z ' 1:55). The observed bias evolution over this redshift range is compared with model predictions based on the SKADS simulations, with good agreement at low redshift. The bias found at high redshift significantly exceeds these predictions, however, suggesting a more massive population of galaxies than expected, either due to the relative proportions of different radio sources, or a greater typical halo mass for the high-redshift sources. Finally, the reliance on a model redshift distribution to reach to higher redshifts is removed, as the angular cross-correlation function is used with deep VLA data (S1:4 > 90 _Jy) and optical/IR data from VIDEO/CFHTLS (Ks < 23:5) over 1 square degree. With high-quality photometric redshifts up to z _ 4, and a high signal-to-noise clustering measurement (due to the _100,000 Ks-selected galaxies), I am able to find the bias of a matched sample of only 766 radio sources (as well as of v vi the VIDEO sources), divided into 4 redshift bins reaching a median bias at z ' 2:15. Again, at high redshift, the measured bias appears to exceed the prediction made from the SKADS simulations. Applying luminosity cuts to the radio sample at L > 1023 WHz and higher (removing any non-AGN sources), I find a bias of 8-10 at z _ 1:5, considerably higher than for the full sample, and consistent with the more numerous FRI AGN having similar mass to the FRIIs (M _ 10^14 M_), contrary to the assumptions made in the SKADS simulations. Applying this adjustment to the model bias produces a better fit to the observations for the FIRST radio sources cross-matched with GAMA/SDSS/UKIDSS, as well as for the high-redshift radio sources in VIDEO. Therefore, I have shown that we require a more robust model of the evolution of AGN, and their relation to the underlying dark matter distribution. In particular, understanding these quantities for the abundant FRI population is crucial if we are to use such sources to probe the cosmological model as has been suggested by a number of authors (e.g. Raccanelli et al., 2012; Camera et al., 2012; Ferramacho et al., 2014).

Observation of Z decays to four leptons with the CMS detector at the LHC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatrchyan, S.; Khachatryan, V.; Sirunyan, A. M.

The first observation of the Z boson decaying to four leptons in proton-proton collisions is presented. The analyzed data set corresponds to an integrated luminosity of 5.02 inverse femtobarns at sqrt(s) = 7 TeV collected by the CMS detector at the Large Hadron Collider. A pronounced resonance peak, with a statistical significance of 9.7 sigma, is observed in the distribution of the invariant mass of four leptons (electrons and/or muons) with mass and width consistent with expectations for Z boson decays. The branching fraction and cross section reported here are defined by phase space restrictions on the leptons, namely, 80more » < m[4l] < 100 GeV, where m[4l] is the invariant mass of the four leptons, and m[ll] > 4 GeV for all pairs of leptons, where m[ll] is the two-lepton invariant mass. The measured branching fraction is B(Z to 4l) = (4.2 /+0.9/-0.8 (stat.) +/- 0.2 (syst.)) 10E-6 and agrees with the standard model prediction of 4.45 10E-6. The measured cross section times branching fraction is sigma(pp to Z) B(Z to 4 l) = 112 +23/-20 (stat.) +7/-5 (syst.) +3/-2 (lumi.) fb, also consistent with the standard model prediction of 120 fb. The four-lepton mass peak arising from Z to 4 l decays provides a calibration channel for the Higgs boson search in the H to ZZ to 4 l decay mode.« less

An inverter/controller subsystem optimized for photovoltaic applications

NASA Technical Reports Server (NTRS)

Pickrell, R. L.; Osullivan, G.; Merrill, W. C.

1978-01-01

Conversion of solar array dc power to ac power stimulated the specification, design, and simulation testing of an inverter/controller subsystem tailored to the photovoltaic power source characteristics. Optimization of the inverter/controller design is discussed as part of an overall photovoltaic power system designed for maximum energy extraction from the solar array. The special design requirements for the inverter/ controller include: a power system controller (PSC) to control continuously the solar array operating point at the maximum power level based on variable solar insolation and cell temperatures; and an inverter designed for high efficiency at rated load and low losses at light loadings to conserve energy.

Cyclic catalytic upgrading of chemical species using metal oxide materials

NASA Technical Reports Server (NTRS)

White, James H. (Inventor); Schutte, Erick J. (Inventor); Rolfe, Sara L. (Inventor)

2010-01-01

Processes are disclosure which comprise alternately contacting an oxygen-carrying catalyst with a reducing substance, or a lower partial pressure of an oxidizing gas, and then with the oxidizing gas or a higher partial pressure of the oxidizing gas, whereby the catalyst is alternately reduced and then regenerated to an oxygenated state. In certain embodiments, the oxygen-carrying catalyst comprises at least one metal oxide-containing material containing a composition having one of the following formulas: (a) Ce.sub.xB.sub.yB'.sub.zB''O.sub..delta., wherein B=Ba, Sr, Ca, or Zr; B'=Mn, Co, or Fe; B''=Cu; 0.01

Cyclic catalytic upgrading of chemical species using metal oxide materials

DOEpatents

White, James H.; Schutte, Erick J.; Rolfe, Sara L.

2010-11-02

Processes are disclosure which comprise alternately contacting an oxygen-carrying catalyst with a reducing substance, or a lower partial pressure of an oxidizing gas, and then with the oxidizing gas or a higher partial pressure of the oxidizing gas, whereby the catalyst is alternately reduced and then regenerated to an oxygenated state. In certain embodiments, the oxygen-carrying catalyst comprises at least one metal oxide-containing material containing a composition having one of the following formulas: (a) Ce.sub.xB.sub.yB'.sub.zB''O.sub..delta., wherein B=Ba, Sr, Ca, or Zr; B'=Mn, Co, or Fe; B''=Cu; 0.01

Synthesis and biological evaluation of vinylogous combretastatin A-4 derivatives.

PubMed

Kaffy, Julia; Pontikis, Renée; Florent, Jean-Claude; Monneret, Claude

2005-07-21

Stereospecific syntheses of the Z-E and E-Z vinylogues of combretastatin A-4, and two B-ring related analogues, were achieved through a Suzuki-Miyaura coupling. As compared to CA4, the derivative with a phenyl moiety has shown increased potency in its ability to inhibit tubulin polymerisation.

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

PubMed Central

Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

1998-01-01

A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and acquired human diseases affecting cells of erythroid lineage. PMID:9573295

Synchrotron Photoionization Study of Furan and 2-Methylfuran Reactions with Methylidyne Radical (CH) at 298 K.

PubMed

Carrasco, Erica; Smith, Kenneth J; Meloni, Giovanni

2018-01-11

The reactions of furan and 2-methylfuran with methylidyne CH (X 2 Π) radical were investigated at 298 K using synchrotron radiation produced at the Advanced Light Source of the Lawrence Berkeley National Laboratory. Reaction products were observed by multiplexed photoionization mass spectrometry and characterized based on their photoionization spectra and kinetic time traces. Primary products observed in furan + CH are 2,4-cyclopentadien-1-one (m/z = 80), 2-penten-4-ynal (m/z = 80), and vinylacetylene (m/z = 52). From 2-methylfuran + CH, 2-4-cyclopentadien-1-carbaldehyde (m/z = 94), 2,3,4-hexatrienal (m/z = 94), 1,3 cyclopentadiene (m/z = 66), 3-penten-1-yne (Z) (m/z = 66), and vinylacetylene (m/z = 52) are the primary products observed. Using potential energy surface scans, thermodynamically favorable reaction pathways are proposed. CH addition to the π-bonds in furan and 2-methylfuran rings was found to be the entrance channel that led to formation of all identified primary products. Both reactions follow patterns of H loss and CHO loss, as well as formation of cyclic and acyclic isomers.

Emission line galaxies at high redshift and analogs of the sources of cosmic reionization

NASA Astrophysics Data System (ADS)

Schaerer, D.

2017-11-01

We present recent work on emission line galaxies at high redshift and searches for analogs of the sources of cosmic reionization at low redshift. The VIMOS Ultra-Deep Survey (VUDS) carried out at the VLT has assembled more than 7000 spectra of galaxies from z 1.5 to 6 allowing us to address a wide diversity of questions with statistically meaningful samples. From VUDS we have recently identified a sample of CIII] and CIV] emitters at z 2-4 whose properties we present and discuss here (cf. Nakajima et al. 2017; Le Fevre et al. 2017). These objects provide interesting insight into the C/O ratio at high-z, the nature and hardness of their ionizing source, the ionizing photon production, and others. Targeting compact strong emission line galaxies with high [OIII]/[OII] ratios with the COS spectrograph on-board HST, we have recently been able to find several relatively strong Lyman continuum emitters at z 0.3 (Izotov et al. 2016ab). We describe the physical properties of these unique, rare low-z sources, which are found to be comparable to those of typical z>6 galaxies and thus currently the best analogs for the sources of cosmic reionization (cf. Schaerer et al. 2016). We also briefly discuss open questions and future steps.

Investigation of Extensions to the Distorted Born Approximation in Strong Fluctuation Theory

DTIC Science & Technology

1988-10-01

9316I * where D = 3/4[bop+b# J+ l/4b;) D = 1/4[ bpp +bo | (35)n12 b -bo( I D 13 =l/ 2 [Cppzz +C4zzI n Here -1 0~ o , bus(z,z)= (271) u I dl )acs (zl) am...that FXW = 1- 2X + 32. + 1 2(X) = 2 - 23 + + ... (-5 F (X) = 2 3 3 42 3 ’ + VX +.. D5 F3 (X) = 2/X + 3 gn X + ... Using (D-4) and (D-5) as guides for...showed that the rational approximations to Fir F2, F3 have maximum errors of .06%, .03%, and .06%, respectively. The integrals in (C-5) are completely

Numerical Electromagnetic Code (NEC)-Basic Scattering Code. Part 2. Code Manual

DTIC Science & Technology

1979-09-01

imaging of source axes for magnetic source. Ax R VSOURC(1,1) + 9 VSOURC(1,2) + T VSOURC(1,3) 4pi = x VIMAG(I,1) + ^ VINAG (1,2)+ VIMAG(l,3) An =unit...VNC A. yt and z components of the end cap unit normal OUTPUT VARIABLE VINAG X.. Y, and z components defining thesource image coordinate system axesin

The transposon Galileo generates natural chromosomal inversions in Drosophila by ectopic recombination.

PubMed

Delprat, Alejandra; Negre, Bàrbara; Puig, Marta; Ruiz, Alfredo

2009-11-18

Transposable elements (TEs) are responsible for the generation of chromosomal inversions in several groups of organisms. However, in Drosophila and other Dipterans, where inversions are abundant both as intraspecific polymorphisms and interspecific fixed differences, the evidence for a role of TEs is scarce. Previous work revealed that the transposon Galileo was involved in the generation of two polymorphic inversions of Drosophila buzzatii. To assess the impact of TEs in Drosophila chromosomal evolution and shed light on the mechanism involved, we isolated and sequenced the two breakpoints of another widespread polymorphic inversion from D. buzzatii, 2z(3). In the non inverted chromosome, the 2z(3) distal breakpoint was located between genes CG2046 and CG10326 whereas the proximal breakpoint lies between two novel genes that we have named Dlh and Mdp. In the inverted chromosome, the analysis of the breakpoint sequences revealed relatively large insertions (2,870-bp and 4,786-bp long) including two copies of the transposon Galileo (subfamily Newton), one at each breakpoint, plus several other TEs. The two Galileo copies: (i) are inserted in opposite orientation; (ii) present exchanged target site duplications; and (iii) are both chimeric. Our observations provide the best evidence gathered so far for the role of TEs in the generation of Drosophila inversions. In addition, they show unequivocally that ectopic recombination is the causative mechanism. The fact that the three polymorphic D. buzzatii inversions investigated so far were generated by the same transposon family is remarkable and is conceivably due to Galileo's unusual structure and current (or recent) transpositional activity.

Neutrino mass model with S3 symmetry and seesaw interplay

NASA Astrophysics Data System (ADS)

Pramanick, Soumita; Raychaudhuri, Amitava

2016-12-01

We develop a seesaw model for neutrino masses and mixing with an S3×Z3 symmetry. It involves an interplay of type-I and type-II seesaw contributions of which the former is subdominant. The S3×Z3 quantum numbers of the fermion and scalar fields are chosen such that the type-II seesaw generates a mass matrix which incorporates the atmospheric mass splitting and sets θ23=π /4 . The solar splitting and θ13 are absent, while the third mixing angle can achieve any value, θ120. Specific choices of θ120 are of interest, e.g., 35.3° (tribimaximal), 45.0° (bimaximal), 31.7° (golden ratio), and 0° (no solar mixing). The role of the type-I seesaw is to nudge all the above into the range indicated by the data. The model results in novel interrelationships between these quantities due to their common origin, making it readily falsifiable. For example, normal (inverted) ordering is associated with θ23 in the first (second) octant. C P violation is controlled by phases in the right-handed neutrino Majorana mass matrix, Mν R . In their absence, only normal ordering is admissible. When Mν R is complex, the Dirac C P phase, δ , can be large, i.e., ˜±π /2 , and inverted ordering is also allowed. The preliminary results from T2K and NOVA which favor normal ordering and δ ˜-π /2 are indicative, in this model, of a lightest neutrino mass of 0.05 eV or more.

Word Criticality Analysis. MOS: 31N. Skill Levels 1 & 2.

DTIC Science & Technology

1981-09-01

GOVT ACCESSION NO. 3. RECIPIENT’S CATALOG NUMBER 4. TITLE (and Subitle) S. TYPE OF REPOH’ A PERIOD COVERED Word Criticality Analysis FinalMos...1.459,4 Z-456,4 -I2 774- -- 2-1 ll - t-20,3 -2261 24l3 -O2?12-Z4u2i a TV; SS7 /To Z.229,1 Ii TYE- 2-239,1 123,1 2.26,6 2.28b,2 2-1641 2-220,1 2-166.1 1

SL-7 Extreme Stress Data Collection and Reduction.

DTIC Science & Technology

1981-06-01

w c- o b - C.I I’S ~ ~ ~ ~ I’ ’I, , W0 z II 4i4 00 I.cc ’Sc 4 Z Z IZ O * 3 I 3~ 1 t £ 3 I MS 9 4 V CONTENTS Page I. BACKGROUND 1 II. FUNCTIONAL...SL-7-5, (SSC-257) - S-7 Ins: rumen tati-on Th’ooran Background! and Fesearoh Plan by W. J. Siekierka, R. A. Johnson, and CDR C. S. Loosmore, USCG

Generation of a pseudo-2D shear-wave velocity section by inversion of a series of 1D dispersion curves

USGS Publications Warehouse

Luo, Y.; Xia, J.; Liu, J.; Xu, Y.; Liu, Q.

2008-01-01

Multichannel Analysis of Surface Waves utilizes a multichannel recording system to estimate near-surface shear (S)-wave velocities from high-frequency Rayleigh waves. A pseudo-2D S-wave velocity (vS) section is constructed by aligning 1D models at the midpoint of each receiver spread and using a spatial interpolation scheme. The horizontal resolution of the section is therefore most influenced by the receiver spread length and the source interval. The receiver spread length sets the theoretical lower limit and any vS structure with its lateral dimension smaller than this length will not be properly resolved in the final vS section. A source interval smaller than the spread length will not improve the horizontal resolution because spatial smearing has already been introduced by the receiver spread. In this paper, we first analyze the horizontal resolution of a pair of synthetic traces. Resolution analysis shows that (1) a pair of traces with a smaller receiver spacing achieves higher horizontal resolution of inverted S-wave velocities but results in a larger relative error; (2) the relative error of the phase velocity at a high frequency is smaller than at a low frequency; and (3) a relative error of the inverted S-wave velocity is affected by the signal-to-noise ratio of data. These results provide us with a guideline to balance the trade-off between receiver spacing (horizontal resolution) and accuracy of the inverted S-wave velocity. We then present a scheme to generate a pseudo-2D S-wave velocity section with high horizontal resolution using multichannel records by inverting high-frequency surface-wave dispersion curves calculated through cross-correlation combined with a phase-shift scanning method. This method chooses only a pair of consecutive traces within a shot gather to calculate a dispersion curve. We finally invert surface-wave dispersion curves of synthetic and real-world data. Inversion results of both synthetic and real-world data demonstrate that inverting high-frequency surface-wave dispersion curves - by a pair of traces through cross-correlation with phase-shift scanning method and with the damped least-square method and the singular-value decomposition technique - can feasibly achieve a reliable pseudo-2D S-wave velocity section with relatively high horizontal resolution. ?? 2008 Elsevier B.V. All rights reserved.

Activity levels of tamoxifen metabolites at the estrogen receptor and the impact of genetic polymorphisms of phase I and II enzymes on their concentration levels in plasma.

PubMed

Mürdter, T E; Schroth, W; Bacchus-Gerybadze, L; Winter, S; Heinkele, G; Simon, W; Fasching, P A; Fehm, T; Eichelbaum, M; Schwab, M; Brauch, H

2011-05-01

The therapeutic effect of tamoxifen depends on active metabolites, e.g., cytochrome P450 2D6 (CYP2D6) mediated formation of endoxifen. To test for additional relationships, 236 breast cancer patients were genotyped for CYP2D6, CYP2C9, CYP2B6, CYP2C19, CYP3A5, UGT1A4, UGT2B7, and UGT2B15; also, plasma concentrations of tamoxifen and 22 of its metabolites, including the (E)-, (Z)-, 3-, and 4'-hydroxymetabolites as well as their glucuronides, were quantified using liquid chromatography-tandem mass spectrometry (MS). The activity levels of the metabolites were measured using an estrogen response element reporter assay; the strongest estrogen receptor inhibition was found for (Z)-endoxifen and (Z)-4-hydroxytamoxifen (inhibitory concentration 50 (IC50) 3 and 7 nmol/l, respectively). CYP2D6 genotypes explained 39 and 9% of the variability of steady-state concentrations of (Z)-endoxifen and (Z)-4-hydroxytamoxifen, respectively. Among the poor metabolizers, 93% had (Z)-endoxifen levels below IC90 values, underscoring the role of CYP2D6 deficiency in compromised tamoxifen bioactivation. For other enzymes tested, carriers of reduced-function CYP2C9 (*2, *3) alleles had lower plasma concentrations of active metabolites (P < 0.004), pointing to the role of additional pathways.

Preparation and Single-Crystal X-Ray Structures of Four Related Mixed-Ligand 4-Methylpyridine Indium Halide Complexes

NASA Technical Reports Server (NTRS)

Hepp, Aloysius F.; Clark, Eric B.; Schupp, John D.; Williams, Jennifer N.; Duraj, Stan A.; Fanwick, Philip E.

2013-01-01

We describe the structures of four related indium complexes obtained during synthesis of solid-state materials precursors. Indium adducts of halides and 4-methylpyridine, InX3(pic)3 (X = Cl, Br; pic = 4-methylpyridine) consist of octahedral molecules with meridional (mer) geometry. Crystals of mer-InCl3(pic)3 (1) are triclinic, space group P1(bar) (No. 2), with a = 9.3240(3), b = 13.9580(6), c = 16.7268 (7) A, alpha = 84.323(2), beta = 80.938(2), gamma = 78.274(3)Z = 4, R = 0.035 for 8820 unique reflections. Crystals of mer-InBr3(pic)3 (2) are monoclinic, space group P21/n (No. 14), with a = 15.010(2), b = 19.938(2), c = 16.593(3), beta = 116.44(1)Z = 8, R = 0.053 for 4174 unique reflections. The synthesis and structures of related compounds with phenylsulfide (chloride) (3) and a dimeric complex with bridging hydroxide (bromide) (4) coordination is also described. Crystals of trans-In(SC6H5)Cl2(pic)3 (3) are monoclinic, space group P21/n (No. 14), with a = 9.5265(2), b = 17.8729(6), c = 13.8296(4), beta = 99.7640(15)Z = 4, R = 0.048 for 5511 unique reflections. Crystals of [In(mu-OH)Br2(pic)22 (4) are tetragonal, space group = I41cd (No. 110) with a = 19.8560(4), b = 19.8560(4), c = 25.9528(6), Z = 8, R = 0.039 for 5982 unique reflections.

Expression of characteristics of ammonium nutrition as affected by pH of the root medium

NASA Technical Reports Server (NTRS)

Chaillou, S.; Vessey, J. K.; Morot-Gaudry, J. F.; Raper, C. D. Jr; Henry, L. T.; Boutin, J. P.

1991-01-01

To study the effect of root-zone pH on characteristic responses of NH4+ -fed plants, soybeans (Glycine max inverted question markL. inverted question mark Merr. cv. Ransom) were grown in flowing solution culture for 21 d on four sources of N (1.0 mol m-3 NO3-, 0.67 mol m-3 NO3- plus 0.33 mol m-3 NH4+, 0.33 mol m-3 NO3- plus 0.67 mol m-3 NH4+, and 1.0 mol m-3 NH4+) with nutrient solutions maintained at pH 6.0, 5.5, 5.0, and 4.5. Amino acid concentration increased in plants grown with NH4+ as the sole source of N at all pH levels. Total amino acid concentration in the roots of NH4+ -fed plants was 8 to 10 times higher than in NO3(-)-fed plants, with asparagine accounting for more than 70% of the total in the roots of these plants. The concentration of soluble carbohydrates in the leaves of NH4+ -fed plants was greater than that of NO3(-)-fed plants, but was lower in roots of NH4+ -fed plants, regardless of pH. Starch concentration was only slightly affected by N source or root-zone pH. At all levels of pH tested, organic acid concentration in leaves was much lower when NH4+ was the sole N source than when all or part of the N was supplied as NO3-. Plants grown with mixed NO3- plus NH4+ N sources were generally intermediate between NO3(-)- and NH4+ -fed plants. Thus, changes in tissue composition characteristic of NH4+ nutrition when root-zone pH was maintained at 4.5 and growth was reduced, still occurred when pH was maintained at 5.0 or above, where growth was not affected. The changes were slightly greater at pH 4.5 than at higher pH levels.

Enhance field water-color measurements with a Secchi disk and its implication for fusion of active and passive ocean-color remote sensing.

PubMed

Lee, Zhongping; Shang, Shaoling; Du, Keping; Liu, Bingyi; Lin, Gong; Wei, Jianwei; Li, Xiaolong

2018-05-01

Inversion of the total absorption (a) and backscattering coefficients of bulk water through a fusion of remote sensing reflectance (R rs ) and Secchi disk depth (Z SD ) is developed. An application of such a system to a synthesized wide-range dataset shows a reduction of ∼3 folds in the uncertainties of inverted a(λ) (in a range of ∼0.01-6.8  m -1 ) from R rs (λ) for the 350-560 nm range. Such a fusion is further proposed to process concurrent active (ocean LiDAR) and passive (ocean-color) measurements, which can lead to nearly "exact" analytical inversion of an R rs spectrum. With such a fusion, it is found that the uncertainty in the inverted total a in the 350-560 nm range could be reduced to ∼2% for the synthesized data, which can thus significantly improve the derivation of a coefficients of other varying components. Although the inclusion of Z SD places an extra constraint in the inversion of R rs , no apparent improvement over the quasi-analytical algorithm (QAA) was found when the fusion of Z SD and R rs was applied to a field dataset, which calls for more accurate determination of the absorption coefficients from water samples.

The Evolution of Ly-alpha Emitting Galaxies Between z = 2.1 and z = 3.l

NASA Technical Reports Server (NTRS)

Ciardullo, Robin; Gronwall,Caryl; Wolf, Christopher; McCathran, Emily; Bond, Nicholas A.; Gawiser, Eric; Guaita, Lucia; Feldmeier, John J.; Treister, Ezequiel; Padilla, Nelson;

Fatty Acid and Proximate Composition of Bee Bread.

PubMed

Kaplan, Muammer; Karaoglu, Öznur; Eroglu, Nazife; Silici, Sibel

2016-12-01

Palynological spectrum, proximate and fatty acid (FA) composition of eight bee bread samples of different botanical origins were examined and significant variations were observed. The samples were all identified as monofloral, namely Castanea sativa (94.4%), Trifolium spp. (85.6%), Gossypium hirsutum (66.2%), Citrus spp. (61.4%) and Helianthus annuus (45.4%). Each had moisture content between 11.4 and 15.9%, ash between 1.9 and 2.54%, fat between 5.9 and 11.5%, and protein between 14.8 and 24.3%. A total of 37 FAs were determined with most abundant being (9Z,12Z,15Z)-octadeca-9,12,15-trienoic, (9Z,12Z)- -octadeca-9,12-dienoic, hexadecanoic, (Z)-octadec-9-enoic, (Z)-icos-11-enoic and octadecanoic acids. Among all, cotton bee bread contained the highest level of ω-3 FAs, i.e. 41.3%. Unsaturated to saturated FA ratio ranged between 1.38 and 2.39, indicating that the bee bread can be a good source of unsaturated FAs.

Fatty Acid and Proximate Composition of Bee Bread

PubMed Central

Kaplan, Muammer; Karaoglu, Öznur; Eroglu, Nazife

2016-01-01

Summary Palynological spectrum, proximate and fatty acid (FA) composition of eight bee bread samples of different botanical origins were examined and significant variations were observed. The samples were all identified as monofloral, namely Castanea sativa (94.4%), Trifolium spp. (85.6%), Gossypium hirsutum (66.2%), Citrus spp. (61.4%) and Helianthus annuus (45.4%). Each had moisture content between 11.4 and 15.9%, ash between 1.9 and 2.54%, fat between 5.9 and 11.5%, and protein between 14.8 and 24.3%. A total of 37 FAs were determined with most abundant being (9Z,12Z,15Z)-octadeca-9,12,15-trienoic, (9Z,12Z)- -octadeca-9,12-dienoic, hexadecanoic, (Z)-octadec-9-enoic, (Z)-icos-11-enoic and octadecanoic acids. Among all, cotton bee bread contained the highest level of ω-3 FAs, i.e. 41.3%. Unsaturated to saturated FA ratio ranged between 1.38 and 2.39, indicating that the bee bread can be a good source of unsaturated FAs. PMID:28115909

A New Estimator of the Deceleration Parameter from Galaxy Rotation Curves

NASA Astrophysics Data System (ADS)

van Putten, Maurice H. P. M.

2016-06-01

The nature of dark energy can be probed by the derivative Q={{dq}(z)/{dz}| }0 at redshift z = 0 of the deceleration parameter q(z). It is probably static if Q\\lt 1 or dynamic if Q\\gt 2.5, supporting ΛCDM or {{Λ }}=(1-q){H}2, respectively, where H denotes the Hubble parameter. We derive q=1-{(4π {a}0/{cH})}2, enabling a determination of q(z) by measuring Milgrom’s parameter, {a}0(z), in galaxy rotation curves, equivalent to the coefficient A in the Tully-Fisher relation {V}c4={{AM}}b between a rotation velocity V c and a baryonic mass M b . We infer that dark matter should be extremely light, with clustering limited to the size of galaxy clusters. The associated transition radius to non-Newtonian gravity can conceivably be probed in a freefall Cavendish-type experiment in space.

Ground Fault Overvoltage With Inverter-Interfaced Distributed Energy Resources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ropp, Michael; Hoke, Anderson; Chakraborty, Sudipta

Ground Fault Overvoltage can occur in situations in which a four-wire distribution circuit is energized by an ungrounded voltage source during a single phase to ground fault. The phenomenon is well-documented with ungrounded synchronous machines, but there is considerable discussion about whether inverters cause this phenomenon, and consequently whether inverters require effective grounding. This paper examines the overvoltages that can be supported by inverters during single phase to ground faults via theory, simulation and experiment, identifies the relevant physical mechanisms, quantifies expected levels of overvoltage, and makes recommendations for optimal mitigation.

Moment-Tensor Spectra of Source Physics Experiments (SPE) Explosions in Granite

NASA Astrophysics Data System (ADS)

Yang, X.; Cleveland, M.

2016-12-01

We perform frequency-domain moment tensor inversions of Source Physics Experiments (SPE) explosions conducted in granite during Phase I of the experiment. We test the sensitivity of source moment-tensor spectra to factors such as the velocity model, selected dataset and smoothing and damping parameters used in the inversion to constrain the error bound of inverted source spectra. Using source moments and corner frequencies measured from inverted source spectra of these explosions, we develop a new explosion P-wave source model that better describes observed source spectra of these small and over-buried chemical explosions detonated in granite than classical explosion source models derived mainly from nuclear-explosion data. In addition to source moment and corner frequency, we analyze other features in the source spectra to investigate their physical causes.

Probing the Metal Enrichment of the Intergalactic Medium at z = 5-6 Using the Hubble Space Telescope

NASA Astrophysics Data System (ADS)

Cai, Zheng; Fan, Xiaohui; Dave, Romeel; Finlator, Kristian; Oppenheimer, Ben

2017-11-01

We test the galactic outflow model by probing associated galaxies of four strong intergalactic C IV absorbers at z = 5-6 using the Hubble Space Telescope (HST) Advanced Camera for Surveys (ACS) ramp narrowband filters. The four strong C IV absorbers reside at z = 5.74, 5.52, 4.95, and 4.87, with column densities ranging from N C IV = 1013.8 to 1014.8 cm-2. At z = 5.74, we detect an I-dropout Lyα emitter (LAE) candidate with a projected impact parameter of 42 physical kpc from the C IV absorber. This LAE candidate has a Lyα-based star formation rate (SFRLyα ) of 2 M ⊙ yr-1 and a UV-based SFR of 4 M ⊙ yr-1. Although we cannot completely rule out that this I-dropout emitter may be an [O II] interloper, its measured properties are consistent with the C IV powered galaxy at z = 5.74. For C IV absorbers at z = 4.95 and z = 4.87, although we detect two LAE candidates with impact parameters of 160 and 200 kpc, such distances are larger than that predicted from the simulations. Therefore, we treat them as nondetections. For the system at z = 5.52, we do not detect LAE candidates, placing a 3σ upper limit of SFRLyα ≈ 1.5 M ⊙ yr-1. In summary, in these four cases, we only detect one plausible C IV source at z = 5.74. Combining the modest SFR of the one detection and the three nondetections, our HST observations strongly support that smaller galaxies (SFRLyα ≲ 2 M ⊙ yr-1) are main sources of intergalactic C IV absorbers, and such small galaxies play a major role in the metal enrichment of the intergalactic medium at z ≳ 5.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willner, S. P.; Ashby, M. L. N.; Huang, J.-S.

Infrared 3.6-8 {mu}m images of the Extended Groth Strip yield plausible counterpart identifications for all but one of 510 radio sources in the AEGIS20 S(1.4 GHz) > 50 {mu}Jy sample. This is the first such deep sample that has been effectively 100% identified. Achieving the same identification rate at R band would require observations reaching R{sub AB} > 27. Spectroscopic redshifts are available for 46% of the sample and photometric redshifts for an additional 47%. Almost all of the sources with 3.6 {mu}m AB magnitudes brighter than 19 have spectroscopic redshifts z < 1.1, while fainter objects predominantly have photometricmore » redshifts with 1 {approx}< z {approx}< 3. Unlike more powerful radio sources that are hosted by galaxies having large stellar masses within a relatively narrow range, the AEGIS20 counterparts have stellar masses spanning more than a factor of 10 at z {approx} 1. The sources are roughly 10%-15% starbursts at z {approx}< 0.5 and 20%-25% active galactic nuclei mostly at z > 1 with the remainder of uncertain nature.« less

Project ArchimedeZ

DTIC Science & Technology

2015-05-18

of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering...describe the proposed content of Project ArchimedeZ, 4 ) describe incentives that Project ArchimedeZ will give to Total Force Airmen to participate and...engaged, most of the time, in some sort of PME but at a manageable level. Rather than a three- hour block, for example, Project ArchimedeZ would deliver

Converter topologies for common mode voltage reduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez, Fernando

An inverter includes a three-winding transformer, a DC-AC inverter electrically coupled to the first winding of the transformer, a cycloconverter electrically coupled to the second winding of the transformer, and an active filter electrically coupled to the third winding of the transformer. The DC-AC inverter is adapted to convert the input DC waveform to an AC waveform delivered to the transformer at the first winding. The cycloconverter is adapted to convert an AC waveform received at the second winding of the transformer to the output AC waveform having a grid frequency of the AC grid. The active filter is adaptedmore » to sink and source power with one or more energy storage devices based on a mismatch in power between the DC source and the AC grid. At least two of the DC-AC inverter, the cycloconverter, or the active filter are electrically coupled via a common reference electrical interconnect.« less

Power inverter implementing phase skipping control

DOEpatents

Somani, Utsav; Amirahmadi, Ahmadreza; Jourdan, Charles; Batarseh, Issa

2016-10-18

A power inverter includes a DC/AC inverter having first, second and third phase circuitry coupled to receive power from a power source. A controller is coupled to a driver for each of the first, second and third phase circuitry (control input drivers). The controller includes an associated memory storing a phase skipping control algorithm, wherein the controller is coupled to receive updating information including a power level generated by the power source. The drivers are coupled to control inputs of the first, second and third phase circuitry, where the drivers are configured for receiving phase skipping control signals from the controller and outputting mode selection signals configured to dynamically select an operating mode for the DC/AC inverter from a Normal Control operation and a Phase Skipping Control operation which have different power injection patterns through the first, second and third phase circuitry depending upon the power level.

Production and characterization of a novel yeast extracellular invertase activity towards improved dibenzothiophene biodesulfurization.

PubMed

Arez, Bruno F; Alves, Luís; Paixão, Susana M

2014-11-01

The main goal of this work was the production and characterization of a novel invertase activity from Zygosaccharomyces bailii strain Talf1 for further application to biodesulfurization (BDS) in order to expand the exploitable alternative carbon sources to renewable sucrose-rich feedstock. The maximum invertase activity (163 U ml(-1)) was achieved after 7 days of Z. bailii strain Talf1 cultivation at pH 5.5-6.0, 25 °C, and 150 rpm in Yeast Malt Broth with 25 % Jerusalem artichoke pulp as inducer substrate. The optimum pH and temperature for the crude enzyme activity were 5.5 and 50 °C, respectively, and moreover, high stability was observed at 30 °C for pH 5.5-6.5. The application of Talf1 crude invertase extract (1 %) to a BDS process by Gordonia alkanivorans strain 1B at 30 °C and pH 7.5 was carried out through a simultaneous saccharification and fermentation (SSF) approach in which 10 g l(-1) sucrose and 250 μM dibenzothiophene were used as sole carbon and sulfur sources, respectively. Growth and desulfurization profiles were evaluated and compared with those of BDS without invertase addition. Despite its lower stability at pH 7.5 (loss of activity within 24 h), Talf1 invertase was able to catalyze the full hydrolysis of 10 g l(-1) sucrose in culture medium into invert sugar, contributing to a faster uptake of the monosaccharides by strain 1B during BDS. In SSF approach, the desulfurizing bacterium increased its μmax from 0.035 to 0.070 h(-1) and attained a 2-hydroxybiphenyl productivity of 5.80 μM/h in about 3 days instead of 7 days, corresponding to an improvement of 2.6-fold in relation to the productivity obtained in BDS process without invertase addition.

The distant red galaxy neighbour population of 1

NASA Astrophysics Data System (ADS)

Bornancini, C.; García Lambas, D.

We study the Distant Red Galaxy (DRG, J-Ks > 2.3) neighbour population of Quasi Stellar Objects (QSOs) selected from the Sloan Digital Sky Survey (SDSS) in the redshift range 1 < z < 2. We perform a similar analysis for optically obscured AGNs (i.e. with a limiting magnitude I > 24) detected in the mid-infrared (24 microns) with the Spitzer Space Telescope and a mean redshift z~2.2 in the Flamingos Extragalactic Survey (FLAMEX). We present results on the cross-correlation function of DRGs around QSOs and optically faint mid-infrared sources. The corresponding correlation length obtained for the QSO sample targets is r_0=5.4+/-1.6 Mpc. For the optically obscured galaxy sample we find r_0=8.9+/-1.4 Mpc. These results indicate that optically faint obscured sources are located in denser environment of evolved red galaxies compare to QSOs.

NEW EXTINCTION AND MASS ESTIMATES FROM OPTICAL PHOTOMETRY OF THE VERY LOW MASS BROWN DWARF COMPANION CT CHAMAELEONTIS B WITH THE MAGELLAN AO SYSTEM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Ya-Lin; Close, Laird M.; Males, Jared R.

We used the Magellan adaptive optics system and its VisAO CCD camera to image the young low mass brown dwarf companion CT Chamaeleontis B for the first time at visible wavelengths. We detect it at r', i', z', and Y{sub S}. With our new photometry and T {sub eff} ∼ 2500 K derived from the shape of its K-band spectrum, we find that CT Cha B has A{sub V} = 3.4 ± 1.1 mag, and a mass of 14-24 M{sub J} according to the DUSTY evolutionary tracks and its 1-5 Myr age. The overluminosity of our r' detection indicates thatmore » the companion has significant Hα emission and a mass accretion rate ∼6 × 10{sup –10} M {sub ☉} yr{sup –1}, similar to some substellar companions. Proper motion analysis shows that another point source within 2'' of CT Cha A is not physical. This paper demonstrates how visible wavelength adaptive optics photometry (r', i', z', Y{sub S}) allows for a better estimate of extinction, luminosity, and mass accretion rate of young substellar companions.« less

New Extinction and Mass Estimates from Optical Photometry of the Very Low Mass Brown Dwarf Companion CT Chamaeleontis B with the Magellan AO System

NASA Astrophysics Data System (ADS)

Wu, Ya-Lin; Close, Laird M.; Males, Jared R.; Barman, Travis S.; Morzinski, Katie M.; Follette, Katherine B.; Bailey, Vanessa; Rodigas, Timothy J.; Hinz, Philip; Puglisi, Alfio; Xompero, Marco; Briguglio, Runa

2015-03-01

We used the Magellan adaptive optics system and its VisAO CCD camera to image the young low mass brown dwarf companion CT Chamaeleontis B for the first time at visible wavelengths. We detect it at r', i', z', and YS . With our new photometry and T eff ~ 2500 K derived from the shape of its K-band spectrum, we find that CT Cha B has AV = 3.4 ± 1.1 mag, and a mass of 14-24 MJ according to the DUSTY evolutionary tracks and its 1-5 Myr age. The overluminosity of our r' detection indicates that the companion has significant Hα emission and a mass accretion rate ~6 × 10-10 M ⊙ yr-1, similar to some substellar companions. Proper motion analysis shows that another point source within 2'' of CT Cha A is not physical. This paper demonstrates how visible wavelength adaptive optics photometry (r', i', z', YS ) allows for a better estimate of extinction, luminosity, and mass accretion rate of young substellar companions. This paper includes data gathered with the 6.5 m Magellan Clay Telescope at Las Campanas Observatory, Chile.

NuSTAR observations of M31: globular cluster candidates found to be Z sources

NASA Astrophysics Data System (ADS)

Maccarone, Thomas J.; Yukita, Mihoko; Hornschemeier, Ann E.; Lehmer, Bret; Antoniou, Vallia; Ptak, Andrew; Wik, Daniel R.; Zezas, Andreas; Boyd, Patricia T.; Kennea, Jamie A.; Page, Kim; Eracleous, Michael; Williams, Benjamin F.; NuSTAR mission Team

2016-01-01

We present the results of Swift + NuSTAR observations of 4 bright globular cluster sources in M31. Three of these had previously been suggested to be black holes on the basis of their spectra. We show that all are well fit by models indicative of Z source natures for the sources. We also discuss some reasons why the long term light curves of these objects indicate that they are more likely to be neutron stars, and discuss the discrepancy between the empirical understanding of persistent sources and theoretical predictions.

Design and Implementation of 13 Levels Multilevel Inverter for Photovoltaic System

NASA Astrophysics Data System (ADS)

Subramani, C.; Dhineshkumar, K.; Palanivel, P.

2018-04-01

This paper approaches the appearing and modernization of S-Type PV based 13- level multilevel inverter with less quantity of switch. The current S-Type Multi level inverter contains more number of switches and voltage sources. Multilevel level inverter is a be understandable among the most gainful power converters for high power application and present day applications with reduced switches. The fundamental good arrangement of the 13-level multilevel inverter is to get ventured voltage from a couple of levels of DC voltages.. The controller gives actual way day and age to switches through driver circuit using PWM methodology. The execution assessment of proposed multilevel inverter is checked using MATLAB/Simulink. This is the outstanding among other techniquem appeared differently in relation to all other existing system

VHF Direction Finder (VDF) Operational Test and Evaluation (OT&E) integration and OT&E Operational Test Logs and Data

DTIC Science & Technology

1994-05-01

4. 2 + 30 1 120 K1. Dl f o’fZ. 5 $ Time 143 q Data___________ Plot.,- s A "’ke-., v CO Pi.ot -----.-.. n•_ ze g .,nL,.,khav ,.-VW ý61I;, 9- 0 ; $ 4...Saemario 0 5 . Two Airaraft. apraimately 45 minutes. D1Fre ; 12T. Z.-t._--__ Aircraft a1 iiuot-Mg A~uomy-ss 3nq1?O" lLock~v*otf time 2 13 9a Aircraft 02...1 a b ul a z %# U,’t YIV M" us~N b Ct u U, ý at nOt P SI am N% EA . 0 40 on N n -q P"I n n I - 44~~K 5 ~ - - N N mul 3 UA ’YM ly! oni - 4 b eq a

Controllable Threshold Voltage in Organic Complementary Logic Circuits with an Electron-Trapping Polymer and Photoactive Gate Dielectric Layer.

PubMed

Dao, Toan Thanh; Sakai, Heisuke; Nguyen, Hai Thanh; Ohkubo, Kei; Fukuzumi, Shunichi; Murata, Hideyuki

2016-07-20

We present controllable and reliable complementary organic transistor circuits on a PET substrate using a photoactive dielectric layer of 6-[4'-(N,N-diphenylamino)phenyl]-3-ethoxycarbonylcoumarin (DPA-CM) doped into poly(methyl methacrylate) (PMMA) and an electron-trapping layer of poly(perfluoroalkenyl vinyl ether) (Cytop). Cu was used for a source/drain electrode in both the p-channel and n-channel transistors. The threshold voltage of the transistors and the inverting voltage of the circuits were reversibly controlled over a wide range under a program voltage of less than 10 V and under UV light irradiation. At a program voltage of -2 V, the inverting voltage of the circuits was tuned to be at nearly half of the supply voltage of the circuit. Consequently, an excellent balance between the high and low noise margins (NM) was produced (64% of NMH and 68% of NML), resulting in maximum noise immunity. Furthermore, the programmed circuits showed high stability, such as a retention time of over 10(5) s for the inverter switching voltage. Our findings bring about a flexible, simple way to obtain robust, high-performance organic circuits using a controllable complementary transistor inverter.

The Munich Near-Infrared Cluster Survey - IX. Galaxy evolution to z ~ 2 from optically selected catalogues†‡

NASA Astrophysics Data System (ADS)

Feulner, Georg; Goranova, Yuliana; Hopp, Ulrich; Gabasch, Armin; Bender, Ralf; Botzler, Christine S.; Drory, Niv

2007-06-01

We present B-, R- and I-band-selected galaxy catalogues based on the Munich Near-Infrared Cluster Survey (MUNICS) which, together with the previously used K-selected sample, serve as an important probe of galaxy evolution in the redshift range 0 <~ z <~ 2. Furthermore, used in comparison they are ideally suited to study selection effects in extragalactic astronomy. The construction of the B-, R- and I-selected photometric catalogues, containing ~9000, ~9000 and ~6000 galaxies, respectively, is described in detail. The catalogues reach 50 per cent completeness limits for point sources of B ~= 24.5 mag, R ~= 23.5 mag and I ~= 22.5 mag and cover an area of about 0.3deg2. Photometric redshifts are derived for all galaxies with an accuracy of δz/(1 + z) ~= 0.057, very similar to the K-selected sample. Galaxy number counts in the B, V, R, I, J and K bands demonstrate the quality of the data set. The rest-frame colour distributions of galaxies at different selection bands and redshifts suggest that the most-massive galaxies have formed the bulk of their stellar population at earlier times and are essentially in place at redshift unity. We investigate the influence of selection band and environment on the specific star formation rate (SSFR). We find that K-band selection indeed comes close to selection in stellar mass, while B-band selection purely selects galaxies in SFR. We use a galaxy group catalogue constructed on the K-band-selected MUNICS sample to study possible differences of the SSFR between the field and the group environment, finding a marginally lower average SSFR in groups as compared to the field, especially at lower redshifts. The field-galaxy luminosity function in the B and R band as derived from the R-selected sample evolves out to z ~= 2 in the sense that the characteristic luminosity increases but the number density decreases. This effect is smaller at longer rest-frame wavelengths and gets more pronounced at shorter wavelengths. Parametrizing the redshift evolution of the Schechter parameters as M*(z) = M*(0) + aln(1 + z) and Φ*(z) = Φ*(0) (1 +z)b, we find evolutionary parameters a ~= -2.1 and b ~= -2.5 for the B band, and a ~= -1.4 and b ~= -1.8 for the R band. Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated by the Max-Planck-Institut für Astronomie, Heidelberg, jointly with the Spanish National Commission for Astronomy. Based on observations collected at the Very Large Telescope (Chile) operated by the European Southern Observatory in the course of the observing proposals 66.A-0123 and 66.A-0129. ‡ Based on observations obtained with the Hobby-Eberly Telescope, which is a joint project of the University of Texas at Austin, the Pennsylvania State University, Stanford University, Ludwig-Maximilians-Universität München, and Georg-August-Universität Göttingen. § E-mail: feulner@usm.uni-muenchen.de ¶ Current address: Leiden Observatory, P.O. Box 9513, NL-2300 RA Leiden, the Netherlands. ∥ Current address: European Southern Observatory, Karl-Schwarzschild Strasse 2, D-85748, Garching bei München, Germany.

Prime Contractors with Awards Over $25,000 by Name, Location, and Contract Number. Fiscal Year 1993. (1079 Construction Corp-Centre Manufacturing Co Inc.). Part 1

DTIC Science & Technology

1994-03-01

EZ 8 44 1- 1.. z 4L ZP u u 0 w Pa8 d 4i) 0 4.z’ 04 ~u 0 4 ) 4.~0 0:. 0W .w- w A.0 tD U.4 0) 0 4 4 4 0W IEu 40 IA. 0 W 42 4n z 4E ww W ta U4 m 4 4 U L...N 0 0kI ~II~(~ ( ~0~c ~IC I N I~(~I~0 01C 4 N( 04i..4 II .4 󈧄W00 IC0 Q 44 -4 0ൈ 00 00 0 1 .Z0 0 00ZZ 4 Is,00 00 0 0 ZI0I wc > 0 3a I Q I4b oo...1 m 3t 024.223 E g r 𔃺 4 to wi L8 z- z . 4L c o Wm 4l H z " E. w 0~ 4lL 44 W a U3 TD W xP 4 j 4 ) W V) F-4 4 4 1 w2 C. : 40 ’s U Q IN 0 1 0 0 0 0

Department of Defense Contractor Establishment Code (CEC). Alphabet Listing. Volume II

DTIC Science & Technology

1992-11-01

401 0 ix (~C -): N.2 g ~O4 N. w N4 w(0 000~-C)N42C)04�t480W4O0𔃺 f,1fi ’ N 1 C) 0C)04’ml1.2~ ~~ ~ Hi -0 - MEm ~, jrIIII gar IIi I i II il l (D...W- & 0 - wd 0 c.H234 w aC 0~’-~~"g- 4(󈧣*-Wn -. a wW Q Cd 0 0a 0 0z w 026d A 0". 0.. OZo8o~ 8..0 I -- )z6---z U200W0r" 00 w . 1 . . .51 MEM -.3 -. 9...01 bW0 4) w c -"> U In cc0 0 I 02:m 260 in : ca 0 in W In -a 0: i in ~ I 4 05i 0- WH =ii. Z4 .9 z .Z.O inwLm~ w-W m =i t..Zin4= c W 0 0 >..in. Z MEM

Identification of the stereochemical requirements in the 4-aryl-2-cycloalkylidenhydrazinylthiazole scaffold for the design of selective human monoamine oxidase B inhibitors.

PubMed

D'Ascenzio, Melissa; Carradori, Simone; Secci, Daniela; Mannina, Luisa; Sobolev, Anatoly P; De Monte, Celeste; Cirilli, Roberto; Yáñez, Matilde; Alcaro, Stefano; Ortuso, Francesco

2014-05-15

Exploring the effect that substituents on the cycloaliphatic ring had on the inhibitory activity against human monoamine oxidase B of a series of 4-aryl-2-cycloalkylidenhydrazinylthiazoles led to the synthesis of a new series of 2-methylcyclopentyl and 3-methylcyclopentyl derivatives which were tested in vitro as mixtures of diastereoisomers. In fact, due to the presence of a chiral center on the cycloaliphatic ring and a trisubstituted CN bond, they exist as four diastereoisomers ((E)-(R), (E)-(S), (Z)-(R), (Z)-(S)). 4-(2,4-Difluorophenyl)-2-(2-(3-methylcyclopentylidene)hydrazinyl)thiazole was chosen as a model to investigate the influence of stereochemical requirements on the inhibitory activity against hMAO-B of these derivatives after a stereoconservative synthesis and semi-preparative HPLC diastereoseparation. (R)-(Z) isomer of this compound was endowed with a potent and selective hMAO-B inhibition higher than that of reference drugs as also corroborated by molecular modeling studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Synthesis, characterization, crystal structure, superoxide dismutase and biological activities of nickel (II) complexes with bidentate ligands possessing N and O donor atoms

NASA Astrophysics Data System (ADS)

Sangeeta, S.; Ahmad, K.; Noorussabah, N.; Bharti, S.; Mishra, M. K.; Sharma, S. R.; Choudhary, M.

2017-12-01

Two new Schiff bases 2-((E)-(4-bromo-2-chlorophenylimino)methyl)-4-bromophenol(HL1) and1-((E)-(4-bromo-2-chlorophenylimino)methyl)naphthalene-2-ol (HL2) and their new nickel (II) complexes [Ni(L1)2]·DMF(1) and [Ni(L2)2] (2) have been synthesized and characterized by various physico- chemical and spectroscopic methods. The solid-state structures of synthesized compounds were determined by single crystal X-ray crystallography, which revealed square planar geometry around Ni (II) ion. Infrared spectra, UV-Vis, thermal analysis and magnetic susceptibility measurements agreed with the observed crystal structures. The ligand (HL1) crystallized in the Orthorhombic system of the space group Pbca,a = 7.5485(4)Å, b = 11.5514(5) Å, c = 30.1370(14)Å, α = 90°, β = 90°, γ = 90°and Z = 8. Complex[Ni(L1)2]·DMF(1) crystallized in the Triclinic system of the space group P-1, a = 8.9954(3) Å, b = 9.4593(4) Å, c = 13.2657(5) Å, α = 101.478°, β = 99.595°, γ = 117.651°and Z = 2, whereas complex [Ni(L2)2]·(2) crystallized in the Monoclinic system of the space group P21/c, a = 9.301(9)Å, b = 12.149(8)Å, c = 13.792(10)Å, α = 90°, β = 106.35(4).°, γ = 90°and Z = 2. The Schiff bases (HL1and HL2) behaved as monobasic bidentate ligands possessing N and O donor atoms. The SOD activities of HL1 and its Ni (II) complex[Ni(L1)2]·DMF(1) have been measured using xanthine-xanthine oxidase as a source of superoxide radical and NBT assay as O2- scavenger. In vitro antimicrobial activities of the Ni(II) complexes (1) and (2)against Bacillus cereus and Staphylococcus aureus as Gram + ve and Salmonella typhi, Klebsiella pneumonia and Escherichia coli as Gram-ve species have been investigated comparing with the Schiff base ligands (HL1and HL2).

The PEP survey: clustering of infrared-selected galaxies and structure formation at z ˜ 2 in GOODS-South

NASA Astrophysics Data System (ADS)

Magliocchetti, M.; Santini, P.; Rodighiero, G.; Grazian, A.; Aussel, H.; Altieri, B.; Andreani, P.; Berta, S.; Cepa, J.; Castañeda, H.; Cimatti, A.; Daddi, E.; Elbaz, D.; Genzel, R.; Gruppioni, C.; Lutz, D.; Magnelli, B.; Maiolino, R.; Popesso, P.; Poglitsch, A.; Pozzi, F.; Sanchez-Portal, M.; Förster Schreiber, N. M.; Sturm, E.; Tacconi, L.; Valtchanov, I.

2011-09-01

This paper presents the first direct estimate of the 3D clustering properties of far-infrared sources up to z˜ 3. This has been possible thanks to the PACS Evolutionary Probe (PEP) survey of the GOODS-South field performed with the PACS instrument on board the Herschel satellite. 550 and 502 sources were detected respectively in the 100- and 160-μm channels down to fluxes ? mJy and ? mJy, cuts that ensure >80 per cent completeness of the two catalogues. More than 65 per cent of these sources have an (either photometric or spectroscopic) redshift determination from the MUSIC catalogue; this percentage rises to ˜95 per cent in the inner portion of GOODS-South which is covered by data at other wavelengths. An analysis of the deprojected two-point correlation function w(θ) over the whole redshift range spanned by the data reports for the (comoving) correlation length, r0˜ 6.3 and ˜6.7 Mpc, respectively at 100 and 160 μm, corresponding to dark matter halo masses M≳ 1012.4 M⊙, in an excellent agreement with previous estimates obtained for mid-IR selected sources in the same field. Objects at z˜ 2 instead seem to be more strongly clustered, with r0˜ 19 and ˜17 Mpc in the two considered PACS channels. This dramatic increase of the correlation length between z˜ 1 and ˜2 is connected with the presence, more visible at 100 μm than in the other band, of a wide (at least 4 Mpc across in projection), M≳ 1014 M⊙, filamentary structure which includes more than 50 per cent of the sources detected at z˜ 2. An investigation of the properties of such sources indicates the possibility of a boosted star-forming activity in those which reside within the overdense environment with respect to more isolated galaxies found in the same redshift range. If confirmed by larger data sets, this result can be explained as due to the combined effect of large reservoirs of gas available at high redshifts in deep potential wells such as those associated with large overdensities and the enhanced rate of encounters between sources favoured by their relative proximity. Lastly, we also present our results on the evolution of the relationship between luminous and dark matter in star-forming galaxies between z˜ 1 and ˜2. We find that the increase in (average) stellar mass in galaxies between z˜ 1 and ˜2 is about a factor of 10 lower than that of the dark matter haloes hosting such objects (z˜ 1/z˜ 2˜ 4 × 10-1 versus Mz˜ 1halo/Mhaloz˜ 2˜ 4 × 10-2). When compared with recent results taken from the literature, our findings agree with the evolutionary picture of downsizing whereby massive galaxies at z˜ 2 were more actively forming stars than their z˜ 1 counterparts, while at the same time they contained a lower fraction of their mass in the form of luminous matter. Herschel is an ESA space observatory with science instruments provided by the European-led Principal Investigator consortia, with an important participation from NASA.

Why Do Compact Active Galactic Nuclei at High Redshift Twinkle Less?

NASA Technical Reports Server (NTRS)

Koay, J. Y.; Macquart, J.-P.; Bignall, H. E.; Reynolds, C.; Rickett, B. J.; Jauncey, D. L.; Pursimo, T.; Lovell, J. E. J.; Kedziora-Chudczer, L.; Ojha, R.

2012-01-01

The fraction of compact active galactic.nuclei (AGNs) that exhibit interstellar scintillation (ISS) at radio wavelengths, as well as their scintillation amplitudes, have been found to decrease significantly for sources at redshifts z approx greater than 2. This can be attributed to an increase in the angular sizes of the mu-as-scale cores or a decrease in the flux densities of the compact mu-as cores relative to that of the mas-scale components with increasing redshift, possibly arising from (1) the space-time curvature of an expanding Universe, (2) AGN evolution, (3) source selection biases, (4) scatter broadening in the ionized intergalactic medium (IGM), or (5) gravitational lensing. We examine the frequency scaling of this redshift dependence of ISS to determine its origin, using data from a dual-frequency survey of ISS of 128 sources at 0 approx < z approx < 4. We present a novel method of analysis which accounts for selection effects in the source sample. We determine that the redshift dependence of ISS is partially linked to the steepening of source spectral indices (alpha (sup 8.4, sub 4.9)) with redshift, caused either by selection biases or AGN evolution, coupled with weaker ISS in the alpha (sup 8.4, sub 4.9) < -0.4 sources. Selecting only the -0.4 < alpha (sup 8.4, sub 4.9) < 0.4 sources, we find that the redshift dependence of ISS is still significant, but is not significantly steeper than the expected (1 + z)(exp 0.5) scaling of source angular sizes due to cosmological expansion for a brightness temperature and flux-limited sample of sources. We find no significant evidence for scatter broadening in the IGM, ruling it out as the main cause of the redshift dependence of ISS. We obtain an upper limit to IGM scatter broadening of approx. < 110 mu-as at 4.9 GHz with 99% confidence for all lines of sight, and as low as approx. < 8 mu-as for sight-lines to the most compact, approx 10 mu-as sources.

The Effect of Scattering and Absorption on Noise from a Cavitating Noise Source in the Subsurface Ocean Layer.

DTIC Science & Technology

1981-06-01

for a de- tection probability of PD and associated false alarm probability PFA (in dB). 21 - - - II V. REFERENCE MODEL A. INTRODUCTION In order to...space for which to choose HI . PFA = P (wI 0o)dw = Q(---) (26) j 0 Similarity, the miss probability=l-detection probability is obtained by integrating...31) = 2 (1+ (22 [()BT z] ~Z The input signal-to-noise ratio: S/N(input) - a2 (32) The probability of false alarm: PFA = Q[ tB(j-I) 1 (33) The

Production and Electrical Characterization Tests of the ISL Detector and a Trigger Design for Higgs Boson Searches at CDF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munar Ara, Antoni

2002-01-01

This thesis is structured as follows: Chapter 1. gives a brief review of the Higgs mechanism in the Standard Model and the electroweak symmetry breaking. The Standard Model Higgs boson phenomenology at Tevatron energies is reviewed. Chapter 2. describes the upgraded Fermilab laboratory accelerator complex, and the upgraded CDF detector. Chapter 3. gives a brief overview of the more relevant aspects of the silicon detectors, and the ISL is described in detail. Chapter 4. describes the construction of the ISL ladders, the full custom testing setup (functionality tests, laser test, burn-in test andmore » $$\\beta$$-source measurements), and the problems encountered during the ISL ladders construction. The procedures for ladder grading are also discussed. Chapter 5. describes the multilevel trigger system of the CDF detector, and the trigger primitives available at each level. The most relevant offine event observables are briefly discussed. In Chapter 6 the procedures to estimate the trigger rate and trigger effciency calculation are described. The particularities of triggering in $$p\\bar{p}$$ collisions at high luminosities are discussed. Chapter 7. and Chapter 8. are dedicated to study an effcient trigger strategy for the $$H + W/Z \\to b\\bar{b}jj$$ channel and the $$H + Z \\to b\\bar{b} \

Toward a W4-F12 approach: Can explicitly correlated and orbital-based ab initio CCSD(T) limits be reconciled?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sylvetsky, Nitai, E-mail: gershom@weizmann.ac.il; Martin, Jan M. L., E-mail: gershom@weizmann.ac.il; Peterson, Kirk A., E-mail: kipeters@wsu.edu

2016-06-07

In the context of high-accuracy computational thermochemistry, the valence coupled cluster with all singles and doubles (CCSD) correlation component of molecular atomization energies presents the most severe basis set convergence problem, followed by the (T) component. In the present paper, we make a detailed comparison, for an expanded version of the W4-11 thermochemistry benchmark, between, on the one hand, orbital-based CCSD/AV{5,6}Z + d and CCSD/ACV{5,6}Z extrapolation, and on the other hand CCSD-F12b calculations with cc-pVQZ-F12 and cc-pV5Z-F12 basis sets. This latter basis set, now available for H–He, B–Ne, and Al–Ar, is shown to be very close to the basis setmore » limit. Apparent differences (which can reach 0.35 kcal/mol for systems like CCl{sub 4}) between orbital-based and CCSD-F12b basis set limits disappear if basis sets with additional radial flexibility, such as ACV{5,6}Z, are used for the orbital calculation. Counterpoise calculations reveal that, while total atomization energies with V5Z-F12 basis sets are nearly free of BSSE, orbital calculations have significant BSSE even with AV(6 + d)Z basis sets, leading to non-negligible differences between raw and counterpoise-corrected extrapolated limits. This latter problem is greatly reduced by switching to ACV{5,6}Z core-valence basis sets, or simply adding an additional zeta to just the valence orbitals. Previous reports that all-electron approaches like HEAT (high-accuracy extrapolated ab-initio thermochemistry) lead to different CCSD(T) limits than “valence limit + CV correction” approaches like Feller-Peterson-Dixon and Weizmann-4 (W4) theory can be rationalized in terms of the greater radial flexibility of core-valence basis sets. For (T) corrections, conventional CCSD(T)/AV{Q,5}Z + d calculations are found to be superior to scaled or extrapolated CCSD(T)-F12b calculations of similar cost. For a W4-F12 protocol, we recommend obtaining the Hartree-Fock and valence CCSD components from CCSD-F12b/cc-pV{Q,5}Z-F12 calculations, but the (T) component from conventional CCSD(T)/aug’-cc-pV{Q,5}Z + d calculations using Schwenke’s extrapolation; post-CCSD(T), core-valence, and relativistic corrections are to be obtained as in the original W4 theory. W4-F12 is found to agree slightly better than W4 with ATcT (active thermochemical tables) data, at a substantial saving in computation time and especially I/O overhead. A W4-F12 calculation on benzene is presented as a proof of concept.« less

Grissom AFB, Indiana. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

DTIC Science & Technology

1983-07-01

8.8i 15.51 1b.3 27.1 7%39 USAFETAC 0 TOS N. OL. ), O~ Poyaw 0mo IMS rOR Omm V~ Jm- - - - - -- - - -- - - - - - - U A 2AL CLIMATOLOY B’ANCH 2 Z .Ac...2Z812.o3410.911 S. 945 ,.137 6.561 6.607 8.977 9.95612.15813.1I5 19.923 6~ 3 .46 927. 920 --U 9 R. Z 9Z5. 3 U. 9CC 93 Q 900 927. 1 C9 4. 13. 11.7 3j

Phase Variations, Transits and Eclipses of the Misfit CoRoT-2b

NASA Astrophysics Data System (ADS)

Cowan, Nicolas; Deming, Drake; Gillon, Michael; Knutson, Heather; Madhusudhan, Nikku; Rauscher, Emily

2011-05-01

We propose to observe the nearby transiting hot Jupiter CoRoT-2b for a little over one planetary orbit on two occasions, yielding two secondary eclipses, a transit, and a full phase curve in each of the 3.6 and 4.5 micron channels. These data will help resolve the unique nature of this bloated planet: CoRoT-2b is the only hot Jupiter that is poorly fit by either inverted or non-inverted spectral models (Deming et al. 2011). Two hypotheses have been proposed to explain the peculiar mid-IR colors of CoRoT-2b, and thermal phase measurements with Spitzer's continuous, high-precision photometry will be able to distinguish between them: the planet has a non-inverted atmosphere but is losing mass to its host star, or the planet has a peculiar kind of temperature inversion due to mysterious atmospheric scatterers. CoRoT-2b is also among the most inflated hot Jupiters and, because of its relatively large mass, cannot be reconciled with interior evolution models, despite a small but non-zero eccentricity. A recent planetary collision may be necessary to explain the planet's youthful radius (Guillot & Havel 2011). Finally, the planet's extremely young host star, CoRoT-2, is the most chromospherically active of all transit hosts. This appears to be a common thread connecting all of its planet's peculiarities: the high UV flux of the star will drive mass loss, as well as photochemistry. Most importantly, the radius measurement of the planet at optical wavelengths may be contaminated by star spots. Mid-IR transit measurements from Spitzer will help resolve the mystery of CoRoT-2b's inflated radius.

Nellis AFB, Las Vegas, Nevada, Revised Uniform Summary of Surface Weather Observations (RUSSWO). Part A-F

DTIC Science & Technology

1975-03-07

87.9 87.91 87.9 87.0 87.9 S7,’ _-_89. a9L,.l9.. 89 89.a8l ’ 99.& a . 99.* - BOY A I &.D8.( >-’ 92.5 92s6 92;6 92.692.6 9z,6 󈨠.7 92.7 9z.7J 92.I 92’s7...9- I I-l 3 859 . 1-- - ... I 9- II/_-- - - I 1 1 54 __ It _.___ I D OTL Boi . 56*1% 97 982 14.,) ___33 - .43. 2. 1.2* l~.7 4Z1 0 1867 163 0/ -;. 7 i6...293jo3 b B -B Dry B.ib Wet BviblDew Porn ’ 1 7/ 73 0, - 11_ 1 _ _____ ; - -t- - -_L--_____ _ !;c - I I-72-Tl I_ Ic 5 5 Q;!; ,, 4 6 70 69 Is. ~*.d __L ~6 6

Measurements of {Gamma}(Z{sup O} {yields} b{bar b})/{Gamma}(Z{sup O} {yields} hadrons) using the SLD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neal, H.A. Jr. II

1995-07-01

The quantity R{sub b} = {Gamma}(Z{sup o} {yields}b{bar b})/{Gamma}(Z{sup o} {yields} hadrons) is a sensitive measure of corrections to the Zbb vertex. The precision necessary to observe the top quark mass dependent corrections is close to being achieved. LEP is already observing a 1.8{sigma} deviation from the Standard Model prediction. Knowledge of the top quark mass combined with the observation of deviations from the Standard Model prediction would indicate new physics. Models which include charged Higgs or light SUSY particles yield predictions for R{sub b} appreciably different from the Standard Model. In this thesis two independent methods are used tomore » measure R{sub b}. One uses a general event tag which determines R{sub b} from the rate at which events are tagged as Z{sup o} {yields} b{bar b} in data and the estimated rates at which various flavors of events are tagged from the Monte Carlo. The second method reduces the reliance on the Monte Carlo by separately tagging each hemisphere as containing a b-decay. The rates of single hemisphere tagged events and both hemisphere tagged events are used to determine the tagging efficiency for b-quarks directly from the data thus eliminating the main sources of systematic error present in the event tag. Both measurements take advantage of the unique environment provided by the SLAC Linear Collider (SLC) and the SLAC Large Detector (SLD). From the event tag a result of R{sub b} = 0.230{plus_minus}0.004{sub statistical}{plus_minus}0.013{sub systematic} is obtained. The higher precision hemisphere tag result obtained is R{sub b} = 0.218{plus_minus}0.004{sub statistical}{plus_minus}0.004{sub systematic}{plus_minus}0.003{sub Rc}.« less

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

PubMed

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

Understanding the formation and composition of hazes in planetary atmospheres that contain carbon monoxide

NASA Astrophysics Data System (ADS)

Hörst, S. M.; Yoon, Y. H.; Hicks, R. K.; Tolbert, M. A.

2012-09-01

Measurements from the Cassini Plasma Spectrometer (CAPS) have revealed the presence of molecules in Titan's ionosphere with masses in excess of hundreds of amu. Negative ions with mass/charge (m/z) up to 10,000 amu/q [1] and positive ions with m/z up to 400 amu/q [2] have been detected. CAPS has also observed O+ flowing into Titan's upper atmosphere [3], which appears to originate from Enceladus and is likely the source of oxygen bearing molecules in Titan's atmosphere [4]. The observed O+ is deposited in the region now known to contain large organic molecules. A recent Titan atmosphere simulation experiment has shown that incorporation of oxygen into Titan aerosol analogues results in the formation of all five nucleotide bases and the two smallest amino acids, glycine and alanine [5]. Similar chemical processes may have occurred in the atmosphere of the early Earth, or in the atmospheres of extrasolar planets; atmospheric aerosols may be an important source of the building blocks of life. Atmospheric aerosols play an important role in determining the radiation budget of an atmosphere and can also provide a wealth of organic material to the surface. The presence of atmospheric aerosols has been invoked to explain the relatively featureless spectrum of HD 189773b, including the lack of predicted atmospheric Na and K spectral lines [9]. The majority of the O+ precipitating into Titan's atmosphere forms CO (O(3P)+CH3 -> CO+H2+H) [4]. CO has also been detected in the atmospheres of a number of exoplanets including HD 189733b, HD 209458b, and WASP-12b [6-8]. It is therefore important to understand the role CO plays in the formation and composition of hazes in planetary atmospheres. Using a High-Resolution Time-of-Flight Aerosol Mass Spectrometer (HR-ToF-AMS) (see e.g. [10]) we have obtained in situ composition measurements of aerosol particles (so-called "tholins") produced in N2/CH4/CO gas mixtures subjected to either FUV radiation (deuterium lamp, 115-400 nm) or a spark discharge for a range of initial CO mixing ratios. A comparison of the composition of tholins produced using the two different energy sources will be presented. The effect of variation of CO mixing ratio on aerosol production and composition will also be discussed.

Air Force Office of Scientific Research, Air Force Systems Command Technical Report Summaries. First Quarter 1986.

DTIC Science & Technology

1986-03-01

wi 41 t4 0- Sw ? cL 1 CCCWC ." L ILmL C +o 00W 04 N ~ -C W. CD 0o -0 00 G CL Fr - -3 0 4 - .. CO C4 C1 OD C - - V.. 3 z LL (AC C )C’L -C 4.- Z.’ MCD...0 r -113W 4--L-0 L + *0 * Inm NOC IDn. *m ai u 0- 0 >% ~0C NC Fr IC NC1 CS L.. 0 4)4 0O L Lu * L %C. ii ~ B* LL CC0 z*- 0 > (a> 41r L X 0 mJ L... www U W A. ’-4 L IX z L o t iS o N AU w . C4 U CD4 UIa IL CD Li 0 -i. x - O cc 0 0 WL 4 4 si 4w IA- SnIA in (A C :I- c * i . V z < L 0) 6a L It 0

Seismic zoning (first approximation) using data of the main geomagnetic field

NASA Astrophysics Data System (ADS)

Khachikyan, Galina; Zhumabayev, Beibit; Toyshiev, Nursultan; Kairatkyzy, Dina; Seraliyev, Alibek; Khassanov, Eldar

2017-04-01

Seismic zoning is among the most complicated and extremely important problems of modern seismology. In solving this problem, a very important parameter is maximal possible earthquake magnitude (Mmax) which is believed at present depends on horizontal size of geoblocks. At the same time, it was found by Khachikyan et al. [2012, IJG, doi: 10.4236/ijg.2012.35109] that Mmax value in any seismic region may be determined using Z_GSM value that is geomagnetic Z-component in this region estimated in geocentric solar-magnetosphere coordinate system (GSM). On the base of the global seismological catalog NEIC with M≥4.5 for 1973-2010 years, and the International Geomagnetic Reference Field (IGRF) model, an empirical relation was obtained as follows: Mmax= a + b {log[abs(Z_GSM)]}. For the case of the whole planet, obtained empirical coefficients are as follows: a = (5,22 ± 0,17), and b = (0,78 ± 0,06) with correlation coefficient R=0.91, standard deviation SD=0.56, and probability 95%. Further investigations showed that the coefficients of the regression equation are different for different seismically active regions of the planet. For example, to the territory of the San Andreas Fault, defined by the coordinates 30-45N, 105-135W obtained values are as follows: a = (4,04 ± 0.38) and b = (0.7 ± 0.13) with correlation coefficient R = 0.91, standard deviation SD = 0.34, and probability of 95%. For territory of inland seismicity in Eurasia defined by the coordinates 30-45N, 0-110E, a = (12.44 ± 0.48) and b = (1,15 ± 0.2) with correlation coefficient R = 0.87, standard deviation SD = 0.98, and probability of 95%, and for the territory of the strongest seismicity in the world defined by the coordinates 20S-20N, 90-150E, obtained values of a = (- 17.5 ± 1,5) and b = (5,7 ± 0.4) with correlation coefficient R = 0.97, standard deviation SD = 0.4, and probability of 95%. The relationship between the intensity of the main geomagnetic field and released seismic energy is expectable, because both the main geomagnetic field and the tectonic activity of the planet originate from the same source - the convection in the Earth's liquid core. The relationship between earthquake magnitude and geomagnetic Z - component expressed namely in geocentric solar magnetosphere coordinate system (GSM), in which the interaction of the solar wind magnetic field with the geomagnetic field is better ordered, indicates at the external (triggering) earthquake occurrence in the extremely stressed tectonic area. Above empirical relationships may be used (in first approximation) for global seismic zoning and for prediction of possible Mmax, when a place and time of earthquake occurrence are predicted. In report we present global maps of Z_GSM and Mmax estimated for different seasons and different times.

An Analysis of the Structural Organization of the Venezuelan Naval Aviation.

DTIC Science & Technology

1987-12-01

NAME OF MONITORING ORGANIZAT ON (if aplicable ) Naval Postgraduate School 54 Naval Postgraduate School 6. ADDRESS City. State , n d Z PCo e) 7b A DRESS...organizational chart; however, due to the mobility of this unit and , the remote geographical location far from the Transport Squadron post, there is...K- K-- L~L~ a-. .~ -~ d a,, -. ’.1. d z * -C 0 V 4 4z .7 -’a- 62 ’a, 4.4 a.. V 0’ a.- _T.7 opportunity for upward mobility by limiting the

Development and Evaluation of Adeno-HTLV-III Hybrid Virus and Non- Cytopathic HTLV-III Mutant for Vaccine Use

DTIC Science & Technology

1988-10-28

I44r.0 + I I U.-4 Io 4- z+ (b I- 0 cj V I-SI: -4 I4 0)~ W4+ I ~ ’ IC14 e 9Q~ 4I cj-0 C:.L SI r. Cl I1C I0 -4 -4 I- .I -.t- 1 J.X- )0 1I 4 I I < < I w ...1-1 0 (3I I >+ ++ >> coZ mI WC ~ + U- H-i m ca IQg OI pI I4 cN.3 I "- .- 00I - I In :3 :3 w w 1 04l ci I I I I I ~ 4(~,-4~4.36 + a% 𔃺 001 to U 4-4...C) l~ u(V14:: - 4L + 4+ bC4 co4 ~0 M~ 40 -40~4. 4.4 bc I0 -l 110 C) 1 0 1 N, o 1) 41 -4 + cn, -H + N- to4 z:: Ia 41 w 1-1+ II,-HI r_ (cc ) (N -a* 1

Effect of Inverter Power Source Characteristics on Welding Stability and Heat Affected Zone Dimensions

NASA Astrophysics Data System (ADS)

Il'yaschenko, D. P.; Chinakhov, D. A.; Mamadaliev, R. A.

2018-01-01

The paper presents results the research in the effect of power sources dynamic characteristics on stability of melting and electrode metal transfer to the weld pool shielded metal arc welding. It is proved that when applying inverter-type welding power sources, heat and mass transfer characteristics change, arc gap short-circuit time and drop generation time are reduced. This leads to reduction of weld pool heat content and contraction of the heat-affected zone by 36% in comparison the same parameters obtained using a diode rectifier.

THE CHANDRA COSMOS-LEGACY SURVEY: THE z > 3 SAMPLE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marchesi, S.; Civano, F.; Urry, C. M.

2016-08-20

We present the largest high-redshift (3 < z < 6.85) sample of X-ray-selected active galactic nuclei (AGNs) on a contiguous field, using sources detected in the Chandra COSMOS-Legacy survey. The sample contains 174 sources, 87 with spectroscopic redshift and the other 87 with photometric redshift (z {sub phot}). In this work, we treat z {sub phot} as a probability-weighted sum of contributions, adding to our sample the contribution of sources with z {sub phot} < 3 but z {sub phot} probability distribution >0 at z > 3. We compute the number counts in the observed 0.5–2 keV band, finding amore » decline in the number of sources at z > 3 and constraining phenomenological models of the X-ray background. We compute the AGN space density at z > 3 in two different luminosity bins. At higher luminosities (log L (2–10 keV) > 44.1 erg s{sup −1}), the space density declines exponentially, dropping by a factor of ∼20 from z ∼ 3 to z ∼ 6. The observed decline is ∼80% steeper at lower luminosities (43.55 erg s{sup −1} < logL(2–10 keV) < 44.1 erg s{sup −1}) from z ∼ 3 to z ∼ 4.5. We study the space density evolution dividing our sample into optically classified Type 1 and Type 2 AGNs. At log L (2–10 keV) > 44.1 erg s{sup −1}, unobscured and obscured objects may have different evolution with redshift, with the obscured component being three times higher at z ∼ 5. Finally, we compare our space density with predictions of quasar activation merger models, whose calibration is based on optically luminous AGNs. These models significantly overpredict the number of expected AGNs at log L (2–10 keV) > 44.1 erg s{sup −1} with respect to our data.« less

Etiological role of human papillomavirus infection for inverted papilloma of the bladder.

PubMed

Shigehara, Kazuyoshi; Sasagawa, Toshiyuki; Doorbar, John; Kawaguchi, Shohei; Kobori, Yoshitomo; Nakashima, Takao; Shimamura, Masayoshi; Maeda, Yuji; Miyagi, Tohru; Kitagawa, Yasuhide; Kadono, Yoshifumi; Konaka, Hiroyuki; Mizokami, Atsushi; Koh, Eitetsu; Namiki, Mikio

2011-02-01

The status of human papillomavirus (HPV) infection in urothelial inverted papilloma was examined in the present study. Formalin-fixed and paraffin-embedded tissues from eight cases of inverted papilloma of the bladder were studied. The presence of HPV-DNA was examined by modified GP5/6+PCR using archival tissue sections by microdissection. HPV genotype was determined with a Hybri-Max HPV genotyping kit. Immunohistochemical analysis for p16-INK4a, mcm7, HPV-E4, and L1, and in situ hybridization for the HPV genome were performed. HPV was detected in seven of eight cases (87.5%) of inverted papilloma. Three cases were diagnosed as inverted papilloma with atypia, while the remaining five were typical cases. HPV-18 was detected in two cases, including one inverted papilloma with atypia, and HPV-16 was detected in four cases, including one inverted papilloma with atypia. Multiple HPV type infection was detected in one typical case and one atypical case. High-risk HPV was present in all HPV-positive cases. Cellular proteins, p16-INK4a and mcm7, which are surrogate markers for HPV-E7 expression, were detected in all HPV-positive cases, and their levels were higher in inverted papilloma with atypia than in typical cases. In contrast, HPV-E4 and L1, which are markers for HPV propagation, were observed in some parts of the typical inverted papilloma tissue. High-risk HPV infection may be one of the causes of urothelial inverted papilloma, and inverted papilloma with atypia may have malignant potential. 2010 Wiley-Liss, Inc.

NOx Control for Utility Boiler OTR Compliance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid Farzan

Under sponsorship of the Department of Energy's National Energy Technology Laboratory (NETL), the Babcock and Wilcox Company (B and W), and Fuel Tech teamed together to investigate an integrated solution for NO{sub x} control. The system is comprised of B and W's DRB-4Z{trademark} ultra low-NO{sub x} pulverized coal (PC) burner technology and Fuel Tech's NOxOUT{reg_sign}, a urea-based selective non-catalytic reduction (SNCR) technology. Development of the low-NO{sub x} burner technology has been a focus in B and W's combustion program. The DRB-4Z{trademark} burner is B and W's newest low-NO{sub x} burner capable of achieving very low NO{sub x}. The burner ismore » designed to reduce NO{sub x} by controlled mixing of the fuel and air. Based on data from several 500 to 600 MWe boilers firing PRB coal, NOx emissions levels of 0.15 to 0.20 lb/ 106 Btu have been achieved from the DRB-4Z{trademark} burners in combination with overfire air ports. Although NOx emissions from the DRB-4Z{trademark} burner are nearing the Ozone Transport Rule (OTR) level of 0.15 lb NO{sub x}/106 Btu, the utility boiler owners can still benefit from the addition of an SNCR and/or SCR system in order to comply with the stringent NO{sub x} emission levels facing them. Large-scale testing is planned in B and W's 100-million Btu/hr Clean Environment Development Facility (CEDF) that simulates the conditions of large coal-fired utility boilers. The objective of the project is to achieve a NO{sub x} level below 0.15 lb/106 Btu (with ammonia slip of less than 5 ppm) in the CEDF using PRB coal and B and W's DRB-4Z{trademark} low-NO{sub x} pulverized coal (PC) burner in combination with dual zone overfire air ports and Fuel Tech's NO{sub x}OUT{reg_sign}. During this period B and W prepared and submitted the project management plan and hazardous substance plan to DOE. The negotiation of a subcontract for Fuel Tech has been started.« less

Extreme X-ray Behaviour of Mrk 421

NASA Astrophysics Data System (ADS)

Kapanadze, Bidzina

2013-03-01

In ATel #4864 (B. Kapanadze, M4k 421 Still Active through X-rays), we reported the flaring activity in the high-energy peaked BL Lacertae source Mrk 421 (z=0.031) detected via the observations performed during March 1-5, 2013, by the X-ray Telescope (XRT) onboard the Swift satellite. The recent observations, performed by this telescope, show increasing X-ray activity of this source. The data, allocated at the webpage http://www.swift.psu.edu/monitoring/ , show that the source was extremely active on hours timescale during the March 17 pointing: the 0.3-10 keV flux dropped from 16.83+0.17 cts/s (Orbit 1) to 12.46+0.24 cts/s (Orbit 5) in about 4.2 hr; it increased then to 24.60+0.14 cts/s for next orbit (in 1.45 hr) and afterwards drooped again to 16.01+0.15 cts/s in the case of next orbit (in 1.7 hr).

Crystal structure of (1Z,4Z)-2,4-dimethyl-3H-benzo[b][1,4]diazepine.

PubMed

Nieto, Carla I; Claramunt, Rosa M; Torralba, M Carmen; Torres, M Rosario; Elguero, Jose

2017-05-01

The title compound, C 11 H 12 N 2 , is not planar due to the folding of the seven-membered ring. In the crystal, mol-ecules are packed opposite each other to minimize the electronic repulsion but the long inter-molecular distances indicate that no directional contacts are found.

Experimental pathways to understand and avoid high-Z impurity contamination from ICRF heating in tokamaks

NASA Astrophysics Data System (ADS)

Reinke, Matthew

2016-10-01

Recent results from Alcator C-Mod and JET demonstrate progress in understanding and mitigating core high-Z impurity contamination linked to ICRF heating in tokamaks with high-Z PFCs. Theory has identified two likely mechanisms: impurity sources due to sputtering enhanced by RF-rectified sheaths and greater cross-field SOL transport due to ExB convective cells. New experiments on Alcator C-Mod and JET demonstrate convective cell transport is likely a sub-dominant effect, despite directly observing ExB flows from rectified RF fields on C-Mod. Trace N2 introduced in the far SOL on field lines connected to and well away from an active ICRF antenna result in similar levels of core nitrogen, indicating local RF-driven transport is weak. This suggests the core high-Z density, nZ,core, is determined by sheath-induced sputtering and RF-independent SOL transport, allowing further reductions through antenna design. ICRF heating on C-Mod uses a unique, field aligned (FAA) and a pair of conventional, toroidally aligned (TAA) antennas. The FAA is designed to reduce rectified voltages relative to the TAA, and the impact of sheath-induced sputtering is explored by observing nZ,core while varying the TAA/FAA heating mix. A reduction of approximately 50% in core high-Z content is seen in L-modes when using the FAA and high-Z sources at the antenna limiter are effectively eliminated, indicating the remaining RF-driven source is away from the limiter. A drop in nZ,core may also be realized by locating the RF antenna on the inboard side where SOL transport aids impurity screening. New C-Mod experiments demonstrate up to a factor of 5 reduction in core nitrogen when N2 is injected on the high-field side as compared to low-field side impurity fueling. Varying the magnetic topology helps to elucidate the SOL transport physics responsible, laying a physics basis for inboard RF antenna placement. This work is supported by U.S. DOE Award DE-FC02-99ER54512, using Alcator C-Mod and carried out within the framework of the EUROfusion Consortium and has received funding from Euratom under Grant Agreement No 633053.

Dollar Summary of Federal Supply Classification and Service Category by Company. Part 2 (B502-J066)

DTIC Science & Technology

1990-01-01

U 0 V ) V ( w~~~~ ae a11 - 4 W 4 0~~~~ a a4 " A 0 1> z~~~~ a. a0 4 0 4 1 4 ,0 4 - 4a%- %. 0 4a4 t4 i acca Lu awHIu 0a 0 0 0 Iw awa In InI I IK t0 n 4...f0 <z 1. 0 m) 1-4 w 0 .0 0 ) 0 w ’ -J z U) 1-- -- &a x -- m < I z w z 0 F- or. o LU c-c, J O "I- "I- 11-1 0 F1 {A - " " :)ix [ I-- . U H E (. 0 ’ C3...I Ir 10 0 10 - U I I CO F1 4 04 U 40 40 IWI O 4 -~ ~ ~ OF- ~ 1 Z E c’) a Sc 0 00 -4 𔃺 0 U) SO (a e UL N 4 q 0 -4 1 -tr N (0 0) r, (a L0 m w) m 0 -t

Bohr Hamiltonian for γ = 30° with Davidson potential

NASA Astrophysics Data System (ADS)

Yigitoglu, Ibrahim; Gokbulut, Melek

2018-03-01

A γ-rigid solution of the Bohr Hamiltonian for γ = 30° is constructed with the Davidson potential in the β part. This solution is going to be called Z(4)-D. The energy eigenvalues and wave functions are obtained by using the analytic method developed by Nikiforov and Uvarov. The calculated intraband and interband B(E2) transitions rates are presented and compared with the Z(4) model predictions. The staggering behavior in γ-bands is considered to search Z(4) -D candidate nuclei. A variational procedure is applied to demonstrate that the Z(4) model is a solution of the critical point at the shape phase transition from spherical to rigid triaxial rotor.

Cascadable all-optical inverter based on a nonlinear vertical-cavity semiconductor optical amplifier.

PubMed

Zhang, Haijiang; Wen, Pengyue; Esener, Sadik

2007-07-01

We report, for the first time to our knowledge, the operation of a cascadable, low-optical-switching-power(~10 microW) small-area (~100 microm(2)) high-speed (80 ps fall time) all-optical inverter. This inverter employs cross-gain modulation, polarization gain anisotropy, and highly nonlinear gain characteristics of an electrically pumped vertical-cavity semiconductor optical amplifier (VCSOA). The measured transfer characteristics of such an optical inverter resemble those of standard electronic metal-oxide semiconductor field-effect transistor-based inverters exhibiting high noise margin and high extinction ratio (~9.3 dB), making VCSOAs an ideal building block for all-optical logic and memory.

Far-Field Accumulation of Fissile Material From Waste Packages Containing Plutonium Disposition Waste Form

DOE Office of Scientific and Technical Information (OSTI.GOV)

J.P. Nicot

The objective of this calculation is to estimate the quantity of fissile material that could accumulate in fractures in the rock beneath plutonium-ceramic (Pu-ceramic) and Mixed-Oxide (MOX) waste packages (WPs) as they degrade in the potential monitored geologic repository at Yucca Mountain. This calculation is to feed another calculation (Ref. 31) computing the probability of criticality in the systems described in Section 6 and then ultimately to a more general report on the impact of plutonium on the performance of the proposed repository (Ref. 32), both developed concurrently to this work. This calculation is done in accordance with the developmentmore » plan TDP-DDC-MD-000001 (Ref. 9), item 5. The original document described in item 5 has been split into two documents: this calculation and Ref. 4. The scope of the calculation is limited to only very low flow rates because they lead to the most conservative cases for Pu accumulation and more generally are consistent with the way the effluent from the WP (called source term in this calculation) was calculated (Ref. 4). Ref. 4 (''In-Drift Accumulation of Fissile Material from WPs Containing Plutonium Disposition Waste Forms'') details the evolution through time (breach time is initial time) of the chemical composition of the solution inside the WP as degradation of the fuel and other materials proceed. It is the chemical solution used as a source term in this calculation. Ref. 4 takes that same source term and reacts it with the invert; this calculation reacts it with the rock. In addition to reactions with the rock minerals (that release Si and Ca), the basic mechanisms for actinide precipitation are dilution and mixing with resident water as explained in Section 2.1.4. No other potential mechanism such as flow through a reducing zone is investigated in this calculation. No attempt was made to use the effluent water from the bottom of the invert instead of using directly the effluent water from the WP. This calculation supports disposal criticality analysis and has been prepared in accordance with AP-3.12Q, Calculations (Ref. 49). This calculation uses results from Ref. 4 on actinide accumulation in the invert and more generally does reference heavily the cited calculation. In addition to the information provided in this calculation, the reader is referred to the cited calculation for a more thorough treatment of items applying to both the invert and fracture system such as the choice of the thermodynamic database, the composition of J-13 well water, tuff composition, dissolution rate laws, Pu(OH){sub 4} solubility and also for details on the source term composition. The flow conditions (seepage rate, water velocity in fractures) in the drift and the fracture system beneath initially referred to the TSPA-VA because this work was prepared before the release of the work feeding the TSPA-SR. Some new information feeding the TSPA-SR has since been included. Similarly, the soon-to-be-qualified thermodynamic database data0.ymp has not been released yet.« less

THE REDSHIFT DISTRIBUTION OF DUSTY STAR-FORMING GALAXIES FROM THE SPT SURVEY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strandet, M. L.; Weiss, A.; Vieira, J. D.

2016-05-10

We use the Atacama Large Millimeter/submillimeter Array (ALMA) in Cycle 1 to determine spectroscopic redshifts of high-redshift dusty star-forming galaxies (DSFGs) selected by their 1.4 mm continuum emission in the South Pole Telescope (SPT) survey. We present ALMA 3 mm spectral scans between 84 and 114 GHz for 15 galaxies and targeted ALMA 1 mm observations for an additional eight sources. Our observations yield 30 new line detections from CO, [C i], [N ii], H{sub 2}O and NH{sub 3}. We further present Atacama Pathfinder Experiment [C ii] and CO mid- J observations for seven sources for which only a singlemore » line was detected in spectral-scan data from ALMA Cycle 0 or Cycle 1. We combine the new observations with previously published and new millimeter/submillimeter line and photometric data of the SPT-selected DSFGs to study their redshift distribution. The combined data yield 39 spectroscopic redshifts from molecular lines, a success rate of >85%. Our sample represents the largest data set of its kind today and has the highest spectroscopic completeness among all redshift surveys of high- z DSFGs. The median of the redshift distribution is z = 3.9 ± 0.4, and the highest-redshift source in our sample is at z = 5.8. We discuss how the selection of our sources affects the redshift distribution, focusing on source brightness, selection wavelength, and strong gravitational lensing. We correct for the effect of gravitational lensing and find the redshift distribution for 1.4 mm selected sources with a median redshift of z = 3.1 ± 0.3. Comparing to redshift distributions selected at shorter wavelengths from the literature, we show that selection wavelength affects the shape of the redshift distribution.« less

The Redshift Distribution of Dusty Star-forming Galaxies from the SPT Survey

NASA Astrophysics Data System (ADS)

Strandet, M. L.; Weiss, A.; Vieira, J. D.; de Breuck, C.; Aguirre, J. E.; Aravena, M.; Ashby, M. L. N.; Béthermin, M.; Bradford, C. M.; Carlstrom, J. E.; Chapman, S. C.; Crawford, T. M.; Everett, W.; Fassnacht, C. D.; Furstenau, R. M.; Gonzalez, A. H.; Greve, T. R.; Gullberg, B.; Hezaveh, Y.; Kamenetzky, J. R.; Litke, K.; Ma, J.; Malkan, M.; Marrone, D. P.; Menten, K. M.; Murphy, E. J.; Nadolski, A.; Rotermund, K. M.; Spilker, J. S.; Stark, A. A.; Welikala, N.

2016-05-01

We use the Atacama Large Millimeter/submillimeter Array (ALMA) in Cycle 1 to determine spectroscopic redshifts of high-redshift dusty star-forming galaxies (DSFGs) selected by their 1.4 mm continuum emission in the South Pole Telescope (SPT) survey. We present ALMA 3 mm spectral scans between 84 and 114 GHz for 15 galaxies and targeted ALMA 1 mm observations for an additional eight sources. Our observations yield 30 new line detections from CO, [C I], [N II], H2O and NH3. We further present Atacama Pathfinder Experiment [C II] and CO mid-J observations for seven sources for which only a single line was detected in spectral-scan data from ALMA Cycle 0 or Cycle 1. We combine the new observations with previously published and new millimeter/submillimeter line and photometric data of the SPT-selected DSFGs to study their redshift distribution. The combined data yield 39 spectroscopic redshifts from molecular lines, a success rate of >85%. Our sample represents the largest data set of its kind today and has the highest spectroscopic completeness among all redshift surveys of high-z DSFGs. The median of the redshift distribution is z = 3.9 ± 0.4, and the highest-redshift source in our sample is at z = 5.8. We discuss how the selection of our sources affects the redshift distribution, focusing on source brightness, selection wavelength, and strong gravitational lensing. We correct for the effect of gravitational lensing and find the redshift distribution for 1.4 mm selected sources with a median redshift of z = 3.1 ± 0.3. Comparing to redshift distributions selected at shorter wavelengths from the literature, we show that selection wavelength affects the shape of the redshift distribution.

Inverted polymer fullerene solar cells exceeding 10% efficiency with poly(2-ethyl-2-oxazoline) nanodots on electron-collecting buffer layers

PubMed Central

Nam, Sungho; Seo, Jooyeok; Woo, Sungho; Kim, Wook Hyun; Kim, Hwajeong; Bradley, Donal D. C.; Kim, Youngkyoo

2015-01-01

Polymer solar cells have been spotlighted due to their potential for low-cost manufacturing but their efficiency is still less than required for commercial application as lightweight/flexible modules. Forming a dipole layer at the electron-collecting interface has been suggested as one of the more attractive approaches for efficiency enhancement. However, only a few dipole layer material types have been reported so far, including only one non-ionic (charge neutral) polymer. Here we show that a further neutral polymer, namely poly(2-ethyl-2-oxazoline) (PEOz) can be successfully used as a dipole layer. Inclusion of a PEOz layer, in particular with a nanodot morphology, increases the effective work function at the electron-collecting interface within inverted solar cells and thermal annealing of PEOz layer leads to a state-of-the-art 10.74% efficiency for single-stack bulk heterojunction blend structures comprising poly[4,8-bis(5-(2-ethylhexyl)thiophen-2-yl)benzo[1,2-b:4,5-b′]dithiophene-alt-3-fluorothieno[3,4-b]thiophene-2-carboxylate] as donor and [6,6]-phenyl-C71-butyric acid methyl ester as acceptor. PMID:26656447

Modeling, Development and Control of Multilevel Converters for Power System Application =

NASA Astrophysics Data System (ADS)

Vahedi, Hani

The main goal of this project is to develop a multilevel converter topology to be useful in power system applications. Although many topologies are introduced rapidly using a bunch of switches and isolated dc sources, having a single-dc-source multilevel inverter is still a matter of controversy. In fact, each isolated dc source means a bulky transformer and a rectifier that have their own losses and costs forcing the industries to avoid entering in this topic conveniently. On the other hand, multilevel inverters topologies with single-dc-source require associated controllers to regulate the dc capacitors voltages in order to have multilevel voltage waveform at the output. Thus, a complex controller would not interest investors properly. Consequently, developing a single-dc-source multilevel inverter topology along with a light and reliable voltage control is still a challenging topic to replace the 2-level inverters in the market effectively. The first effort in this project was devoted to the PUC7 inverter to design a simple and yet efficient controller. A new modelling is performed on the PUC7 inverter and it has been simplified to first order system. Afterwards, a nonlinear cascaded controller is designed and applied to regulate the capacitor voltage at 1/3 of the DC source amplitude and to generate 7 identical voltage levels at the output supplying different type of loads such as RL or rectifier harmonic ones. In next work, the PUC5 topology is proposed as a remedy to the PUC7 that requires a complicated controller to operate properly. The capacitor voltage is regulated at half of dc source amplitude to generate 5 voltage levels at the output. Although the 7-level voltage waveform is replaced by a 5-level one in PUC5 topology, it is shown that the PUC5 needs a very simple and reliable voltage balancing technique due to having some redundant switching states. Moreover, a sensor-less voltage balancing technique is designed and implemented on the PUC5 inverter successfully to work in both stand-alone and gridconnected mode of operation. Eventually, a modified configuration of the PUC5 topology is presented to work as a buck PFC rectifier. The internal performance of the rectifier is like a buck converter to generate stepped down DC voltages at the two output terminals while the grid sees a boost converter externally. As well, a decoupled voltage/current controller is designed and applied to balance the output voltages identically and synchronize the input current with grid voltage to have a PFC operation acceptably. A power balance analysis is done to show the load variation range limit. All the theoretical and simulation studies are validated by experimental results completely.

The mitochondrial genome of the ethanol-metabolizing, wine cellar mold Zasmidium cellare is the smallest for a filamentous ascomycete

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodwin, Stephen; McCorison, Cassandra B.; Cavaletto, Jessica R.

Fungi in the class Dothideomycetes often live in extreme environments or have unusual physiology. One of these, the wine cellar mold Zasmidium cellare, produces thick curtains of mycelial growth in cellars with high humidity, and its ability to metabolize volatile organic compounds including alcohols, esters and formaldehyde is thought to improve air quality. It grows slowly but appears to outcompete ordinarily faster-growing species under anaerobic conditions.Whether these abilities have affected its mitochondrial genome is not known.To fill this gap, its mitochondrial genome was assembled as part of a whole- genome shotgun-sequencing project.The circular-mapping mitochondrial genome of Z. cellare, at onlymore » 23,743 bp, is the smallest yet reported for a filamentous fungus.It contains the complete set of 14 protein-coding genes seen typically in other filamentous fungi, along with genes for large and small ribosomal RNA subunits, 25 predicted tRNA genes capable of decoding all 20 amino acids, and a single open reading frame potentially coding for a protein of unknown function.The Z. cellare mitochondrial genome had genes encoded on both strands with a single change of direction, different from most other fungi but consistent with the Dothideomycetes. The high synteny among mitochondrial genomes of fungi in the Eurotiomycetes broke down almost completely in the Dothideomycetes.Only a low level of microsynteny was observed among protein-coding and tRNA genes in comparison with Mycosphaerella graminicola (synonym Zymoseptoria tritici), the only other fungus in the order Capnodiales with a sequenced mitochondrial genome, involving the three gene pairs atp8-atp9, nad2-nad3, and nad4L-nad5.However, even this low level of microsynteny did not extend to other fungi in the Dothideomycetes and Eurotiomycetes. Phylogenetic analysis of concatenated protein-coding genes confirmed the relationship between Z. cellare and M. graminicola in the Capnodiales, although conclusions were limited due to low sampling density.Other than its small size, the only unusual feature of the Z. cellare mitochondrial genome was two copies of a 110-bp sequence that were duplicated, inverted and separated by approximately 1 kb. This inverted-repeat sequence confused the assembly program but appears to have no functional significance.The small size of the Z. cellare mitochondrial genome was due to slightly smaller genes, lack of introns and non-essential genes, reduced intergenic spaces and very few ORFs relative to other fungi rather than a loss of essential genes. Whether this reduction facilitates its unusual biology remains unknown.« less

Electromagnetic Fields of a Uniform Sphere in a Uniform Conducting Medium with Application to Dipole Sources

DTIC Science & Technology

1991-09-01

12b. DISTRIBUTION CODE Approved for public release; distribution is unlimited. 13. ABSTRACT (Maximum 200 words) Vector spherical harmonic expansions are...electric and magnetic field vectors from E rand B - r alone. Genural expressions are given relating the scattered field expansion coefficients to the source...Prescnbed by ANSI Std. Z39-18 29W-102 NCSC TR 426-90 CONTENTS Pag o INTRODUCTION 1 BACKGROUND 1 ANGULAR MOMENTUM OPERATOR AND VECTOR SPHERICAL

On an efficient multilevel inverter assembly: structural savings and design optimisations

NASA Astrophysics Data System (ADS)

Choupan, Reza; Nazarpour, Daryoush; Golshannavaz, Sajjad

2018-01-01

This study puts forward an efficient unit cell to be taken in use in multilevel inverter assemblies. The proposed structure is in line with reductions in number of direct current (dc) voltage sources, insulated-gate bipolar transistors (IGBTs), gate driver circuits, installation area, and hence the implementation costs. Such structural savings do not sacrifice the technical performance of the proposed design wherein an increased number of output voltage levels is attained, interestingly. Targeting a techno-economic characteristic, the contemplated structure is included as the key unit of cascaded multilevel inverters. Such extensions require development of applicable design procedures. To this end, two efficient strategies are elaborated to determine the magnitudes of input dc voltage sources. As well, an optimisation process is developed to explore the optimal allocation of different parameters in overall performance of the proposed inverter. These parameters are investigated as the number of IGBTs, dc sources, diodes, and overall blocked voltage on switches. In the lights of these characteristics, a comprehensive analysis is established to compare the proposed design with the conventional and recently developed structures. Detailed simulation and experimental studies are conducted to assess the performance of the proposed design. The obtained results are discussed in depth.

Cellular generators of the cortical auditory evoked potential initial component.

PubMed

Steinschneider, M; Tenke, C E; Schroeder, C E; Javitt, D C; Simpson, G V; Arezzo, J C; Vaughan, H G

1992-01-01

Cellular generators of the initial cortical auditory evoked potential (AEP) component were determined by analyzing laminar profiles of click-evoked AEPs, current source density, and multiple unit activity (MUA) in primary auditory cortex of awake monkeys. The initial AEP component is a surface-negative wave, N8, that peaks at 8-9 msec and inverts in polarity below lamina 4. N8 is generated by a lamina 4 current sink and a deeper current source. Simultaneous MUA is present from lower lamina 3 to the subjacent white matter. Findings indicate that thalamocortical afferents are a generator of N8 and support a role for lamina 4 stellate cells. Relationships to the human AEP are discussed.

Observation of a Neutral Structure near the DD[over ¯]^{*} Mass Threshold in e^{+}e^{-}→(DD[over ¯]^{*})^{0}π^{0} at sqrt[s]=4.226 and 4.257 GeV.

PubMed

Ablikim, M; Achasov, M N; Ai, X C; Albayrak, O; Albrecht, M; Ambrose, D J; Amoroso, A; An, F F; An, Q; Bai, J Z; Ferroli, R Baldini; Ban, Y; Bennett, D W; Bennett, J V; Bertani, M; Bettoni, D; Bian, J M; Bianchi, F; Boger, E; Boyko, I; Briere, R A; Cai, H; Cai, X; Cakir, O; Calcaterra, A; Cao, G F; Cetin, S A; Chang, J F; Chelkov, G; Chen, G; Chen, H S; Chen, H Y; Chen, J C; Chen, M L; Chen, S Chen; Chen, S J; Chen, X; Chen, X R; Chen, Y B; Cheng, H P; Chu, X K; Cibinetto, G; Dai, H L; Dai, J P; Dbeyssi, A; Dedovich, D; Deng, Z Y; Denig, A; Denysenko, I; Destefanis, M; De Mori, F; Ding, Y; Dong, C; Dong, J; Dong, L Y; Dong, M Y; Du, S X; Duan, P F; Fan, J Z; Fang, J; Fang, S S; Fang, X; Fang, Y; Fava, L; Feldbauer, F; Felici, G; Feng, C Q; Fioravanti, E; Fritsch, M; Fu, C D; Gao, Q; Gao, X L; Gao, X Y; Gao, Y; Gao, Z; Garzia, I; Goetzen, K; Gong, W X; Gradl, W; Greco, M; Gu, M H; Gu, Y T; Guan, Y H; Guo, A Q; Guo, L B; Guo, R P; Guo, Y; Guo, Y P; Haddadi, Z; Hafner, A; Han, S; Hao, X Q; Harris, F A; He, K L; He, X Q; Held, T; Heng, Y K; Hou, Z L; Hu, C; Hu, H M; Hu, J F; Hu, T; Hu, Y; Huang, G M; Huang, G S; Huang, J S; Huang, X T; Huang, Y; Hussain, T; Ji, Q; Ji, Q P; Ji, X B; Ji, X L; Jiang, L W; Jiang, X S; Jiang, X Y; Jiao, J B; Jiao, Z; Jin, D P; Jin, S; Johansson, T; Julin, A; Kalantar-Nayestanaki, N; Kang, X L; Kang, X S; Kavatsyuk, M; Ke, B C; Kiese, P; Kliemt, R; Kloss, B; Kolcu, O B; Kopf, B; Kornicer, M; Kühn, W; Kupsc, A; Lange, J S; Lara, M; Larin, P; Leng, C; Li, C; Li, Cheng; Li, D M; Li, F; Li, F Y; Li, G; Li, H B; Li, H J; Li, J C; Li, Jin; Li, K; Li, K; Li, Lei; Li, P R; Li, T; Li, W D; Li, W G; Li, X L; Li, X M; Li, X N; Li, X Q; Li, Z B; Liang, H; Liang, J J; Liang, Y F; Liang, Y T; Liao, G R; Lin, D X; Liu, B J; Liu, C X; Liu, D; Liu, F H; Liu, Fang; Liu, Feng; Liu, H B; Liu, H H; Liu, H H; Liu, H M; Liu, J; Liu, J B; Liu, J P; Liu, J Y; Liu, K; Liu, K Y; Liu, L D; Liu, P L; Liu, Q; Liu, S B; Liu, X; Liu, Y B; Liu, Z A; Liu, Zhiqing; Loehner, H; Lou, X C; Lu, H J; Lu, J G; Lu, Y; Lu, Y P; Luo, C L; Luo, M X; Luo, T; Luo, X L; Lyu, X R; Ma, F C; Ma, H L; Ma, L L; Ma, M M; Ma, Q M; Ma, T; Ma, X N; Ma, X Y; Maas, F E; Maggiora, M; Mao, Y J; Mao, Z P; Marcello, S; Messchendorp, J G; Min, J; Mitchell, R E; Mo, X H; Mo, Y J; Morales, C Morales; Moriya, K; Muchnoi, N Yu; Muramatsu, H; Nefedov, Y; Nerling, F; Nikolaev, I B; Ning, Z; Nisar, S; Niu, S L; Niu, X Y; Olsen, S L; Ouyang, Q; Pacetti, S; Pan, Y; Patteri, P; Pelizaeus, M; Peng, H P; Peters, K; Pettersson, J; Ping, J L; Ping, R G; Poling, R; Prasad, V; Qi, M; Qian, S; Qiao, C F; Qin, L Q; Qin, N; Qin, X S; Qin, Z H; Qiu, J F; Rashid, K H; Redmer, C F; Ripka, M; Rong, G; Rosner, Ch; Ruan, X D; Sarantsev, A; Savrié, M; Schoenning, K; Schumann, S; Shan, W; Shao, M; Shen, C P; Shen, P X; Shen, X Y; Sheng, H Y; Shi, M; Song, W M; Song, X Y; Sosio, S; Spataro, S; Sun, G X; Sun, J F; Sun, S S; Sun, X H; Sun, Y J; Sun, Y Z; Sun, Z J; Sun, Z T; Tang, C J; Tang, X; Tapan, I; Thorndike, E H; Tiemens, M; Ullrich, M; Uman, I; Varner, G S; Wang, B; Wang, D; Wang, D Y; Wang, K; Wang, L L; Wang, L S; Wang, M; Wang, P; Wang, P L; Wang, S G; Wang, W; Wang, W P; Wang, X F; Wang, Y D; Wang, Y F; Wang, Y Q; Wang, Z; Wang, Z G; Wang, Z H; Wang, Z Y; Wang, Z Y; Weber, T; Wei, D H; Wei, J B; Weidenkaff, P; Wen, S P; Wiedner, U; Wolke, M; Wu, L H; Wu, L J; Wu, Z; Xia, L; Xia, L G; Xia, Y; Xiao, D; Xiao, H; Xiao, Z J; Xie, Y G; Xiu, Q L; Xu, G F; Xu, J J; Xu, L; Xu, Q J; Xu, X P; Yan, L; Yan, W B; Yan, W C; Yan, Y H; Yang, H J; Yang, H X; Yang, L; Yang, Y; Yang, Y X; Ye, M; Ye, M H; Yin, J H; Yu, B X; Yu, C X; Yu, J S; Yuan, C Z; Yuan, W L; Yuan, Y; Yuncu, A; Zafar, A A; Zallo, A; Zeng, Y; Zeng, Z; Zhang, B X; Zhang, B Y; Zhang, C; Zhang, C C; Zhang, D H; Zhang, H H; Zhang, H Y; Zhang, J; Zhang, J J; Zhang, J L; Zhang, J Q; Zhang, J W; Zhang, J Y; Zhang, J Z; Zhang, K; Zhang, L; Zhang, X Y; Zhang, Y; Zhang, Y N; Zhang, Y H; Zhang, Y T; Zhang, Yu; Zhang, Z H; Zhang, Z P; Zhang, Z Y; Zhao, G; Zhao, J W; Zhao, J Y; Zhao, J Z; Zhao, Lei; Zhao, Ling; Zhao, M G; Zhao, Q; Zhao, Q W; Zhao, S J; Zhao, T C; Zhao, Y B; Zhao, Z G; Zhemchugov, A; Zheng, B; Zheng, J P; Zheng, W J; Zheng, Y H; Zhong, B; Zhou, L; Zhou, X; Zhou, X K; Zhou, X R; Zhou, X Y; Zhu, K; Zhu, K J; Zhu, S; Zhu, S H; Zhu, X L; Zhu, Y C; Zhu, Y S; Zhu, Z A; Zhuang, J; Zotti, L; Zou, B S; Zou, J H

2015-11-27

A neutral structure in the DD[over ¯]^{*} system around the DD[over ¯]^{*} mass threshold is observed with a statistical significance greater than 10σ in the processes e^{+}e^{-}→D^{+}D^{*-}π^{0}+c.c. and e^{+}e^{-}→D^{0}D[over ¯]^{*0}π^{0}+c.c. at sqrt[s]=4.226 and 4.257 GeV in the BESIII experiment. The structure is denoted as Z_{c}(3885)^{0}. Assuming the presence of a resonance, its pole mass and width are determined to be [3885.7_{-5.7}^{+4.3}(stat)±8.4(syst)]  MeV/c^{2} and [35_{-12}^{+11}(stat)±15(syst)]  MeV, respectively. The Born cross sections are measured to be σ[e^{+}e^{-}→Z_{c}(3885)^{0}π^{0},Z_{c}(3885)^{0}→DD[over ¯]^{*}]=[77±13(stat)±17(syst)]  pb at 4.226 GeV and [47±9(stat)±10(syst)]  pb at 4.257 GeV. The ratio of decay rates B[Z_{c}(3885)^{0}→D^{+}D^{*-}+c.c.]/B[Z_{c}(3885)^{0}→D^{0}D[over ¯]^{*0}+c.c.] is determined to be 0.96±0.18(stat)±0.12(syst), consistent with no isospin violation in the process, Z_{c}(3885)^{0}→DD[over ¯]^{*}.

4D (x-y-z-t) imaging of thick biological samples by means of Two-Photon inverted Selective Plane Illumination Microscopy (2PE-iSPIM)

PubMed Central

Lavagnino, Zeno; Sancataldo, Giuseppe; d’Amora, Marta; Follert, Philipp; De Pietri Tonelli, Davide; Diaspro, Alberto; Cella Zanacchi, Francesca

2016-01-01

In the last decade light sheet fluorescence microscopy techniques, such as selective plane illumination microscopy (SPIM), has become a well established method for developmental biology. However, conventional SPIM architectures hardly permit imaging of certain tissues since the common sample mounting procedure, based on gel embedding, could interfere with the sample morphology. In this work we propose an inverted selective plane microscopy system (iSPIM), based on non-linear excitation, suitable for 3D tissue imaging. First, the iSPIM architecture provides flexibility on the sample mounting, getting rid of the gel-based mounting typical of conventional SPIM, permitting 3D imaging of hippocampal slices from mouse brain. Moreover, all the advantages brought by two photon excitation (2PE) in terms of reduction of scattering effects and contrast improvement are exploited, demonstrating an improved image quality and contrast compared to single photon excitation. The system proposed represents an optimal platform for tissue imaging and it smooths the way to the applicability of light sheet microscopy to a wider range of samples including those that have to be mounted on non-transparent surfaces. PMID:27033347

A-4 scientific results

NASA Technical Reports Server (NTRS)

Matteson, J.

1979-01-01

Observations of galactic sources, extragalactic sources and gamma bursts with the A-4 instrument at energy 1 energies of between 0.1 to 10 MeV are discussed. Aximuthal scans are presented. The Crab Nebula and its spectrum and the spectrum of Cygnus Z-1 are described.

Ionospheric current source modeling and global geomagnetic induction using ground geomagnetic observatory data

USGS Publications Warehouse

Sun, Jin; Kelbert, Anna; Egbert, G.D.

2015-01-01

Long-period global-scale electromagnetic induction studies of deep Earth conductivity are based almost exclusively on magnetovariational methods and require accurate models of external source spatial structure. We describe approaches to inverting for both the external sources and three-dimensional (3-D) conductivity variations and apply these methods to long-period (T≥1.2 days) geomagnetic observatory data. Our scheme involves three steps: (1) Observatory data from 60 years (only partly overlapping and with many large gaps) are reduced and merged into dominant spatial modes using a scheme based on frequency domain principal components. (2) Resulting modes are inverted for corresponding external source spatial structure, using a simplified conductivity model with radial variations overlain by a two-dimensional thin sheet. The source inversion is regularized using a physically based source covariance, generated through superposition of correlated tilted zonal (quasi-dipole) current loops, representing ionospheric source complexity smoothed by Earth rotation. Free parameters in the source covariance model are tuned by a leave-one-out cross-validation scheme. (3) The estimated data modes are inverted for 3-D Earth conductivity, assuming the source excitation estimated in step 2. Together, these developments constitute key components in a practical scheme for simultaneous inversion of the catalogue of historical and modern observatory data for external source spatial structure and 3-D Earth conductivity.

Higgs-flavon mixing and LHC phenomenology in a simplified model of broken flavor symmetry [Higgs boson physics and broken flavor symmetry - LHC phenomenology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berger, Edmond L.; Giddings, Steven B.; Wang, Haichen

2014-10-10

Here, the LHC phenomenology of a low-scale gauged flavor symmetry model with inverted hierarchy is studied, through introduction of a simplified model of broken flavor symmetry. A new scalar (a flavon) and a new neutral top-philic massive gauge boson emerge with mass in the TeV range, along with a new heavy fermion associated with the standard model top quark. After checking constraints from electroweak precision observables, we investigate the influence of the model on Higgs boson physics, notably on its production cross section and decay branching fractions. Limits on the flavon φ from heavy Higgs boson searches at the LHCmore » at 7 and 8 TeV are presented. The branching fractions of the flavon are computed as a function of the flavon mass and the Higgs-flavon mixing angle. We also explore possible discovery of the flavon at 14 TeV, particularly via the φ → Z 0Z 0 decay channel in the 2ℓ2ℓ' final state, and through standard model Higgs boson pair production φ → hh in the b¯bγγ final state. We conclude that the flavon mass range up to 500 GeV could be probed down to quite small values of the Higgs-flavon mixing angle with 100 fb –1 of integrated luminosity at 14 TeV.« less

Addressing Control of Hazardous Energy (COHE) Requirements in a Laser Safety Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woods, Michael; /SLAC

OSHA regulation 29CFR1910.147 specifies control of hazardous energy requirements for 'the servicing and maintenance of machines and equipment in which the unexpected energization or start up of the machines or equipment, or release of stored energy could cause injury to employees.' Class 3B and Class 4 laser beams must be considered hazardous energy sources because of the potential for serious eye injury; careful consideration is therefore needed to safely de-energize these lasers. This paper discusses and evaluates control of hazardous energy principles in this OSHA regulation, in ANSI Z136.1 ''Safe Use of Lasers,'' and in ANSI Z244.1 ''Control of Hazardousmore » Energy, Lockout/Tagout and Alternative Methods.'' Recommendations are made for updating and improving CoHE (control of hazardous energy) requirements in these standards for their applicability to safe laser operations.« less

Pulse width modulation inverter with battery charger

DOEpatents

Slicker, James M.

1985-01-01

An inverter is connected between a source of DC power and a three-phase AC induction motor, and a microprocessor-based circuit controls the inverter using pulse width modulation techniques. In the disclosed method of pulse width modulation, both edges of each pulse of a carrier pulse train are equally modulated by a time proportional to sin .theta., where .theta. is the angular displacement of the pulse center at the motor stator frequency from a fixed reference point on the carrier waveform. The carrier waveform frequency is a multiple of the motor stator frequency. The modulated pulse train is then applied to each of the motor phase inputs with respective phase shifts of 120.degree. at the stator frequency. Switching control commands for electronic switches in the inverter are stored in a random access memory (RAM) and the locations of the RAM are successively read out in a cyclic manner, each bit of a given RAM location controlling a respective phase input of the motor. The DC power source preferably comprises rechargeable batteries and all but one of the electronic switches in the inverter can be disabled, the remaining electronic switch being part of a "flyback" DC-DC converter circuit for recharging the battery.

Pulse width modulation inverter with battery charger

NASA Technical Reports Server (NTRS)

Slicker, James M. (Inventor)

1985-01-01

An inverter is connected between a source of DC power and a three-phase AC induction motor, and a microprocessor-based circuit controls the inverter using pulse width modulation techniques. In the disclosed method of pulse width modulation, both edges of each pulse of a carrier pulse train are equally modulated by a time proportional to sin .theta., where .theta. is the angular displacement of the pulse center at the motor stator frequency from a fixed reference point on the carrier waveform. The carrier waveform frequency is a multiple of the motor stator frequency. The modulated pulse train is then applied to each of the motor phase inputs with respective phase shifts of 120.degree. at the stator frequency. Switching control commands for electronic switches in the inverter are stored in a random access memory (RAM) and the locations of the RAM are successively read out in a cyclic manner, each bit of a given RAM location controlling a respective phase input of the motor. The DC power source preferably comprises rechargeable batteries and all but one of the electronic switches in the inverter can be disabled, the remaining electronic switch being part of a flyback DC-DC converter circuit for recharging the battery.

Development and Psychometric Testing of the Strategy Inventory for Language Learning (SILL). Appendix

DTIC Science & Technology

1986-11-01

I c 0A 00r . O"C:0. JUm 3 M1. : - z I a0 U ~ 4 044 01 I C -1 .. >.* c. 0.1 A 0 WIX W wu C 0 10 0161c 0 .5 0 4.O1 C 00)id 0.t A12 -On-r L Vrrn- n- u... WIx in ug ug c US mug mcug NL 19,II 1-z w NO I SO W I VI m00 g 01 010 1 a~~ gA >. It m~) * .8 S~l Zaga ~ Z.Ig-.j ..I Z...j -A Z..J-.jNI .. a4.. N c- I...8217.I7. ~ ~ a f %.a 0,%D Im 2. 4 @C;CCCCC@@.oooooCooooaooooaooooooooa Z 9 O a I& A, I I I 1 4 0 LL. La @N %DA Web -Ina %b a W a N C’?C aP.0 a 0 % WN 0

The Transposon Galileo Generates Natural Chromosomal Inversions in Drosophila by Ectopic Recombination

PubMed Central

Delprat, Alejandra; Ruiz, Alfredo

2009-01-01

Background Transposable elements (TEs) are responsible for the generation of chromosomal inversions in several groups of organisms. However, in Drosophila and other Dipterans, where inversions are abundant both as intraspecific polymorphisms and interspecific fixed differences, the evidence for a role of TEs is scarce. Previous work revealed that the transposon Galileo was involved in the generation of two polymorphic inversions of Drosophila buzzatii. Methodology/Principal Findings To assess the impact of TEs in Drosophila chromosomal evolution and shed light on the mechanism involved, we isolated and sequenced the two breakpoints of another widespread polymorphic inversion from D. buzzatii, 2z 3. In the non inverted chromosome, the 2z 3 distal breakpoint was located between genes CG2046 and CG10326 whereas the proximal breakpoint lies between two novel genes that we have named Dlh and Mdp. In the inverted chromosome, the analysis of the breakpoint sequences revealed relatively large insertions (2,870-bp and 4,786-bp long) including two copies of the transposon Galileo (subfamily Newton), one at each breakpoint, plus several other TEs. The two Galileo copies: (i) are inserted in opposite orientation; (ii) present exchanged target site duplications; and (iii) are both chimeric. Conclusions/Significance Our observations provide the best evidence gathered so far for the role of TEs in the generation of Drosophila inversions. In addition, they show unequivocally that ectopic recombination is the causative mechanism. The fact that the three polymorphic D. buzzatii inversions investigated so far were generated by the same transposon family is remarkable and is conceivably due to Galileo's unusual structure and current (or recent) transpositional activity. PMID:19936241

Module Embedded Micro-inverter Smart Grid Ready Residential Solar Electric System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agamy, Mohammed

The “Module Embedded Micro-inverter Smart Grid Ready Residential Solar Electric System” program is focused on developing innovative concepts for residential photovoltaic (PV) systems with the following objectives: to create an Innovative micro-inverter topology that reduces the cost from the best in class micro-inverter and provides high efficiency (>96% CEC - California Energy Commission), and 25+ year warranty, as well as reactive power support; integrate micro-inverter and PV module to reduce system price by at least $0.25/W through a) accentuating dual use of the module metal frame as a large area heat spreader reducing operating temperature, and b) eliminating redundant wiringmore » and connectors; and create micro-inverter controller handles smart grid and safety functions to simplify implementation and reduce cost.« less

Dollar Summary of Prime Contract Awards by Contractor, State or Country, and Place. Part 3 (E&E Reisen - Hiawatha Rubber Co)

DTIC Science & Technology

1990-01-01

w ui 3j W3A b a w ww w w u i U j L A u a w Wa 4*to a o a N C4 anL (a "Cc cm em an a aD a A a GOO F6 46 404 S. >0 I.J man com 04 R 12 CM e4cc ~ m I...I WC: I co r aCCa 001 I-I 0. 0 NCJ o #1.U0 1-- 44 4 -4W C )C (JN -4~y 001 4 4 1I~ C’I1- mmcoco 44 I I. 4 C . a I- U. >- -4.- 010 00 - 1 . Za -C 4 vm...6W1-6z x. z-z- U~.L 4c -C I.--.4- z~L L W~mm 09~ ac -4- U..CI -I io ACLZ 0 U 3 0 0 (0 62 0 z I. zzz (A 6 000 Csd 314" 6 6 CA (ft 4.WU U . U A F4 F6 I I

An UPLC-MS/MS method for separation and accurate quantification of tamoxifen and its metabolites isomers.

PubMed

Arellano, Cécile; Allal, Ben; Goubaa, Anwar; Roché, Henri; Chatelut, Etienne

2014-11-01

A selective and accurate analytical method is needed to quantify tamoxifen and its phase I metabolites in a prospective clinical protocol, for evaluation of pharmacokinetic parameters of tamoxifen and its metabolites in adjuvant treatment of breast cancer. The selectivity of the analytical method is a fundamental criteria to allow the quantification of the main active metabolites (Z)-isomers from (Z)'-isomers. An UPLC-MS/MS method was developed and validated for the quantification of (Z)-tamoxifen, (Z)-endoxifen, (E)-endoxifen, Z'-endoxifen, (Z)'-endoxifen, (Z)-4-hydroxytamoxifen, (Z)-4'-hydroxytamoxifen, N-desmethyl tamoxifen, and tamoxifen-N-oxide. The validation range was set between 0.5ng/mL and 125ng/mL for 4-hydroxytamoxifen and endoxifen isomers, and between 12.5ng/mL and 300ng/mL for tamoxifen, tamoxifen N-desmethyl and tamoxifen-N-oxide. The application to patient plasma samples was performed. Copyright © 2014 Elsevier B.V. All rights reserved.

Transistorized PWM inverter-induction motor drive system

NASA Technical Reports Server (NTRS)

Peak, S. C.; Plunkett, A. B.

1982-01-01

This paper describes the development of a transistorized PWM inverter-induction motor traction drive system. A vehicle performance analysis was performed to establish the vehicle tractive effort-speed requirements. These requirements were then converted into a set of inverter and motor specifications. The inverter was a transistorized three-phase bridge using General Electric power Darlington transistors. The description of the design and development of this inverter is the principal object of this paper. The high-speed induction motor is a design which is optimized for use with an inverter power source. The primary feedback control is a torque angle control with voltage and torque outer loop controls. A current-controlled PWM technique is used to control the motor voltage. The drive has a constant torque output with PWM operation to base motor speed and a constant horsepower output with square wave operation to maximum speed. The drive system was dynamometer tested and the results are presented.

The Dispersion of Fast Radio Bursts from a Structured Intergalactic Medium at Redshifts z < 1.5

NASA Astrophysics Data System (ADS)

Shull, J. Michael; Danforth, Charles W.

2018-01-01

We analyze the sources of free electrons that produce the large dispersion measures, {DM}≈ 300{--}1600 (in units of cm‑3 pc), observed toward fast radio bursts (FRBs). Individual galaxies typically produce {DM}∼ 25{--}60 {{cm}}-3 {pc} from ionized gas in their disk, disk-halo interface, and circumgalactic medium. Toward an FRB source at redshift z, a homogeneous intergalactic medium (IGM) containing a fraction {f}{IGM} of cosmological baryons will produce {DM}=(935 {{cm}}-3 {pc}){f}{IGM} {h}70-1I(z), where I{(z)=(2/3{{{Ω }}}m)[\\{{{{Ω }}}m(1+z)}3+{{{Ω }}}{{Λ }}\\}{}1/2-1]. A structured IGM of photoionized Lyα absorbers in the cosmic web produces similar dispersion, modeled from the observed distribution, {f}b(N,z), of H I (Lyα-forest) absorbers in column density and redshift with ionization corrections and scaling relations from cosmological simulations. An analytic formula for DM(z) applied to observed FRB dispersions suggests that {z}{FRB}≈ 0.2{--}1.5 for an IGM containing a significant baryon fraction, {f}{IGM}=0.6+/- 0.1. Future surveys of the statistical distribution, DM(z), of FRBs identified with specific galaxies and redshifts can be used to calibrate the IGM baryon fraction and distribution of Lyα absorbers. Fluctuations in DM at the level ±10 cm‑3 pc will arise from filaments and voids in the cosmic web.

Mitigation of nitrous oxide emissions from soils by Bradyrhizobium japonicum inoculation

NASA Astrophysics Data System (ADS)

Itakura, Manabu; Uchida, Yoshitaka; Akiyama, Hiroko; Hoshino, Yuko Takada; Shimomura, Yumi; Morimoto, Sho; Tago, Kanako; Wang, Yong; Hayakawa, Chihiro; Uetake, Yusuke; Sánchez, Cristina; Eda, Shima; Hayatsu, Masahito; Minamisawa, Kiwamu

2013-03-01

Nitrous oxide (N2O) is a greenhouse gas that is also capable of destroying the ozone layer. Agricultural soil is the largest source of N2O (ref. ). Soybean is a globally important leguminous crop, and hosts symbiotic nitrogen-fixing soil bacteria (rhizobia) that can also produce N2O (ref. ). In agricultural soil, N2O is emitted from fertilizer and soil nitrogen. In soybean ecosystems, N2O is also emitted from the degradation of the root nodules. Organic nitrogen inside the nodules is mineralized to NH4+, followed by nitrification and denitrification that produce N2O. N2O is then emitted into the atmosphere or is further reduced to N2 by N2O reductase (N2OR), which is encoded by the nosZ gene. Pure culture and vermiculite pot experiments showed lower N2O emission by nosZ+ strains and nosZ++ strains (mutants with increased N2OR activity) of Bradyrhizobium japonicum than by nosZ- strains. A pot experiment using soil confirmed these results. Although enhancing N2OR activity has been suggested as a N2O mitigation option, this has never been tested in the field. Here, we show that post-harvest N2O emission from soybean ecosystems due to degradation of nodules can be mitigated by inoculation of nosZ+ and non-genetically modified organism nosZ++ strains of B. japonicum at a field scale.

INVERTING CASCADE IMPACTOR DATA FOR SIZE-RESOLVED CHARACTERIZATION OF FINE PARTICULATE SOURCE EMISSIONS

EPA Science Inventory

Cascade impactors are particularly useful in determining the mass size distributions of particulate and individual chemical species. The impactor raw data must be inverted to reconstruct a continuous particle size distribution. An inversion method using a lognormal function for p...

Lepton flavor universality violation without new sources of quark flavor violation

NASA Astrophysics Data System (ADS)

Kamenik, Jernej F.; Soreq, Yotam; Zupan, Jure

2018-02-01

We show that new physics models without new flavor violating interactions can explain the recent anomalies in the b →s ℓ+ℓ- transitions. The b →s ℓ+ℓ- arises from a Z' penguin which automatically predicts the V -A structure for the quark currents in the effective operators. This framework can either be realized in a renormalizable U (1 )' setup or be due to new strongly interacting dynamics. The dimuon resonance searches at the LHC are becoming sensitive to this scenario since the Z' is relatively light, and could well be discovered in future searches by ATLAS and CMS.

Crystal structure of (1Z,4Z)-2,4-dimethyl-3H-benzo[b][1,4]diazepine

PubMed Central

Nieto, Carla I.; Claramunt, Rosa M.; Torralba, M. Carmen; Torres, M. Rosario; Elguero, Jose

2017-01-01

The title compound, C11H12N2, is not planar due to the folding of the seven-membered ring. In the crystal, mol­ecules are packed opposite each other to minimize the electronic repulsion but the long inter­molecular distances indicate that no directional contacts are found. PMID:28529767

Mixed-metal uranium(VI) iodates: hydrothermal syntheses, structures, and reactivity of Rb[UO(2)(CrO(4))(IO(3))(H(2)O)], A(2)[UO(2)(CrO(4))(IO(3))(2)] (A = K, Rb, Cs), and K(2)[UO(2)(MoO(4))(IO(3))(2)].

PubMed

Sykora, Richard E; McDaniel, Steven M; Wells, Daniel M; Albrecht-Schmitt, Thomas E

2002-10-07

The reactions of the molecular transition metal iodates A[CrO(3)(IO(3))] (A = K, Rb, Cs) with UO(3) under mild hydrothermal conditions provide access to four new, one-dimensional, uranyl chromatoiodates, Rb[UO(2)(CrO(4))(IO(3))(H(2)O)] (1) and A(2)[UO(2)(CrO(4))(IO(3))(2)] (A = K (2), Rb (3), Cs (4)). Under basic conditions, MoO(3), UO(3), and KIO(4) can be reacted to form K(2)[UO(2)(MoO(4))(IO(3))(2)] (5), which is isostructural with 2 and 3. The structure of 1 consists of one-dimensional[UO(2)(CrO(4))(IO(3))(H(2)O)](-) ribbons that contain uranyl moieties bound by bridging chromate and iodate anions as well as a terminal water molecule to create [UO(7)] pentagonal bipyramidal environments around the U(VI) centers. These ribbons are separated from one another by Rb(+) cations. When the iodate content is increased in the hydrothermal reactions, the terminal water molecule is replaced by a monodentate iodate anion to yield 2-4. These ribbons can be further modified by replacing tetrahedral chromate anions with MoO(4)(2)(-) anions to yield isostructural, one-dimensional [UO(2)(MoO(4))(IO(3))(2)](2)(-) ribbons. Crystallographic data: 1, triclinic, space group P(-)1, a = 7.3133(5) A, b = 8.0561(6) A, c = 8.4870(6) A, alpha = 88.740(1) degrees, beta = 87.075(1) degrees, gamma = 71.672(1) degrees, Z = 2; 2, monoclinic, space group P2(1)/c, a = 11.1337(5) A, b = 7.2884(4) A, c = 15.5661(7) A, beta = 107.977(1) degrees, Z = 4; 3, monoclinic, space group P2(1)/c, a = 11.3463(6) A, b = 7.3263(4) A, c = 15.9332(8) A, beta = 108.173(1) degrees, Z = 4; 4, monoclinic, space group P2(1)/n, a = 7.3929(5) A, b = 8.1346(6) A, c = 22.126(2) A, beta = 90.647(1) degrees, Z = 4; 5, monoclinic, space group P2(1)/c, a = 11.3717(6) A, b = 7.2903(4) A, c = 15.7122(8) A, beta = 108.167(1) degrees, Z = 4.

Evaluation of the Immunologic Impact of RAF Inhibitors to Guide Optimal Combination of RAF Inhibitors and Immunotherapy for the Treatment of Advanced Melanoma

DTIC Science & Technology

2016-03-01

TILS (Vehicle) Fr eq o f P ar en t CD4+ T cells CD4+CD25+Foxp3+ CD8+ CD8+PD1+ CD8+GrzB...PDL1+ CD 4+ T ce lls CD 4+ CD 25 +F ox p3 + CD 8+ CD 8+ PD 1+ CD 8+ Gr zB + CD 8+ Ki6 7+ 0 10 20 30 40 Day 5 - TILS (BRAFi) Fr eq o f P ar en t...ce lls CD 4+ CD 25 +F ox p3 + CD 8+ CD 8+ PD 1+ CD 8+ Gr zB + CD 8+ Ki6 7+ 0 10 20 30 40 Day 2 - TILS (Vehicle) Fr eq o f P ar en t CD4+ T cells

Flight Tunnel Response of Male European Corn Borer Moths to Cross-Specific Mixtures of European and Asian Corn Borer Sex Pheromones: Evidence Supporting a Critical Stage in Evolution of a New Communication System.

PubMed

Martin, Nathan; Moore, Kevin; Musto, Callie J; Linn, Charles E

2016-01-01

Previous flight tunnel studies showed that 3-5 % of male European corn borer (ECB) moths, Ostrinia nubilalis, could fly upwind and make contact with sources releasing the sex pheromone of the closely related Asian corn borer (ACB), Ostrina furnacalis, [2:1 (Z)-12-tetradecenyl acetate (Z12-14:OAc) : (E)-12-teradecenyl acetate (E12-14:OAc)] and that 2-4 % of ACB males could similarly fly upwind to the sex pheromone blends of the ECB Z- [97:3 (Z)-tetradecenyl acetate (Z11-14:OAc) : (E)-tetradecenyl acetate (E11-14:Ac)] and E-strains (1:99 Z/E11-14:OAc) pheromones. The results supported the hypothesis that the evolution of the ACB pheromone system from an ECB-like ancestor included a stage in which males could be attracted to the unusual females emitting Z12- and E12-14:OAc while retaining their responsiveness to the ancestral pheromone blend of Z11- and E11-14:OAc. Here, we showed further that ECB E-strain males exhibited upwind oriented flight and source contacts to sources containing all combinations of ECB and ACB components. Maximal response levels were observed with the E-strain 99:1 E11/Z11-14:OAc blend, and high response levels also were observed with two other blends containing E11-14:OAc as the major component (E11:E12 and E11:Z12). Upwind flight and source contact also occurred at lower levels with the remaining blend combinations in which Z11-, E12-, or Z12-14:OAc was the major component. Our current results support the hypothesis concerning the evolution of ACB from an ECB-like ancester by showing that males were able to respond to females producing either the 12-14:Ac isomers, 11-14:Ac isomers, or even mixtures of all four components.

Domestic Contractor Establishment Code (CEC) Alphabetical Listing. (A and C Electrical-North Bridge Plaza Inc.). Fiscal Year 1993. Volume 2

DTIC Science & Technology

1994-03-01

N~~~W 314’𔃺 tun ~~ 0 -z -CI RO 9.40. goo I..~rr-0 0N E . z- 0- E. -! t eq 14 R IN~ 0 00 5- h. C, ZWD u L LI 7 I-, ’ Iq CUZZ , UE -U~bU 2 UiI 8 ,a 4 -D...U8 0 U I-~ U UU. U" U cy-ý 𔃺 a I0 .00~o 4. 90 9 0 0’, 1 wO"Q a,~O0 -. h-- 221 * In~ 0u tunN vu) tun -w 0%0% -w%%~c In In.I SRu C, 20 8~98 0 -’C rmjw...0zI oo :9 _l go co AZ u 0~’.A~-( ~ 2(A (C U 0g -0 00 20 En~ýfR RR R R RE .E 0 b4(~ -u u- A u u u U 000Q -0 ýR Z2 0 L~ Es TZ 2 T! :g -’ t3 S tun >4 m

An Analytic Solution for Surface Source Sigma Z Calculations.

DTIC Science & Technology

1981-01-01

diabatic influence function , dimensionless temperature gradient 20. continued. - urbulence as a function of stability for inversion conditions. The...diabatic influence function (f). The unstable u = u,(In(z/zo) - )/k (4) regime diabatic influence function as defined by Paulson (1970) is presented in

Probing the Metal Enrichment of the Intergalactic Medium at z = 5–6 Using the Hubble Space Telescope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cai, Zheng; Fan, Xiaohui; Dave, Romeel

We test the galactic outflow model by probing associated galaxies of four strong intergalactic C iv absorbers at z = 5–6 using the Hubble Space Telescope ( HST ) Advanced Camera for Surveys (ACS) ramp narrowband filters. The four strong C iv absorbers reside at z = 5.74, 5.52, 4.95, and 4.87, with column densities ranging from N {sub Civ} = 10{sup 13.8} to 10{sup 14.8} cm{sup −2}. At z = 5.74, we detect an i-dropout Ly α emitter (LAE) candidate with a projected impact parameter of 42 physical kpc from the C iv absorber. This LAE candidate has amore » Ly α -based star formation rate (SFR{sub Lyα} ) of 2 M {sub ⊙} yr{sup −1} and a UV-based SFR of 4 M {sub ⊙} yr{sup −1}. Although we cannot completely rule out that this i-dropout emitter may be an [O ii] interloper, its measured properties are consistent with the C iv powered galaxy at z = 5.74. For C iv absorbers at z = 4.95 and z = 4.87, although we detect two LAE candidates with impact parameters of 160 and 200 kpc, such distances are larger than that predicted from the simulations. Therefore, we treat them as nondetections. For the system at z = 5.52, we do not detect LAE candidates, placing a 3 σ upper limit of SFR{sub Lyα} ≈ 1.5 M {sub ⊙} yr{sup −1}. In summary, in these four cases, we only detect one plausible C iv source at z = 5.74. Combining the modest SFR of the one detection and the three nondetections, our HST observations strongly support that smaller galaxies (SFR{sub Lyα} ≲ 2 M {sub ⊙} yr{sup −1}) are main sources of intergalactic C iv absorbers, and such small galaxies play a major role in the metal enrichment of the intergalactic medium at z ≳ 5.« less

A new on-chip all-digital three-phase full-bridge dc/ac power inverter with feedforward and frequency control techniques.

PubMed

Chen, Jiann-Jong; Kung, Che-Min

2010-09-01

The communication speed between components is far from satisfactory. To achieve high speed, simple control system configuration, and low cost, a new on-chip all-digital three-phase dc/ac power inverter using feedforward and frequency control techniques is proposed. The controller of the proposed power inverter, called the shift register, consists of six-stage D-latch flip-flops with a goal of achieving low-power consumption and area efficiency. Variable frequency is achieved by controlling the clocks of the shift register. One advantage regarding the data signal (D) and the common clock (CK) is that, regardless of the phase difference between the two, all of the D-latch flip-flops are capable of delaying data by one CK period. To ensure stability, the frequency of CK must be six times higher than that of D. The operation frequency of the proposed power inverter ranges from 10 Hz to 2 MHz, and the maximum output loading current is 0.8 A. The prototype of the proposed circuit has been fabricated with TSMC 0.35 μm 2P4M CMOS processes. The total chip area is 2.333 x 1.698 mm2. The three-phase dc/ac power inverter is applicable in uninterrupted power supplies, cold cathode fluorescent lamps, and motors, because of its ability to convert the dc supply voltage into the three-phase ac power sources.

ULTRA STEEP SPECTRUM RADIO SOURCES IN THE LOCKMAN HOLE: SERVS IDENTIFICATIONS AND REDSHIFT DISTRIBUTION AT THE FAINTEST RADIO FLUXES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Afonso, J.; Bizzocchi, L.; Grossi, M.

2011-12-20

Ultra steep spectrum (USS) radio sources have been successfully used to select powerful radio sources at high redshifts (z {approx}> 2). Typically restricted to large-sky surveys and relatively bright radio flux densities, it has gradually become possible to extend the USS search to sub-mJy levels, thanks to the recent appearance of sensitive low-frequency radio facilities. Here a first detailed analysis of the nature of the faintest USS sources is presented. By using Giant Metrewave Radio Telescope and Very Large Array radio observations of the Lockman Hole at 610 MHz and 1.4 GHz, a sample of 58 USS sources, with 610more » MHz integrated fluxes above 100 {mu}Jy, is assembled. Deep infrared data at 3.6 and 4.5 {mu}m from the Spitzer Extragalactic Representative Volume Survey (SERVS) are used to reliably identify counterparts for 48 (83%) of these sources, showing an average total magnitude of [3.6]{sub AB} = 19.8 mag. Spectroscopic redshifts for 14 USS sources, together with photometric redshift estimates, improved by the use of the deep SERVS data, for a further 19 objects, show redshifts ranging from z = 0.1 to z = 2.8, peaking at z {approx} 0.6 and tailing off at high redshifts. The remaining 25 USS sources, with no redshift estimate, include the faintest [3.6] magnitudes, with 10 sources undetected at 3.6 and 4.5 {mu}m (typically [3.6] {approx}> 22-23 mag from local measurements), which suggests the likely existence of higher redshifts among the sub-mJy USS population. The comparison with the Square Kilometre Array Design Studies Simulated Skies models indicates that Fanaroff-Riley type I radio sources and radio-quiet active galactic nuclei may constitute the bulk of the faintest USS population, and raises the possibility that the high efficiency of the USS technique for the selection of high-redshift sources remains even at the sub-mJy level.« less

Long-term nutrient addition differentially alters community composition and diversity of genes that control nitrous oxide flux from salt marsh sediments

NASA Astrophysics Data System (ADS)

Kearns, Patrick J.; Angell, John H.; Feinman, Sarah G.; Bowen, Jennifer L.

2015-03-01

Enrichment of natural waters, soils, and sediments by inorganic nutrients, including nitrogen, is occurring at an increasing rate and has fundamentally altered global biogeochemical cycles. Salt marshes are critical for the removal of land-derived nitrogen before it enters coastal waters. This is accomplished via multiple microbially mediated pathways, including denitrification. Many of these pathways, however, are also a source of the greenhouse gas nitrous oxide (N2O). We used clone libraries and quantative PCR (qPCR) to examine the effect of fertilization on the diversity and abundance of two functional genes associated with denitrification and N2O production (norB and nosZ) in experimental plots at the Great Sippewissett Salt Marsh (Falmouth, MA, USA) that have been enriched with nutrients for over 40 years. Our data showed distinct nosZ and norB community structures at different nitrogen loads, especially at the highest level of fertilization. Furthermore, calculations of the Shannon Diversity Index and Chao1 Richness Estimator indicated that nosZ gene diversity and richness increased with increased nitrogen supply, however no such relationship existed with regard to richness and diversity of the norB gene. Results from qPCR demonstrated that nosZ gene abundance was an order of magnitude lower in the extra-highly fertilized plots compared to the other plots, but the abundance of norB was not affected by fertilization. The majority of sequences obtained from the marsh plots had no close cultured relatives and they were divergent from previously sequenced norB and nosZ fragments. Despite their divergence from any cultured representatives, most of the norB and nosZ sequences appeared to be from members of the Alpha- and Betaproteobacteria, suggesting that these classes are particularly important in salt marsh nitrogen cycling. Our results suggest that both norB and nosZ containing microbes are affected by fertilization and that the Great Sippewissett Marsh may harbor distinct clades of novel denitrifying microorganisms that are responsible for both the production and removal of N2O.

Planck intermediate results: XXVII. High-redshift infrared galaxy overdensity candidates and lensed sources discovered by Planck and confirmed by Herschel -SPIRE

DOE PAGES

Aghanim, N.; Altieri, B.; Arnaud, M.; ...

2015-09-30

We have used the Planck all-sky submillimetre and millimetre maps to search for rare sources distinguished by extreme brightness, a few hundred millijanskies, and their potential for being situated at high redshift. These “cold” Planck sources, selected using the High Frequency Instrument (HFI) directly from the maps and from the Planck Catalogue of Compact Sources (PCCS), all satisfy the criterion of having their rest-frame far-infrared peak redshifted to the frequency range 353–857 GHz. This colour-selection favours galaxies in the redshift range z = 2–4, which we consider as cold peaks in the cosmic infrared background. With a 4'.5 beam atmore » the four highest frequencies, our sample is expected to include overdensities of galaxies in groups or clusters, lensed galaxies, and chance line-of-sight projections. In this paper, we perform a dedicated Herschel-SPIRE follow-up of 234 such Planck targets, finding a significant excess of red 350 and 500μm sources, in comparison to reference SPIRE fields. About 94% of the SPIRE sources in the Planck fields are consistent with being overdensities of galaxies peaking at 350μm, with 3% peaking at 500μm, and none peaking at 250μm. About 3% are candidate lensed systems, all 12 of which have secure spectroscopic confirmations, placing them at redshifts z> 2.2. Only four targets are Galactic cirrus, yielding a success rate in our search strategy for identifying extragalactic sources within the Planck beam of better than 98%. The galaxy overdensities are detected with high significance, half of the sample showing statistical significance above 10σ. The SPIRE photometric redshifts of galaxies in overdensities suggest a peak at z ≃ 2, assuming a single common dust temperature for the sources of T d = 35 K. Under this assumption, we derive an infrared (IR) luminosity for each SPIRE source of about 4 × 10 12L ⊙, yielding star formation rates of typically 700 M ⊙ yr -1. If the observed overdensities are actual gravitationally-bound structures, the total IR luminosity of all their SPIRE-detected sources peaks at 4 × 10 13L ⊙, leading to total star formation rates of perhaps 7 × 10 3M ⊙ yr -1 per overdensity. Taken together, these sources show the signatures of high-z (z> 2) protoclusters of intensively star-forming galaxies. Finally, all these observations confirm the uniqueness of our sample compared to reference samples and demonstrate the ability of the all-skyPlanck-HFI cold sources to select populations of cosmological and astrophysical interest for structure formation studies.« less

Planck intermediate results: XXVII. High-redshift infrared galaxy overdensity candidates and lensed sources discovered by Planck and confirmed by Herschel -SPIRE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aghanim, N.; Altieri, B.; Arnaud, M.

We have used the Planck all-sky submillimetre and millimetre maps to search for rare sources distinguished by extreme brightness, a few hundred millijanskies, and their potential for being situated at high redshift. These “cold” Planck sources, selected using the High Frequency Instrument (HFI) directly from the maps and from the Planck Catalogue of Compact Sources (PCCS), all satisfy the criterion of having their rest-frame far-infrared peak redshifted to the frequency range 353–857 GHz. This colour-selection favours galaxies in the redshift range z = 2–4, which we consider as cold peaks in the cosmic infrared background. With a 4'.5 beam atmore » the four highest frequencies, our sample is expected to include overdensities of galaxies in groups or clusters, lensed galaxies, and chance line-of-sight projections. In this paper, we perform a dedicated Herschel-SPIRE follow-up of 234 such Planck targets, finding a significant excess of red 350 and 500μm sources, in comparison to reference SPIRE fields. About 94% of the SPIRE sources in the Planck fields are consistent with being overdensities of galaxies peaking at 350μm, with 3% peaking at 500μm, and none peaking at 250μm. About 3% are candidate lensed systems, all 12 of which have secure spectroscopic confirmations, placing them at redshifts z> 2.2. Only four targets are Galactic cirrus, yielding a success rate in our search strategy for identifying extragalactic sources within the Planck beam of better than 98%. The galaxy overdensities are detected with high significance, half of the sample showing statistical significance above 10σ. The SPIRE photometric redshifts of galaxies in overdensities suggest a peak at z ≃ 2, assuming a single common dust temperature for the sources of T d = 35 K. Under this assumption, we derive an infrared (IR) luminosity for each SPIRE source of about 4 × 10 12L ⊙, yielding star formation rates of typically 700 M ⊙ yr -1. If the observed overdensities are actual gravitationally-bound structures, the total IR luminosity of all their SPIRE-detected sources peaks at 4 × 10 13L ⊙, leading to total star formation rates of perhaps 7 × 10 3M ⊙ yr -1 per overdensity. Taken together, these sources show the signatures of high-z (z> 2) protoclusters of intensively star-forming galaxies. Finally, all these observations confirm the uniqueness of our sample compared to reference samples and demonstrate the ability of the all-skyPlanck-HFI cold sources to select populations of cosmological and astrophysical interest for structure formation studies.« less

Planck intermediate results. XXVII. High-redshift infrared galaxy overdensity candidates and lensed sources discovered by Planck and confirmed by Herschel-SPIRE

NASA Astrophysics Data System (ADS)

Planck Collaboration; Aghanim, N.; Altieri, B.; Arnaud, M.; Ashdown, M.; Aumont, J.; Baccigalupi, C.; Banday, A. J.; Barreiro, R. B.; Bartolo, N.; Battaner, E.; Beelen, A.; Benabed, K.; Benoit-Lévy, A.; Bernard, J.-P.; Bersanelli, M.; Bethermin, M.; Bielewicz, P.; Bonavera, L.; Bond, J. R.; Borrill, J.; Bouchet, F. R.; Boulanger, F.; Burigana, C.; Calabrese, E.; Canameras, R.; Cardoso, J.-F.; Catalano, A.; Chamballu, A.; Chary, R.-R.; Chiang, H. C.; Christensen, P. R.; Clements, D. L.; Colombi, S.; Couchot, F.; Crill, B. P.; Curto, A.; Danese, L.; Dassas, K.; Davies, R. D.; Davis, R. J.; de Bernardis, P.; de Rosa, A.; de Zotti, G.; Delabrouille, J.; Diego, J. M.; Dole, H.; Donzelli, S.; Doré, O.; Douspis, M.; Ducout, A.; Dupac, X.; Efstathiou, G.; Elsner, F.; Enßlin, T. A.; Falgarone, E.; Flores-Cacho, I.; Forni, O.; Frailis, M.; Fraisse, A. A.; Franceschi, E.; Frejsel, A.; Frye, B.; Galeotta, S.; Galli, S.; Ganga, K.; Giard, M.; Gjerløw, E.; González-Nuevo, J.; Górski, K. M.; Gregorio, A.; Gruppuso, A.; Guéry, D.; Hansen, F. K.; Hanson, D.; Harrison, D. L.; Helou, G.; Hernández-Monteagudo, C.; Hildebrandt, S. R.; Hivon, E.; Hobson, M.; Holmes, W. A.; Hovest, W.; Huffenberger, K. M.; Hurier, G.; Jaffe, A. H.; Jaffe, T. R.; Keihänen, E.; Keskitalo, R.; Kisner, T. S.; Kneissl, R.; Knoche, J.; Kunz, M.; Kurki-Suonio, H.; Lagache, G.; Lamarre, J.-M.; Lasenby, A.; Lattanzi, M.; Lawrence, C. R.; Le Floc'h, E.; Leonardi, R.; Levrier, F.; Liguori, M.; Lilje, P. B.; Linden-Vørnle, M.; López-Caniego, M.; Lubin, P. M.; Macías-Pérez, J. F.; MacKenzie, T.; Maffei, B.; Mandolesi, N.; Maris, M.; Martin, P. G.; Martinache, C.; Martínez-González, E.; Masi, S.; Matarrese, S.; Mazzotta, P.; Melchiorri, A.; Mennella, A.; Migliaccio, M.; Moneti, A.; Montier, L.; Morgante, G.; Mortlock, D.; Munshi, D.; Murphy, J. A.; Natoli, P.; Negrello, M.; Nesvadba, N. P. H.; Novikov, D.; Novikov, I.; Omont, A.; Pagano, L.; Pajot, F.; Pasian, F.; Perdereau, O.; Perotto, L.; Perrotta, F.; Pettorino, V.; Piacentini, F.; Piat, M.; Plaszczynski, S.; Pointecouteau, E.; Polenta, G.; Popa, L.; Pratt, G. W.; Prunet, S.; Puget, J.-L.; Rachen, J. P.; Reach, W. T.; Reinecke, M.; Remazeilles, M.; Renault, C.; Ristorcelli, I.; Rocha, G.; Roudier, G.; Rusholme, B.; Sandri, M.; Santos, D.; Savini, G.; Scott, D.; Spencer, L. D.; Stolyarov, V.; Sunyaev, R.; Sutton, D.; Sygnet, J.-F.; Tauber, J. A.; Terenzi, L.; Toffolatti, L.; Tomasi, M.; Tristram, M.; Tucci, M.; Umana, G.; Valenziano, L.; Valiviita, J.; Valtchanov, I.; Van Tent, B.; Vieira, J. D.; Vielva, P.; Wade, L. A.; Wandelt, B. D.; Wehus, I. K.; Welikala, N.; Zacchei, A.; Zonca, A.

2015-10-01

We have used the Planck all-sky submillimetre and millimetre maps to search for rare sources distinguished by extreme brightness, a few hundred millijanskies, and their potential for being situated at high redshift. These "cold" Planck sources, selected using the High Frequency Instrument (HFI) directly from the maps and from the Planck Catalogue of Compact Sources (PCCS), all satisfy the criterion of having their rest-frame far-infrared peak redshifted to the frequency range 353-857 GHz. This colour-selection favours galaxies in the redshift range z = 2-4, which we consider as cold peaks in the cosmic infrared background. With a 4.´5 beam at the four highest frequencies, our sample is expected to include overdensities of galaxies in groups or clusters, lensed galaxies, and chance line-of-sight projections. We perform a dedicated Herschel-SPIRE follow-up of 234 such Planck targets, finding a significant excess of red 350 and 500μm sources, in comparison to reference SPIRE fields. About 94% of the SPIRE sources in the Planck fields are consistent with being overdensities of galaxies peaking at 350μm, with 3% peaking at 500μm, and none peaking at 250μm. About 3% are candidate lensed systems, all 12 of which have secure spectroscopic confirmations, placing them at redshifts z> 2.2. Only four targets are Galactic cirrus, yielding a success rate in our search strategy for identifying extragalactic sources within the Planck beam of better than 98%. The galaxy overdensities are detected with high significance, half of the sample showing statistical significance above 10σ. The SPIRE photometric redshifts of galaxies in overdensities suggest a peak at z ≃ 2, assuming a single common dust temperature for the sources of Td = 35 K. Under this assumption, we derive an infrared (IR) luminosity for each SPIRE source of about 4 × 1012L⊙, yielding star formation rates of typically 700 M⊙ yr-1. If the observed overdensities are actual gravitationally-bound structures, the total IR luminosity of all their SPIRE-detected sources peaks at 4 × 1013L⊙, leading to total star formation rates of perhaps 7 × 103M⊙ yr-1 per overdensity. Taken together, these sources show the signatures of high-z (z> 2) protoclusters of intensively star-forming galaxies. All these observations confirm the uniqueness of our sample compared to reference samples and demonstrate the ability of the all-skyPlanck-HFI cold sources to select populations of cosmological and astrophysical interest for structure formation studies. Appendices are available in electronic form at http://www.aanda.org

Measurements of Z{sub EFF} spatial profiles from bremsstrahlung emission in the visible and near infrared spectral region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orsitto, F.; Belforte, M.R.; Borra, M.

1997-01-01

Measurement of plasma radiation (i.e., breusstrahlung) in the infrared (IR) range ({lambda}=933, 978 nm), at six lines of sight from z={minus}20 cm to z=8 cm above the equatorial plane, using the detection system of the Frascati Tokamak Upgrade (FTU) Thomson scattering system (TSS) are reported. The agreement of IR with visible ({lambda}=540 nm) bremsstrahlung intensity {ital S}, [S=photons/(m{sup 2}srnms)] measurements is within 20{percent}{endash}30{percent} and depends upon the absolute calibration of both systems. The intensity is equal S(z)={l_angle}Z{sub eff}Gn{sup 2}/T{sub e}{sup 1/2}{r_angle}, where {l_angle}{center_dot}{r_angle} means average on a line of sight. For determining the Z{sub eff} the Gaunt factor(G) is needed,more » and analysis the Born{endash}Elwert formula is used. The Z{sub eff} spatial profiles (i.e., Z{sub eff}(r)), are determined using the plasma temperature (T{sub e}) and density (n{sub e}) measured by the TSS and the Abel inverted intensity profiles, determined using the plasma radiation S(z) measured from six horizontal chords. Z{sub eff}(r) behavior in a variety of FTU discharges is presented. {copyright} {ital 1997 American Institute of Physics.}« less

Robust Controller Design: A Bounded-Input-Bounded-Output Worst-Case Approach

DTIC Science & Technology

1992-03-01

show that 2 implies 1, suppose 1 does not hold, i.e., that p(M) > 1. The Perron - Frobenius theory for nonnegative matrices states that p(M) is itself an...Pz denote the positive cones inside X, Z consisting of elements with nonnegative pointwise components. Define the operator .4 : X -* Z, decomposed...topology.) The dual cone P! again consists of the nonnegative elements in Z*. The Lagrangian can be defined as L(x,z ’) {< x,c" > + < Ax - b,z

The underside of the cerebral cortex: layer V/VI spiny inverted neurons

PubMed Central

Mendizabal-Zubiaga, Juan L; Reblet, Concepcion; Bueno-Lopez, Jose L

2007-01-01

This paper presents an account of past and current research on spiny inverted neurons – alternatively also known as ‘inverted pyramidal neurons’– in rats, rabbits and cats. In our laboratory, we have studied these cells with a battery of techniques suited for light and electron microscopy, including Nissl staining, Golgi impregnation, dye intracellular filling and axon retrograde track-tracing. Our results show that spiny inverted neurons make up less than 8.5 and 5.5% of all cortical neurons in the primary and secondary rabbit visual cortex, respectively. Infragranular spiny inverted neurons constitute 15 and 8.5% of infragranular neurons in the same animal and areas. Spiny inverted neurons congregate at layers V–VI in all studied species. Studies have also revealed that spiny inverted neurons are excitatory neurons which furnish axons for various cortico-cortical, cortico-claustral and cortico-striatal projections, but not for non-telencephalic centres such as the lateral and medial geniculate nuclei, the colliculi or the pons. As a group, each subset of inverted cells contributing to a given projection is located below the pyramidal neurons whose axons furnish the same centre. Spiny inverted neurons are particularly conspicuous as a source of the backward cortico-cortical projection to primary visual cortex and from this to the claustrum. Indeed, they constitute up to 82% of the infragranular cells that furnish these projections. Spiny inverted neurons may be classified into three subtypes according to the point of origin of the axon on the cell: the somatic basal pole which faces the cortical outer surface, the somatic flank and the reverse apical dendrite. As seen with electron microscopy, the axon initial segments of these subtypes are distinct from one another, not only in length and thickness, but also in the number of received synaptic boutons. All of these anatomical features together may support a synaptic-input integration which is peculiar to spiny inverted neurons. In this way, two differently qualified streams of axonal output may coexist in a projection which arises from a particular infragranular point within a given cortical area; one stream would be furnished by the typical pyramidal neurons, whereas spiny inverted neurons would constitute the other source of distinct information flow. PMID:17635629

Nanowire NMOS Logic Inverter Characterization.

PubMed

Hashim, Yasir

2016-06-01

This study is the first to demonstrate characteristics optimization of nanowire N-Channel Metal Oxide Semiconductor (NW-MOS) logic inverter. Noise margins and inflection voltage of transfer characteristics are used as limiting factors in this optimization. A computer-based model used to produce static characteristics of NW-NMOS logic inverter. In this research two circuit configuration of NW-NMOS inverter was studied, in first NW-NMOS circuit, the noise margin for (low input-high output) condition was very low. For second NMOS circuit gives excellent noise margins, and results indicate that optimization depends on applied voltage to the inverter. Increasing gate to source voltage with (2/1) nanowires ratio results better noise margins. Increasing of applied DC load transistor voltage tends to increasing in decreasing noise margins; decreasing this voltage will improve noise margins significantly.

An inverter/controller subsystem optimized for photovoltaic applications

NASA Technical Reports Server (NTRS)

Pickrell, R. L.; Merrill, W. C.; Osullivan, G.

1978-01-01

Conversion of solar array dc power to ac power stimulated the specification, design, and simulation testing of an inverter/controller subsystem tailored to the photovoltaic power source characteristics. This paper discusses the optimization of the inverter/controller design as part of an overall Photovoltaic Power System (PPS) designed for maximum energy extraction from the solar array. The special design requirements for the inverter/controller include: (1) a power system controller (PSC) to control continuously the solar array operating point at the maximum power level based on variable solar insolation and cell temperatures; and (2) an inverter designed for high efficiency at rated load and low losses at light loadings to conserve energy. It must be capable of operating connected to the utility line at a level set by an external controller (PSC).

MOTION VERIFIED RED STARS (MoVeRS): A CATALOG OF PROPER MOTION SELECTED LOW-MASS STARS FROM WISE, SDSS, AND 2MASS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Theissen, Christopher A.; West, Andrew A.; Dhital, Saurav, E-mail: ctheisse@bu.edu

2016-02-15

We present a photometric catalog of 8,735,004 proper motion selected low-mass stars (KML-spectral types) within the Sloan Digital Sky Survey (SDSS) footprint, from the combined SDSS Data Release 10 (DR10), Two Micron All-Sky Survey (2MASS) point-source catalog (PSC), and Wide-field Infrared Survey Explorer (WISE) AllWISE catalog. Stars were selected using r − i, i − z, r − z, z − J, and z − W1 colors, and SDSS, WISE, and 2MASS astrometry was combined to compute proper motions. The resulting 3,518,150 stars were augmented with proper motions for 5,216,854 earlier type stars from the combined SDSS and United States Naval Observatory B1.0 catalog (USNO-B). We used SDSS+USNO-B proper motionsmore » to determine the best criteria for selecting a clean sample of stars. Only stars whose proper motions were greater than their 2σ uncertainty were included. Our Motion Verified Red Stars catalog is available through SDSS CasJobs and VizieR.« less

VizieR Online Data Catalog: z<1 3CR radio galaxies and quasars star formation (Westhues+, 2016)

NASA Astrophysics Data System (ADS)

Westhues, C.; Haas, M.; Barthel, P.; Wilkes, B. J.; Willner, S. P.; Kuraszkiewicz, J.; Podigachoski, P.; Leipski, C.; Meisenheimer, K.; Siebenmorgen, R.; Chini, R.

2018-03-01

This work studies a sample of 87 sources from the 3CR catalog (Edge et al. 1959, Cat. VIII/1; Bennett 1962MNRAS.125...75B; Laing et al. 1983, J/MNRAS/204/151; Spinrad et al. 1985, J/PASP/97/932). With the Herschel Space Observatory (Pilbratt et al. 2010A&A...518L...1P) we measured the FIR/submm spectral energy distributions (SEDs) of the 3CR sources in two complementary proposals: one at redshift 1

Explicit blow-up solutions to the Schroedinger maps from R{sup 2} to the hyperbolic 2-space H{sup 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding Qing

2009-10-15

In this article, we prove that the equation of the Schroedinger maps from R{sup 2} to the hyperbolic 2-space H{sup 2} is SU(1,1)-gauge equivalent to the following 1+2 dimensional nonlinear Schroedinger-type system of three unknown complex functions p, q, r, and a real function u: iq{sub t}+q{sub zz}-2uq+2(pq){sub z}-2pq{sub z}-4|p|{sup 2}q=0, ir{sub t}-r{sub zz}+2ur+2(pr){sub z}-2pr{sub z}+4|p|{sup 2}r=0, ip{sub t}+(qr){sub z}-u{sub z}=0, p{sub z}+p{sub z}=-|q|{sup 2}+|r|{sup 2}, -r{sub z}+q{sub z}=-2(pr+pq), where z is a complex coordinate of the plane R{sup 2} and z is the complex conjugate of z. Although this nonlinear Schroedinger-type system looks complicated, it admits a class ofmore » explicit blow-up smooth solutions: p=0, q=(e{sup i(bzz/2(a+bt))}/a+bt){alpha}z, r=e{sup -i(bzz/2(a+bt))}/(a+bt){alpha}z, u=2{alpha}{sup 2}zz/(a+bt){sup 2}, where a and b are real numbers with ab<0 and {alpha} satisfies {alpha}{sup 2}=b{sup 2}/16. From these facts, we explicitly construct smooth solutions to the Schroedinger maps from R{sup 2} to the hyperbolic 2-space H{sup 2} by using the gauge transformations such that the absolute values of their gradients blow up in finite time. This reveals some blow-up phenomenon of Schroedinger maps.« less

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Stellar mass buildup in galaxies in the first 1.5 Gyr of the universe

NASA Astrophysics Data System (ADS)

Gonzalez, Valentino

In this thesis we have made extensive use of the deepest optical and infrared images currently available from the Hubble Space Telescope (HST) and the Spitzer Space Telescope to study the properties of the stellar populations and the stellar mass buildup in galaxies in the first 1.5 Gyr after the Big Bang. The star formation Rates (SFRs) estimated for LBGs at z ≳ 4 are generally in the range 1 -- 100 M⊙ yr--1. The stellar mass estimates are most robust for sources with good Spitzer/IRAC detections, corresponding to galaxies with stellar masses ≳ 108.5 M⊙ at z ˜ 4 ( ≳ 109.5 M⊙ at z ˜ 7). For sources with lower rest-frame optical luminosities, that, as a result, are individually undetected in IRAC, their average stellar masses have been studied in a stacking analysis of a large number of sources. This enables us to reach stellar masses ˜ 10 7.8 M⊙ at z ˜ 4. The stellar masses show a fairly tight correlation with UV luminosity or SFR, and the zeropoint of the relation does not seem to evolve strongly with redshift. We have taken advantage of the UV luminosity vs. stellar mass relation observed in LBGs at z ≳ 4 -- 7 to derive the stellar mass function (SMF) of galaxies at these redshifts. The method uses a combination of the UV LF and the mean UV vs. stellar mass relation (including the scatter, estimated to be ˜ 0.5 dex at bright luminosities at z ˜ 4). This method allows an analytic estimate of the low mass slope of the SMF. This slope (the power-law exponent of the SMF at low masses), is estimated to be in the --1.44 -- --1.55, range which is flatter than the UV LF faint end slope at these redshifts ( ≲ --1.74). This means that low mass systems contribute less to the total stellar mass density (SMD) of the Universe than would have been estimated assuming a constant mass-to-UV-light ratio. We show that this is also much flatter than the theoretical predictions from simulations, which generally over-predict the number density of low mass systems at these redshifts. The UV luminosity vs. stellar mass relation indicates only a small variation of the mass-to-light ratio as a function of UV luminosity. This is confirmed in a stacking analysis of a large number of sources from the HUDF and the Early Release Science fields (˜ 400 z ˜ 4, ˜ 120 z ˜ 5, ˜ 60 z ˜ 6, 36 at z ˜ 7). Interestingly, the stacked SEDs at z ≳ 5 in the rest-frame optical shows a color [3.6] -- [4.5] ˜ 0.3 mag. This color is hard to reproduce by synthetic stellar population models that only include stellar continua, and it probably indicates the presence of moderately strong emission lines (Halpha EWrest ˜ 300 A). The contribution from such emission lines in the IRAC fluxes indicates that the stellar masses and ages could both be over-estimated by a factor ˜ 2. One of the most interesting results presented in this thesis is the apparent plateau of the specific SFR (sSFR = SFR / stellar mass). In early results, the similarity in the SEDs of galaxies at a given UV luminosity in the z ˜ 4 -- 7 redshift range resulted in very similar estimates of the SFR and stellar masses of these galaxies. Furthermore, we find that the reported sSFR estimates at z ˜ 2 are also very similar to the ones in the z ˜ 4 -- 7 redshift range (˜ 2 Gyr--1 for ˜ 5 x 109 M⊙ galaxies). A puzzle arises from the fact that the dark matter accretion rate onto halos is predicted to decrease monotonically and rather fast as a function of cosmic time (approximately ∝ (1 + z) 2.5). If gas and star formation follow the inflow of dark matter, the sSFR at a constant mass should also decrease monotonically with time, which is contrary to the indication from these observations. When we include the possible effects of emission lines, the stellar masses decrease by a factor ˜ 2x at z ≳ 5. The revised stellar masses may favor a slowly rising sSFR at z ≳ 2, but the rise as a function of redshift is still much slower (sSFR(z) ∝ (1 + z)0.7) than that of specific dark matter accretion rate. This suggests that the stellar mass buildup is somehow decoupled from the dark matter buildup at early times. (Abstract shortened by UMI.)

15 Mile Road/Edison Corridor Sewer Tunnel Failure Study, Detroit Area, Michigan.

DTIC Science & Technology

1981-01-01

td piezometers...0. CO-j Ii, Z 3r A2 -- Z b 0 0 TSi .- y. LA- W LL -. j~ (L CL c-J ICIA * td 4,L ’o 2 0- ~< Q o A3 LUJ A-J 0C M s OJ 0 L1 o o zn 0 U - -r-< i Hi 0 a...4~ N C) z ’ ) - 0 ’U. J . 0kI .. )1 𔄃 ’J A IA C) LL M0 u . U U0 - _Cz2--- - 0 U 0. 0 w LLI- -1 I- f I 0 0 06 0 0. 0 uj z LLZI A57 ’C A cc~ -- z

The SHAFT Book (Design Charts for Torsional Properties of Non-Circular Shafts)

DTIC Science & Technology

1980-03-01

7870 .7906 .7944 .7864 .7903 .7968 .8048 . 7845 .7874 .7933 .8035 .8189 .7852 .7899 .7993 .8143 .8362 .7857 .7918 .8059 .8270 .8580 .7862 .7950 .8113...similar manner to equation 4): Ch h2V2f0= A(f1 +f3) +B(f2 +f4) +— (f2-f4) 2Rr - (A + B)2 f0 = h’D Eq (12) See figure A-6. 73 IRREGULAR...b2+b4) 4 1 Ch ba f k Ro b2(b2+b4) 2 b4(b2+b4) i Z2 f + r ] 1 2A_ ^ ^B_ _ Ch cb«-b4 j f ! bjbj b2b4

Radical salts of bis(ethylenediseleno)tetrathiafulvalene with paramagnetic tris(oxalato)metalate anions.

PubMed

Coronado, Eugenio; Curreli, Simona; Giménez-Saiz, Carlos; Gómez-García, Carlos J; Alberola, Antonio

2006-12-25

The synthesis, crystal structure, and physical characterization of five new radical salts formed by the organic donor bis(ethylenediseleno)tetrathiafulvalene (BEST) and the paramagnetic tris(oxalato)metalate anions [M(C2O4)3]3- (M = FeIII and CrIII) are reported. The salts isolated are (BEST)4[M(C2O4)3].PhCOOH.H2O with MIII = Cr (1) or Fe (2) (crystal data: 1, triclinic, space group P(-)1 with a = 14.0999(4) A, b = 15.3464(4) A, c =19.5000(4) A, alpha = 76.711(5) degrees, beta = 71.688(5) degrees, gamma = 88.545(5) degrees, V = 3893.5(2) A3, and Z = 2; 2, triclinic, space group P(-)1 with a = 14.0326(3) A, b =15.1981(4) A, c =19.4106(4) A, alpha = 76.739(5) degrees, beta = 71.938(5) degrees, gamma = 88.845(5) degrees, V = 3824.9(2) A3, and Z = 2), (BEST)4[M(C2O4)3].1.5H2O with MIII = Cr (3) or Fe (4) (crystal data: 3, monoclinic, space group C2/m with a = 33.7480(10) A, b =12.3151(7) A, c = 8.8218(5) A, beta = 99.674(5) degrees, V = 3614.3(3) A3, and Z = 2; 4, monoclinic, space group C2/m with a = 33.659(6) A, b =12.248(2) A, c = 8.759(2) A, beta = 99.74(3) degrees, V = 3558.9(12) A3, and Z = 2), and (BEST)9[Fe(C2O4)3]2.7H2O (5) (crystal data: triclinic, space group P(-)1 with a =12.6993(3) A, b =18.7564(4) A, c = 18.7675(4) A, alpha = 75.649(5) degrees, beta = 107.178(5) degrees, gamma = 79.527(5) degrees, V = 3977.5(3) A3, and Z = 1). The structures of all these salts consist of alternating layers of the organic donors and tris(oxalato)metalate anions. In 1 and 2 the anionic layers contain also benzoic acid molecules H-bonded to the terminal oxygen atoms of the anions. In all salts the organic layers adopt beta-type packings. Along the parallel stacks the donors form dimers in 3 and 4, trimers in 5, and tetramers in 1 and 2. All the compounds are paramagnetic semiconductors with high room-temperature conductivities and magnetic susceptibilities dominated by the Fe- or Cr-containing anions.

Natural microseismicity investigated using double-difference tomography: a 3D look at the 2008 swarm in the Novy Kostel area, Czech Republic

NASA Astrophysics Data System (ADS)

Alexandrakis, C.; Calo, M.; Bouchaala, F.; Vavrycuk, V.

2012-04-01

The Novy Kostel region in West Bohemia is an area prone to periodic bursts of natural microseismic activity. In this study, we use 476 events from the October 2008 earthquake swarm recorded on the WEBNET seismic network. The foci occurred on the northern extension of the Marianske-Lazne Fault near the town of Novy Kostel in the Czech Republic. Initial source locations indicated a rupture zone approximately 3 km along the fault with the sources spread over 4 km depth, centered at 9 km. We use the double-difference tomography method to study the fault structure by relocating the sources and inverting for the P and S velocities in the rupture region. Events are first relocated using the HypoDD program (Waldhauser and Ellsworth, 2000) using both catalog and cross-correlated datasets. These datasets, along with the absolute time picks are then used by the TomoDD program (Zhang and Thurber, 2003) to iteratively relocate the sources and invert for the 3D seismic structure. This dataset is ideal for this procedure as the cluster is very condensed and the WEBNET network offers ray coverage in all directions. The relocated events flatten onto a fault plane striking at 169 degrees NE. This fault plane has three sections with distinct dip angles. At the shallowest (up to 8 km) and deepest (10 - 11 km) parts of the fault, the dip is shallow, whereas the middle section has a steep dip angle. Most events occur at the deeper part of the middle section. The inverted velocities correspond well to results from regional seismic refraction surveys (e.g., CELEBRATION 2000). Here, more details of the 3D velocity structure are revealed. As expected, velocities to the east of the fault are overall higher, corresponding to the uplifted northern margin of the Eger Rift. Finer structures surrounding the source region are also resolved.

1,4-Hydroiodination of dienyl alcohols with TMSI to form homoallylic alcohols containing a multisubstituted Z-alkene and application to Prins cyclization.

PubMed

Xu, Yongjin; Yin, Zhiping; Lin, Xinglong; Gan, Zubao; He, Yanyang; Gao, Lu; Song, Zhenlei

2015-04-17

A regioselective 1,4-hydroiodination of dienyl alcohols has been developed using trimethylsilyl iodide as Lewis acid and iodide source. A range of homoallylic alcohols containing a multisubstituted Z-alkene was synthesized with good to excellent configurational control. The approach was applied in sequential hydroiodination/Prins cyclization to afford multisubstituted tetrahydropyrans diastereoselectively.

An inverted cylindrical sputter magnetron as metal vapor supply for electron cyclotron resonance ion sources.

PubMed

Weichsel, T; Hartung, U; Kopte, T; Zschornack, G; Kreller, M; Silze, A

2014-05-01

An inverted cylindrical sputter magnetron device has been developed. The magnetron is acting as a metal vapor supply for an electron cyclotron resonance (ECR) ion source. FEM simulation of magnetic flux density was used to ensure that there is no critical interaction between both magnetic fields of magnetron and ECR ion source. Spatially resolved double Langmuir probe and optical emission spectroscopy measurements show an increase in electron density by one order of magnitude from 1 × 10(10) cm(-3) to 1 × 10(11) cm(-3), when the magnetron plasma is exposed to the magnetic mirror field of the ECR ion source. Electron density enhancement is also indicated by magnetron plasma emission photography with a CCD camera. Furthermore, photographs visualize the formation of a localized loss-cone - area, when the magnetron is operated at magnetic mirror field conditions. The inverted cylindrical magnetron supplies a metal atom load rate of R > 1 × 10(18) atoms/s for aluminum, which meets the demand for the production of a milliampere Al(+) ion beam.

THE ZEEMAN EFFECT IN THE 44 GHZ CLASS I METHANOL MASER LINE TOWARD DR21(OH)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Momjian, E.; Sarma, A. P., E-mail: emomjian@nrao.edu, E-mail: asarma@depaul.edu

2017-01-10

We report detection of the Zeeman effect in the 44 GHz Class I methanol maser line, toward the star-forming region DR21(OH). In a 219 Jy beam{sup −1} maser centered at an LSR velocity of 0.83 km s{sup −1}, we find a 20- σ detection of zB {sub los} = 53.5 ± 2.7 Hz. If 44 GHz methanol masers are excited at n ∼ 10{sup 7–8} cm{sup −3}, then the B versus n {sup 1/2} relation would imply, from comparison with Zeeman effect detections in the CN(1 − 0) line toward DR21(OH), that magnetic fields traced by 44 GHz methanol masersmore » in DR21(OH) should be ∼10 mG. Combined with our detected zB {sub los} = 53.5 Hz, this would imply that the value of the 44 GHz methanol Zeeman splitting factor z is ∼5 Hz mG{sup −1}. Such small values of z would not be a surprise, as the methanol molecule is non-paramagnetic, like H{sub 2}O. Empirical attempts to determine z , as demonstrated, are important because there currently are no laboratory measurements or theoretically calculated values of z for the 44 GHz CH{sub 3}OH transition. Data from observations of a larger number of sources are needed to make such empirical determinations robust.« less

System and method for single-phase, single-stage grid-interactive inverter

DOEpatents

Liu, Liming; Li, Hui

2015-09-01

The present invention provides for the integration of distributed renewable energy sources/storages utilizing a cascaded DC-AC inverter, thereby eliminating the need for a DC-DC converter. The ability to segment the energy sources and energy storages improves the maintenance capability and system reliability of the distributed generation system, as well as achieve wide range reactive power compensation. In the absence of a DC-DC converter, single stage energy conversion can be achieved to enhance energy conversion efficiency.

A search for faint high-redshift radio galaxy candidates at 150 MHz

NASA Astrophysics Data System (ADS)

Saxena, A.; Jagannathan, P.; Röttgering, H. J. A.; Best, P. N.; Intema, H. T.; Zhang, M.; Duncan, K. J.; Carilli, C. L.; Miley, G. K.

2018-04-01

Ultrasteep spectrum (USS) radio sources are good tracers of powerful radio galaxies at z > 2. Identification of even a single bright radio galaxy at z > 6 can be used to detect redshifted 21 cm absorption due to neutral hydrogen in the intervening intergalactic medium. Here we describe a new sample of high-redshift radio galaxy (HzRG) candidates constructed from the TIFR GMRT Sky Survey First Alternative Data Release survey at 150 MHz. We employ USS selection (α ≤ -1.3) in ˜10 000 deg2, in combination with strict size selection and non-detections in all-sky optical and infrared surveys. We apply flux density cuts that probe a unique parameter space in flux density (50 mJy < S150 < 200 mJy) to build a sample of 32 HzRG candidates. Follow-up Karl G. Jansky Very Large Array (VLA) observations at 1.4 GHz with an average beam size of 1.3 arcsec revealed ˜ 48 per cent of sources to have a single radio component. P-band (370 MHz) imaging of 17 of these sources revealed a flattening radio SED for 10 sources at low frequencies, which is expected from compact HzRGs. Two of our sources lie in fields where deeper multiwavelength photometry and ancillary radio data are available and for one of these we find a best-fitting photo-z of 4.8 ± 2.0. The other source has zphot = 1.4 ± 0.1 and a small angular size (3.7 arcsec), which could be associated with an obscured star-forming galaxy or with a `dead' elliptical. One USS radio source not part of the HzRG sample but observed with the VLA none the less is revealed to be a candidate giant radio galaxy with a host galaxy photo-z of 1.8 ± 0.5, indicating a size of 875 kpc.

Production Rule Systems as an Approach to Interpretation of Ground Sensor Information.

DTIC Science & Technology

1980-06-01

V-LC v- ) L. 0 𔃾 M b nJrC .V L. Q C I -4a 0 0 4 3 3C i LUV C 0 L 0 -4 c 4 c c0 4t 0 MC I c 4). z 04)1 IV in W-4 V)U C0z4 M) -4 , LL _4) : 0) 0 0 )v40...RtEPORT DOCMENTAlnON PAGE 11111o INTC? PRNS 6RCPO3rT 0UM6bER I . NOVI ACCKWOOOIN me a fPgNT5 CATALOG NumbS U 9 T.L I Production Rule Systems as an...OPPICE NAMCE#4 ADDRESS53 Naval Postgraduate School. JunO’.--8 I - Monterey, California 93940 77Ucasfe (1C kASSIPICATIONIONGRAOING Approved for public

The Herschel* PEP-HERMES Luminosity Function- I. Probing the Evolution of PACS Selected Galaxies to z approx. equal to 4

NASA Technical Reports Server (NTRS)

Gruppioni, Carlotta; Pozzi, F.; Rodighiero, G.; Delvecchio, I.; Berta, S.; Pozzetti, L.; Zamorani, G.; Andreani, P.; Cimatti, A.; Ilbert, O.;

Multi-energy SXR cameras for magnetically confined fusion plasmas (invited).

PubMed

Delgado-Aparicio, L F; Maddox, J; Pablant, N; Hill, K; Bitter, M; Rice, J E; Granetz, R; Hubbard, A; Irby, J; Greenwald, M; Marmar, E; Tritz, K; Stutman, D; Stratton, B; Efthimion, P

2016-11-01

A compact multi-energy soft x-ray camera has been developed for time, energy and space-resolved measurements of the soft-x-ray emissivity in magnetically confined fusion plasmas. Multi-energy soft x-ray imaging provides a unique opportunity for measuring, simultaneously, a variety of important plasma properties (T e , n Z , ΔZ eff , and n e,fast ). The electron temperature can be obtained by modeling the slope of the continuum radiation from ratios of the available brightness and inverted radial emissivity profiles over multiple energy ranges. Impurity density measurements are also possible using the line-emission from medium- to high-Z impurities to separate the background as well as transient levels of metal contributions. This technique should be explored also as a burning plasma diagnostic in-view of its simplicity and robustness.

A simultaneous search for High-z LAEs and LBGs in the SHARDS survey

NASA Astrophysics Data System (ADS)

Haro, P. Arrabal; Espinosa, J. M. Rodríguez; Muñoz-Tuñón, C.; Pérez-González, P. G.; Dannerbauer, H.; Bongiovann, Á.; Barro, G.; Cava, A.; Lumbreras-Calle, A.; Hernán-Caballero, A.; Eliche-Moral, M. C.; Sánchez, H. Dománguez; Conselice, C. J.; Tresse, L.; Pampliega, B. Alcalde; Balcells, M.; Daddi, E.; Rodighiero, G.

2018-05-01

We have undertaken a comprehensive search for both Lyman Alpha Emitters (LAEs) and Lyman Break Galaxies (LBGs) in the SHARDS Survey of the GOODS-N field. SHARDS is a deep imaging survey, made with the 10.4 m Gran Telescopio Canarias (GTC), employing 25 medium band filters in the range from 500 to 941 nm. This is the first time that both LAEs and LBGs are surveyed simultaneously in a systematic way in a large field. We draw a sample of 1558 sources; 528 of them are LAEs. Most of the sources (1434) show rest-frame UV continua. A minority of them (124) are pure LAEs with virtually no continuum detected in SHARDS. We study these sources from z ˜ 3.35 up to z ˜ 6.8, well into the epoch of reionization. Note that surveys done with just one or two narrow band filters lack the possibility to spot the rest-frame UV continuum present in most of our LAEs. We derive redshifts, Star Formation Rates (SFRs), Lyα Equivalent Widths (EWs) and Luminosity Functions (LFs). Grouping within our sample is also studied, finding 92 pairs or groups of galaxies at the same redshift separated by less than 60 comoving kpc. In addition, we relate 87 and 55 UV-selected objects with two known overdensities at z = 4.05 and z = 5.198, respectively. Finally, we show that surveys made with broad band filters are prone to introduce many unwanted sources (˜20% interlopers), which means that previous studies may be overestimating the calculated LFs, specially at the faint end.

Converter topologies and control

DOEpatents

Rodriguez, Fernando; Qin, Hengsi; Chapman, Patrick

2018-05-01

An inverter includes a transformer that includes a first winding, a second winding, and a third winding, a DC-AC inverter electrically coupled to the first winding of the transformer, a cycloconverter electrically coupled to the second winding of the transformer, an active filter electrically coupled to the third winding of the transformer. The DC-AC inverter is adapted to convert the input DC waveform to an AC waveform delivered to the transformer at the first winding. The cycloconverter is adapted to convert an AC waveform received at the second winding of the transformer to the output AC waveform having a grid frequency of the AC grid. The active filter is adapted to sink and source power with one or more energy storage devices based on a mismatch in power between the DC source and the AC grid.

Ultrafast Harmonic Coherent Compound (UHCC) imaging for high frame rate echocardiography and Shear Wave Elastography

PubMed Central

Correia, Mafalda; Provost, Jean; Chatelin, Simon; Villemain, Olivier; Tanter, Mickael; Pernot, Mathieu

2016-01-01

Transthoracic shear wave elastography of the myocardium remains very challenging due to the poor quality of transthoracic ultrafast imaging and the presence of clutter noise, jitter, phase aberration, and ultrasound reverberation. Several approaches, such as, e.g., diverging-wave coherent compounding or focused harmonic imaging have been proposed to improve the imaging quality. In this study, we introduce ultrafast harmonic coherent compounding (UHCC), in which pulse-inverted diverging-waves are emitted and coherently compounded, and show that such an approach can be used to enhance both Shear Wave Elastography (SWE) and high frame rate B-mode Imaging. UHCC SWE was first tested in phantoms containing an aberrating layer and was compared against pulse-inversion harmonic imaging and against ultrafast coherent compounding (UCC) imaging at the fundamental frequency. In-vivo feasibility of the technique was then evaluated in six healthy volunteers by measuring myocardial stiffness during diastole in transthoracic imaging. We also demonstrated that improvements in imaging quality could be achieved using UHCC B-mode imaging in healthy volunteers. The quality of transthoracic images of the heart was found to be improved with the number of pulse-inverted diverging waves with reduction of the imaging mean clutter level up to 13.8-dB when compared against UCC at the fundamental frequency. These results demonstrated that UHCC B-mode imaging is promising for imaging deep tissues exposed to aberration sources with a high frame-rate. PMID:26890730

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

PubMed Central

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

Quantitative calcaneal ultrasound parameters and bone mineral density at final height in girls treated with depot gonadotrophin-releasing hormone agonist for central precocious puberty or idiopathic short stature.

PubMed

Kapteijns-van Kordelaar, Simone; Noordam, Kees; Otten, Barto; van den Bergh, Joop

2003-11-01

To evaluate the effect of gonadotrophin-releasing hormone (GnRH) agonist treatment on bone quality at final height, we studied girls with central precocious puberty (CPP) and with idiopathic short stature (ISS). A total of 25 Caucasian girls were included: group A (n=14) with idiopathic CPP (mean age at start 7.4 years) and group B (n=11) with ISS (mean age at start 11.7 years). Treatment duration was 3.8 and 1.7 years respectively. The quantitative ultrasound parameters (QUS) broadband ultrasound attenuation (BUA) and speed of sound (SOS) were measured at the calcaneus (UBIS 3000 device). Lumbar spine bone mineral density (BMD; L2-L4) was measured by dual energy X-ray absorptiometry (DXA) (Hologic QDR1000). Measurements were performed at final height and expressed as Z-scores corrected for bone age. Mean Z-scores of QUS parameters, areal BMD and volumetric BMD (BMDvol) were above -1 in both groups (group A: BUA Z-score -0.21, SOS Z-score -0.29, BMD Z-score 0.02, BMDvol Z-score 0.05, group B: BUA Z-score -0.93, SOS Z-score -0.40, BMD Z-score -0.86, BMDvol Z-score -0.68), although mean Z-scores of BUA and areal BMD in group B were significantly different from zero (P=0.03 and P=0.02 respectively). Mean Z-score BMDvol was not significantly different from zero (P=0.05), we found no significant difference between the groups for BMDvol (P=0.13). Although quantitative ultrasound parameters parameters and bone mineral density were normal in girls with central precocious puberty at final height after gonadotrophin-releasing hormone agonist treatment, mean Z-score for broadband ultrasound attenuation and areal bone mineral density were significantly different from zero and mean Z-score for volumetric bone mineral density was (just) not significantly different from zero in idiopathic short stature girls with normal puberty treated with gonadotrophin-releasing hormone agonists. Therefore we cannot say that this treatment is safe in these girls with regard to bone health.

Sensitivities of Two Zebrafish TRPA1 Paralogs to Chemical and Thermal Stimuli Analyzed in Heterologous Expression Systems.

PubMed

Oda, Mai; Kurogi, Mako; Kubo, Yoshihiro; Saitoh, Osamu

2016-03-01

Transient receptor potential A1 (TRPA1) is the only member of the mouse, chick, and frog TRPA family, whereas 2 paralogs (zTRPA1a and zTRPA1b) are present in zebrafish. We herein investigated functional differences in the 2 zebrafish TRPA1s. HEK293T cells were used as heterologous expression systems, and the sensitivities of these cells to 4 chemical irritants (allyl isothiocyanate [AITC], caffeine, auto-oxidized epigallocatechin gallate [EGCG], and hydrogen peroxide [H2O2]) were compared with Ca(2+) imaging techniques. Sensitivities to the activators for AITC, oxidized EGCG, and H2O2 were higher in cells expressing zTRPA1a than in those expressing zTRPA1b, whereas caffeine appeared to activate both cells equally. We also characterized the thermal sensitivity of Xenopus oocytes expressing each TRPA1 electrophysiologically using a 2-electrode voltage clamp. Although endogenous currents induced by a cold stimulation were observed in control oocytes in some batches, oocytes expressing zTRPA1b showed significantly stronger cold- and heat-induced responses. However, significant thermal activation was not observed in oocytes expressing zTRPA1a. The results obtained using in vitro expression systems suggest that zTRPA1a is specialized for chemical sensing, whereas zTRPA1b responds to thermal stimuli. Furthermore, characterization of the chimeric molecule of TRPA1a and 1b revealed the importance of the N-terminal region in chemical and thermal sensing by zTRPA1s. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Advanced Inverter Technology.

DTIC Science & Technology

1984-07-01

polysilicon gates. They have con- sistently demonstrated total dose tolerance in the l05 rad (Si) to 1 0b rad (Si) range. They have also demonstrated...FPGs. Because there are two full bridges for one direction of resonant current two SGRs uxust be fired for each bridge, :.:: oL total of tour for the...less than 0.5 W. 2.5.4.4 BLoc-k Diagram - Figure 2.5.4-6 is a block diagram ol thC three-phase unit. All of the input and output signals for the three

Reaction to Halogens and Interhalogens with 4-Halo-1,1,2-trifluorobut-1-enes: Rearrangement of 3-Membered Halonium to 5-Membered Trifluorotetramethylene Halonium Ion Intermediates and Comparison of Open-Chloronium Fluorosubstituted Ions to Flurocarbocations from Protons (Preprint)

DTIC Science & Technology

2008-02-28

were found to be open-ion (A or E), unsymmetrical (B or D), or symmetrical C depending on the halogen electrophile and on the position and number of...Rearranged products 4 (Structures A-E) 1 Z = Cl 2 Z = Br 3 Z = I XY = Cl2, Br2, BrCl ICl, IBr Scheme 1 Y on the fluorine atoms of 5 shield the carbon nucleus...and 3) WITH HALOGEN ELECTROPHILES IN METHYLENE CHLORIDE F F F Z XY CH2Cl2 CF2CFZ Y X CF2CFZ X Y CF2CFY X Z + + M aM Rearranged Run Alkene (Z

A strong X-ray Flare in 1ES 1959+650

NASA Astrophysics Data System (ADS)

Kapanadze, Bidzina

2016-06-01

The nearby TeV-detected HBL object 1ES 1959+650 (z=0.047) has been observed by Swift today which revealed a strong X-ray flare in the source. Namely, the observation-binned 0.3-10 keV count rate is 16.49+/-0.15 cts/s that is by a factor 2.45 larger compared to weighted mean count rate from all Swift-XRT pointings to this source, and by 90% larger than the rate recorded during the previous observation (performed on June 4). Note that the higher brightness states were observed only three times in the past (in 2015 September - December; see Kapanadze B. et al. 2016, "A recent strong X-ray flaring activity of 1ES 1959+650 with possibly less efficient stochastic acceleration", MNRASL, in press).

Organic photovoltaics

NASA Astrophysics Data System (ADS)

Demming, Anna; Krebs, Frederik C.; Chen, Hongzheng

2013-12-01

Energy inflation, the constant encouragement to economize on energy consumption and the huge investments in developing alternative energy resources might seem to suggest that there is a global shortage of energy. Far from it, the energy the Sun beams on the Earth each hour is equivalent to a year's supply, even at our increasingly ravenous rate of global energy consumption [1]. But it's not what you have got it's what you do with it. Hence the intense focus on photovoltaic research to find more efficient ways to harness energy from the Sun. Recently much of this research has centred on organic solar cells since they offer simple, low-cost, light-weight and large-area flexible photovoltaic structures. This issue with guest editors Frederik C Krebs and Hongzheng Chen focuses on some of the developments at the frontier of organic photovoltaic technology. Improving the power conversion efficiency of organic photovoltaic systems, while maintaining the inherent material, economic and fabrication benefits, has absorbed a great deal of research attention in recent years. Here significant progress has been made with reports now of organic photovoltaic devices with efficiencies of around 10%. Yet operating effectively across the electromagnetic spectrum remains a challenge. 'The trend is towards engineering low bandgap polymers with a wide optical absorption range and efficient hole/electron transport materials, so that light harvesting in the red and infrared region is enhanced and as much light of the solar spectrum as possible can be converted into an electrical current', explains Mukundan Thelakkat and colleagues in Germany, the US and UK. In this special issue they report on how charge carrier mobility and morphology of the active blend layer in thin film organic solar cells correlate with device parameters [2]. The work contributes to a better understanding of the solar-cell characteristics of polymer:fullerene blends, which form the material basis for some of the most successful solution processable organic photovoltaic devices at present. Andrey E Rudenko, Sangtaik Noh, and Barry C Thompson at the University of Southern California, Los Angeles, combine two approaches to broaden the absorption of conjugated polymers [3]. In atomistic bandgap control, a heavier chalcogen heteroatom is introduced into the aromatic repeat unit to decrease the HOMO-LUMO gap. In the semi-random donor-acceptor polymer architecture, small amounts of electron deficient monomers are incorporated at random. 'We have successfully established the concept of extending photon absorption through the combination of atomistic bandgap control and the donor-acceptor-based semi-random platform using a family of three new semi-random selenophene-based polymers', explain Thompson and colleagues. They add that the polymers exhibit extended and enhanced photon absorption compared with their polythiophene analogues while maintaining semicrystallinity. The benefits of various fabrication treatments are also reported, such as methanol rinsing for modifying the active layer interface [4] and annealing to achieve bicontinuous nanoscale phase separation for efficient exciton dissociation and charge collection [5]. The issue highlights how successfully structure and morphology can be manipulated to optimize solar-cell efficiencies while retaining advantageous material properties, with reports of innovative studies of bulk heterojunction [6-9] and inverse [10-13] structures, as well as innovative replacements for the traditional ITO transparent conducting electrode [14, 15]. Thomas Edison is famously quoted as saying 'I'd put my money on the Sun and solar energy, what a source of power! I hope we don't have to wait until oil and coal run out, before we tackle that'. Born in the wake of the industrial revolution when coal was king, the words seem strangely anachronistic and ahead of his time. As an undisputed genius of inventions it should not surprise us that he had such remarkable foresight, nor that the present generation of innovators are 'tackling' the opportunity with such promise and success, as the work in this special issue clearly demonstrates. References [1] http://environment.nationalgeographic.co.uk/environment/global-warming/solar-power-profile [2] Muth M-A, Mitchel W, Tierney S, Lada T A, Xue X, Richter H, Carrasco-Orozco M and Thelakkat M 2013 Influence of charge carrier mobility and morphology on solar cell parameters in devices of mono- and bis-fullerene adducts Nanotechnology 24 484001 [3] Rudenko A E, Noh S and Thompson B C 2013 Influence of selenophene on the properties of semi-random polymers and their blends with PC61BM Nanotechnology 24 484002 [4] Zhang K, Hu Z, Duan C, Ying L, Huang F and Cao Y 2013 The effect of methanol treatment on the performance of polymer solar cells Nanotechnology 24 484003 [5] Meng B, Fang G, Fu Y, Xie Z and Wang L 2013 Fine tuning of the PCDTBT-OR:PC71BM blend nanoscale phase separation via selective solvent annealing toward high-performance polymer photovoltaics Nanotechnology 24 484004 [6] Arar M et al 2013 Influence of morphology and polymer:nanoparticle ratio on device performance of hybrid solar cells—an approach in experiment and simulation Nanotechnology 24 484005 [7] Yu B, Wang H and Yan D 2013 Efficient organic photovoltaic cells with vertical ordered bulk heterojunction Nanotechnology 24 484006 [8] Chen G, Sasabe H, Sano T, Wang X-F, Hong Z, Kido J and Yang Y 2013 Chloroboron (III) subnaphthalocyanine as an electron donor in bulk heterojunction photovoltaic cells Nanotechnology 24 484007 [9] Cheng P, Li Y and Zhan X 2013 DMF-assisted solution process boosts the efficiency in P3HT:PCBM solar cells up to 5.31% Nanotechnology 24 484008 [10] Chen H-Y, Lin S-H, Sun J-Y, Hsu C-H, Lan S and Lin C-F 2013 Morphologic improvement of the PBDTTT-C and PC71BM blend film with mixed solvent for high-performance inverted polymer solar cells Nanotechnology 24 484009 [11] Peng J, Sun Q, Zhai Z, Yuan J, Huang X, Jin Z, Li K, Wang S, Wang H and Ma W 2013 Low-temperature, solution-processed alumina for organic solar cells Nanotechnology 24 484010 [12] Chen F, Chen Q, Mao L, Wang Y, Huang X, Lu W, Wang B and Chen L 2013 Tuning ITO work function with solution-processed alkali carbonate interfacial layers for high-efficiency inverted organic photovoltaic cells Nanotechnology 24 484011 [13] Wu Z, Song T, Xia Z, Wei H and Sun B 2013 Enhanced performance of polymer solar cell with ZnO nanoparticle electron transporting layer passivated by in situ cross-linked three-dimensional polymer network Nanotechnology 24 484012 [14] Urbina A, Park J-S, Lee J-M, Kim S-O and Kim J-S 2013 Work function engineering of ZnO electrodes by using p-type and n-type doped carbon nanotubes Nanotechnology 24 484013 [15] van de Wiel H J et al 2013 R2R embedded conductive structures integrated into OPV devices Nanotechnology 24 484014

WHEN DID ROUND DISK GALAXIES FORM?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takeuchi, T. M.; Ohta, K.; Yuma, S.

2015-03-01

When and how galaxy morphology, such as the disk and bulge seen in the present-day universe, emerged is still not clear. In the universe at z ≳ 2, galaxies with various morphologies are seen, and star-forming galaxies at z ∼ 2 show the intrinsic shape of bar-like structures. Then, when did the round disk structure form? Here we take a simple and straightforward approach to see the epoch when a round disk galaxy population emerged by constraining the intrinsic shape statistically based on the apparent axial ratio distribution of galaxies. We derived the distributions of the apparent axial ratios inmore » the rest-frame optical light (∼5000 Å) of star-forming main-sequence galaxies at 2.5 > z > 1.4, 1.4 > z > 0.85, and 0.85 > z > 0.5, and found that their apparent axial ratios show peaky distributions at z ≳ 0.85, while a rather flat distribution at the lower redshift. By using a tri-axial model (A > B > C) for the intrinsic shape, we found that the best-fit models give the peaks of the B/A distribution of 0.81 ± 0.04, 0.84 ± 0.04, and 0.92 ± 0.05 at 2.5 > z > 1.4, 1.4 > z > 0.85, and 0.85 > z > 0.5, respectively. The last value is close to the local value of 0.95. Thickness (C/A) is ∼0.25 at all the redshifts and is close to the local value (0.21). The results indicate that the shape of the star-forming galaxies in the main sequence changes gradually, and that the round disk is established at around z ∼ 0.9. The establishment of the round disk may be due to the cessation of a violent interaction between galaxies or the growth of a bulge and/or a supermassive black hole residing at the center of a galaxy that dissolves the bar structure.« less

Stability Assessment of a System Comprising a Single Machine and Inverter with Scalable Ratings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Brian B; Lin, Yashen; Gevorgian, Vahan

From the inception of power systems, synchronous machines have acted as the foundation of large-scale electrical infrastructures and their physical properties have formed the cornerstone of system operations. However, power electronics interfaces are playing a growing role as they are the primary interface for several types of renewable energy sources and storage technologies. As the role of power electronics in systems continues to grow, it is crucial to investigate the properties of bulk power systems in low inertia settings. In this paper, we assess the properties of coupled machine-inverter systems by studying an elementary system comprised of a synchronous generator,more » three-phase inverter, and a load. Furthermore, the inverter model is formulated such that its power rating can be scaled continuously across power levels while preserving its closed-loop response. Accordingly, the properties of the machine-inverter system can be assessed for varying ratios of machine-to-inverter power ratings and, hence, differing levels of inertia. After linearizing the model and assessing its eigenvalues, we show that system stability is highly dependent on the interaction between the inverter current controller and machine exciter, thus uncovering a key concern with mixed machine-inverter systems and motivating the need for next-generation grid-stabilizing inverter controls.« less

Epigenetic events underlie the pathogenesis of sinonasal papillomas.

PubMed

Stephen, Josena K; Vaught, Lori E; Chen, Kang M; Sethi, Seema; Shah, Veena; Benninger, Michael S; Gardner, Glendon M; Schweitzer, Vanessa G; Khan, Mumtaz; Worsham, Maria J

2007-10-01

Benign inverted papillomas have been reported as monoclonal but lacking common genetic alterations identified in squamous cell carcinoma of the head and neck. Epigenetic changes alter the heritable state of gene expression and chromatin organization without change in DNA sequence. We investigated whether epigenetic events of aberrant promoter hypermethylation in genes known to be involved in squamous head and neck cancer underlie the pathogenesis of sinonasal papillomas. Ten formalin-fixed paraffin DNA samples from three inverted papilloma cases, two exophytic (everted) papilloma cases, and two cases with inverted and exophytic components were studied. DNA was obtained from microdissected areas of normal and papilloma areas and examined using a panel of 41 gene probes, designed to interrogate 35 unique genes for aberrant methylation status (22 genes) using the methylation-specific multiplex-ligation-specific polymerase assay. Methylation-specific PCR was employed to confirm aberrant methylation detected by the methylation-specific multiplex-ligation-specific polymerase assay. All seven cases indicated at least one epigenetic event of aberrant promoter hypermethylation. The CDKN2B gene was a consistent target of aberrant methylation in six of seven cases. Methylation-specific PCR confirmed hypermethylation of CDKN2B. Recurrent biopsies from two inverted papilloma cases had common epigenetic events. Promoter hypermethylation of CDKN2B was a consistent epigenetic event. Common epigenetic alterations in recurrent biopsies underscore a monoclonal origin for these lesions. Epigenetic events contribute to the underlying pathogenesis of benign inverted and exophytic papillomas. As a consistent target of aberrant promoter hypermethylation, CDKN2B may serve as an important epigenetic biomarker for gene reactivation studies.

Genetics Home Reference: PRICKLE1-related progressive myoclonus epilepsy with ataxia

MedlinePlus

... PROGRESSIVE MYOCLONIC, 1B Sources for This Page Bassuk AG, Wallace RH, Buhr A, Buller AR, Afawi Z, ... Jan 10. Citation on PubMed Fox MH, Bassuk AG. PRICKLE1-Related Progressive Myoclonus Epilepsy with Ataxia. 2009 ...

The recent NIR Flare of the Blazar CTA102

NASA Astrophysics Data System (ADS)

Carrasco, L.; Escobedo, G.; Porras, A.; Recillas, E.; Chavushyan, V.; Mayya, D. Y.

2018-01-01

Following the report of increased Gamma-Ray activity detected by AGILE of the high redshift QSO (z=1.037) CTA102 cross identified with the radio source 4C+11.69 and the Gamma-ray source 2FGLJ2232.4+1143 by Lucarelli et al.(ATEL #11045).

The Infrared Properties of Sources Matched in the Wise All-Sky and Herschel ATLAS Surveys

NASA Technical Reports Server (NTRS)

Bond, Nicholas A.; Benford, Dominic J.; Gardner, Jonathan P.; Amblard, Alexandre; Fleuren, Simone; Blain, Andrew W.; Dunne, Loretta; Smith, Daniel J. B.; Maddox, Steve J.; Hoyos, Carlos;

The Infrared Properties of Sources Matched in the WISE All-Sky and Herschel Atlas Surveys

NASA Technical Reports Server (NTRS)

Bond, Nicholas A.; Benford, Dominic J.; Gardner, Jonathan P.; Eisenhardt, Peter; Amblard, Alexandre; Temi, Pasquale; Fleuren, Simone; Blain, Andrew W.; Dunne, Loretta; Smith, Daniel J.;

Global changes in gene expression during compatible and incompatible interactions of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides.

PubMed

Huang, Kan; Mellor, Karolina E; Paul, Shom N; Lawson, Mark J; Mackey, Aaron J; Timko, Michael P

2012-08-17

Cowpea, Vigna unguiculata L. Walp., is one of the most important food and forage legumes in the semi-arid tropics. While most domesticated forms of cowpea are susceptible to the root parasitic weed Striga gesnerioides, several cultivars have been identified that show race-specific resistance. Cowpea cultivar B301 contains the RSG3-301 gene for resistance to S. gesnerioides race SG3, but is susceptible to race SG4z. When challenged by SG3, roots of cultivar B301 develop a strong resistance response characterized by a hypersensitive reaction and cell death at the site of parasite attachment. In contrast, no visible response occurs in B301 roots parasitized by SG4z. Gene expression in the roots of the cowpea cultivar B301 during compatible (susceptible) and incompatible (resistant) interactions with S. gesnerioides races SG4z and SG3, respectively, were investigated at the early (6 days post-inoculation (dpi)) and late (13 dpi) stages of the resistance response using a Nimblegen custom design cowpea microarray. A total of 111 genes were differentially expressed in B301 roots at 6 dpi; this number increased to 2102 genes at 13 dpi. At 13 dpi, a total of 1944 genes were differentially expressed during compatible (susceptible) interactions of B301 with SG4z. Genes and pathways involved in signal transduction, programmed cell death and apoptosis, and defense response to biotic and abiotic stress were differentially expressed in the early resistance response; at the later time point, enrichment was primarily for defense-related gene expression, and genes encoding components of lignifications and secondary wall formation. In compatible interactions (B301-SG4z), multiple defense pathways were repressed, including those involved in lignin biosynthesis and secondary cell wall modifications, while cellular transport processes for nitrogen and sulfur were increased. Distinct changes in global gene expression profiles occur in host roots following successful and unsuccessful attempted parasitism by Striga. Induction of specific defense related genes and pathways defines components of a unique resistance mechanism. Some genes and pathways up-regulated in the host resistance response to SG3 are repressed in the susceptible interactions, suggesting that the parasite is targeting specific components of the host's defense. These results add to our understanding of plant-parasite interactions and the evolution of resistance to parasitic weeds.

Approach to Fabricate Rigid Substrate for 2.4 GHz Inverted-F Antenna Using a Room Temperature Curable Dielectric Ink on Photo and Nanopaper

NASA Astrophysics Data System (ADS)

Sowpati, A. K.; Nelo, M.; Varghese, J.; Liimatainen, H.; Visanko, M.; Sebastian, M. T.; Jantunen, H.

2018-05-01

The effect of a room temperature curable dielectric ink (ZrSiO4) printed on commercial photo paper and prepared nanopaper on the dielectric properties at 2.4 GHz are studied. In both cases, the dielectric layer decreased the relative permittivity and dielectric loss and made the flexible substrates rigid. For the nanopaper, the permittivity decreased from 4.7 to 3.57 and the loss value from 0.12 to 0.04. The measured decreases for the photo paper were from 3.12 to 2.61 and from 0.09 to 0.05, respectively. In the performance of the simulated and fabricated inverted-F antennas, the effect of the dielectric layer could be observed in the decrease of its frequency with about 130 MHz mainly due to the thicker substrate. The measured total efficiency and gain were 83% and 3.4 dB. The proposed approach could be in the future used for further development of the antenna by modification of the dielectric ink with different additives.

Approach to Fabricate Rigid Substrate for 2.4 GHz Inverted-F Antenna Using a Room Temperature Curable Dielectric Ink on Photo and Nanopaper

NASA Astrophysics Data System (ADS)

Sowpati, A. K.; Nelo, M.; Varghese, J.; Liimatainen, H.; Visanko, M.; Sebastian, M. T.; Jantunen, H.

2018-07-01

The effect of a room temperature curable dielectric ink (ZrSiO4) printed on commercial photo paper and prepared nanopaper on the dielectric properties at 2.4 GHz are studied. In both cases, the dielectric layer decreased the relative permittivity and dielectric loss and made the flexible substrates rigid. For the nanopaper, the permittivity decreased from 4.7 to 3.57 and the loss value from 0.12 to 0.04. The measured decreases for the photo paper were from 3.12 to 2.61 and from 0.09 to 0.05, respectively. In the performance of the simulated and fabricated inverted-F antennas, the effect of the dielectric layer could be observed in the decrease of its frequency with about 130 MHz mainly due to the thicker substrate. The measured total efficiency and gain were 83% and 3.4 dB. The proposed approach could be in the future used for further development of the antenna by modification of the dielectric ink with different additives.

Infrared-faint radio sources in the SERVS deep fields. Pinpointing AGNs at high redshift

NASA Astrophysics Data System (ADS)

Maini, A.; Prandoni, I.; Norris, R. P.; Spitler, L. R.; Mignano, A.; Lacy, M.; Morganti, R.

2016-12-01

Context. Infrared-faint radio sources (IFRS) represent an unexpected class of objects which are relatively bright at radio wavelength, but unusually faint at infrared (IR) and optical wavelengths. A recent and extensive campaign on the radio-brightest IFRSs (S1.4 GHz≳ 10 mJy) has provided evidence that most of them (if not all) contain an active galactic nuclei (AGN). Still uncertain is the nature of the radio-faintest IFRSs (S1.4 GHz≲ 1 mJy). Aims: The scope of this paper is to assess the nature of the radio-faintest IFRSs, testing their classification and improving the knowledge of their IR properties by making use of the most sensitive IR survey available so far: the Spitzer Extragalactic Representative Volume Survey (SERVS). We also explore how the criteria of IFRSs can be fine-tuned to pinpoint radio-loud AGNs at very high redshift (z > 4). Methods: We analysed a number of IFRS samples identified in SERVS fields, including a new sample (21 sources) extracted from the Lockman Hole. 3.6 and 4.5 μm IR counterparts of the 64 sources located in the SERVS fields were searched for and, when detected, their IR properties were studied. Results: We compared the radio/IR properties of the IR-detected IFRSs with those expected for a number of known classes of objects. We found that IR-detected IFRSs are mostly consistent with a mixture of high-redshift (z ≳ 3) radio-loud AGNs. The faintest ones (S1.4 GHz 100 μJy), however, could be also associated with nearer (z 2) dust-enshrouded star-burst galaxies. We also argue that, while IFRSs with radio-to-IR ratios >500 can very efficiently pinpoint radio-loud AGNs at redshift 2 < z < 4, lower radio-to-IR ratios ( 100-200) are expected for higher redshift radio-loud AGNs.

VIMOS Ultra-Deep Survey (VUDS): IGM transmission towards galaxies with 2.5 < z < 5.5 and the colour selection of high-redshift galaxies

NASA Astrophysics Data System (ADS)

Thomas, R.; Le Fèvre, O.; Le Brun, V.; Cassata, P.; Garilli, B.; Lemaux, B. C.; Maccagni, D.; Pentericci, L.; Tasca, L. A. M.; Zamorani, G.; Zucca, E.; Amorin, R.; Bardelli, S.; Cassarà, L.; Castellano, M.; Cimatti, A.; Cucciati, O.; Durkalec, A.; Fontana, A.; Giavalisco, M.; Grazian, A.; Hathi, N. P.; Ilbert, O.; Paltani, S.; Pforr, J.; Ribeiro, B.; Schaerer, D.; Scodeggio, M.; Sommariva, V.; Talia, M.; Tresse, L.; Vanzella, E.; Vergani, D.; Capak, P.; Charlot, S.; Contini, T.; Cuby, J. G.; de la Torre, S.; Dunlop, J.; Fotopoulou, S.; Koekemoer, A.; López-Sanjuan, C.; Mellier, Y.; Salvato, M.; Scoville, N.; Taniguchi, Y.; Wang, P. W.

2017-01-01

The observed UV rest-frame spectra of distant galaxies are the result of their intrinsic emission combined with absorption along the line of sight produced by the inter-galactic medium (IGM). Here we analyse the evolution of the mean IGM transmission Tr(Lyα) and its dispersion along the line of sight for 2127 galaxies with 2.5 < z < 5.5 in the VIMOS Ultra Deep Survey (VUDS). We fitted model spectra combined with a range of IGM transmission to the galaxy spectra using the spectral fitting algorithm GOSSIP+. We used these fits to derive the mean IGM transmission towards each galaxy for several redshift slices from z = 2.5 to z = 5.5. We found that the mean IGM transmission defined as Tr(Lyα) = e- τ (with τ as the HI optical depth) is 79%, 69%, 59%, 55%, and 46% at redshifts 2.75, 3.22, 3.70, 4.23, and 4.77, respectively. We compared these results to measurements obtained from quasar lines of sight and found that the IGM transmission towards galaxies is in excellent agreement with quasar values up to redshift z 4. We found tentative evidence for a higher IGM transmission at z ≥ 4 compared to results from QSOs, but a degeneracy between dust extinction and IGM prevents us from firmly concluding whether the internal dust extinction for star-forming galaxies at z > 4 takes a mean value significantly in excess of E(B-V) > 0.15. Most importantly, we found a large dispersion of IGM transmission along the lines of sight towards distant galaxies with 68% of the distribution within 10 to 17% of the median value in δz = 0.5 bins, similar to what is found on the lines of sight towards QSOs. We demonstrate that taking this broad range of IGM transmission into account is important when selecting high-redshift galaxies based on their colour properties (e.g. LBG or photometric redshiftselection) because failing to do so causes a significant incompleteness in selecting high-redshift galaxy populations. We finally discuss the observed IGM properties and speculate that the broad range of observed transmissions might be the result of cosmic variance and clustering along lines of sight. This clearly shows that the sources that cause this extinction need to be more completely modelled. Based on data obtained with the European Southern Observatory Very Large Telescope, Paranal, Chile, under Large Program 185.A-0791.

The whole chloroplast genome of wild rice (Oryza australiensis).

PubMed

Wu, Zhiqiang; Ge, Song

2016-01-01

The whole chloroplast genome of wild rice (Oryza australiensis) is characterized in this study. The genome size is 135,224  bp, exhibiting a typical circular structure including a pair of 25,776  bp inverted repeats (IRa,b) separated by a large single-copy region (LSC) of 82,212  bp and a small single-copy region (SSC) of 12,470  bp. The overall GC content of the genome is 38.95%. 110 unique genes were annotated, including 76 protein-coding genes, 4 ribosomal RNA genes, and 30t RNA genes. Among these, 18 are duplicated in the inverted repeat regions, 13 genes contain one intron, and 2 genes (rps12 and ycf3) have two introns.

VizieR Online Data Catalog: z>~5 AGN in Chandra Deep Field-South (Weigel+, 2015)

NASA Astrophysics Data System (ADS)

Weigel, A. K.; Schawinski, K.; Treister, E.; Urry, C. M.; Koss, M.; Trakhtenbrot, B.

2015-09-01

The Chandra 4-Ms source catalogue by Xue et al. (2011, Cat. J/ApJS/195/10) is the starting point of this work. It contains 740 sources and provides counts and observed frame fluxes in the soft (0.5-2keV), hard (2-8keV) and full (0.5-8keV) band. All object IDs used in this work refer to the source numbers listed in the Xue et al. (2011, Cat. J/ApJS/195/10) Chandra 4-Ms catalogue. We make use of Hubble Space Telescope (HST)/Advanced Camera for Surveys (ACS) data from the Great Observatories Origins Deep Survey South (GOODS-south) in the optical wavelength range. We use catalogues and images for filters F435W (B), F606W (V), F775W (i) and 850LP (z) from the second GOODS/ACS data release (v2.0; Giavalisco et al., 2004, Cat. II/261). We use Cosmic Assembly Near-infrared Deep Extragalactic Legacy Survey (CANDELS) Wide Field Camera 3 (WFC3)/infrared data from the first data release (DR1, v1.0) for passbands F105W (Y), F125W (J) and F160W (H) (Grogin et al., 2011ApJS..197...35G; Koekemoer et al., 2011ApJS..197...36K). To determine which objects are red, dusty, low-redshift interlopers, we also include the 3.6 and 4.5 micron Spitzer Infrared Array Camera (IRAC) channels. We use SIMPLE image data from the DR1 (van Dokkum et al., 2005, Spitzer Proposal, 2005.20708) and the first version of the extended SIMPLE catalogue by Damen et al. (2011, Cat. J/ApJ/727/1). (6 data files).

Observer-Pattern Modeling and Slow-Scale Bifurcation Analysis of Two-Stage Boost Inverters

NASA Astrophysics Data System (ADS)

Zhang, Hao; Wan, Xiaojin; Li, Weijie; Ding, Honghui; Yi, Chuanzhi

2017-06-01

This paper deals with modeling and bifurcation analysis of two-stage Boost inverters. Since the effect of the nonlinear interactions between source-stage converter and load-stage inverter causes the “hidden” second-harmonic current at the input of the downstream H-bridge inverter, an observer-pattern modeling method is proposed by removing time variance originating from both fundamental frequency and hidden second harmonics in the derived averaged equations. Based on the proposed observer-pattern model, the underlying mechanism of slow-scale instability behavior is uncovered with the help of eigenvalue analysis method. Then eigenvalue sensitivity analysis is used to select some key system parameters of two-stage Boost inverter, and some behavior boundaries are given to provide some design-oriented information for optimizing the circuit. Finally, these theoretical results are verified by numerical simulations and circuit experiment.

Using Diffraction Tomography to Estimate Marine Animal Size

NASA Astrophysics Data System (ADS)

Jaffe, J. S.; Roberts, P.

In this article we consider the development of acoustic methods which have the potential to size marine animals. The proposed technique uses scattered sound in order to invert for both animal size and shape. The technique uses the Distorted Wave Born Approximation (DWBA) in order to model sound scattered from these organisms. The use of the DWBA also provides a valuable context for formulating data analysis techniques in order to invert for parameters of the animal. Although 3-dimensional observations can be obtained from a complete set of views, due to the difficulty of collecting full 3-dimensional scatter, it is useful to simplify the inversion by approximating the animal by a few parameters. Here, the animals are modeled as 3-dimensional ellipsoids. This reduces the complexity of the problem to a determination of the 3 semi axes for the x, y and z dimensions from just a few radial spokes through the 3-dimensional Fourier Transform. In order to test the idea, simulated scatter data is taken from a 3-dimensional model of a marine animal and the resultant data are inverted in order to estimate animal shape

Control strategy based on SPWM switching patterns for grid connected photovoltaic inverter

NASA Astrophysics Data System (ADS)

Hassaine, L.; Mraoui, A.

2017-02-01

Generally, for lower installation of photovoltaic systems connected to the grid, pulse width modulation (PWM) is a widely used technique for controlling the voltage source inverters injects currents into the grid. The current injected must be sinusoidal with reduced harmonic distortion. In this paper, a digital implementation of a control strategy based on PWM switching patterns for an inverter for photovoltaic system connected to the grid is presented. This strategy synchronize a sinusoidal inverter output current with a grid voltage The digital implementation of the proposed PWM switching pattern when is compared with the conventional one exhibit the advantage: Simplicity, reduction of the memory requirements and power calculation for the control

Improving the reliability of inverter-based welding machines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schiedermayer, M.

1997-02-01

Although inverter-based welding power sources have been available since the late 1980s, many people hesitated to purchase them because of reliability issues. Unfortunately, their hesitancy had a basis, until now. Recent improvements give some inverters a reliability level that approaches that of traditional, transformer-based industrial welding machines, which have a failure rate of about 1%. Acceptance of inverter-based welding machines is important because, for many welding applications, they provide capabilities that solid-state, transformer-based machines cannot deliver. These advantages include enhanced pulsed gas metal arc welding (GMAW-P), lightweight portability, an ultrastable arc, and energy efficiency--all while producing highly aesthetic weld beadsmore » and delivering multiprocess capabilities.« less

Design of a three-phase, 15-kilovolt-ampere static inverter for motor-starting a Brayton space power system

NASA Technical Reports Server (NTRS)

Frye, R. J.; Birchenough, A. G.

1971-01-01

The design of a three-phase, 400-Hz, 15-kVA static inverter for motor-starting the 2- to 15-kWe Brayton electrical space power system is described. The inverter operates from a nominal 56-V dc source to provide a 28-V, rms, quasi-square-wave output. The inverter is capable of supplying a 200-A peak current. Integrated circuitry is used to generate the three-phase, 400-Hz reference signals. Performance data for a drive stage that improves switching speed and provides efficient operation over a range of output current and drive supply voltage are presented. A transformerless, transistor output stage is used.

Simultaneous determination of thirteen flavonoids from Xiaobuxin-Tang extract using high-performance liquid chromatography coupled with electrospray ionization mass spectrometry.

PubMed

Cen, Meifeng; Ruan, Jinxiu; Huang, Lihua; Zhang, Zhenqing; Yu, Nengjiang; Zhang, Youzhi; Cheng, Xuange; Xiong, Xiaohong; Wang, Guixiang; Zang, Linquan; Wang, Sujun

2015-11-10

A simple and reliable high performance liquid chromatography coupled with electrospray ionization mass spectrometry (HPLC-ESI-MS) analysis method was established to simultaneously determine thirteen flavonoids of Xiaobuxing-Tang in intestine perfusate, namely onpordin, 3'-O-methylorobol, glycitein, patuletin, genistein, luteolin, quercetin, nepitrin, quercimeritrin, daidzin, patulitrin, quercetagitrin and 3-glucosylisorhamnetin. Detection was performed on a quadrupole mass spectrometer equipped with an electrospray ionization (ESI) source operating in negative ionization mode. Negative ion ESI was used to form deprotonated molecules at m/z 315 for onpordin, m/z 299 for 3'-O-methylorobol, m/z 283 for glycitein, m/z 331 for patuletin, m/z 269 for genistein, m/z 285 for luteolin, m/z 301 for quercetin, m/z 477 for nepitrin, m/z 463 for quercimeritrin, m/z 461 for daidzin, m/z 493 for patulitrin, m/z 479 for quercetagitrin, m/z 477 for 3-glucosylisorhamnetin and m/z 609.2 for rutin. The linearity, sensitivity, selectivity, repeatability, accuracy, precision, recovery and matrix effect of the assay were evaluated. The proposed method was successfully applied to simultaneous determination of these thirteen flavonoids, and using this method, the intestinal absorption profiles of thirteen flavonoids were preliminarily predicted. Copyright © 2015 Elsevier B.V. All rights reserved.

The H2A.Z/H2B dimer is unstable compared to the dimer containing the major H2A isoform.

PubMed

Placek, Brandon J; Harrison, L Nicole; Villers, Brooke M; Gloss, Lisa M

2005-02-01

The nucleosome, the basic fundamental repeating unit of chromatin, contains two H2A/H2B dimers and an H3/H4 tetramer. Modulation of the structure and dynamics of the nucleosome is an important regulation mechanism of DNA-based chemistries in the eukaryotic cell, such as transcription and replication. One means of altering the properties of the nucleosome is by incorporation of histone variants. To provide insights into how histone variants may impact the thermodynamics of the nucleosome, the stability of the heterodimer between the H2A.Z variant and H2B was determined by urea-induced denaturation, monitored by far-UV circular dichroism, intrinsic Tyr fluorescence intensity, and anisotropy. In the absence of stabilizing agents, the H2A.Z/H2B dimer is only partially folded. The stabilizing cosolute, trimethylamine-N-oxide (TMAO) was used to promote folding of the unstable heterodimer. The equilibrium stability of the H2A.Z/H2B dimer is compared to that of the H2A/H2B dimer. The equilibrium folding of both histone dimers is highly reversible and best described by a two-state model, with no detectable equilibrium intermediates populated. The free energies of unfolding, in the absence of denaturant, of H2A.Z/H2B and H2A/H2B are 7.3 kcal mol(-1) and 15.5 kcal mol(-1), respectively, in 1 M TMAO. The H2A.Z/H2B dimer is the least stable histone fold characterized to date, while H2A/H2B appears to be the most stable. It is speculated that this difference in stability may contribute to the different biophysical properties of nucleosomes containing the major H2A and the H2A.Z variant.

Research on Turbine Flowfield Analysis Methods.

DTIC Science & Technology

1985-01-01

Z W 2 N 312 ZClC(NP)=(Z7A1(NP)+Z- A2(NP),*2-W)/Z. 72:’ 3 l=2,NB.2 SNP =NBI2+I ZB-B=(Z-AI(NP2-NP)iZA2(NP--NIP)*ZW)/2. 31𔃽 Z’CC’(NP)=CONJG(ZBB) =REAL (C...AD-RI64 179 RESEARCH ON TURBINE FLOUFIELD ANALYSIS NETHODSCU) 1/2 CALSPAN ADYANCED TECHNOLOGY CENTER BUFFALO NY U J RAE JAN 85 CALSPAN-?177 A 3 AFOSR...MARKINGS %. ft UNCLASSIFIED _ _ _ _ _ _ _ 4 2&. SECURITY CLASSIFICATION AUTHORITY 3 . DISTRIBUTION/AVAI LABILITY OF REPORT * 2. OCLASIFCATON/OWNRAONG

Methods for Solving the Viscoelasticity Equations for Cylinder and Sphere Problems

DTIC Science & Technology

1976-03-22

iEA~Q:t~). Z: 1:40i p .2.. * 4// 4 4) DISPLALEMENT- INLIEPENCEANr POTENTIAL AýELArO: 4) iPAL~T NDEIJUNCF’!r. IoorENTAL .qELATiOW5 bIO GkERAL...A t) STELE .8) Q~SP...]’e- $3~bp "j6 I1+MDV2(E.. -E.L~ REAL2. Ot Jr *l f.Ji) 4_NV Z 4 i.’ v THE rzOXM EPRlON CAN BE GIVE N PVAU IN DNA ANY LANf

Spatial Correlation Function of the Chandra Selected Active Galactic Nuclei

NASA Technical Reports Server (NTRS)

Yang, Y.; Mushotzky, R. F.; Barger, A. J.; Cowie, L. L.

2006-01-01

We present the spatial correlation function analysis of non-stellar X-ray point sources in the Chandra Large Area Synoptic X-ray Survey of Lockman Hole Northwest (CLASXS). Our 9 ACIS-I fields cover a contiguous solid angle of 0.4 deg(exp 2) and reach a depth of 3 x 10(exp -15) erg/square cm/s in the 2-8 keV band. We supplement our analysis with data from the Chandra Deep Field North (CDFN). The addition of this field allows better probe of the correlation function at small scales. A total of 233 and 252 sources with spectroscopic information are used in the study of the CLASXS and CDFN fields respectively. We calculate both redshift-space and projected correlation functions in co-moving coordinates, averaged over the redshift range of 0.1 < z < 3.0, for both CLASXS and CDFN fields for a standard cosmology with Omega(sub Lambda) = 0.73,Omega(sub M) = 0.27, and h = 0.71 (H(sub 0) = 100h km/s Mpc(exp -1). The correlation function for the CLASXS field over scales of 3 Mpc< s < 200 Mpc can be modeled as a power-law of the form xi(s) = (S/SO)(exp - gamma), with gamma = 1.6(sup +0.4 sub -0.3) and S(sub o) = 8.0(sup +.14 sub -1.5) Mpc. The redshift-space correlation function for CDFN on scales of 1 Mpc< s < 100 Mpc is found to have a similar correlation length so = 8.55(sup +0.74 sub -0.74) Mpc, but a shallower slope (gamma = 1.3 +/- 0.1). The real-space correlation functions derived from the projected correlation functions, are found to be tau(sub 0 = 8.1(sup +1.2 sub -2.2) Mpc, and gamma = 2.1 +/- 0.5 for the CLASXS field, and tau(sub 0) = 5.8(sup +.1.0 sub -1.5) Mpc, gamma = 1.38(sup +0.12 sub -0.14 for the CDFN field. By comparing the real- and redshift-space correlation functions in the combined CLASXS and CDFN samples, we are able to estimate the redshift distortion parameter Beta = 0.4 +/- 0.2 at an effective redshift z = 0.94. We compare the correlation functions for hard and soft spectra sources in the CLASXS field and find no significant difference between the two groups. We have also found that the correlation between X-ray luminosity and clustering amplitude is weak, which, however, is fully consistent with the expectation using the simplest relations between X-ray luminosity, black hole mass, and dark halo mass. We study the evolution of the AGN clustering by dividing the samples into 4 redshift bins over 0.1 Mpc< z <3.0 Mpc. We find a very mild evolution in the clustering amplitude, which show the same evolution trend found in optically selected quasars in the 2dF survey. We estimate the evolution of the bias, and find that the bias increases rapidly with redshift (b(z = 0.45) = 0.95 +/- 0.15 and b(z = 2.07) = 3.03 +/- 0.83): The typical mass of the dark matter halo derived from the bias estimates show little change with redshift. The average halo mass is found to be log (M(sub halo)/M(sun))approximates 12.1. Subject headings: cosmology: observations - large-scale structure of the universe - x-rays: diffuse background - galaxies: nuclei

Intermittent Oxygen Inhalation with Proper Frequency Improves Overall Health Conditions and Alleviates Symptoms in a Population at High Risk of Chronic Mountain Sickness with Severe Symptoms

PubMed Central

Feng, Bin; Xu, Wei-Hao; Gao, Yu-Qi; Liu, Fu-Yu; Li, Peng; Zheng, Shan-Jun; Gai, Lu-Yue; Zhang, Gang

2016-01-01

Background: Oxygen inhalation therapy is essential for the treatment of patients with chronic mountain sickness (CMS), but the efficacy of oxygen inhalation for populations at high risk of CMS remains unknown. This research investigated whether oxygen inhalation therapy benefits populations at high risk of CMS. Methods: A total of 296 local residents living at an altitude of 3658 m were included; of which these were 25 diagnosed cases of CMS, 8 cases dropped out of the study, and 263 cases were included in the analysis. The subjects were divided into high-risk (180 ≤ hemoglobin (Hb) <210 g/L, n = 161) and low-risk (Hb <180 g/L, n = 102) groups, and the cases in each group were divided into severe symptom (CMS score ≥6) and mild symptom (CMS score 0-5) subgroups. Severe symptomatic population of either high- or low-risk CMS was randomly assigned to no oxygen intake group (A group) or oxygen intake 7 times/week group (D group); mild symptomatic population of either high- or low-risk CMS was randomly assigned to no oxygen intake group (A group), oxygen intake 2 times/week group (B group), and 4 times/week group (C group). The courses for oxygen intake were all 30 days. The CMS symptoms, sleep quality, physiological biomarkers, biochemical markers, etc., were recorded on the day before oxygen intake, on the 15th and 30th days of oxygen intake, and on the 15th day after terminating oxygen intake therapy. Results: A total of 263 residents were finally included in the analysis. Among these high-altitude residents, CMS symptom scores decreased for oxygen inhalation methods B, C, and D at 15 and 30 days after oxygen intake and 15 days after termination, including dyspnea, palpitation, and headache index, compared to those before oxygen intake (B group: Z = 5.604, 5.092, 5.741; C group: Z = 4.155, 4.068, 4.809; D group: Z = 6.021, 6.196, 5.331, at the 3 time points respectively; all P < 0.05/3 vs. before intake). However, dyspnea/palpitation (A group: Z = 5.003, 5.428, 5.493, both P < 0.05/3 vs. before intake) and headache (A group: Z = 4.263, 3.890, 4.040, both P < 0.05/3 vs. before intake) index decreased significantly also for oxygen inhalation method A at all the 3 time points. Cyanosis index decreased significantly 30 days after oxygen intake only in the group of participants administered the D method (Z = 2.701, P = 0.007). Tinnitus index decreased significantly in group A and D at 15 days (A group: Z = 3.377, P = 0.001, D group: Z = 3.150, P = 0.002), 30 days after oxygen intake (A group: Z = 2.836, P = 0.005, D group: Z = 5.963, P < 0.0001) and 15 days after termination (A group: Z = 2.734, P = 0.006, D group: Z = 4.049, P = 0.0001), and decreased significantly in the group B and C at 15 days after termination (B group: Z = 2.611, P = 0.009; C group: Z = 3.302, P = 0.001). In the population at high risk of CMS with severe symptoms, oxygen intake 7 times/week significantly improved total symptom scores of severe symptoms at 15 days (4 [2, 5] vs. 5.5 [4, 7], Z = 2.890, P = 0.005) and 30 days (3 [1, 5] vs. 5.5 [2, 7], Z = 3.270, P = 0.001) after oxygen intake compared to no oxygen intake. In the population at high risk of CMS with mild symptoms, compared to no oxygen intake, oxygen intake 2 or 4 times/week did not improve the total symptom scores at 15 days (2 [1, 3], 3 [1, 4] vs. 3 [1.5, 5]; χ2= 2.490, P = 0.288), and at 30 days (2 [0, 4], 2 [1, 4.5] vs. 3 [2, 5]; χ2= 3.730, P = 0.155) after oxygen intake. In the population at low risk of CMS, oxygen intake did not significantly change the white cell count and red cell count compared to no oxygen intake, neither in the severe symptomatic population nor in the mild symptomatic population. Conclusions: Intermittent oxygen inhalation with proper frequency might alleviate symptoms in residents at high altitude by improving their overall health conditions. Administration of oxygen inhalation therapy 2–4 times/week might not benefit populations at high risk of CMS with mild CMS symptoms while administration of therapy 7 times/week might benefit those with severe symptoms. Oxygen inhalation therapy is not recommended for low-risk CMS populations. PMID:27231170

Boosting Up Performance of Inverted Photovoltaic Cells from Bis(alkylthien-2-yl)dithieno[2,3-d:2',3'-d']benzo[1,2-b:4',5'-b']di thiophene-Based Copolymers by Advantageous Vertical Phase Separation.

PubMed

Guo, Pengzhi; Luo, Guoping; Su, Qiang; Li, Jianfeng; Zhang, Peng; Tong, Junfeng; Yang, Chunyan; Xia, Yangjun; Wu, Hongbin

2017-03-29

The photovoltaic cells (PVCs) from conjugated copolymers of PDTBDT-BT and PDTBDT-FBT with 5,10-bis(4,5-didecylthien-2-yl)dithieno[2,3-d:2',3'-d']benzo[1,2-b:4,5-b']dithiophene as electron donor moieties and benzothiadiazole and/or 5,6-difluorobenzothiadiazole as electron acceptor moieties are optimized by employing alcohol-soluble PFN (poly(9,9-bis(3'-(N,N-dimethylamino)propyl)-2,7-fluorene)-alt-2,7-(9,9-dioctylfluorene)) as cathode modification interlayer. The power conversion efficiencies (PCEs) of inverted PVCs (i-PVCs) from PDTBDT-BT and PDTBDT-FBT with devices configuration as ITO/PFN/active layer/MoO 3 /Ag are increased from 4.97% to 8.54% and 5.92% to 8.74%, in contrast to those for the regular PVCs (r-PVCs) with devices configuration as ITO/PEDOT:PSS/active layer/Ca/Al under 100 mW/cm 2 AM 1.5 illumination. The optical modeling calculations and X-ray photoelectron spectroscopy (XPS) investigations reveal that the r-PVCs and i-PVCs from the copolymers exhibit similar light harvesting characteristics, and the enhancements of the PCEs of the i-PVCs from the copolymers are mainly contributed to the favorable vertical phase separation as the strongly polymer-enriched top surface layers and slightly PC 71 BM (phenyl-C 71 -butyric acid methyl ester)-enriched bottom surface layers are correspondingly connected to the anodes and cathodes of the i-PVCs, while they are opposite in the r-PVCs. As we known, it is the first time to experimentally verify that the i-PVCs with alcohol-soluble conjugated polymers cathode modification layers enjoy favorable vertical phase separation.

Spectroscopic parameters and decays of the resonance Z_b(10610)

NASA Astrophysics Data System (ADS)

Agaev, S. S.; Azizi, K.; Sundu, H.

2017-12-01

The resonance Z_b(10610) is investigated as the diquark-antidiquark Z_b=[bu][\\overline{bd}] state with spin-parity JP=1+. The mass and current coupling of the resonance Z_b(10610) are evaluated using QCD two-point sum rule and taking into account the vacuum condensates up to ten dimensions. We study the vertices Z_bΥ (nS)π (n=1,2,3) by applying the QCD light-cone sum rule to compute the corresponding strong couplings g_{Z_bΥ (nS)π } and widths of the decays Z_b → Υ (nS)π . We explore also the vertices Z_b hb(mP)π (m=1,2) and calculate the couplings g_{Z_b hb(mP)π } and the widths of the decay channels Z_b → hb(mP)π . To this end, we calculate the mass and decay constants of the h_b(1P) and h_b(2P) mesons. The results obtained are compared with experimental data of the Belle Collaboration.

Determination of aniracetam's main metabolite, N-anisoyl-GABA, in human plasma by LC-MS/MS and its application to a pharmacokinetic study.

PubMed

Cai, Shuang; Wang, Lei

2012-05-15

A simple and rapid high-performance liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) method has been developed and validated for the determination of 4-p-anisamidobutyric acid (ABA; or N-anysoyl-γ-aminobutiryc acid, N-anisoyl-GABA), a major active metabolite of aniracetam, in human plasma. After protein precipitation of plasma sample with methanol, ABA and the internal standard lisinopril were separated on a Venusil ASB C₁₈ column at 25 °C. The mobile phase consisted of methanol-ammonium acetate (10 mmol/L) (30:70, v/v). The detection was performed on a triple quadrupole tandem mass spectrometer with an ESI source in negative ion mode. Multiple reaction monitoring (MRM) using the precursor→product ion combinations of m/z 235.8→m/z 106.6, and m/z 403.8→m/z 113.6 was used to quantify ABA and lisinopril, respectively. This is the first LC-MS/MS method for ABA with advantages of short analysis time (4.5 min per sample run) and high selectivity attributable to the MRM detection and optimized HPLC conditions. The response was linear in a concentration range of 0.0485-19.4 μg/mL in plasma. The extraction recovery of ABA was between 89.1% and 100.7%. The precision (RSD) and accuracy (RE) of the method were evaluated to be within 7.3% and from 2.5% to 6.9%. The validated method has been applied to the pharmacokinetic study after a single oral administration of aniracetam dispersible tablets to human beings. Copyright © 2012 Elsevier B.V. All rights reserved.

Modeling the Volcanic Source at Long Valley, CA, Using a Genetic Algorithm Technique

NASA Technical Reports Server (NTRS)

Tiampo, Kristy F.

1999-01-01

In this project, we attempted to model the deformation pattern due to the magmatic source at Long Valley caldera using a real-value coded genetic algorithm (GA) inversion similar to that found in Michalewicz, 1992. The project has been both successful and rewarding. The genetic algorithm, coded in the C programming language, performs stable inversions over repeated trials, with varying initial and boundary conditions. The original model used a GA in which the geophysical information was coded into the fitness function through the computation of surface displacements for a Mogi point source in an elastic half-space. The program was designed to invert for a spherical magmatic source - its depth, horizontal location and volume - using the known surface deformations. It also included the capability of inverting for multiple sources.

2D Electrostatic Potential Solver for Hall Thruster Simulation

DTIC Science & Technology

2006-07-12

µ(jrBz − jzBr)Br − jrBθ) + µneEz + µ∇zp jr = µ(jzBθ − µ(jrBz − jzBr)Bz) + µneEr + µ∇rp (5) This equation system can be solved to isolate the axial and...Simplification The following simplifications are used to more easily manipulate the equation system . jz = Z3Ez + Z4Er + Z5 jr = R3Ez +R4Er +R5 (10) where, Z5...j−1 ∆r (18) With appropriate boundary conditions, a pentadiagonal linear system of equations of the form Ax=b can be constructed (where x is the

High input impedance amplifier

NASA Technical Reports Server (NTRS)

Kleinberg, Leonard L.

1995-01-01

High input impedance amplifiers are provided which reduce the input impedance solely to a capacitive reactance, or, in a somewhat more complex design, provide an extremely high essentially infinite, capacitive reactance. In one embodiment, where the input impedance is reduced in essence, to solely a capacitive reactance, an operational amplifier in a follower configuration is driven at its non-inverting input and a resistor with a predetermined magnitude is connected between the inverting and non-inverting inputs. A second embodiment eliminates the capacitance from the input by adding a second stage to the first embodiment. The second stage is a second operational amplifier in a non-inverting gain-stage configuration where the output of the first follower stage drives the non-inverting input of the second stage and the output of the second stage is fed back to the non-inverting input of the first stage through a capacitor of a predetermined magnitude. These amplifiers, while generally useful, are very useful as sensor buffer amplifiers that may eliminate significant sources of error.

M-X Environmental Technical Report. Socioeconomic Impact Estimates for Texas ROI Counties. Detailed Tables.

DTIC Science & Technology

1980-12-22

C LC0 a F L(i :> I c,. r- DC -0. _j- F 0> FL F . >m xz_ v Fj j . Z Z’- >0 D 14 4 iCC Li CO 04F _j- 4 .C(nm bC 4. u o 0j l 0 <--- m xcw -n Z 0 .j F -j... lC0 0 - (- rd WIj -I IOO 0- D 0 Id0 In miL r0 m Ii Qi W. Q N _j n z w < I S-i < N Iu m I I N jw > -N Ni Ih Ij j> L n -j> E r I ’ -I aIi ’ It 0 I ) x

21 CFR 146.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-04-01

... dextrose. (b) The term dextrose means the hydrated or anhydrous, refined monosaccharide obtained from... means an aqueous solution of inverted or partly inverted, refined or partly refined sucrose, the solids... flavorless, except for sweetness. (f) The term sugar means refined sucrose. (g) Compliance means the...

21 CFR 146.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... dextrose. (b) The term dextrose means the hydrated or anhydrous, refined monosaccharide obtained from... means an aqueous solution of inverted or partly inverted, refined or partly refined sucrose, the solids... flavorless, except for sweetness. (f) The term sugar means refined sucrose. (g) Compliance means the...

21 CFR 146.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... dextrose. (b) The term dextrose means the hydrated or anhydrous, refined monosaccharide obtained from... means an aqueous solution of inverted or partly inverted, refined or partly refined sucrose, the solids... flavorless, except for sweetness. (f) The term sugar means refined sucrose. (g) Compliance means the...

21 CFR 146.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... dextrose. (b) The term dextrose means the hydrated or anhydrous, refined monosaccharide obtained from... means an aqueous solution of inverted or partly inverted, refined or partly refined sucrose, the solids... flavorless, except for sweetness. (f) The term sugar means refined sucrose. (g) Compliance means the...

Photometric redshifts for the next generation of deep radio continuum surveys - II. Gaussian processes and hybrid estimates

NASA Astrophysics Data System (ADS)

Duncan, Kenneth J.; Jarvis, Matt J.; Brown, Michael J. I.; Röttgering, Huub J. A.

2018-07-01

Building on the first paper in this series (Duncan et al. 2018), we present a study investigating the performance of Gaussian process photometric redshift (photo-z) estimates for galaxies and active galactic nuclei (AGNs) detected in deep radio continuum surveys. A Gaussian process redshift code is used to produce photo-z estimates targeting specific subsets of both the AGN population - infrared (IR), X-ray, and optically selected AGNs - and the general galaxy population. The new estimates for the AGN population are found to perform significantly better at z > 1 than the template-based photo-z estimates presented in our previous study. Our new photo-z estimates are then combined with template estimates through hierarchical Bayesian combination to produce a hybrid consensus estimate that outperforms both of the individual methods across all source types. Photo-z estimates for radio sources that are X-ray sources or optical/IR AGNs are significantly improved in comparison to previous template-only estimates - with outlier fractions and robust scatter reduced by up to a factor of ˜4. The ability of our method to combine the strengths of the two input photo-z techniques and the large improvements we observe illustrate its potential for enabling future exploitation of deep radio continuum surveys for both the study of galaxy and black hole coevolution and for cosmological studies.

Limited Surface Observations Climatic Summaries for Avon Park, Florida, MSC 747960. Parts A thru F

DTIC Science & Technology

1987-02-01

N -aa cm .c 2. C. a b- IAD C ’a. la U U. o I It. CD = MEM 040 0 0) 543. 0 ’Cc 0$4 (a> 0 0t I 0.jO 0 04.0 0 00 0 Ř 4V JO 0 4) U (da. 0 .4 ’ ,0 VO...00 V3 00 0; 0; C P. 0%; Z>0 0 0 OD in In 0% 0 co in IA -C p4 __ 0 4n > 0. 0 >- 0f do 0 -4 0 0y aUJ ~ a M. CPh ohp oh6 0l 0 0- 09 z z Cl U cl 0 an

Fault-Tolerant and Reconfigurable Control of Unmanned Aerial Vehicles (UAVs)

DTIC Science & Technology

2008-02-29

forces and moments are expressed as functions of angle of attack, sideslip angle, angular rates, and control surface deflection. L, M, and N are...invertible. As for matrix B, the control surfaces of the reusable launch vehicle are designed to control each axes angular rate of aircraft...literature as being invertible. As for matrix B, the control surfaces of the UAV are designed to control angular rate along each axis of the aircraft

Spontaneous ferroelectricity in strained low-temperature monoclinic Fe3O4: A first-principles study

NASA Astrophysics Data System (ADS)

Liu, Xiang; Mi, Wen-Bo

2018-04-01

As a single-phase multiferroic material, Fe3O4 exhibits spontaneous ferroelectric polarization below 38 K. However, the nature of the ferroelectricity in Fe3O4 and effect of external disturbances such as strain on it remains ambiguous. Here, the spontaneous ferroelectric polarization of low-temperature monoclinic Fe3O4 was investigated by first-principles calculations. The pseudo-centrosymmetric Fe B42-Fe B43 pair has a different valence state. The noncentrosymmetric charge distribution results in ferroelectric polarization. The initial ferroelectric polarization direction is in the - x and - z directions. The ferroelectricity along the y axis is limited owing to the symmetry of the Cc space group. Both the ionic displacement and charge separation at the Fe B42-Fe B43 pair are affected by strain, which further influences the spontaneous ferroelectric polarization of monoclinic Fe3O4. The ferroelectric polarization along the z axis exhibits an increase of 45.3% as the strain changes from 6% to -6%.

Poly-β-hydroxybutyrate Metabolism Is Unrelated to the Sporulation and Parasporal Crystal Protein Formation in Bacillus thuringiensis.

PubMed

Wang, Xun; Li, Zhou; Li, Xin; Qian, Hongliang; Cai, Xia; Li, Xinfeng; He, Jin

2016-01-01

Poly-3-hydroxybutyrate (PHB) is a natural polymer synthesized by many bacteria as a carbon-energy storage material. It was accumulated maximally prior to the spore formation but was degraded during the process of sporulation in Bacillus thuringiensis. Intriguingly, B. thuringiensis also accumulates large amounts of insecticidal crystal proteins (ICPs) during sporulation, which requires considerable input of carbon and energy sources. How PHB accumulation affects sporulation and ICP formation remains unclear to date. Intuitively, one would imagine that accumulated PHB provides the energy required for ICP formation. Yet our current data indicate that this is not the case. First, growth curves of the deletion mutants of phaC (encoding the PHB synthase) and phaZ (encoding the PHB depolymerase) were found to be similar to the parent strain BMB171; no difference in growth rate could be observed. In addition we further constructed the cry1Ac10 ICP gene overexpression strains of BMB171 (BMB171-cry), as well as its phaC and phaZ deletion mutants ΔphaC-cry and ΔphaZ-cry to compare their spore and ICP production rates. Again, not much change of ICP production was observed among these strains either. In fact, PHB was still degraded in most ΔphaZ-cry cells as observed by transmission electron microscopy. Together these results indicated that there is no direct association between the PHB accumulation and the sporulation and ICP formation in B. thuringiensis. Some other enzymes for PHB degradation or other energy source may be responsible for the sporulation and/or ICP formation in B. thuringiensis.

Nebular Line Emission and Stellar Mass of Bright z 8 Galaxies "Super-Eights"

NASA Astrophysics Data System (ADS)

Holwerda, Benne; Bouwens, Rychard; Trenti, Michele; Oesch, Pascal; Labbe, Ivo; Smit, Renske; Roberts-Borsani, Guido; Bernard, Stephanie; Bridge, Joanna

2018-05-01

Searches for the Lyman-alpha emission from the very first galaxies ionizing the Universe have proved to be extremely difficult with limited success beyond z 7 (<3% detections). However, a search of all CANDELS yielded four bright z 8 sources with associated strong Lyman-alpha lines, despite the Universe expected to be 70% neutral at this time. The key to their selection is an extremely red IRAC color ([3.6]-[4.5]> 0.5, Roberts-Borsani+ 2016), indicative of very strong nebular line emission. Do such extreme line emitting galaxies produce most of the photons to reionize the Universe? We propose to expand the sample of bright z 8 galaxies with reliable IRAC colors with seven more Y-band dropouts found with HST and confirmed through HST/Spitzer. The Spitzer observations will test how many of bright z 8 galaxies are IRAC-red and measure both their stellar mass and [OIII]+Hbeta line strength. Together with Keck/VLT spectroscopy, they will address these questions: I) Do all luminous z 8 galaxies show such red IRAC colors ([OIII] emission / hard spectra)? II) Is luminosity or a red IRAC color the dominant predictor for Lyman-alpha emission? III) Or are these sources found along exceptionally transparent sightlines into the early Universe? With 11 bright z 8 sources along different lines-of-sight, all prime targets for JWST, we will aim to determine which of the considered factors (luminosity, color, sight-line) drives the high Lyman-alpha prevalence (100%) and insight into the sources reionizing the Universe.

SHARDS: Survey for High-z Absorption Red & Dead Sources

NASA Astrophysics Data System (ADS)

Pérez-González, P. G.; Cava, A.

2013-05-01

SHARDS, an ESO/GTC Large Program, is an ultra-deep (26.5 mag) spectro-photometric survey with GTC/OSIRIS designed to select and study massive passively evolving galaxies at z=1.0-2.3 in the GOODS-N field using a set of 24 medium-band filters (FWHM~17 nm) covering the 500-950 nm spectral range. Our observing strategy has been planned to detect, for z>1 sources, the prominent Mg absorption feature (at rest-frame ~280 nm), a distinctive, necessary, and sufficient feature of evolved stellar populations (older than 0.5 Gyr). These observations are being used to: (1) derive for the first time an unbiased sample of high-z quiescent galaxies, which extends to fainter magnitudes the samples selected with color techniques and spectroscopic surveys; (2) derive accurate ages and stellar masses based on robust measurements of spectral features such as the Mg_UV or D(4000) indices; (3) measure their redshift with an accuracy Δz/(1+z)<0.02; and (4) study emission-line galaxies (starbursts and AGN) up to very high redshifts. The well-sampled optical SEDs provided by SHARDS for all sources in the GOODS-N field are a valuable complement for current and future surveys carried out with other telescopes (e.g., Spitzer, HST, and Herschel).

Simultaneous determination of asperosaponin VI and its active metabolite hederagenin in rat plasma by liquid chromatography-tandem mass spectrometry with positive/negative ion-switching electrospray ionization and its application in pharmacokinetic study.

PubMed

Zhu, He; Ding, Li; Shakya, Shailendra; Qi, Xiemin; Hu, Linlin; Yang, Xiaolin; Yang, Zhonglin

2011-11-15

A new liquid chromatography-tandem mass spectrometry (LC-MS/MS) method operated in the positive/negative electrospray ionization (ESI) switching mode has been developed and validated for the simultaneous determination of asperosaponin VI and its active metabolite hederagenin in rat plasma. After addition of internal standards diazepam (for asperosaponin VI) and glycyrrhetic acid (for hederagenin), the plasma sample was deproteinized with acetonitrile, and separated on a reversed phase C18 column with a mobile phase of methanol (solvent A)-0.05% glacial acetic acid containing 10 mM ammonium acetate and 30 μM sodium acetate (solvent B) using gradient elution. The detection of target compounds was done in multiple reaction monitoring (MRM) mode using a tandem mass spectrometry equipped with positive/negative ion-switching ESI source. At the first segment, the MRM detection was operated in the positive ESI mode using the transitions of m/z 951.5 ([M+Na](+))→347.1 for asperosaponin VI and m/z 285.1 ([M+H](+))→193.1 for diazepam for 4 min, then switched to the negative ESI mode using the transitions of m/z 471.3 ([M-H](-))→471.3 for hederagenin and m/z 469.4 ([M-H](-))→425.4 for glycyrrhetic acid, respectively. The sodiated molecular ion [M+Na](+) at m/z 951.5 was selected as the precursor ion for asperosaponin VI, since it provided better sensitivity compared to the deprotonated and protonated molecular ions. Sodium acetate was added to the mobile phase to make sure that abundant amount of the sodiated molecular ion of asperosaponin VI could be produced, and more stable and intensive mass response of the product ion could be obtained. For the detection of hederagenin, since all of the mass responses of the fragment ions were very weak, the deprotonated molecular ion [M-H](-)m/z 471.3 was employed as both the precursor ion and the product ion. But the collision energy was still used for the MRM, in order to eliminate the influences induced by the interference substances from the rat plasma. The validated method was successfully applied to study the pharmacokinetics of asperosaponin VI and its active metabolite hederagenin in rat plasma after oral administration of asperosaponin VI at a dose of 90 mg/kg. Copyright © 2011 Elsevier B.V. All rights reserved.

Three-phase Four-leg Inverter LabVIEW FPGA Control Code

DOE Office of Scientific and Technical Information (OSTI.GOV)

In the area of power electronics control, Field Programmable Gate Arrays (FPGAs) have the capability to outperform their Digital Signal Processor (DSP) counterparts due to the FPGA’s ability to implement true parallel processing and therefore facilitate higher switching frequencies, higher control bandwidth, and/or enhanced functionality. National Instruments (NI) has developed two platforms, Compact RIO (cRIO) and Single Board RIO (sbRIO), which combine a real-time processor with an FPGA. The FPGA can be programmed with a subset of the well-known LabVIEW graphical programming language. The use of cRIO and sbRIO for power electronics control has developed over the last few yearsmore » to include control of three-phase inverters. Most three-phase inverter topologies include three switching legs. The addition of a fourth-leg to natively generate the neutral connection allows the inverter to serve single-phase loads in a microgrid or stand-alone power system and to balance the three-phase voltages in the presence of significant load imbalance. However, the control of a four-leg inverter is much more complex. In particular, instead of standard two-dimensional space vector modulation (SVM), the inverter requires three-dimensional space vector modulation (3D-SVM). The candidate software implements complete control algorithms in LabVIEW FPGA for a three-phase four-leg inverter. The software includes feedback control loops, three-dimensional space vector modulation gate-drive algorithms, advanced alarm handling capabilities, contactor control, power measurements, and debugging and tuning tools. The feedback control loops allow inverter operation in AC voltage control, AC current control, or DC bus voltage control modes based on external mode selection by a user or supervisory controller. The software includes the ability to synchronize its AC output to the grid or other voltage-source before connection. The software also includes provisions to allow inverter operation in parallel with other voltage regulating devices on the AC or DC buses. This flexibility allows the Inverter to operate as a stand-alone voltage source, connected to the grid, or in parallel with other controllable voltage sources as part of a microgrid or remote power system. In addition, as the inverter is expected to operate under severe unbalanced conditions, the software includes algorithms to accurately compute real and reactive power for each phase based on definitions provided in the IEEE Standard 1459: IEEE Standard Definitions for the Measurement of Electric Power Quantities Under Sinusoidal, Nonsinusoidal, Balanced, or Unbalanced Conditions. Finally, the software includes code to output analog signals for debugging and for tuning of control loops. The software fits on the Xilinx Virtex V LX110 FPGA embedded in the NI cRIO-9118 FPGA chassis, and with a 40 MHz base clock, supports a modulation update rate of 40 MHz, user-settable switching frequencies and synchronized control loop update rates of tens of kHz, and reference waveform generation, including Phase Lock Loop (PLL), update rate of 100 kHz.« less

Status of Standardization Projects

DTIC Science & Technology

1992-03-31

50 SS N D 8915 TOTAL- 1. DELINQUENT- 0, STATUS CODES: A- 1, G- 0, Y- 0, Z- 0 8920 0539 MIL R 35084A RICE INSTANT ENRICHED GL G2 903 913 913 A GL SA 50...G XXX GL GINGERBREAD PWDER FOLF GL B4 922 932 932 A GL N 8940 A731 IMIL P XXX GL PORK ORIENTAL WITH NOODLES GL B4 922 932 932 A GL N 8940 A732 MIL R... INSTANT GL 84 A 893 903 922 A GL SA 50 SS U B 8955 TOTAL- 1. DELINQUENT- 1, STATUS CODES: A- 1, G- 0, Y- 0. Z- 0 8960 0077 MIL C 3031J 1 COCOA BEVERAGE

Chlorella mirabilis as a Potential Species for Biomass Production in Low-Temperature Environment.

PubMed

Shukla, S P; Kvíderová, J; Tříska, J; Elster, J

2013-01-01

Successful adaptation/acclimatization to low temperatures in micro-algae is usually connected with production of specific biotechnologically important compounds. In this study, we evaluated the growth characteristics in a micro-scale mass cultivation of the Antarctic soil green alga Chlorella mirabilis under different nitrogen and carbon sources followed by analyses of fatty acid contents. The micro-scale mass cultivation was performed in stable (in-door) and variable (out-door) conditions during winter and/or early spring in the Czech Republic. In the in-door cultivation, the treatments for nitrogen and carbon sources determination included pure Z medium (control, Z), Z medium + 5% glycerol (ZG), Z medium + 5% glycerol + 50 μM KNO3 (ZGN), Z medium + 5% glycerol + 200 μM NH4Cl (ZGA), Z medium + 5% glycerol + 1 mM Na2CO3 (ZNC), Z medium + 5% glycerol + 1 mM Na2CO3 + 200 μM NH4Cl (ZGCA) and Z medium + 5% glycerol + 1 mM Na2CO3 + 50 μM KNO3 (ZGCN) and were performed at 15°C with an irradiance of 75 μmol m(-2) s(-1). During the out-door experiments, the night-day temperature ranged from -6.6 to 17.5°C (daily average 3.1 ± 5.3°C) and irradiance ranged from 0 to 2,300 μmol m(-2) s(-1) (daily average 1,500 ± 1,090 μmol m(-2) s(-1)). Only the Z, ZG, ZGN, and ZGC treatments were used in the out-door cultivation. In the in-door mass cultivation, all nitrogen and carbon sources additions increased the growth rate with the exception of ZGA. When individual sources were considered, only the effect of 5% glycerol addition was significant. On the other hand, the growth rate decreased in the ZG and ZGN treatments in the out-door experiment, probably due to carbon limitation. Fatty acid composition showed increased production of linoleic acid in the glycerol treatments. The studied strain of C. mirabilis is proposed to be a promising source of linoleic acid in low-temperature-mass cultivation biotechnology. This strain is a perspective model organism for biotechnology in low-temperature conditions.

Chlorella mirabilis as a Potential Species for Biomass Production in Low-Temperature Environment

PubMed Central

Shukla, S. P.; Kvíderová, J.; Tříska, J.; Elster, J.

2013-01-01

Successful adaptation/acclimatization to low temperatures in micro-algae is usually connected with production of specific biotechnologically important compounds. In this study, we evaluated the growth characteristics in a micro-scale mass cultivation of the Antarctic soil green alga Chlorella mirabilis under different nitrogen and carbon sources followed by analyses of fatty acid contents. The micro-scale mass cultivation was performed in stable (in-door) and variable (out-door) conditions during winter and/or early spring in the Czech Republic. In the in-door cultivation, the treatments for nitrogen and carbon sources determination included pure Z medium (control, Z), Z medium + 5% glycerol (ZG), Z medium + 5% glycerol + 50 μM KNO3 (ZGN), Z medium + 5% glycerol + 200 μM NH4Cl (ZGA), Z medium + 5% glycerol + 1 mM Na2CO3 (ZNC), Z medium + 5% glycerol + 1 mM Na2CO3 + 200 μM NH4Cl (ZGCA) and Z medium + 5% glycerol + 1 mM Na2CO3 + 50 μM KNO3 (ZGCN) and were performed at 15°C with an irradiance of 75 μmol m−2 s−1. During the out-door experiments, the night-day temperature ranged from −6.6 to 17.5°C (daily average 3.1 ± 5.3°C) and irradiance ranged from 0 to 2,300 μmol m−2 s−1 (daily average 1,500 ± 1,090 μmol m−2 s−1). Only the Z, ZG, ZGN, and ZGC treatments were used in the out-door cultivation. In the in-door mass cultivation, all nitrogen and carbon sources additions increased the growth rate with the exception of ZGA. When individual sources were considered, only the effect of 5% glycerol addition was significant. On the other hand, the growth rate decreased in the ZG and ZGN treatments in the out-door experiment, probably due to carbon limitation. Fatty acid composition showed increased production of linoleic acid in the glycerol treatments. The studied strain of C. mirabilis is proposed to be a promising source of linoleic acid in low-temperature-mass cultivation biotechnology. This strain is a perspective model organism for biotechnology in low-temperature conditions. PMID:23630521

Optical Surface Analysis

DTIC Science & Technology

1996-08-01

34 : " ... , h„.,. ... rP,„onse includinq the time for reviewing instructions, searching existing data sources , gÄÄa^^^ Shsi^ BT ::^^"!in9’°n...DISTRIBUTION CODE ^^ZZ^Z^ZZ centered around the continued development of a unique "^ ^^ to semiconductor materials characterization. A brief...NEW SCATTEROMETER CAPABILITIES 23 4.1 Polarization control 23 4.2 Four-inch sample translation 25 4.3 New photometer 26 4.4 New laser sources 27

Structure and function of natural sulphide-oxidizing microbial mats under dynamic input of light and chemical energy

PubMed Central

Klatt, Judith M; Meyer, Steffi; Häusler, Stefan; Macalady, Jennifer L; de Beer, Dirk; Polerecky, Lubos

2016-01-01

We studied the interaction between phototrophic and chemolithoautotrophic sulphide-oxidizing microorganisms in natural microbial mats forming in sulphidic streams. The structure of these mats varied between two end-members: one characterized by a layer dominated by large sulphur-oxidizing bacteria (SOB; mostly Beggiatoa-like) on top of a cyanobacterial layer (B/C mats) and the other with an inverted structure (C/B mats). C/B mats formed where the availability of oxygen from the water column was limited (<5 μm). Aerobic chemolithotrophic activity of the SOB depended entirely on oxygen produced locally by cyanobacteria during high light conditions. In contrast, B/C mats formed at locations where oxygen in the water column was comparatively abundant (>45 μM) and continuously present. Here SOB were independent of the photosynthetic activity of cyanobacteria and outcompeted the cyanobacteria in the uppermost layer of the mat where energy sources for both functional groups were concentrated. Outcompetition of photosynthetic microbes in the presence of light was facilitated by the decoupling of aerobic chemolithotrophy and oxygenic phototrophy. Remarkably, the B/C mats conserved much less energy than the C/B mats, although similar amounts of light and chemical energy were available. Thus ecosystems do not necessarily develop towards optimal energy usage. Our data suggest that, when two independent sources of energy are available, the structure and activity of microbial communities is primarily determined by the continuous rather than the intermittent energy source, even if the time-integrated energy flux of the intermittent energy source is greater. PMID:26405833

Implementing and diagnosing magnetic flux compression on the Z pulsed power accelerator

DOE Office of Scientific and Technical Information (OSTI.GOV)

McBride, Ryan D.; Bliss, David E.; Gomez, Matthew R.

2015-11-01

We report on the progress made to date for a Laboratory Directed Research and Development (LDRD) project aimed at diagnosing magnetic flux compression on the Z pulsed-power accelerator (0-20 MA in 100 ns). Each experiment consisted of an initially solid Be or Al liner (cylindrical tube), which was imploded using the Z accelerator's drive current (0-20 MA in 100 ns). The imploding liner compresses a 10-T axial seed field, B z ( 0 ) , supplied by an independently driven Helmholtz coil pair. Assuming perfect flux conservation, the axial field amplification should be well described by B z ( tmore » ) = B z ( 0 ) x [ R ( 0 ) / R ( t )] 2 , where R is the liner's inner surface radius. With perfect flux conservation, B z ( t ) and dB z / dt values exceeding 10 4 T and 10 12 T/s, respectively, are expected. These large values, the diminishing liner volume, and the harsh environment on Z, make it particularly challenging to measure these fields. We report on our latest efforts to do so using three primary techniques: (1) micro B-dot probes to measure the fringe fields associated with flux compression, (2) streaked visible Zeeman absorption spectroscopy, and (3) fiber-based Faraday rotation. We also mention two new techniques that make use of the neutron diagnostics suite on Z. These techniques were not developed under this LDRD, but they could influence how we prioritize our efforts to diagnose magnetic flux compression on Z in the future. The first technique is based on the yield ratio of secondary DT to primary DD reactions. The second technique makes use of the secondary DT neutron time-of-flight energy spectra. Both of these techniques have been used successfully to infer the degree of magnetization at stagnation in fully integrated Magnetized Liner Inertial Fusion (MagLIF) experiments on Z [P. F. Schmit et al. , Phys. Rev. Lett. 113 , 155004 (2014); P. F. Knapp et al. , Phys. Plasmas, 22 , 056312 (2015)]. Finally, we present some recent developments for designing and fabricating novel micro B-dot probes to measure B z ( t ) inside of an imploding liner. In one approach, the micro B-dot loops were fabricated on a printed circuit board (PCB). The PCB was then soldered to off-the-shelf 0.020- inch-diameter semi-rigid coaxial cables, which were terminated with standard SMA connectors. These probes were recently tested using the COBRA pulsed power generator (0-1 MA in 100 ns) at Cornell University. In another approach, we are planning to use new multi-material 3D printing capabilities to fabricate novel micro B-dot packages. In the near future, we plan to 3D print these probes and then test them on the COBRA generator. With successful operation demonstrated at 1-MA, we will then make plans to use these probes on a 20-MA Z experiment.« less

Bruker Biotyper Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry System for Identification of Nocardia, Rhodococcus, Kocuria, Gordonia, Tsukamurella, and Listeria Species

PubMed Central

Lee, Tai-Fen; Du, Shin-Hei; Teng, Shih-Hua; Liao, Chun-Hsing; Sheng, Wang-Hui; Teng, Lee-Jene

2014-01-01

We evaluated whether the Bruker Biotyper matrix-associated laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) system provides accurate species-level identifications of 147 isolates of aerobically growing Gram-positive rods (GPRs). The bacterial isolates included Nocardia (n = 74), Listeria (n = 39), Kocuria (n = 15), Rhodococcus (n = 10), Gordonia (n = 7), and Tsukamurella (n = 2) species, which had all been identified by conventional methods, molecular methods, or both. In total, 89.7% of Listeria monocytogenes, 80% of Rhodococcus species, 26.7% of Kocuria species, and 14.9% of Nocardia species (n = 11, all N. nova and N. otitidiscaviarum) were correctly identified to the species level (score values, ≥2.0). A clustering analysis of spectra generated by the Bruker Biotyper identified six clusters of Nocardia species, i.e., cluster 1 (N. cyriacigeorgica), cluster 2 (N. brasiliensis), cluster 3 (N. farcinica), cluster 4 (N. puris), cluster 5 (N. asiatica), and cluster 6 (N. beijingensis), based on the six peaks generated by ClinProTools with the genetic algorithm, i.e., m/z 2,774.477 (cluster 1), m/z 5,389.792 (cluster 2), m/z 6,505.720 (cluster 3), m/z 5,428.795 (cluster 4), m/z 6,525.326 (cluster 5), and m/z 16,085.216 (cluster 6). Two clusters of L. monocytogenes spectra were also found according to the five peaks, i.e., m/z 5,594.85, m/z 6,184.39, and m/z 11,187.31, for cluster 1 (serotype 1/2a) and m/z 5,601.21 and m/z 11,199.33 for cluster 2 (serotypes 1/2b and 4b). The Bruker Biotyper system was unable to accurately identify Nocardia (except for N. nova and N. otitidiscaviarum), Tsukamurella, or Gordonia species. Continuous expansion of the MALDI-TOF MS databases to include more GPRs is necessary. PMID:24759706

Star formation rate and extinction in faint z ∼ 4 Lyman break galaxies

DOE Office of Scientific and Technical Information (OSTI.GOV)

To, Chun-Hao; Wang, Wei-Hao; Owen, Frazer N.

We present a statistical detection of 1.5 GHz radio continuum emission from a sample of faint z ∼ 4 Lyman break galaxies (LBGs). To constrain their extinction and intrinsic star formation rate (SFR), we combine the latest ultradeep Very Large Array 1.5 GHz radio image and the Hubble Space Telescope Advanced Camera for Surveys (ACS) optical images in the GOODS-N. We select a large sample of 1771 z ∼ 4 LBGs from the ACS catalog using B {sub F435W}-dropout color criteria. Our LBG samples have I {sub F775W} ∼ 25-28 (AB), ∼0-3 mag fainter than M{sub UV}{sup ⋆} at zmore » ∼ 4. In our stacked radio images, we find the LBGs to be point-like under our 2'' angular resolution. We measure their mean 1.5 GHz flux by stacking the measurements on the individual objects. We achieve a statistical detection of S {sub 1.5} {sub GHz} = 0.210 ± 0.075 μJy at ∼3σ for the first time on such a faint LBG population at z ∼ 4. The measurement takes into account the effects of source size and blending of multiple objects. The detection is visually confirmed by stacking the radio images of the LBGs, and the uncertainty is quantified with Monte Carlo simulations on the radio image. The stacked radio flux corresponds to an obscured SFR of 16.0 ± 5.7 M {sub ☉} yr{sup –1}, and implies a rest-frame UV extinction correction factor of 3.8. This extinction correction is in excellent agreement with that derived from the observed UV continuum spectral slope, using the local calibration of Meurer et al. This result supports the use of the local calibration on high-redshift LBGs to derive the extinction correction and SFR, and also disfavors a steep reddening curve such as that of the Small Magellanic Cloud.« less

Dollar Summary of Prime Contract Awards by Contractor, State or Country, and Place, FY 85. Part 1 (IDSCR Inc - Czetli Jess & Son In).

DTIC Science & Technology

1985-01-01

m.-I-I.m.m0IIF- - . I00 I- I.-fI.-I- . 0 4 4 64*.4 444@da *444 004 4 o aG aea a& 4 *a 0 *a *a 6.-a *a60 4 e 4 GOO6Uea44 * Ao i 4 1 1 0 M a*a- -- 4-1...4 a~a .4 . 1 4 1 I -4 0 Z(0 = 0 0 CX o m ag m- C- m .-4.. 0c -* . a4 E 041 0 U C)1-0 1 W.C.Z0404 C 1C4 41 -C -C z. 40.- w - - Cx L C 0 40 -C -C 3-4...w . - " 0 0 14 ZI 0 6 " -I U0 > - z C aG 0I - 0 C w (0 61 ~- wo w g x b. I. . . .- . L 0 V 61 U 0 0 w w " CA I 0 U 61 4 4 U 61 1 E4 -C 4 -- I I 0 61

Relationship between field-aligned currents and inverted-V parallel potential drops observed at midaltitudes

NASA Astrophysics Data System (ADS)

Sakanoi, T.; Fukunishi, H.; Mukai, T.

1995-10-01

The inverted-V field-aligned acceleration region existing in the altitude range of several thousand kilometers plays an essential role for the magnetosphere-ionosphere coupling system. The adiabatic plasma theory predicts a linear relationship between field-aligned current density (J∥) and parallel potential drop (Φ∥), that is, J∥=KΦ∥, where K is the field-aligned conductance. We examined this relationship using the charged particle and magnetic field data obtained from the Akebono (Exos D) satellite. The potential drop above the satellite was derived from the peak energy of downward electrons, while the potential drop below the satellite was derived from two different methods: the peak energy of upward ions and the energy-dependent widening of electron loss cone. On the other hand, field-aligned current densities in the inverted-V region were estimated from the Akebono magnetometer data. Using these potential drops and field-aligned current densities, we estimated the linear field-aligned conductance KJΦ. Further, we obtained the corrected field-aligned conductance KCJΦ by applying the full Knight's formula to the current-voltage relationship. We also independently estimated the field-aligned conductance KTN from the number density and the thermal temperature of magnetospheric source electrons which were obtained by fitting accelerated Maxwellian functions for precipitating electrons. The results are summarized as follows: (1) The latitudinal dependence of parallel potential drops is characterized by a narrow V-shaped structure with a width of 0.4°-1.0°. (2) Although the inverted-V potential region exactly corresponds to the upward field aligned current region, the latitudinal dependence of upward current intensity is an inverted-U shape rather than an inverted-V shape. Thus it is suggested that the field-aligned conductance KCJΦ changes with a V-shaped latitudinal dependence. In many cases, KCJΦ values at the edge of the inverted-V region are about 5-10 times larger than those at the center. (3) By comparing KCJΦ with KTN, KCJΦ is found to be about 2-20 times larger than KTN. These results suggest that low-energy electrons such as trapped electrons, secondary and back-scattered electrons, and ionospheric electrons significantly contribute to upward field-aligned currents in the inverted-V region. It is therefore inferred that non adiabatic pitch angle scattering processes play an important role in the inverted-V region. .

Evidence that human papillomavirus causes inverted papilloma is sparse.

PubMed

Justice, Jeb M; Davis, Kern M; Saenz, Daniel A; Lanza, Donald C

2014-12-01

Controversy exists regarding the pathogenesis of inverted papilloma as it relates to the involvement of human papillomavirus (HPV). The purpose of this report is to describe the prevalence of HPV in nondysplastic, "early inverted papilloma" and to summarize HPV detection rates in the general population and in other HPV related neoplasia. This case series report characterizes consecutive inverted papilloma patients from January 2005 to August 2012 with regard to smoking history, dysplasia, and HPV detection rates. Presence or absence of low/high risk HPV was determined by standardized in situ hybridization DNA probes. Medline literature review was performed to determine the prevalence of HPV in inverted papilloma without moderate or severe dysplasia. Thirty-six consecutive patients were identified with an average age of 63.6 (range, 40-84) years; gender: 23 men, 13 women. More than half (55%) were active or former smokers (14% active and 41% former). High/low risk HPV was present in 1 in 36 (2.7%) patients and 1 in 36 (2.7%) had mild dysplasia. In the literature review: (1) HPV was detected in 16.4% of inverted papilloma without dysplasia; (2) oral cavity HPV detection was 4.2% to 11.4% in the normal population; and (3) HPV was normally detected in 85% to 95% of HPV-related neoplasia. Given histological features of inverted papilloma and comparatively low detection rates of HPV in inverted papilloma without dysplasia (2.7%), as well as the summary of the world literature, HPV is not related to the initial pathogenesis of inverted papilloma or inverted papilloma's tendency to persist or recur. It is postulated that since inverted papilloma is more an inflammatory polyp, it is susceptible to secondary HPV infection because of its metaplasia. Tobacco and other causes of respiratory epithelium remodeling are more plausible explanations for the initial tissue transformation to inverted papilloma. © 2014 ARS-AAOA, LLC.

Multi-energy SXR cameras for magnetically confined fusion plasmas (invited)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delgado-Aparicio, L. F.; Maddox, J.; Pablant, N.

A compact multi-energy soft x-ray camera has been developed for time, energy and space-resolved measurements of the soft-x-ray emissivity in magnetically confined fusion plasmas. Multi-energy soft x-ray imaging provides a unique opportunity for measuring, simultaneously, a variety of important plasma properties (T e, n Z, ΔZ eff, and n e,fast). The electron temperature can be obtained by modeling the slope of the continuum radiation from ratios of the available brightness and inverted radial emissivity profiles over multiple energy ranges. Impurity density measurements are also possible using the line-emission from medium- to high-Z impurities to separate the background as well asmore » transient levels of metal contributions. As a result, this technique should be explored also as a burning plasma diagnostic in-view of its simplicity and robustness.« less

Multi-energy SXR cameras for magnetically confined fusion plasmas (invited)

DOE PAGES

Delgado-Aparicio, L. F.; Maddox, J.; Pablant, N.; ...

2016-11-14

A compact multi-energy soft x-ray camera has been developed for time, energy and space-resolved measurements of the soft-x-ray emissivity in magnetically confined fusion plasmas. Multi-energy soft x-ray imaging provides a unique opportunity for measuring, simultaneously, a variety of important plasma properties (T e, n Z, ΔZ eff, and n e,fast). The electron temperature can be obtained by modeling the slope of the continuum radiation from ratios of the available brightness and inverted radial emissivity profiles over multiple energy ranges. Impurity density measurements are also possible using the line-emission from medium- to high-Z impurities to separate the background as well asmore » transient levels of metal contributions. As a result, this technique should be explored also as a burning plasma diagnostic in-view of its simplicity and robustness.« less

Regional Characteristics of Stress State of Main Seismic Active Faults in Mid-Northern Part of Sichuan-Yunnan Block

NASA Astrophysics Data System (ADS)

Weiwei, W.; Yaling, W.

2017-12-01

We restore the seismic source spectrums of 1012 earthquakes(2.0 ≤ ML ≤ 5.0) in the mid-northern part of Sichuan-Yunnan seismic block(26 ° N-33 ° N, 99 ° E-104 ° E),then calculate the source parameters.Based on the regional seismic tectonic background, the distribution of active faults and seismicity, the study area is divided into four statistical units (Z1 Jinshajiang and Litang fault zone, Z2 Xianshuihe fault zone, Z3 Anninghe-Zemuhe fault zone, Z4 Lijiang-Xiaojinhe fault zone). Seismic source stress drop results show the following, (1)The stress at the end of the Jinshajiang fault is low, strong earthquake activity rare.Stress-strain loading deceases gradually from northwest to southeast along Litang fault, the northwest section which is relatively locked is more likely to accumulate strain than southeast section. (2)Stress drop of Z2 is divided by Kangding, the southern section is low and northern section is high. Southern section (Kangding-Shimian) is difficult to accumulate higher strain in the short term, but in northern section (Garzê-Kangding), moderate and strong earthquakes have not filled the gaps of seismic moment release, there is still a high stress accumulation in partial section. (3)High stress-drop events were concentrated on Z3, strain accumulation of this unit is strong, and stress level is the highest, earthquake risk is high. (4)On Z4, stress drop characteristics of different magnitude earthquakes are not the same, which is related to complex tectonic setting, the specific reasons still need to be discussed deeply.The study also show that, (1)Stress drops display a systematic change with different faults and locations, high stress-drop events occurs mostly on the fault intersection area. Faults without locking condition and mainly creep, are mainly characterized by low stress drop. (2)Contrasting to what is commonly thought that "strike-slip faults are not easy to accumulate stress ", Z2 and Z3 all exhibit high stress levels, which may be due to that the magnitude and intensity of medium-strong earthquakes are not enough to release the accumulated energy. On the other hand, when the tectonic unit blocking fault movement and its contribution to accumulation of stress play a key role, the earthquake of same magnitude will release higher stress drop.

Structure of the Outer Cusp and Sources of the Cusp Precipitation during Intervals of a Horizontal IMF

NASA Technical Reports Server (NTRS)

Berchem, Jean; Nemecek, Z.; Safrankova, J.; Prech, L.; Simunek, J.; Sauvaud, J.-A.; Fedorov, A.; Stenuit, H.; Fuselier, S. A.; Savin, S.;

Multiwall carbon nanotube and poly(3,4-ethylenedioxythiophene): polystyrene sulfonate (PEDOT:PSS) composite films for transistor and inverter devices.

PubMed

Yun, Dong-Jin; Hong, KiPyo; Kim, Se hyun; Yun, Won-Min; Jang, Jae-young; Kwon, Woo-Sung; Park, Chan-Eon; Rhee, Shi-Woo

2011-01-01

Highly conductive multiwalled carbon nanotube (MWNT)/Poly(3,4-ethylenedioxythiophene) polymerized with poly(4-styrenesulfonate) (PEDOT:PSS) films were prepared by spin coating a mixture solution. The solution was prepared by dispersing MWNT in the PEDOT:PSS solution in water using ultrasonication without any oxidation process. The effect of the MWNT loading in the solution on the film properties such as surface roughness, work function, surface energy, optical transparency, and conductivity was studied. The conductivity of MWNT/PEDOT:PSS composite film was increased with higher MWNT loading and the high conductivity of MWNT/PEDOT:PSS films enabled them to be used as a source/drain electrode in organic thin film transistor (OTFT). The pentacene TFT with MWNT/PEDOT:PSS S/D electrode showed much higher performance with mobility about 0.2 cm²/(V s) and on/off ratio about 5 × 10⁵ compared to that with PEDOT:PSS S/D electrode (∼0.05 cm²/(V s), 1 × 10⁵). The complementary inverters exhibited excellent characteristics, including high gain value of about 30.

Time-Dependent Moment Tensors of the First Four Source Physics Experiments (SPE) Explosions

NASA Astrophysics Data System (ADS)

Yang, X.

2015-12-01

We use mainly vertical-component geophone data within 2 km from the epicenter to invert for time-dependent moment tensors of the first four SPE explosions: SPE-1, SPE-2, SPE-3 and SPE-4Prime. We employ a one-dimensional (1D) velocity model developed from P- and Rg-wave travel times for Green's function calculations. The attenuation structure of the model is developed from P- and Rg-wave amplitudes. We select data for the inversion based on the criterion that they show consistent travel times and amplitude behavior as those predicted by the 1D model. Due to limited azimuthal coverage of the sources and the mostly vertical-component-only nature of the dataset, only long-period, diagonal components of the moment tensors are well constrained. Nevertheless, the moment tensors, particularly their isotropic components, provide reasonable estimates of the long-period source amplitudes as well as estimates of corner frequencies, albeit with larger uncertainties. The estimated corner frequencies, however, are consistent with estimates from ratios of seismogram spectra from different explosions. These long-period source amplitudes and corner frequencies cannot be fit by classical P-wave explosion source models. The results motivate the development of new P-wave source models suitable for these chemical explosions. To that end, we fit inverted moment-tensor spectra by modifying the classical explosion model using regressions of estimated source parameters. Although the number of data points used in the regression is small, the approach suggests a way for the new-model development when more data are collected.

An X-Ray Source for Lithography Based on a Quasi-Optical Maser Undulator

DTIC Science & Technology

1989-05-09

an electron, c is the speed of light in vacuo, B is the peak magnetic induction and X is the period of the planar undulator or wiggler, the wavelength...relativistic motion is given 11 p = Le’ Y 6 [2 - X )2] (4) where = v/c is the particle velocity normalized to the speAd of light , and § /c, where v = -v is...k0 z + Wt),) (7) where E is the amplitude of the electric field, w is the radian frequency A and k a (0,0,k ) is the wave- vector . ez is a unit vector

An inverted cylindrical sputter magnetron as metal vapor supply for electron cyclotron resonance ion sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weichsel, T., E-mail: tim.weichsel@fep.fraunhofer.de; Hartung, U.; Kopte, T.

2014-05-15

An inverted cylindrical sputter magnetron device has been developed. The magnetron is acting as a metal vapor supply for an electron cyclotron resonance (ECR) ion source. FEM simulation of magnetic flux density was used to ensure that there is no critical interaction between both magnetic fields of magnetron and ECR ion source. Spatially resolved double Langmuir probe and optical emission spectroscopy measurements show an increase in electron density by one order of magnitude from 1 × 10{sup 10} cm{sup −3} to 1 × 10{sup 11} cm{sup −3}, when the magnetron plasma is exposed to the magnetic mirror field of themore » ECR ion source. Electron density enhancement is also indicated by magnetron plasma emission photography with a CCD camera. Furthermore, photographs visualize the formation of a localized loss-cone - area, when the magnetron is operated at magnetic mirror field conditions. The inverted cylindrical magnetron supplies a metal atom load rate of R > 1 × 10{sup 18} atoms/s for aluminum, which meets the demand for the production of a milliampere Al{sup +} ion beam.« less

An SCR inverter for electric vehicles

NASA Technical Reports Server (NTRS)

Latos, T.; Bosack, D.; Ehrlich, R.; Jahns, T.; Mezera, J.; Thimmesch, D.

1980-01-01

An inverter for an electric vehicle propulsion application has been designed and constructed to excite a polyphase induction motor from a fixed propulsion battery source. The inverter, rated at 35kW peak power, is fully regenerative and permits vehicle operation in both the forward and reverse directions. Thyristors are employed as the power switching devices arranged in a dc bus commutated topology. This paper describes the major role the controller plays in generating the motor excitation voltage and frequency to deliver performance similar to dc systems. Motoring efficiency test data for the controller are presented. It is concluded that an SCR inverter in conjunction with an ac induction motor is a viable alternative to present dc vehicle propulsion systems on the basis of performance and size criteria.

Eight-Element Antenna Array for LTE 3.4-3.8 GHz Mobile Handset Applications

NASA Astrophysics Data System (ADS)

Yang, Lingsheng; Ji, Ming; Cheng, Biyu; Ni, Bo

2017-05-01

In this letter, an eight-element Multiple-input multiple-output (MIMO) antenna system for LTE mobile handset applications is proposed. The antenna array consists of eight 3D inverted F-shaped antennas (3D-IFA), and the measured -10 dB impedance bandwidth is 3.2-3.9 GHz which can cover the LTE bands 42 and 43 (3.4-3.8 GHz). By controlling the rotation of the antenna elements, no less than 10 dB isolation between antenna elements can be obtained. After using the specially designed meandered slots on the ground as decoupling structures, the measured isolation can be further improved to higher than 13 dB between the antenna elements at the whole operating band.

Very Strong 0.3-10 keV Flare in the HBL Source 1ES 1959+650

NASA Astrophysics Data System (ADS)

Kapanadze, Bidzina

2017-08-01

Since 2017 June 12, the nearby TeV-detected HBL source 1ES 1959+650 (z=0.048) is showing another cycle of a very strong X-ray flaring activity, which is the fourth since 2015 August (see Kapanadze B. et al. "A recent strong X-ray flaring activity of 1ES 1959+650 with possibly less efficient stochastic acceleration"; ATel#9949,9694,9205,9121,8468,8342, 8289,8014,10439; see http://www.swift.psu.edu/monitoring/source.php?source=1ES1959+650).

Exploration of Digital Circuits and Transistor-Level Testing in the DARPA TRUST Program

DTIC Science & Technology

2015-03-01

Transmission lines will be simulated by placing long metal wiring between two inverters . The metal wiring will be changed with each simulation to detect (if...though this could potentially cause a fabricated device to fail. Transmission lines were simulated by creating metal wiring between two inverters ...34 4.1 Initial Test . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34 4.1.1 Inverter

Z boson production in association with heavy quark jets at D0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joseph Anthony Zennamo, III

2013-10-28

The dominant background in searches for a Higgs boson decaying into b-quarks at the Tevatron is production of a Z boson in association with either b- or c-quark initiated jets (b or c jets). This thesis describes the first measurements of the ratio of differential cross sections σ (Z + b jet)/ σ(Z + jet), and the first measurements of the ratio of cross sections σ (Z + c jet)/ σ(Z + jet) and σ (Z + c jet)/ σ(Z + b jet). These measurements are performed using the full D0 Run II data set corresponding to an integrated luminositymore » of 9.7 fb -1. The ratio of differential cross sections σ(Z + b jet)/σ (Z + jet) have been measured as a function of jet and Z boson p T , jet η , and Δφ(Z, jet). The Z+c jet ratios of differential cross sections are measured as a function of jet and Z boson p T .« less

A modification of Einstein-Schrödinger theory that contains both general relativity and electrodynamics

NASA Astrophysics Data System (ADS)

Shifflett, J. A.

2008-08-01

We modify the Einstein-Schrödinger theory to include a cosmological constant Λ z which multiplies the symmetric metric, and we show how the theory can be easily coupled to additional fields. The cosmological constant Λ z is assumed to be nearly cancelled by Schrödinger’s cosmological constant Λ b which multiplies the nonsymmetric fundamental tensor, such that the total Λ = Λ z + Λ b matches measurement. The resulting theory becomes exactly Einstein-Maxwell theory in the limit as | Λ z | → ∞. For | Λ z | ~ 1/(Planck length)2 the field equations match the ordinary Einstein and Maxwell equations except for extra terms which are < 10-16 of the usual terms for worst-case field strengths and rates-of-change accessible to measurement. Additional fields can be included in the Lagrangian, and these fields may couple to the symmetric metric and the electromagnetic vector potential, just as in Einstein-Maxwell theory. The ordinary Lorentz force equation is obtained by taking the divergence of the Einstein equations when sources are included. The Einstein-Infeld-Hoffmann (EIH) equations of motion match the equations of motion for Einstein-Maxwell theory to Newtonian/Coulombian order, which proves the existence of a Lorentz force without requiring sources. This fixes a problem of the original Einstein-Schrödinger theory, which failed to predict a Lorentz force. An exact charged solution matches the Reissner-Nordström solution except for additional terms which are ~10-66 of the usual terms for worst-case radii accessible to measurement. An exact electromagnetic plane-wave solution is identical to its counterpart in Einstein-Maxwell theory.

Effect of high-pitch dual-source CT to compensate motion artifacts: a phantom study.

PubMed

Farshad-Amacker, Nadja A; Alkadhi, Hatem; Leschka, Sebastian; Frauenfelder, Thomas

2013-10-01

To evaluate the potential of high-pitch, dual-source computed tomography (DSCT) for compensation of motion artifacts. Motion artifacts were created using a moving chest/cardiac phantom with integrated stents at different velocities (from 0 to 4-6 cm/s) parallel (z direction), transverse (x direction), and diagonal (x and z direction combined) to the scanning direction using standard-pitch (SP) (pitch = 1) and high-pitch (HP) (pitch = 3.2) 128-detector DSCT (Siemens, Healthcare, Forchheim, Germany). The scanning parameters were (SP/HP): tube voltage, 120 kV/120 kV; effective tube current time product, 300 mAs/500 mAs; and a pitch of 1/3.2. Motion artifacts were analyzed in terms of subjective image quality and object distortion. Image quality was rated by two blinded, independent observers using a 4-point scoring system (1, excellent; 2, good with minor object distortion or blurring; 3, diagnostically partially not acceptable; and 4, diagnostically not acceptable image quality). Object distortion was assessed by the measured changes of the object's outer diameter (x) and length (z) and a corresponding calculated distortion vector (d) (d = √(x(2) + z(2))). The interobserver agreement was excellent (k = 0.91). Image quality using SP was diagnostically not acceptable with any motion in x direction (scores 3 and 4), in contrast to HP DSCT where it remained diagnostic up to 2 cm/s (scores 1 and 2). For motion in the z direction only, image quality remained diagnostic for SP and HP DSCT (scores 1 and 2). Changes of the object's diameter (x), length (z), and distortion vectors (d) were significantly greater with SP (overall: x = 1.9 cm ± 1.7 cm, z = 0.6 cm ± 0.8 cm, and d = 1.4 cm ± 1.5 cm) compared to HP DSCT (overall: x = 0.1 cm ± 0.1 cm, z = 0.0 cm ± 0.1 cm, and d = 0.1 cm ± 0.1 cm; each P < .05). High-pitch DSCT significantly decreases motion artifacts in various directions and improves image quality. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.

The novel 13S,14S-epoxy-maresin is converted by human macrophages to maresin 1 (MaR1), inhibits leukotriene A4 hydrolase (LTA4H), and shifts macrophage phenotype

PubMed Central

Dalli, Jesmond; Zhu, Min; Vlasenko, Nikita A.; Deng, Bin; Haeggström, Jesper Z.; Petasis, Nicos A.; Serhan, Charles N.

2013-01-01

Maresins are produced by macrophages from docosahexaenoic acid (DHA) and exert potent proresolving and tissue homeostatic actions. Maresin 1 (MaR1; 7R,14S-dihydroxy-docosa-4Z,8E,10E,12Z,16Z,19Z-hexaenoic acid) is the first identified maresin. Here, we investigate formation, stereochemistry, and precursor role of 13,14-epoxy-docosahexaenoic acid, an intermediate in MaR1 biosynthesis. The 14-lipoxygenation of DHA by human macrophage 12-lipoxygenase (hm12-LOX) gave 14-hydro(peroxy)-docosahexaenoic acid (14-HpDHA), as well as several dihydroxy-docosahexaenoic acids, implicating an epoxide intermediate formation by this enzyme. Using a stereo-controlled synthesis, enantiomerically pure 13S,14S-epoxy-docosa-4Z,7Z,9E,11E,16Z,19Z-hexaenoic acid (13S,14S-epoxy-DHA) was prepared, and its stereochemistry was confirmed by NMR spectroscopy. When this 13S,14S-epoxide was incubated with human macrophages, it was converted to MaR1. The synthetic 13S,14S-epoxide inhibited leukotriene B4 (LTB4) formation by human leukotriene A4 hydrolase (LTA4H) ∼40% (P<0.05) to a similar extent as LTA4 (∼50%, P<0.05) but was not converted to MaR1 by this enzyme. 13S,14S-epoxy-DHA also reduced (∼60%; P<0.05) arachidonic acid conversion by hm12-LOX and promoted conversion of M1 macrophages to M2 phenotype, which produced more MaR1 from the epoxide than M1. Together, these findings establish the biosynthesis of the 13S,14S-epoxide, its absolute stereochemistry, its precursor role in MaR1 biosynthesis, and its own intrinsic bioactivity. Given its actions and role in MaR1 biosynthesis, this epoxide is now termed 13,14-epoxy-maresin (13,14-eMaR) and exhibits new mechanisms in resolution of inflammation in its ability to inhibit proinflammatory mediator production by LTA4 hydrolase and to block arachidonate conversion by human 12-LOX rather than merely terminating phagocyte involvement.—Dalli, J., Zhu, M., Vlasenko, N. A., Deng, B., Haeggström, J. Z., Petasis, N. A., Serhan, C. N. The novel 13S,14S-epoxy-maresin is converted by human macrophages to maresin 1 (MaR1), inhibits leukotriene A4 hydrolase (LTA4H) and shifts macrophage phenotype. PMID:23504711

An Accurate Measurement of the IGM HeII Lyman Alpha Forest toward a Newly Discovered UV-bright Quasar at z>3.5

NASA Astrophysics Data System (ADS)

Worseck, Gabor

2016-10-01

The advent of GALEX and COS have revolutionized our view of HeII reionization, the final major phase transition of the intergalactic medium. COS spectra of the HeII Lyman alpha forest have confirmed with high confidence the high HeII transmission that signifies the completion of HeII reionization at z 2.7. However, the handful of z>3.5 quasars observed to date show a set of HeII transmission 'spikes' and larger regions with non-zero transmission that suggest HeII reionization was well underway by z=4. This is in striking conflict with predictions from state-of-the-art radiative transfer simulations of a HeII reionization driven by bright quasars. Explaining these measurements may require either faint quasars or more exotic sources of hard photons at z>4, with concomitant implications for HI reionization. We propose here to observe J2354-2033, an FUV-bright quasar at z=3.786 that we recently discovered in a dedicated survey for likely HeII-transmitting quasars. With this COS/G140L spectrum, we would confirm that the quasar is valuable for studies of the HeII Lyman alpha forest by identifying possible interloping low-z HI absorbers, provide accurate measurements of the IGM HeII opacity, and provide only the third z>3.5 sightline that would allow for high-resolution G130M spectroscopy before the end of HST's mission. The proposed observations would mark only the fourth observation of the HeII Lyman alpha forest at z>3.7 and the source would be the 2nd-brightest known on the sky at these redshifts.

Highly efficient hybrid energy generator: coupled organic photovoltaic device and randomly oriented electrospun poly(vinylidene fluoride) nanofiber.

PubMed

Park, Boongik; Lee, Kihwan; Park, Jongjin; Kim, Jongmin; Kim, Ohyun

2013-03-01

A hybrid architecture consisting of an inverted organic photovoltaic device and a randomly-oriented electrospun PVDF piezoelectric device was fabricated as a highly-efficient energy generator. It uses the inverted photovoltaic device with coupled electrospun PVDF nanofibers as tandem structure to convert solar and mechanical vibrations energy to electricity simultaneously or individually. The power conversion efficiency of the photovoltaic device was also significantly improved up to 4.72% by optimized processes such as intrinsic ZnO, MoO3 and active layer. A simple electrospinning method with the two electrode technique was adopted to achieve a high voltage of - 300 mV in PVDF piezoelectric fibers. Highly-efficient HEG using voltage adder circuit provides the conceptual possibility of realizing multi-functional energy generator whenever and wherever various energy sources are available.

Electrical Control of Silicon Photonic Crystal Cavity by Graphene

DTIC Science & Technology

2012-01-01

Henriksen, E. A.; Jiang, Z.; Hao, Z.; Martin, M. C.; Kim, P.; Stormer , H. L.; Basov, D. N. Nat. Phys. 2008, 4 (7), 532−535. (4) Liu, M.; Yin, X...Zhang, Y.; Tan, Y.-W.; Stormer , H. L.; Kim, P. Nature 2005, 438 (7065), 201−204. (21) Cho, J. H.; Lee, J.; Xia, Y.; Kim, B.; He, Y.; Renn, M. J

Synthesis and characterization of aluminum- and gallium-bridged [1.1]chromarenophanes and [1.1]molybdarenophanes.

PubMed

Lund, Clinton L; Schachner, Jörg A; Burgess, Ian J; Quail, J Wilson; Schatte, Gabriele; Müller, Jens

2008-07-07

The synthesis and structural characterization of the first [1.1]chromarenophanes and the first [1.1]molybdarenophanes are described. A salt-metathesis reaction of [2-(Me 2NCH 2)C 6H 4]AlCl 2 with freshly prepared [Cr(LiC 6H 5) 2].TMEDA (TMEDA = N, N, N', N'-tetramethylethylenediamine) resulted in the dialumina[1.1]chromarenophane [{2-(Me 2NCH 2)C 6H 4}Al(eta (6)-C 6H 5) 2Cr] 2 ( 2a). The poor solubility of 2a in organic solvents prompted us to synthesize the new intramolecularly coordinated aluminum- and gallium dichlorides [5- tBu-2-(Me 2NCH 2)C 6H 3]ECl 2 [E = Al ( 3a), Ga ( 3b)] in which the phenyl group was equipped with a tert-butyl group. Salt-metathesis reactions of 3a and 3b, respectively, with freshly prepared [M(LiC 6H 5) 2].TMEDA (M = Cr, Mo) resulted in four new [1.1]metallarenophanes of the general type [{5- tBu-2-(Me 2NCH 2)C 6H 3}E(eta (6)-C 6H 5) 2M] 2 [E = Al, M = Cr ( 4a); E = Ga, M = Cr ( 4b); E = Al, M = Mo ( 5a); E = Ga, M = Mo ( 5b)]. 2a, 4a, b, and 5a, b have been structurally characterized by single-crystal analysis [ 2a.1/2C 6H 12: C 48H 56Al 2Cr 2N 2, monoclinic, P2 1/ c, a = 9.9117(9) A, b = 19.9361(16) A, c = 10.638(2) A, alpha = 90 degrees , beta = 112.322(5) degrees , gamma = 90 degrees , Z = 2; 4a.2C 6H 6: C 62H 72Al 2Cr 2N 2, monoclinic, P2 1/ c, a = 10.9626(9) A, b = 19.3350(18) A, c = 12.4626(9) A, alpha = 90 degrees , beta = 100.756(5) degrees , gamma = 90 degrees , Z = 2; 4b.2C 6H 6: C 62H 72Cr 2Ga 2N 2, monoclinic, P2 1/ c, a = 10.8428(2) A, b = 19.4844(4) A, c = 12.4958(2) A, alpha = 90 degrees , beta = 100.6187 degrees , gamma = 90 degrees , Z = 2; 5a.2C 6H 6: C 62H 72Al 2Mo 2N 2, triclinic, P1, a = 10.4377(4) A, b = 11.6510(4) A, c = 11.6514(4) A, alpha = 73.545(3) degrees , beta = 89.318(2) degrees , gamma = 76.120(2) degrees , Z = 1; 5b.2C 6H 6: C 62H 72Ga 2Mo 2N 2, triclinic, P1, a = 10.3451(5) A, b = 11.6752(6) A, c = 11.6900(5) A, alpha = 73.917(3) degrees , beta = 89.550(3) degrees , gamma = 76.774(2) degrees , Z = 1]. All five [1.1]metallarenophanes 2a, 4a, b, and 5a, b crystallize as anti isomers with both Me 2N donor groups in exo positions ( C i point group symmetry). The new [1.1]metallarenophanes show NMR spectra that can be interpreted as being caused by time-averaged C 2 h symmetrical species, which is consistent with the findings of their molecular structures in the solid state. Variable-temperature (1)H NMR measurements for 4a, b and 5a, b (500 MHz; -90 to 90 degrees C) revealed only peak broadening in the lower temperature range of -70 to -90 degrees C. (1)H NMR saturation transfer difference experiments did not show an expected anti-to-anti isomerization, rendering the new [1.1]metallacyclophanes rigid on the NMR time scale. Electrochemical measurements were performed for 4a, b and 5a, b. However, reproducible cyclic voltammograms could only be obtained for the two gallium species 4b and 5b, revealing the expected weak communication between the two transition-metal atoms in both compounds (class II).

United States Air Force Statistical Digest, Fiscal Year 1980. Thirty-Fifth Edition

DTIC Science & Technology

1981-03-15

11832 90.b =en 2 11052 11352 10 .... 7 en’""’"" 3 1 U503 10146 96.6= ~’:Id4 10158 101.7 =:z ’+ :zr- r--< 9903 -<TOTAL 4376’+ 43489 T-,)3 A 1 102b4 ’Hb...34’""’" 76.8 == .. 1498 .1.151::ICI ::ICI= TOTAL ~. iSO 457:>3 ’i5.1 ="’""’" :::!:!"’"Si e:.- 6-c;7C 252r- 51123F 1 r- c: 2 221 c:en 3 231 en"’""’" 4 0:::31= !iZ

Serotonergic activity-guided phytochemical investigation of the roots of Angelica sinensis.

PubMed

Deng, Shixin; Chen, Shao-Nong; Yao, Ping; Nikolic, Dejan; van Breemen, Richard B; Bolton, Judy L; Fong, Harry H S; Farnsworth, Norman R; Pauli, Guido F

2006-04-01

Serotonin receptor (5-HT(7)) binding assay-directed fractionation of a methanol extract of the dried roots of Angelica sinensis led to the isolation and identification of 21 compounds including a new phenolic ester, angeliferulate (1), and three new phthalides, 10-angeloylbutylphthalide (2), sinaspirolide (3), and ansaspirolide (4), along with 17 known compounds, p-hydroxyphenethyl trans-ferulate (5), Z-ligustilide (6), Z-butylidenephthalide (7), senkyunolide I (8), Z-6-hydroxy-7-methoxydihydroligustilide (9), N-butylbenzenesulfonamide (10), 11(S),16(R)-dihydroxyoctadeca-9Z,17-diene-12,14-diyn-1-yl acetate (11), (3R,8S)-falcarindiol (12), heptadeca-1-en-9,10-epoxy-4,6-diyne-3,8-diol (13), oplopandiol (14), 8-hydroxy-1-methoxy-, Z-9-heptadecene-4,6-diyn-3-one (15), imperatorin, ferulic acid, vanillin, stigmasterol, sucrose, and 1,3-dilinolenin. This is the first report of a sulfonamide (10) identified from a higher plant source, although its presence needs further investigation. Biosynthetic pathways for dimeric phthalides 3 and 4 are proposed. Compounds 5, 7, 11, 12, 15, and imperatorin exhibited affinity toward 5-HT(7) receptors in a competitive binding assay.

Analysis of monochromatic and quasi-monochromatic X-ray sources in imaging and therapy

NASA Astrophysics Data System (ADS)

Westphal, Maximillian; Lim, Sara; Nahar, Sultana; Orban, Christopher; Pradhan, Anil

2017-04-01

We studied biomedical imaging and therapeutic applications of recently developed quasi-monochromatic and monochromatic X-ray sources. Using the Monte Carlo code GEANT4, we found that the quasi-monochromatic 65 keV Gaussian X-ray spectrum created by inverse Compton scattering with relatavistic electron beams were capable of producing better image contrast with less radiation compared to conventional 120 kV broadband CT scans. We also explored possible experimental detection of theoretically predicted K α resonance fluorescence in high-Z elements using the European Synchrotron Research Facility with a tungsten (Z = 74) target. In addition, we studied a newly developed quasi-monochromatic source generated by converting broadband X-rays to monochromatic K α and β X-rays with a zirconium target (Z = 40). We will further study how these K α and K β dominated spectra can be implemented in conjunction with nanoparticles for targeted therapy. Acknowledgement: Ohio Supercomputer Center, Columbus, OH.

Harvesting wind energy to detect weak signals using mechanical stochastic resonance.

PubMed

Breen, Barbara J; Rix, Jillian G; Ross, Samuel J; Yu, Yue; Lindner, John F; Mathewson, Nathan; Wainwright, Elliot R; Wilson, Ian

2016-12-01

Wind is free and ubiquitous and can be harnessed in multiple ways. We demonstrate mechanical stochastic resonance in a tabletop experiment in which wind energy is harvested to amplify weak periodic signals detected via the movement of an inverted pendulum. Unlike earlier mechanical stochastic resonance experiments, where noise was added via electrically driven vibrations, our broad-spectrum noise source is a single flapping flag. The regime of the experiment is readily accessible, with wind speeds ∼20 m/s and signal frequencies ∼1 Hz. We readily obtain signal-to-noise ratios on the order of 10 dB.

CLASH: DISCOVERY OF A BRIGHT z {approx_equal} 6.2 DWARF GALAXY QUADRUPLY LENSED BY MACS J0329.6-0211

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zitrin, A.; Moustakas, J.; Bradley, L.

2012-03-15

We report the discovery of a z{sub phot} = 6.18{sup +0.05}{sub -0.07} (95% confidence level) dwarf galaxy, lensed into four images by the galaxy cluster MACS J0329.6-0211 (z{sub l} = 0.45). The galaxy is observed as a high-redshift dropout in HST/ACS/WFC3 CLASH and Spitzer/IRAC imaging. Its redshift is securely determined due to a clear detection of the Lyman break in the 18-band photometry, making this galaxy one of the highest-redshift multiply lensed objects known to date with an observed magnitude of F125W =24.00 {+-} 0.04 AB mag for its most magnified image. We also present the first strong-lensing analysis ofmore » this cluster uncovering 15 additional multiply imaged candidates of five lower-redshift sources spanning the range z{sub s} {approx_equal} 2-4. The mass model independently supports the high photometric redshift and reveals magnifications of 11.6{sup +8.9}{sub -4.1}, 17.6{sup +6.2}{sub -3.9}, 3.9{sup +3.0}{sub -1.7}, and 3.7{sup +1.3}{sub -0.2}, respectively, for the four images of the high-redshift galaxy. By delensing the most magnified image we construct an image of the source with a physical resolution of {approx}200 pc when the universe was {approx}0.9 Gyr old, where the z {approx_equal} 6.2 galaxy occupies a source-plane area of approximately 2.2 kpc{sup 2}. Modeling the observed spectral energy distribution using population synthesis models, we find a demagnified stellar mass of {approx}10{sup 9} M{sub Sun }, subsolar metallicity (Z/Z{sub Sun} {approx} 0.5), low dust content (A{sub V} {approx} 0.1 mag), a demagnified star formation rate (SFR) of {approx}3.2 M{sub Sun} yr{sup -1}, and a specific SFR of {approx}3.4 Gyr{sup -1}, all consistent with the properties of local dwarf galaxies.« less

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Inverter-based GTA welding machines improve fabrication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sammons, M.

2000-05-01

While known as precision process, many fabricators using the gas tungsten arc welding (GTAW) process fight several common problems that hinder quality, slow production, frustrate the operator and otherwise prevent the process from achieving its full potential. These include a limited ability to tailor the weld bead profile, poor control of the arc direction and arc wandering, poor arc starting, unstable or inconsistent arcs in the AC mode, high-frequency interference with electronics and tungsten contamination. Fortunately, new GTA welding technology--made possible by advances with inverter-based power sources and micro-processor controls--can eliminate common productivity gremlins. Further, new AC/DC inverter-based GTA powermore » sources provide advanced arc shaping capabilities. As a result, many fabricators adopting this new technology have experienced phenomenal production increases, taken on new types of projects and reduced costs. Most importantly, the operators enjoy welding more.« less

A Comparison of Measured and Calculated Air-Transported Radiation from a Fast. Unshielded Nuclear Reactor.

DTIC Science & Technology

1980-12-01

UNSHIELDED NUCLEAR REACTOR by H. A. Robitaille and B. E. Hoffarth D T ICS ELECTE SEP 1 5 i9813 C- LA . DISTRIBUTION STATEMENT A O PROJECT NO. 1 DECEMBER 1980...et de neutrons b diff6rentes distances jusqu’ 1100 m~tres du r6acteur ncldaire & neutrons rapides de la Pulse Radiation Division de la U.S. Army...u)UOU 𔃽N~nl4 N0in0 -CuD z f- 000 LUU ’4 :1O 00 w4 w4 w (u3)uU3 𔃽N~n-A NO.Ln3 rc ino OQQ z ca co, 0 0- C ) LU c C. M CU m CD 0 LA (u3uOU 𔃽N~n1.4No

Refractive Index of Alkaline Earth Halides and Its Wavelength and Temperature Derivatives.

DTIC Science & Technology

1977-09-01

L 1- hi.4 6- W 11 41W11 h 444 4 0 44 a J A f owi 4m W 2p mom. W Wa x of o0 44 @10 50001 ZOO & hh hi0 * I 0 3o 10,. 011 O 44 01-1 I& 4 O1-h U -Z. co...o 0 cy ) -iMJ .- z .. bJb ’ O.3 40. 0 3 V󈧢 0’.0b I-- . I- I- * .- u m. I.- U ".a-03 e0 .- 0’.. WZ4 w~2 .2U >e of X- be W. be w.S/0 W t 4 u3 4 4i 4...I A U WW Ir Fa a P . m W a al U% UU m . 0 * . .1C U I a a a C a a a i b- 0 04 N, N 4 N 148 0 r -t u 0 01. 20 W 6 0 2 a -1 2 0 1-9 s-, jb 4. i 54w

George AFB Victorville, California. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

DTIC Science & Technology

1977-08-05

w, 2 , L 29.B 1 9. 2* 10 .39 l;5 8*00 0 67 NNW M ___ __1 495 TNW NUeM7 1* 3I*r0ATIONS SUSAFETAC 0-8.5 (L Al ’uvoC SITO IS oE THIS/o ,OIN ASo SWUI...38Z___ 37 1C Obi gel 36/___ 357F *1 *2 o * 5 61 6 k~ EI4ncn 3X - N.. . o o’ .Ih T m.it~ w 12/ 31i _____52 A/ 29 i I DATA PRuCESS!ING BRANCH SM AYS4...Eemmnt (X) - Zxt " . Z X No . .. Ob.. Me. No. of Nuts with Tempottur. __-_4 gel . Hum.- 0 1 ,32P . 6 73 .•01F .F Tool u , 8’, . 1, ’ . .. " we B!b -. INI46

Composite films of oxidized multiwall carbon nanotube and poly(3,4-ethylenedioxythiophene): polystyrene sulfonate (PEDOT:PSS) as a contact electrode for transistor and inverter devices.

PubMed

Yun, Dong-Jin; Rhee, Shi-Woo

2012-02-01

Composite films of multiwall carbon nanotube (MWNT)/poly(3,4-ethylenedioxythiophene) polymerized with poly(4-styrenesulfonate) (PEDOT:PSS) were prepared by spin-coating a mixture solution. The effect of the MWNT loading and the MWNT oxidation, with acid solution or ultraviolet (UV)-ozone treatment, on the film properties such as surface roughness, work function, surface energy, optical transparency and conductivity were studied. Also pentacene thin film transistors and inverters were made with these composite films as a contact metal and the device characteristics were measured. The oxidation of MWNT reduced the conductivity of MWNT/PEDOT:PSS composite film but increased the work function and transparency. UV-ozone treated MWNT/PEDOT:PSS composite film showed higher conductivity (14000 Ω/□) and work function (4.9 eV) than acid-oxidized MWNT/PEDOT:PSS composite film and showed better performance as a source/drain electrode in organic thin film transistor (OTFT) than other types of MWNT/PEDOT:PSS composite films. Hole injection barrier of the UV-ozone treated MWNT/PEDOT:PSS composite film with pentacene was significantly lower than any other films because of the higher work function.

On the Redshift of TeV BL Lac Objects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paiano, Simona; Falomo, Renato; Landoni, Marco

2017-03-10

We report results of a spectroscopic campaign carried out at the 10 m Gran Telescopio Canarias for a sample of 22 BL Lac objects detected (or candidates) at TeV energies, aiming to determine or constrain their redshift. This is of fundamental importance for the interpretation of their emission models and for population studies and is also mandatory for studying the interaction of high-energy photons with the extragalactic background light using TeV sources. Optical spectra with high signal-to-noise ratios in the range 4250–10000 Å were obtained to search for faint emission or absorption lines from both the host galaxy and themore » nucleus. We determine a new redshift for PKS 1424+240 ( z = 0.604) and a tentative one for 1ES 0033+595 ( z = 0.467). We are able to set new spectroscopic redshift lower limits for three other sources on the basis of Mg ii and Ca ii intervening absorption features: BZB J1243+3627 ( z > 0.483), BZB J1540+8155 ( z > 0.672), and BZB 0J2323+4210 ( z > 0.267). We confirm previous redshift estimates for four blazars: S3 0218+357 ( z = 0.944), 1ES 1215+303 ( z = 0.129), W Comae ( z = 0.102), and MS 1221.8+2452 ( z = 0.218). For the remaining targets, in seven cases (S2 0109+22, 3C 66A, VER J0521+211, S4 0954+65, BZB J1120+4214, S3 1227+25, BZB J2323+4210), we do not validate the proposed redshift. Finally, for all sources of still-unknown redshift, we set a lower limit based on the minimum equivalent width of absorption features expected from the host galaxy.« less

Global changes in gene expression during compatible and incompatible interactions of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides

PubMed Central

2012-01-01

Background Cowpea, Vigna unguiculata L. Walp., is one of the most important food and forage legumes in the semi-arid tropics. While most domesticated forms of cowpea are susceptible to the root parasitic weed Striga gesnerioides, several cultivars have been identified that show race-specific resistance. Cowpea cultivar B301 contains the RSG3-301 gene for resistance to S. gesnerioides race SG3, but is susceptible to race SG4z. When challenged by SG3, roots of cultivar B301 develop a strong resistance response characterized by a hypersensitive reaction and cell death at the site of parasite attachment. In contrast, no visible response occurs in B301 roots parasitized by SG4z. Results Gene expression in the roots of the cowpea cultivar B301 during compatible (susceptible) and incompatible (resistant) interactions with S. gesnerioides races SG4z and SG3, respectively, were investigated at the early (6 days post-inoculation (dpi)) and late (13 dpi) stages of the resistance response using a Nimblegen custom design cowpea microarray. A total of 111 genes were differentially expressed in B301 roots at 6 dpi; this number increased to 2102 genes at 13 dpi. At 13 dpi, a total of 1944 genes were differentially expressed during compatible (susceptible) interactions of B301 with SG4z. Genes and pathways involved in signal transduction, programmed cell death and apoptosis, and defense response to biotic and abiotic stress were differentially expressed in the early resistance response; at the later time point, enrichment was primarily for defense-related gene expression, and genes encoding components of lignifications and secondary wall formation. In compatible interactions (B301 – SG4z), multiple defense pathways were repressed, including those involved in lignin biosynthesis and secondary cell wall modifications, while cellular transport processes for nitrogen and sulfur were increased. Conclusion Distinct changes in global gene expression profiles occur in host roots following successful and unsuccessful attempted parasitism by Striga. Induction of specific defense related genes and pathways defines components of a unique resistance mechanism. Some genes and pathways up-regulated in the host resistance response to SG3 are repressed in the susceptible interactions, suggesting that the parasite is targeting specific components of the host’s defense. These results add to our understanding of plant-parasite interactions and the evolution of resistance to parasitic weeds. PMID:22900582

Technical preventive measures in Japan.

PubMed

Yonekawa, Y

1994-05-01

Technical preventive measures against vibration syndrome in the field of industrial health are reviewed in the present paper. The first technical prevention measure is to reduce vibration transmission from the tools to the operators. This measure employs vibration isolators between the handles and vibration sources of machine tools. Handles of tools using Neidhalt dampers, shear type rubber mounts and springs have reduced frequency-weighted acceleration levels (Lh,w) from 2 dB to 10 dB (Lh,w (dB) = 20 log a/ao; a: frequency-weighted acceleration (rms), ao = 10(-5) m/s2) in Z direction, while no reduction was found in X, Y directions. The second measure is to reduce vibration at the source; New chain saws have been developed to reduce vibration with twin cylinder instead of a single cylinder engines. This cancels unbalanced movements inside the internal combustion engine. Such chain saws reduced Lh,w values more than 10 dB in both front and rear handles except in Z direction of the front handle. A new type of impact wrench has been devised with an oil pulse device to avoid direct metal contact inside the power source. This new impact wrench lowered Lh,w values more than 10 dB in three directions. The third measure is to use a remote control system or to substitute another machine generating less vibration. Vibration reduction at the handle lever of the remote control chain saw was more than 20 dB. A more effective means is to substitute other machines for conventional tools: a hydraulic wheel jumbo instead of a leg-type rock drill; a hydraulic breaker instead of a hand-held breaker. However, these heavy machines produce whole-body vibration which might give rise to other problems such as back pain.

National Dam Inspection Program. Perrins Marsh Dam (NDI I.D. PA-0886, DER I.D. 066-005), Susquehanna River Basin Whitelock Creek, Wyoming County, Pennsylvania. Phase I Inspection Report,

DTIC Science & Technology

1981-01-01

4c sw- 0mr- w <L -- 0 I- 0. .1 I0 W ’- -o’ -3 w XLW 8 0 WW 4CFO .-. .- -4 >(lJ K 0 E-#F-0 c...2 -. 4-; In cnz KW cc 8 0 0 I f4 (z~ 0- 0- 0- -- .10 ’ 4c 0z J It’ 00 it w .C 0 W 040 ~񕋘 LL. i ao0000 11.4 Or. z ZOO 3- LCW J- zw a J Cz 4 WW L...a* o darDf Ma r, in ori~e s.Vsaa rsnre (’,. mi ,-te ~ b . C, ."s ...... .- - - - ln,V,,i:e, .’ ,. . "(’ hrm ,..,o lrda hind ’ ,++r!l, hert.

Constraining the relative velocity effect using the Baryon Oscillation Spectroscopic Survey

DOE PAGES

Beutler, Florian; Seljak, Uroš; Vlah, Zvonimir

2017-05-16

Here, we analyse the power spectrum of the Baryon Oscillation Spectroscopic Survey (BOSS) Data Release 12 to constrain the relative velocity effect, which represents a potential systematic for measurements of the baryon acoustic oscillation (BAO) scale. The relative velocity effect is sourced by the different evolution of baryon and cold dark matter perturbations before decoupling. Our power spectrum model includes all one-loop redshift-space terms corresponding to vbc parametrized by the bias parameter bmore » $$2\\atop{v}$$ . We also include the linear terms proportional to the relative density, δbc, and relative velocity dispersion, θbc, which we parametrize with the bias parameters b$$bc\\atop{δ}$$ and b$$bc\\atop{θ}$$. This data does not support a detection of the relative velocity effect in any of these parameters. Combining the low- and high-redshift bins of BOSS, we find limits of b$$2\\atop{v}$$=0.012±0.015(±0.031) , b$$bc\\atop{δ}$$=-1.0±2.5(±6.2) and b$$bc\\atop{θ}$$=-114±55(±175) with 68 percent (95 percent) confidence levels. These constraints restrict the potential systematic shift in D A(z), H(z) and fσ8, due to the relative velocity, to 1 percent, 0.8 percent and 2 percent, respectively. Given the current uncertainties on the BAO measurements of BOSS, these shifts correspond to 0.53σ, 0.5σ and 0.22σ for DA(z), H(z) and fσ8, respectively.« less

Constraining the relative velocity effect using the Baryon Oscillation Spectroscopic Survey

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beutler, Florian; Seljak, Uroš; Vlah, Zvonimir

Here, we analyse the power spectrum of the Baryon Oscillation Spectroscopic Survey (BOSS) Data Release 12 to constrain the relative velocity effect, which represents a potential systematic for measurements of the baryon acoustic oscillation (BAO) scale. The relative velocity effect is sourced by the different evolution of baryon and cold dark matter perturbations before decoupling. Our power spectrum model includes all one-loop redshift-space terms corresponding to vbc parametrized by the bias parameter bmore » $$2\\atop{v}$$ . We also include the linear terms proportional to the relative density, δbc, and relative velocity dispersion, θbc, which we parametrize with the bias parameters b$$bc\\atop{δ}$$ and b$$bc\\atop{θ}$$. This data does not support a detection of the relative velocity effect in any of these parameters. Combining the low- and high-redshift bins of BOSS, we find limits of b$$2\\atop{v}$$=0.012±0.015(±0.031) , b$$bc\\atop{δ}$$=-1.0±2.5(±6.2) and b$$bc\\atop{θ}$$=-114±55(±175) with 68 percent (95 percent) confidence levels. These constraints restrict the potential systematic shift in D A(z), H(z) and fσ8, due to the relative velocity, to 1 percent, 0.8 percent and 2 percent, respectively. Given the current uncertainties on the BAO measurements of BOSS, these shifts correspond to 0.53σ, 0.5σ and 0.22σ for DA(z), H(z) and fσ8, respectively.« less

An Overdensity of Massive, Dusty Starbursts Associated with the High-Redshift Radio Galaxy MRC1138-262 at z = 2.16

NASA Astrophysics Data System (ADS)

Altieri, Bruno; Dannerbauer, Helmut

We present Herschel and APEX LABOCA 870 μm imaging of the field of the high-redshift radio galaxy MRC1138 at z = 2.16. We detect 16 submillimeter galaxies in this ˜140 arcmin2 large bolometer map, with flux densities in the range 3-11 mJy. The pure number counts indicate an overdensity of SMGs by a factor of five compared to blank field surveys. Based on an exquisite multi-wavelength database including VLA 1.4 GHz radio and infrared observations, we verifiy whether these sources are members of the proto-cluster structure at z = 2.2 or not. Based on Herschel PACS+ SPIRE and Spitzer MIPS photometry, we derived reliable far-infrared photometric redshifts for all of our sources. VLT-ISAAC near-infrared spectroscopic observations confirmed redshifts of z ≈ 2.2 for four of these SMGs. We conclude that in total at least seven sources are part of this proto-cluster at z = 2.16. We measure a star formation rate density S FRD ˜ 1500 M⊙ yr-1 Mpc-3, four magntiudes higher compared to the global SFRD at this redshift. Striklingly, these seven sources are concentrated within a region of 2 Mpc (the typical size of clusters in the local universe) and are not distributed in the filaments as predicted by theories and traced by the Hα emitters at z ≈ 2.2. This concentration of massive, dusty starbursts is not centered on the radio galaxy which is submm bright. A significant fraction, six out of 11 SMGs with z ≈ 2.2 Hα imaging coverage are associated with Hα emitters, demonstrating the potential of tracing SMG counterparts with this source population. Our results demonstrate that indeed submm observations enable us to reveal clusters of massive, dusty starbursts and will pave the road for systematic and detailed investigations with this technique in the future.

HBTprogs Version 1.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, D; Danielewicz, P

2002-03-15

This is the manual for a collection of programs that can be used to invert angled-averaged (i.e. one dimensional) two-particle correlation functions. This package consists of several programs that generate kernel matrices (basically the relative wavefunction of the pair, squared), programs that generate test correlation functions from test sources of various types and the program that actually inverts the data using the kernel matrix.

Radiation by Sources on Perfectly Conducting Convex Cylinders with an Impedance Surface Patch.

DTIC Science & Technology

1980-01-01

U -- = - (a to0 . 0 0 m 4- 0 4- 04 0-0 1 - .0 4’ U-- ~4- 4 0 n4- -- C_ to S~0- 4J C >1 cu S)-0’ (0 C 0)~ 00 =3 .r aCCA 50 It is observed from these...by such a source has only a z-component and it will be denoted by H . H satisfies the reduced, inhomo- geneous wave equation, and the f6 1llowing

More Limit Theory for the Sample Correlation Function of Moving Averages.

DTIC Science & Technology

1984-09-01

R DAVIS ET AL. SEP 84 TR-72 UNLSIIDAORT-4i~ F92-2C08 / 21 N Z’ kr’v’ W.- ’-’ b1 tf1 ..b T ’U~b ~ a b. * 3 . 0 128 12 W6 111-2 L 1& - = 11111 .8...particular it was shown that there exists a slowly varying function L(t) such I.c that if p(h):- X Cj c +h/ c2 then V JJ_ n / LI(n...variables. Assume Z belongs to * the domain of attraction of a normal distribution which is equivalent to (cf. Feller, 1971, p. 313) the slow