Sample records for zerstoerungsfreie materialpruefung zfp

  1. ZFP compression plugin (filter) for HDF5

    SciTech Connect

    Miller, Mark C.

    H5Z-ZFP is a compression plugin (filter) for the HDF5 library based upon the ZFP-0.5.0 compression library. It supports 4- or 8-byte integer or floating point HDF5 datasets of any dimension but partitioned in 1, 2, or 3 dimensional chunks. It supports ZFP's four fundamental modes of operation; rate, precision, accuracy or expert. It is a lossy compression plugin.

  2. RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.


    Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin


    Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.

  3. Zfp206 regulates ES cell gene expression and differentiation.


    Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R


    Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

  4. ZFP36L1 and ZFP36L2 control LDLR mRNA stability via the ERK-RSK pathway.


    Adachi, Shungo; Homoto, Masae; Tanaka, Rikou; Hioki, Yusaku; Murakami, Hiroshi; Suga, Hiroaki; Matsumoto, Masaki; Nakayama, Keiichi I; Hatta, Tomohisa; Iemura, Shun-ichiro; Natsume, Tohru


    Low-density lipoprotein receptor (LDLR) mRNA is unstable, but is stabilized upon extracellular signal-regulated kinase (ERK) activation, possibly through the binding of certain proteins to the LDLR mRNA 3'-untranslated region (UTR), although the detailed mechanism underlying this stability control is unclear. Here, using a proteomic approach, we show that proteins ZFP36L1 and ZFP36L2 specifically bind to the 3'-UTR of LDLR mRNA and recruit the CCR4-NOT-deadenylase complex, resulting in mRNA destabilization. We also show that the C-terminal regions of ZFP36L1 and ZFP36L2 are directly phosphorylated by p90 ribosomal S6 kinase, a kinase downstream of ERK, resulting in dissociation of the CCR4-NOT-deadenylase complex and stabilization of LDLR mRNA. We further demonstrate that targeted disruption of the interaction between LDLR mRNA and ZFP36L1 and ZFP36L2 using antisense oligonucleotides results in upregulation of LDLR mRNA and protein. These results indicate that ZFP36L1 and ZFP36L2 regulate LDLR protein levels downstream of ERK. Our results also show the usefulness of our method for identifying critical regulators of specific RNAs and the potency of antisense oligonucleotide-based therapeutics. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Abnormal Behaviors and Developmental Disorder of Hippocampus in Zinc Finger Protein 521 (ZFP521) Mutant Mice

    PubMed Central

    Ohkubo, Nobutaka; Matsubara, Etsuko; Yamanouchi, Jun; Akazawa, Rie; Aoto, Mamoru; Suzuki, Yoji; Sakai, Ikuya; Abe, Takaya; Kiyonari, Hiroshi; Matsuda, Seiji; Yasukawa, Masaki; Mitsuda, Noriaki


    Zinc finger protein 521 (ZFP521) regulates a number of cellular processes in a wide range of tissues, such as osteoblast formation and adipose commitment and differentiation. In the field of neurobiology, it is reported to be an essential factor for transition of epiblast stem cells into neural progenitors in vitro. However, the role of ZFP521 in the brain in vivo still remains elusive. To elucidate the role of ZFP521 in the mouse brain, we generated mice lacking exon 4 of the ZFP521 gene. The birth ratio of our ZFP521 Δ/Δ mice was consistent with Mendel's laws. Although ZFP521 Δ/Δ pups had no apparent defect in the body and were indistinguishable from ZFP521+/+ and ZFP521 +/Δ littermates at the time of birth, ZFP521 Δ/Δ mice displayed significant weight reduction as they grew, and most of them died before 10 weeks of age. They displayed abnormal behavior, such as hyper-locomotion, lower anxiety and impaired learning, which correspond to the symptoms of schizophrenia. The border of the granular cell layer of the dentate gyrus in the hippocampus of the mice was indistinct and granular neurons were reduced in number. Furthermore, Sox1-positive neural progenitor cells in the dentate gyrus and cerebellum were significantly reduced in number. Taken together, these findings indicate that ZFP521 directly or indirectly affects the formation of the neuronal cell layers of the dentate gyrus in the hippocampus, and thus ZFP521 Δ/Δ mice displayed schizophrenia-relevant symptoms. ZFP521 Δ/Δ mice may be a useful research tool as an animal model of schizophrenia. PMID:24676388

  6. A zinc finger protein Zfp521 directs neural differentiation and beyond

    PubMed Central


    Neural induction is largely considered a default process, whereas little is known about intrinsic factors that drive neural differentiation. Kamiya and colleagues now demonstrate that a transcription factor, Zfp521, is capable of directing embryonic stem (ES) cells into neural progenitors. They discovered that Zfp521 transcripts were enriched in early neural lineage of ES cell differentiation. Forced expression of Zfp521 turned ES cells into neural progenitors in culture conditions that would normally inhibit neural differentiation. Zfp521 was expressed in mouse embryos during gastrulation. The protein was shown to associate with a co-activator p300 and directly induce expression of early neural genes. Knockdown of the Zfp521 by shRNA halted cells at the epiblast stage and suppressed neural differentiation. Zfp521 is a nuclear protein with 30 Krüppel-like zinc fingers mediating multiple protein-protein interactions, and regulates transcription in diverse tissues and organs. The protein promotes proliferation, delays differentiation and reduces apoptosis. The findings by Kamiya and colleagues that Zfp521 directs and sustains early neural differentiation now opens up a series of studies to investigate roles of Zfp521 in stem cells and brain development of mice and men. PMID:21539723

  7. Coordinated transcriptional regulation of bone homeostasis by Ebf1 and Zfp521 in both mesenchymal and hematopoietic lineages

    PubMed Central

    Kiviranta, Riku; Yamana, Kei; Saito, Hiroaki; Ho, Daniel K.; Laine, Julius; Tarkkonen, Kati; Nieminen-Pihala, Vappu; Hesse, Eric; Correa, Diego; Määttä, Jorma; Tessarollo, Lino; Rosen, Evan D.; Horne, William C.; Jenkins, Nancy A.; Copeland, Neal G.; Warming, Soren


    Bone homeostasis is maintained by the coupled actions of hematopoietic bone-resorbing osteoclasts (OCs) and mesenchymal bone-forming osteoblasts (OBs). Here we identify early B cell factor 1 (Ebf1) and the transcriptional coregulator Zfp521 as components of the machinery that regulates bone homeostasis through coordinated effects in both lineages. Deletion of Zfp521 in OBs led to impaired bone formation and increased OB-dependent osteoclastogenesis (OC-genesis), and deletion in hematopoietic cells revealed a strong cell-autonomous role for Zfp521 in OC progenitors. In adult mice, the effects of Zfp521 were largely caused by repression of Ebf1, and the bone phenotype of Zfp521+/− mice was rescued in Zfp521+/−:Ebf1+/− mice. Zfp521 interacted with Ebf1 and repressed its transcriptional activity. Accordingly, deletion of Zfp521 led to increased Ebf1 activity in OBs and OCs. In vivo, Ebf1 overexpression in OBs resulted in suppressed bone formation, similar to the phenotype seen after OB-targeted deletion of Zfp521. Conversely, Ebf1 deletion led to cell-autonomous defects in both OB-dependent and cell-intrinsic OC-genesis, a phenotype opposite to that of the Zfp521 knockout. Thus, we have identified the interplay between Zfp521 and Ebf1 as a novel rheostat for bone homeostasis. PMID:23569325

  8. Zfp488 promotes oligodendrocyte differentiation of neural progenitor cells in adult mice after demyelination

    PubMed Central

    Soundarapandian, Mangala M.; Selvaraj, Vimal; Lo, U-Ging; Golub, Mari S.; Feldman, Daniel H.; Pleasure, David E.; Deng, Wenbin


    Basic helix-loop-helix transcription factors Olig1 and Olig2 critically regulate oligodendrocyte development. Initially identified as a downstream effector of Olig1, an oligodendrocyte-specific zinc finger transcription repressor, Zfp488, cooperates with Olig2 function. Although Zfp488 is required for oligodendrocyte precursor formation and differentiation during embryonic development, its role in oligodendrogenesis of adult neural progenitor cells is not known. In this study, we tested whether Zfp488 could promote an oligodendrogenic fate in adult subventricular zone (SVZ) neural stem/progenitor cells (NSPCs). Using a cuprizone-induced demyelination model in mice, we examined the effect of retrovirus-mediated Zfp488 overexpression in SVZ NSPCs. Our results showed that Zfp488 efficiently promoted the differentiation of the SVZ NSPCs into mature oligodendrocytes in vivo. After cuprizone-induced demyelination injury, Zfp488-transduced mice also showed significant restoration of motor function to levels comparable to control mice. Together, these findings identify a previously unreported role for Zfp488 in adult oligodendrogenesis and functional remyelination after injury. PMID:22355521

  9. ZFP36 RNA-binding proteins restrain T-cell activation and anti-viral immunity.


    Moore, Michael J; Blachere, Nathalie E; Fak, John J; Park, Christopher Y; Sawicka, Kirsty; Parveen, Salina; Zucker-Scharff, Ilana; Moltedo, Bruno; Rudensky, Alexander Y; Darnell, Robert B


    Dynamic post-transcriptional control of RNA expression by RNA-binding proteins (RBPs) is critical during immune response. ZFP36 RBPs are prominent inflammatory regulators linked to autoimmunity and cancer, but functions in adaptive immunity are less clear. We used HITS-CLIP to define ZFP36 targets in mouse T cells, revealing unanticipated actions in regulating T cell activation, proliferation, and effector functions. Transcriptome and ribosome profiling showed that ZFP36 represses mRNA target abundance and translation, notably through novel AU-rich sites in coding sequence. Functional studies revealed that ZFP36 regulates early T cell activation kinetics cell autonomously, by attenuating activation marker expression, limiting T cell expansion, and promoting apoptosis. Strikingly, loss of ZFP36 in vivo accelerated T cell responses to acute viral infection and enhanced anti-viral immunity. These findings uncover a critical role for ZFP36 RBPs in restraining T cell expansion and effector functions, and suggest ZFP36 inhibition as a strategy to enhance immune-based therapies. © 2018, Moore et al.

  10. Optical spectroscopy and luminescence properties of Ho3+ doped zinc fluorophosphate (ZFP) glasses for green luminescent device applications

    NASA Astrophysics Data System (ADS)

    Reddy Prasad, V.; Damodaraiah, S.; Ratnakaram, Y. C.


    Ho3+ doped zinc fluorophosphate (ZFP) glasses with molar chemical compositions, (60-x) NH4H2PO4+20ZnO+10BaF2+10NaF+xHo2O3 (where x = 0.1, 0.3, 0.5, 1.0 and 1.5 mol%) were prepared by melt quenching technique. These glasses were characterized through physical, structural, optical, excitation, luminescence and decay curve analysis. From the absorption spectra, spectral intensities (fexp and fcal), Judd-Ofelt intensity parameters (Ω2, Ω4 and Ω6), radiative transition probabilities (AT), radiative lifetimes (τR) and branching ratios (βR) were evaluated for all Ho3+ doped ZFP glass matrices. From the photoluminescence spectra, peak stimulated emission cross-sections (σP) were calculated for all Ho3+ doped ZFP glasses. The Ho3+ doped ZFP glasses show strong green emission at 545 nm and red emission at 656 nm under excitation, 450 nm. The measured lifetimes (τmeas) of (5S2)5F4 level of Ho3+ doped ZFP glasses were obtained from decay profiles. The CIE color coordinates of Ho3+ doped ZFP glasses were calculated from emission spectra and 1.0 mol% of Ho3+ doped ZFP glass matrix gives green emission. Hence, these results confirm that the Ho3+ doped ZFP glasses could be considered as a promising candidate for visible green laser applications.

  11. Genetic and epigenetic mutations affect the DNA binding capability of human ZFP57 in transient neonatal diabetes type 1.


    Baglivo, Ilaria; Esposito, Sabrina; De Cesare, Lucia; Sparago, Angela; Anvar, Zahra; Riso, Vincenzo; Cammisa, Marco; Fattorusso, Roberto; Grimaldi, Giovanna; Riccio, Andrea; Pedone, Paolo V


    In the mouse, ZFP57 contains three classical Cys2His2 zinc finger domains (ZF) and recognizes the methylated TGC(met)CGC target sequence using the first and the second ZFs. In this study, we demonstrate that the human ZFP57 (hZFP57) containing six Cys2His2 ZFs, binds the same methylated sequence through the third and the fourth ZFs, and identify the aminoacids critical for DNA interaction. In addition, we present evidences indicating that hZFP57 mutations and hypomethylation of the TNDM1 ICR both associated with Transient Neonatal Diabetes Mellitus type 1 result in loss of hZFP57 binding to the TNDM1 locus, likely causing PLAGL1 activation. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. Genetic and epigenetic mutations affect the DNA binding capability of human ZFP57 in transient neonatal diabetes type 1

    PubMed Central

    Baglivo, Ilaria; Esposito, Sabrina; De Cesare, Lucia; Sparago, Angela; Anvar, Zahra; Riso, Vincenzo; Cammisa, Marco; Fattorusso, Roberto; Grimaldi, Giovanna; Riccio, Andrea; Pedone, Paolo V.


    In the mouse, ZFP57 contains three classical Cys2His2 zinc finger domains (ZF) and recognizes the methylated TGCmetCGC target sequence using the first and the second ZFs. In this study, we demonstrate that the human ZFP57 (hZFP57) containing six Cys2His2 ZFs, binds the same methylated sequence through the third and the fourth ZFs, and identify the aminoacids critical for DNA interaction. In addition, we present evidences indicating that hZFP57 mutations and hypomethylation of the TNDM1 ICR both associated with Transient Neonatal Diabetes Mellitus type 1 result in loss of hZFP57 binding to the TNDM1 locus, likely causing PLAGL1 activation. PMID:23499433

  13. The RNA-binding proteins Zfp36l1 and Zfp36l2 enforce the thymic β-selection checkpoint by limiting DNA damage response signaling and cell cycle progression

    PubMed Central

    Galloway, Alison; Ahlfors, Helena; Turner, Martin


    The RNA binding proteins Zfp36l1 and Zfp36l2 act redundantly to enforce the β-selection checkpoint during thymopoiesis, yet their molecular targets remain largely unknown. Here, we identify these targets on a genome wide scale in primary mouse thymocytes and show that Zfp36l1/l2 regulate DNA damage response and cell cycle transcripts to ensure proper β-selection. DN3 thymocytes lacking Zfp36l1/l2 share a gene expression profile with post-selected DN3b cells despite the absence of intracellular TCRβ and reduced IL-7 signaling. Our findings show that in addition to controlling the timing of proliferation at β-selection post-transcriptional control by Zfp36l1/l2 limits DNA damage responses which are known to promote thymocyte differentiation. Zfp36l1/l2 therefore act as post-transcriptional safeguards against chromosomal instability and replication stress by integrating pre-TCR and IL-7 signaling with DNA damage and cell cycle control. PMID:27566829

  14. The Zinc Finger Transcription Factor SlZFP2 Negatively Regulates Abscisic Acid Biosynthesis and Fruit Ripening in Tomato1

    PubMed Central

    Weng, Lin; Zhao, Fangfang; Li, Rong; Xu, Changjie; Chen, Kunsong


    Abscisic acid (ABA) regulates plant development and adaptation to environmental conditions. Although the ABA biosynthesis pathway in plants has been thoroughly elucidated, how ABA biosynthetic genes are regulated at the molecular level during plant development is less well understood. Here, we show that the tomato (Solanum lycopersicum) zinc finger transcription factor SlZFP2 is involved in the regulation of ABA biosynthesis during fruit development. Overexpression of SlZFP2 resulted in multiple phenotypic changes, including more branches, early flowering, delayed fruit ripening, lighter seeds, and faster seed germination, whereas down-regulation of its expression caused problematic fruit set, accelerated ripening, and inhibited seed germination. SlZFP2 represses ABA biosynthesis during fruit development through direct suppression of the ABA biosynthetic genes NOTABILIS, SITIENS, and FLACCA and the aldehyde oxidase SlAO1. We also show that SlZFP2 regulates fruit ripening through transcriptional suppression of the ripening regulator COLORLESS NON-RIPENING. Using bacterial one-hybrid screening and a selected amplification and binding assay, we identified the (A/T)(G/C)TT motif as the core binding sequence of SlZFP2. Furthermore, by RNA sequencing profiling, we found that 193 genes containing the SlZFP2-binding motifs in their promoters were differentially expressed in 2 d post anthesis fruits between the SlZFP2 RNA interference line and its nontransgenic sibling. We propose that SlZFP2 functions as a repressor to fine-tune ABA biosynthesis during fruit development and provides a potentially valuable tool for dissecting the role of ABA in fruit ripening. PMID:25637453

  15. Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.


    Kennedy, Lisa M; Grishok, Alla


    Endogenous short RNAs and the conserved plant homeodomain (PHD) zinc-finger protein ZFP-1/AF10 regulate overlapping sets of genes in Caenorhabditis elegans, which suggests that they control common biological pathways. We have shown recently that the RNAi factor RDE-4 and ZFP-1 negatively modulate transcription of the insulin/PI3 signaling-dependent kinase PDK-1 to promote C. elegans fitness. Moreover, we have demonstrated that the insulin/IGF-1-PI3K-signaling pathway regulates the activity of the DAF-16/FOXO transcription factor in the hypodermis to nonautonomously promote the anterior migrations of the hermaphrodite-specific neurons (HSNs) during embryogenesis of C. elegans. In this study, we implicate the PHD-containing isoform of ZFP-1 and endogenous RNAi in the regulation of HSN migration. ZFP-1 affects HSN migration in part through its negative effect on pdk-1 transcription and modulation of downstream DAF-16 activity. We also identify a novel role for ZFP-1 and RNAi pathway components, including RDE-4, in the regulation of HSN migration in parallel with DAF-16. Therefore, the coordinated activities of DAF-16, ZFP-1, and endogenous RNAi contribute to gene regulation during development to ensure proper neuronal positioning.

  16. Neuronal Migration Is Regulated by Endogenous RNAi and Chromatin-Binding Factor ZFP-1/AF10 in Caenorhabditis elegans

    PubMed Central

    Kennedy, Lisa M.; Grishok, Alla


    Endogenous short RNAs and the conserved plant homeodomain (PHD) zinc-finger protein ZFP-1/AF10 regulate overlapping sets of genes in Caenorhabditis elegans, which suggests that they control common biological pathways. We have shown recently that the RNAi factor RDE-4 and ZFP-1 negatively modulate transcription of the insulin/PI3 signaling-dependent kinase PDK-1 to promote C. elegans fitness. Moreover, we have demonstrated that the insulin/IGF-1-PI3K-signaling pathway regulates the activity of the DAF-16/FOXO transcription factor in the hypodermis to nonautonomously promote the anterior migrations of the hermaphrodite-specific neurons (HSNs) during embryogenesis of C. elegans. In this study, we implicate the PHD-containing isoform of ZFP-1 and endogenous RNAi in the regulation of HSN migration. ZFP-1 affects HSN migration in part through its negative effect on pdk-1 transcription and modulation of downstream DAF-16 activity. We also identify a novel role for ZFP-1 and RNAi pathway components, including RDE-4, in the regulation of HSN migration in parallel with DAF-16. Therefore, the coordinated activities of DAF-16, ZFP-1, and endogenous RNAi contribute to gene regulation during development to ensure proper neuronal positioning. PMID:24558261

  17. Post-Transcriptional Regulation of BCL2 mRNA by the RNA-Binding Protein ZFP36L1 in Malignant B Cells

    PubMed Central

    Zekavati, Anna; Nasir, Asghar; Alcaraz, Amor; Aldrovandi, Maceler; Marsh, Phil; Norton, John D.; Murphy, John J.


    The human ZFP36 zinc finger protein family consists of ZFP36, ZFP36L1, and ZFP36L2. These proteins regulate various cellular processes, including cell apoptosis, by binding to adenine uridine rich elements in the 3′ untranslated regions of sets of target mRNAs to promote their degradation. The pro-apoptotic and other functions of ZFP36 family members have been implicated in the pathogenesis of lymphoid malignancies. To identify candidate mRNAs that are targeted in the pro-apoptotic response by ZFP36L1, we reverse-engineered a gene regulatory network for all three ZFP36 family members using the ‘maximum information coefficient’ (MIC) for target gene inference on a large microarray gene expression dataset representing cells of diverse histological origin. Of the three inferred ZFP36L1 mRNA targets that were identified, we focussed on experimental validation of mRNA for the pro-survival protein, BCL2, as a target for ZFP36L1. RNA electrophoretic mobility shift assay experiments revealed that ZFP36L1 interacted with the BCL2 adenine uridine rich element. In murine BCL1 leukemia cells stably transduced with a ZFP36L1 ShRNA lentiviral construct, BCL2 mRNA degradation was significantly delayed compared to control lentiviral expressing cells and ZFP36L1 knockdown in different cell types (BCL1, ACHN, Ramos), resulted in increased levels of BCL2 mRNA levels compared to control cells. 3′ untranslated region luciferase reporter assays in HEK293T cells showed that wild type but not zinc finger mutant ZFP36L1 protein was able to downregulate a BCL2 construct containing the BCL2 adenine uridine rich element and removal of the adenine uridine rich core from the BCL2 3′ untranslated region in the reporter construct significantly reduced the ability of ZFP36L1 to mediate this effect. Taken together, our data are consistent with ZFP36L1 interacting with and mediating degradation of BCL2 mRNA as an important target through which ZFP36L1 mediates its pro-apoptotic effects in

  18. Overexpression of GsZFP1 enhances salt and drought tolerance in transgenic alfalfa (Medicago sativa L.).


    Tang, Lili; Cai, Hua; Ji, Wei; Luo, Xiao; Wang, Zhenyu; Wu, Jing; Wang, Xuedong; Cui, Lin; Wang, Yang; Zhu, Yanming; Bai, Xi


    GsZFP1 encodes a Cys2/His2-type zinc-finger protein. In our previous study, when GsZFP1 was heterologously expressed in Arabidopsis, the transgenic Arabidopsis plants exhibited enhanced drought and cold tolerance. However, it is still unknown whether GsZFP1 is also involved in salt stress. GsZFP1 is from the wild legume Glycine soja. Therefore, the aims of this study were to further elucidate the functions of the GsZFP1 gene under salt and drought stress in the forage legume alfalfa and to investigate its biochemical and physiological functions under these stress conditions. Our data showed that overexpression of GsZFP1 in alfalfa resulted in enhanced salt tolerance. Under high salinity stress, greater relative membrane permeability and malondialdehyde (MDA) content were observed and more free proline and soluble sugars accumulated in transgenic alfalfa than in the wild-type (WT) plants; in addition, the transgenic lines accumulated less Na(+) and more K(+) in both the shoots and roots. Overexpression of GsZFP1 also enhanced the drought tolerance of alfalfa. The fold-inductions of stress-responsive marker gene expression, including MtCOR47, MtRAB18, MtP5CS, and MtRD2, were greater in transgenic alfalfa than those of WT under drought stress conditions. In conclusion, the transgenic alfalfa plants generated in this study could be used for farming in salt-affected as well as arid and semi-arid areas. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  19. Striking a balance: regulation of transposable elements by Zfp281 and Mll2 in mouse embryonic stem cells

    PubMed Central

    Dai, Qian; Shen, Yang; Wang, Yan; Wang, Xin; Francisco, Joel Celio; Luo, Zhuojuan


    Abstract Transposable elements (TEs) compose about 40% of the murine genome. Retrotransposition of active TEs such as LINE-1 (L1) tremendously impacts genetic diversification and genome stability. Therefore, transcription and transposition activities of retrotransposons are tightly controlled. Here, we show that the Krüppel-like zinc finger protein Zfp281 directly binds and suppresses a subset of retrotransposons, including the active young L1 repeat elements, in mouse embryonic stem (ES) cells. In addition, we find that Zfp281-regulated L1s are highly enriched for 5-hydroxymethylcytosine (5hmC) and H3K4me3. The COMPASS-like H3K4 methyltransferase Mll2 is the major H3K4me3 methylase at the Zfp281-regulated L1s and required for their proper expression. Our studies also reveal that Zfp281 functions partially through recruiting the L1 regulators DNA hydroxymethylase Tet1 and Sin3A, and restricting Mll2 at these active L1s, leading to their balanced expression. In summary, our data indicate an instrumental role of Zfp281 in suppressing the young active L1s in mouse ES cells. PMID:29036642

  20. Differential control of retrovirus silencing in embryonic cells by proteasomal regulation of the ZFP809 retroviral repressor.


    Wang, Cheng; Goff, Stephen P


    Replication of the murine leukemia viruses is strongly suppressed in mouse embryonic stem (ES) cells. Proviral DNAs are formed normally but are then silenced by a large complex bound to DNA by the ES cell-specific zinc-finger protein ZFP809. We show here that ZFP809 expression is not regulated by transcription but rather by protein turnover: ZFP809 protein is stable in embryonic cells but highly unstable in differentiated cells. The protein is heavily modified by the accumulation of polyubiquitin chains in differentiated cells and stabilized by the proteasome inhibitor MG132. A short sequence of amino acids at the C terminus of ZFP809, including a single lysine residue (K391), is required for the rapid turnover of the protein. The silencing cofactor TRIM28 was found to promote the degradation of ZFP809 in differentiated cells. These findings suggest that the stem cell state is established not only by an unusual transcriptional profile but also by unusual regulation of protein levels through the proteasomal degradation pathway.

  1. Striking a balance: regulation of transposable elements by Zfp281 and Mll2 in mouse embryonic stem cells.


    Dai, Qian; Shen, Yang; Wang, Yan; Wang, Xin; Francisco, Joel Celio; Luo, Zhuojuan; Lin, Chengqi


    Transposable elements (TEs) compose about 40% of the murine genome. Retrotransposition of active TEs such as LINE-1 (L1) tremendously impacts genetic diversification and genome stability. Therefore, transcription and transposition activities of retrotransposons are tightly controlled. Here, we show that the Krüppel-like zinc finger protein Zfp281 directly binds and suppresses a subset of retrotransposons, including the active young L1 repeat elements, in mouse embryonic stem (ES) cells. In addition, we find that Zfp281-regulated L1s are highly enriched for 5-hydroxymethylcytosine (5hmC) and H3K4me3. The COMPASS-like H3K4 methyltransferase Mll2 is the major H3K4me3 methylase at the Zfp281-regulated L1s and required for their proper expression. Our studies also reveal that Zfp281 functions partially through recruiting the L1 regulators DNA hydroxymethylase Tet1 and Sin3A, and restricting Mll2 at these active L1s, leading to their balanced expression. In summary, our data indicate an instrumental role of Zfp281 in suppressing the young active L1s in mouse ES cells. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Role for a Zinc Finger Protein (Zfp111) in Transformation of 208F Rat Fibroblasts by Jaagsiekte Sheep Retrovirus Envelope Protein

    PubMed Central

    Hsu, Tom; Phung, An; Choe, Kevin; Kim, Jung Woo


    ABSTRACT The native envelope gene (env) of Jaagsiekte sheep retrovirus (JSRV) also acts as an oncogene. To investigate the mechanism of transformation, we performed yeast 2-hybrid screening for cellular proteins that interact with Env. Among several candidates, we identified mouse or rat zinc finger protein 111 (zfp111). The interaction between Env and Zfp111 was confirmed through in vivo coimmunoprecipitation assays. Knockdown of endogenous Zfp111 caused a decrease in cell transformation by JSRV Env, while overexpression of Zfp111 increased overall Env transformation, supporting a role for Zfp111 in Env transformation. Knockdown of Zfp111 had no effect on the growth rate of parental rat 208F cells, while it decreased the proliferation rate of JSRV-transformed 208F cells, suggesting that JSRV-transformed cells became dependent on Zfp111. In addition, Zfp111 preferentially bound to a higher-mobility form of JSRV Env that has not been described previously. The higher-mobility form of Env (P70env) was found exclusively in the nuclear fraction, and size of its polypeptide backbone was the same as that of the cytoplasmic Env polyprotein (Pr80env). The differences in glycosylation between the two versions of Env were characterized. These results identify a novel cellular protein, Zfp111, that binds to the JSRV Env protein, and this binding plays a role in Env transformation. These results indicate that JSRV transformation also involves proteins and interactions in the nucleus. IMPORTANCE The envelope protein (Env) of Jaagsiekte sheep retrovirus (JSRV) is an oncogene, but its mechanism of cell transformation is still unclear. Here we identified seven candidate cellular proteins that can interact with JSRV Env by yeast two-hybrid screening. This study focused on one of the seven candidates, zinc finger protein 111 (Zfp111). Zfp111 was shown to interact with JSRV Env in cells and to be involved in JSRV transformation. Moreover, coexpression of JSRV Env and Zfp111 led to the

  3. Maintenance of the marginal-zone B cell compartment specifically requires the RNA-binding protein ZFP36L1.


    Newman, Rebecca; Ahlfors, Helena; Saveliev, Alexander; Galloway, Alison; Hodson, Daniel J; Williams, Robert; Besra, Gurdyal S; Cook, Charlotte N; Cunningham, Adam F; Bell, Sarah E; Turner, Martin


    RNA-binding proteins of the ZFP36 family are best known for inhibiting the expression of cytokines through binding to AU-rich elements in the 3' untranslated region and promoting mRNA decay. Here we identified an indispensable role for ZFP36L1 as the regulator of a post-transcriptional hub that determined the identity of marginal-zone B cells by promoting their proper localization and survival. ZFP36L1 controlled a gene-expression program related to signaling, cell adhesion and locomotion; it achieved this in part by limiting expression of the transcription factors KLF2 and IRF8, which are known to enforce the follicular B cell phenotype. These mechanisms emphasize the importance of integrating transcriptional and post-transcriptional processes by RNA-binding proteins for maintaining cellular identity among closely related cell types.

  4. Maintenance of the marginal zone B cell compartment specifically requires the RNA-binding protein ZFP36L1

    PubMed Central

    Newman, Rebecca; Ahlfors, Helena; Saveliev, Alexander; Galloway, Alison; Hodson, Daniel J; Williams, Robert; Besra, Gurdyal S.; Cook, Charlotte N; Cunningham, Adam F; Bell, Sarah E; Turner, Martin


    RNA binding proteins (RBP) of the ZFP36 family are best known for inhibiting the expression of cytokines through binding to AU rich elements in the 3’UTR and promoting mRNA decay. Here we show an indispensible role for ZFP36L1 as the regulator of a post-transcriptional hub that determined the identity of marginal zone (MZ) B cells by promoting their proper localization and survival. ZFP36L1 controlled a gene expression program related to signaling, cell-adhesion and locomotion, in part by limiting the expression of the transcription factors KLF2 and IRF8, which are known to enforce the follicular B cell phenotype. These mechanisms emphasize the importance of integrating transcriptional and post-transcriptional processes by RBP for maintaining cellular identity between closely related cell types. PMID:28394372

  5. IL-6 mediates differentiation disorder during spermatogenesis in obesity-associated inflammation by affecting the expression of Zfp637 through the SOCS3/STAT3 pathway.


    Huang, Guizhen; Yuan, Miao; Zhang, Jie; Li, Jun; Gong, Di; Li, Yanyan; Zhang, Jie; Lin, Ping; Huang, Lugang


    Zfp637 is a recently identified zinc finger protein, and its functions remain largely unknown. Here, we innovatively demonstrate the effects of Zfp637 on the differentiation of mouse spermatogonia and on its downstream target gene SOX2 in vitro. Obesity has been recognized as a chronic inflammatory disease that leads to decreased sexual function and sexual development disorders. We observed higher levels of IL-6 in serum and testis homogenates from obese mice compared with control mice. We also demonstrated that high levels of IL-6 inhibited Zfp637 expression, and we elucidated the underlying mechanisms. SOCS3 overexpression and STAT3 phosphorylation inhibitor (AG490) were used to investigate the function of the SOCS3/STAT3 pathway during this process. Our results showed that exposure of mouse spermatogonial cells to high levels of IL-6 inhibited Zfp637 expression by increasing SOCS3 expression and inhibiting the phosphorylation of STAT3, further reducing cellular differentiation. Consistent with the in vitro results, we observed increasing expression levels of SOCS3 and SOX2, but a reduction of Zfp637 expression, in obese mouse testes. In conclusion, Zfp637 plays a crucial role in spermatogenesis by downregulating SOX2 expression, and IL-6 can decrease the expression of Zfp637 through the SOCS3/STAT3 signaling pathway.

  6. TBR2 antagonizes retinoic acid dependent neuronal differentiation by repressing Zfp423 during corticogenesis.


    Massimino, Luca; Flores-Garcia, Lisbeth; Di Stefano, Bruno; Colasante, Gaia; Icoresi-Mazzeo, Cecilia; Zaghi, Mattia; Hamilton, Bruce A; Sessa, Alessandro


    During cerebral cortex development, neural progenitors are required to elaborate a variety of cell differentiation signals to which they are continuously exposed. RA acid is a potent inducer of neuronal differentiation as it was found to influence cortical development. We report herein that TBR2, a transcription factor specific to Intermediate (Basal) Neural Progenitors (INPs), represses activation of the RA responsive element and expression of RA target genes in cell lines. This repressive action on RA signaling was functionally confirmed by the decrease of RA-mediated neuronal differentiation in neural stem cells stably overexpressing TBR2. In vivo mapping of RA activity in the developing cortex indicated that RA activity is detected in radial glial cells and subsequently downregulated in INPs, revealing a fine cell-type specific regulation of its signaling. Thus, TBR2 might be a molecular player in opposing RA signaling in INPs. Interestingly, this negative regulation is achieved at least in part by directly repressing the critical nuclear RA co-factor ZFP423. Indeed, we found ZFP423 to be expressed in the developing cortex and promote RA-dependent neuronal differentiation. These data indicate that TBR2 contributes to suppressing RA signaling in INPs, thereby enabling them to re-enter the cell cycle and delay neuronal differentiation. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Coordination of m6A mRNA methylation and gene transcription by ZFP217 regulates pluripotency and reprogramming

    PubMed Central

    Aguilo, Francesca; Zhang, Fan; Sancho, Ana; Fidalgo, Miguel; Di Cecilia, Serena; Vashisht, Ajay; Lee, Dung-Fang; Chen, Chih-Hung; Rengasamy, Madhumitha; Andino, Blanca; Jahouh, Farid; Roman, Angel; Krig, Sheryl R.; Wang, Rong; Zhang, Weijia; Wohlschlegel, James A.; Wang, Jianlong; Walsh, Martin J.


    SUMMARY Epigenetic and epitranscriptomic networks have important functions in maintaining pluripotency of embryonic stem cells (ESCs) and somatic cell reprogramming. However the mechanisms integrating the actions of these distinct networks are only partially understood. Here, we show that the chromatin-associated zinc finger protein 217 (ZFP217) coordinates epigenetic and epitranscriptomic regulation. ZFP217 interacts with several epigenetic regulators, activates transcription of key pluripotency genes, and modulates N6-methyladenosine (m6A) deposition on their transcripts by sequestering the enzyme m6A methyltransferase-like 3 (METTL3). Consistently, Zfp217 depletion compromises ESC self-renewal and somatic cell reprogramming, globally increases m6A RNA levels, and enhances m6A modification of Nanog, Sox2, Klf4, and c-Myc mRNAs, promoting their degradation. ZFP217 binds its own target gene mRNAs, which are also METTL3-associated, and is enriched at promoters of m6A-modified transcripts. Collectively, these findings shed light on how a transcription factor can tightly couple gene transcription to m6A RNA modification to insure ESC identity. PMID:26526723

  8. MiR-188-5p suppresses gastric cancer cell proliferation and invasion via targeting ZFP91.


    Peng, Yuping; Shen, Xuning; Jiang, Honggang; Chen, Zhiheng; Wu, Jiaming; Zhu, Yi; Zhou, Yuan; Li, Jin


    MicroRNAs (miRNAs) have been demonstrated to be essential regulators in the development and progression of various cancers. The role of miR-188-5p in gastric cancer has not been determined. In this study, we found that the expression of miR-188-5p was downregulated in gastric cancer (GC) tissues compared with adjacent normal tissues. And lowly expressed miR-188-5p was significantly associated with lymph node metastasis and advanced TNM stage. Moreover, overexpression of miR-188-5p significantly inhibited GC cell proliferation, migration and invasion but promoted cellular apoptosis. In mechanism, we identified transcription factor ZFP91 as a target gene of miR-188-5p in GC. We found that miR-188-5p overexpression significantly inhibited the expression of ZFP91 in GC cell lines. And there was an inversely correlation between the expression of miR-188-5p and ZFP91 in GC tissues. What's more, we found that restoration of ZFP91 in miR-188-5poverexpressed MGC-803 and SGC-7901 cells promoted cell proliferation, migration and invasion. Finally, we also showed that overexpression of miR-188-5p inhibited tumor growth in vivo. Taken together, our findings indicated that miR-188-5p serves as a tumor suppressor in human gastric cancer by targeting ZFP91, suggesting that miR-188-5p might be a promising therapeutic target for GC treatment.

  9. The use of ZFP lossy floating point data compression in tornado-resolving thunderstorm simulations

    NASA Astrophysics Data System (ADS)

    Orf, L.


    In the field of atmospheric science, numerical models are used to produce forecasts of weather and climate and serve as virtual laboratories for scientists studying atmospheric phenomena. In both operational and research arenas, atmospheric simulations exploiting modern supercomputing hardware can produce a tremendous amount of data. During model execution, the transfer of floating point data from memory to the file system is often a significant bottleneck where I/O can dominate wallclock time. One way to reduce the I/O footprint is to compress the floating point data, which reduces amount of data saved to the file system. In this presentation we introduce LOFS, a file system developed specifically for use in three-dimensional numerical weather models that are run on massively parallel supercomputers. LOFS utilizes the core (in-memory buffered) HDF5 driver and includes compression options including ZFP, a lossy floating point data compression algorithm. ZFP offers several mechanisms for specifying the amount of lossy compression to be applied to floating point data, including the ability to specify the maximum absolute error allowed in each compressed 3D array. We explore different maximum error tolerances in a tornado-resolving supercell thunderstorm simulation for model variables including cloud and precipitation, temperature, wind velocity and vorticity magnitude. We find that average compression ratios exceeding 20:1 in scientifically interesting regions of the simulation domain produce visually identical results to uncompressed data in visualizations and plots. Since LOFS splits the model domain across many files, compression ratios for a given error tolerance can be compared across different locations within the model domain. We find that regions of high spatial variability (which tend to be where scientifically interesting things are occurring) show the lowest compression ratios, whereas regions of the domain with little spatial variability compress

  10. ZFP580, a Novel Zinc-Finger Transcription Factor, Is Involved in Cardioprotection of Intermittent High-Altitude Hypoxia against Myocardial Ischemia-Reperfusion Injury

    PubMed Central

    Zhang, Wen-cheng; Wang, Tian-hui; Mai, Xia; Liu, Hong-tao; Xu, Rui-cheng


    Background ZFP580 is a novel C2H2 type zinc-finger transcription factor recently identified by our laboratory. We previously showed that ZFP580 may be involved in cell survival and growth. The aim of this study was to elucidate whether ZFP580 is involved in the cardioprotective effects of intermittent high-altitude (IHA) hypoxia against myocardial ischemia-reperfusion (I/R) injury. Methods and Results After rats were subjected to myocardial ischemia for 30 min followed by reperfusion, ZFP580 expression in the left ventricle was measured. ZFP580 protein expression was found to be up-regulated within 1 h and decreased at 2 h after reperfusion. Comparing normoxic and IHA hypoxia-adapted rats (5000 m, 6 h day−1, 6 weeks) following I/R injury (30 min ischemia and 2 h reperfusion), we found that adaptation to IHA hypoxia attenuated infarct size and plasma leakage of lactate dehydrogenase and creatine kinase-MB. In addition, ZFP580 expression in the myocardium was up-regulated by IHA hypoxia. Consistent with this result, ZFP580 expression was found to be significantly increased in cultured H9c2 myocardial cells in the hypoxic preconditioning group compared with those in the control group following simulated I/R injury (3 h simulated ischemic hypoxia and 2 h reoxygenation). To determine the role of ZFP580 in apoptosis, lentivirus-mediated gene transfection was performed in H9c2 cells 72 h prior to simulated I/R exposure. The results showed that ZFP580 overexpression significantly inhibited I/R-induced apoptosis and caspase-3 activation. H9c2 cells were pretreated with or without PD98059, an inhibitor of ERK1/2 phosphorylation, and Western blot results showed that PD98059 (10 µM) markedly suppressed I/R-induced up-regulation of ZFP580 expression. Conclusions Our findings demonstrate that the cardioprotective effect of IHA hypoxia against I/R injury is mediated via ZFP580, a downstream target of ERK1/2 signaling with anti-apoptotic roles in myocardial cells. PMID:24722354

  11. Genome-wide DNA methylation analysis of transient neonatal diabetes type 1 patients with mutations in ZFP57.


    Bak, Mads; Boonen, Susanne E; Dahl, Christina; Hahnemann, Johanne M D; Mackay, Deborah J D G; Tümer, Zeynep; Grønskov, Karen; Temple, I Karen; Guldberg, Per; Tommerup, Niels


    Transient neonatal diabetes mellitus 1 (TNDM1) is a rare imprinting disorder characterized by intrautering growth retardation and diabetes mellitus usually presenting within the first six weeks of life and resolves by the age of 18 months. However, patients have an increased risk of developing diabetes mellitus type 2 later in life. Transient neonatal diabetes mellitus 1 is caused by overexpression of the maternally imprinted genes PLAGL1 and HYMAI on chromosome 6q24. One of the mechanisms leading to overexpression of the locus is hypomethylation of the maternal allele of PLAGL1 and HYMAI. A subset of patients with maternal hypomethylation at PLAGL1 have hypomethylation at additional imprinted loci throughout the genome, including GRB10, ZIM2 (PEG3), MEST (PEG1), KCNQ1OT1 and NESPAS (GNAS-AS1). About half of the TNDM1 patients carry mutations in ZFP57, a transcription factor involved in establishment and maintenance of methylation of imprinted loci. Our objective was to investigate whether additional regions are aberrantly methylated in ZFP57 mutation carriers. Genome-wide DNA methylation analysis was performed on four individuals with homozygous or compound heterozygous ZFP57 mutations, three relatives with heterozygous ZFP57 mutations and five controls. Methylation status of selected regions showing aberrant methylation in the patients was verified using bisulfite-sequencing. We found large variability among the patients concerning the number and identity of the differentially methylated regions, but more than 60 regions were aberrantly methylated in two or more patients and a novel region within PPP1R13L was found to be hypomethylated in all the patients. The hypomethylated regions in common between the patients are enriched for the ZFP57 DNA binding motif. We have expanded the epimutational spectrum of TNDM1 associated with ZFP57 mutations and found one novel region within PPP1R13L which is hypomethylated in all TNDM1 patients included in this study. Functional

  12. The role of ZFP580, a novel zinc finger protein, in TGF-mediated cytoprotection against chemical hypoxia-induced apoptosis in H9c2 cardiac myocytes

    PubMed Central

    Mao, Shi-Yun; Meng, Xiang-Yan; Xu, Zhong-Wei; Zhang, Wen-Cheng; Jin, Xiao-Han; Chen, Xi; Zhou, Xin; Li, Yu-Ming; Xu, Rui-Cheng


    Zing finger protein 580 (ZFP580) is a novel Cys2-His2 zinc-finger transcription factor that has an anti-apoptotic role in myocardial cells. It is involved in the endothelial transforming growth factor-β1 (TGF-β1) signal transduction pathway as a mothers against decapentaplegic homolog (Smad)2 binding partner. The aim of the present study was to determine the involvement of ZFP580 in TGF-β1-mediated cytoprotection against chemical hypoxia-induced apoptosis, using H9c2 cardiac myocytes. Hypoxia was chemically induced in H9c2 myocardial cells by exposure to cobalt chloride (CoCl2). In response to hypoxia, cell viability was decreased, whereas the expression levels of hypoxia inducible factor-1α and ZFP580 were increased. Pretreatment with TGF-β1 attenuated CoCl2-induced cell apoptosis and upregulated ZFP580 protein expression; however, these effects could be suppressed by SB431542, an inhibitor of TGF-β type I receptor and Smad2/3 phosphorylation. Furthermore, suppression of ZFP580 expression by RNA interference reduced the anti-apoptotic effects of TGF-β1 and thus increased CoCl2-induced apoptosis. B-cell lymphoma (Bcl)-2-associated X protein/Bcl-2 ratio, reactive oxygen species generation and caspase-3 activation were also increased following ZFP580 inactivation. In conclusion, these results indicate that ZFP580 is a component of the TGF-β1/Smad signaling pathway, and is involved in the protective effects of TGF-β1 against chemical hypoxia-induced cell apoptosis, through inhibition of the mitochondrial apoptotic pathway. PMID:28259939

  13. Expression of endogenous retroviruses is negatively regulated by the pluripotency marker Rex1/Zfp42

    PubMed Central

    Guallar, D.; Pérez-Palacios, R.; Climent, M.; Martínez-Abadía, I.; Larraga, A.; Fernández-Juan, M.; Vallejo, C.; Muniesa, P.; Schoorlemmer, J.


    Rex1/Zfp42 is a Yy1-related zinc-finger protein whose expression is frequently used to identify pluripotent stem cells. We show that depletion of Rex1 levels notably affected self-renewal of mouse embryonic stem (ES) cells in clonal assays, in the absence of evident differences in expression of marker genes for pluripotency or differentiation. By contrast, marked differences in expression of several endogenous retroviral elements (ERVs) were evident upon Rex1 depletion. We demonstrate association of REX1 to specific elements in chromatin-immunoprecipitation assays, most strongly to muERV-L and to a lower extent to IAP and musD elements. Rex1 regulates muERV-L expression in vivo, as we show altered levels upon transient gain-and-loss of Rex1 function in pre-implantation embryos. We also find REX1 can associate with the lysine-demethylase LSD1/KDM1A, suggesting they act in concert. Similar to REX1 binding to retrotransposable elements (REs) in ES cells, we also detected binding of the REX1 related proteins YY1 and YY2 to REs, although the binding preferences of the two proteins were slightly different. Altogether, we show that Rex1 regulates ERV expression in mouse ES cells and during pre-implantation development and suggest that Rex1 and its relatives have evolved as regulators of endogenous retroviral transcription. PMID:22844087

  14. Over-expression of StZFP2 in Solanum tuberosum L. var. Kennebec (potato) inhibits growth of tobacco hornworm larvae (THW, Manduca sexta L.)

    USDA-ARS?s Scientific Manuscript database

    Tobacco hornworm (Manduca sexta, THW) is a voracious pest of Solanaceous plants such as tomato and potato. Finding new approaches to enhance protection against this pest in potato has led to investigating transcription factors (TF) that are induced upon insect infestation. StZFP2 is a Q-type C2H2 z...

  15. zFP538, a yellow fluorescent protein from coral, belongs to the DsRed subfamily of GFP-like proteins but possesses the unexpected site of fragmentation.


    Zagranichny, Vasily E; Rudenko, Natalia V; Gorokhovatsky, Andrey Yu; Zakharov, Mikhail V; Shenkarev, Zakhar O; Balashova, Tamara A; Arseniev, Alexander S


    The yellow fluorescent protein (zFP538) from coral Zoanthus sp. belongs to a family of green fluorescent protein (GFP). Absorption and emission spectra of zFP538 show an intermediate bathochromic shift as compared with a number of recently cloned GFP-like red fluorescent and nonfluorescent chromoproteins of the DsRed subfamily. Here we report that the zFP538 chromophore is very close, if not identical, in chemical structure to that of DsRed. To gain insight into the mechanism of zFP538 fluorescence and chromophore structure and chemistry, we studied three chromophore-containing peptides isolated from enzymatic digests of zFP538. Like GFP and DsRed chromophores, these contain a p-hydroxybenzylideneimidazolinone moiety formed by Lys-66, Tyr-67, and Gly-68 of zFP538. One of the peptides studied, the hexapeptide FKYGDR derivative, is a proteolysis product of the zFP538 full-length polypeptide containing a GFP-type chromophore already formed and arrested at an earlier stage of maturation. The two other peptides are the derivatives of the pentapeptide KYGDR resulted from the protein in which the chromophore maturation process had been completed. One of these has an oxogroup at Lys-66 C(alpha) and is a hydrolysis product of another one, with the imino group at Lys-66 C(alpha). The N-unsubstituted imino moiety of the latter is generated by spontaneous polypeptide chain fragmentation at a very unexpected site, the former peptide bond between Phe-65 C' and Lys-66 N(alpha). Also observed in the entire protein under mild denaturing conditions, this fragmentation is likely the feature of native zFP538 chromophore that distinguishes it chemically from the DsRed chromophore.

  16. Multifunctional Involvement of a C2H2 Zinc Finger Protein (PbZfp) in Malaria Transmission, Histone Modification, and Susceptibility to DNA Damage Response

    PubMed Central

    Gopalakrishnan, Anusha M.; Aly, Ahmed S. I.; Aravind, L.


    ABSTRACT In sexually reproducing organisms, meiosis is an essential step responsible for generation of haploid gametes from diploid somatic cells. The quest for understanding regulatory mechanisms of meiotic recombination in Plasmodium led to identification of a gene encoding a protein that contains 11 copies of C2H2 zinc fingers (ZnF). Reverse genetic approaches were used to create Plasmodium berghei parasites either lacking expression of full-length Plasmodium berghei zinc finger protein (PbZfp) (knockout [KO]) or expressing PbZfp lacking C-terminal zinc finger region (truncated [Trunc]). Mice infected with KO parasites survived two times longer (P < 0.0001) than mice infected with wild-type (WT) parasites. In mosquito transmission experiments, the infectivity of KO and Trunc parasites was severely compromised (>95% oocyst reduction). KO parasites revealed a total lack of trimethylation of histone 3 at several lysine residues (K4, K27, and K36) without any effect on acetylation patterns (H3K9, H3K14, and H4K16). Reduced DNA damage and reduced expression of topoisomerase-like Spo11 in the KO parasites with normal Rad51 expression further suggest a functional role for PbZfp during genetic recombination that involves DNA double-strand break (DSB) formation followed by DNA repair. These finding raise the possibility of some convergent similarities of PbZfp functions to functions of mammalian PRDM9, also a C2H2 ZnF protein with histone 3 lysine 4 (H3K4) methyltransferase activity. These functions include the major role played by the latter in binding recombination hotspots in the genome during meiosis and trimethylation of the associated histones and subsequent chromatin recruitment of topoisomerase-like Spo11 to catalyze DNA DSB formation and DMC1/Rad51-mediated DNA repair and homologous recombination. PMID:28851851

  17. Jr-ZFP2, encoding a Cys2/His2-type transcription factor, is involved in the early stages of the mechano-perception pathway and specifically expressed in mechanically stimulated tissues in woody plants.


    Leblanc-Fournier, Nathalie; Coutand, Catherine; Crouzet, Jerome; Brunel, Nicole; Lenne, Catherine; Moulia, Bruno; Julien, Jean-Louis


    Plants respond to environmental mechanical stimulation, such as wind, by modifying their growth and development. To study the molecular effects of stem bending on 3-week-old walnut trees, a cDNA-AFLP approach was developed. This study allowed the identification of a cDNA, known as Jr-ZFP2, encoding a Cys2/His2-type two-zinc-fingered transcription factor. Reverse transcriptase-polymerase chain reaction analysis confirmed that Jr-ZFP2 mRNA accumulation is rapidly and transiently induced after mechanical stimulation. After bending, Jr-ZFP2 transcript increase was restricted to the stem, the organ where the mechanical solicitation was applied. Furthermore, other abiotic factors, such as cold or salt, did not modify Jr-ZFP2 mRNA accumulation in walnut stems under our experimental conditions, whereas growth studies demonstrated that salt stress was actually perceived by the plants. These results suggest that the regulation of Jr-ZFP2 expression is more sensitive to mechanical stimulus. This gene will be a good marker for studying the early stages of mechanical perception in woody plants.

  18. Comparative analysis of chimeric ZFP-, TALE- and Cas9-piggyBac transposases for integration into a single locus in human cells.


    Luo, Wentian; Galvan, Daniel L; Woodard, Lauren E; Dorset, Dan; Levy, Shawn; Wilson, Matthew H


    Integrating DNA delivery systems hold promise for many applications including treatment of diseases; however, targeted integration is needed for improved safety. The piggyBac (PB) transposon system is a highly active non-viral gene delivery system capable of integrating defined DNA segments into host chromosomes without requiring homologous recombination. We systematically compared four different engineered zinc finger proteins (ZFP), four transcription activator-like effector proteins (TALE), CRISPR associated protein 9 (SpCas9) and the catalytically inactive dSpCas9 protein fused to the amino-terminus of the transposase enzyme designed to target the hypoxanthine phosphoribosyltransferase (HPRT) gene located on human chromosome X. Chimeric transposases were evaluated for expression, transposition activity, chromatin immunoprecipitation at the target loci, and targeted knockout of the HPRT gene in human cells. One ZFP-PB and one TALE-PB chimera demonstrated notable HPRT gene targeting. In contrast, Cas9/dCas9-PB chimeras did not result in gene targeting. Instead, the HPRT locus appeared to be protected from transposon integration. Supplied separately, PB permitted highly efficient isolation of Cas9-mediated knockout of HPRT, with zero transposon integrations in HPRT by deep sequencing. In summary, these tools may allow isolation of 'targeted-only' cells, be utilized to protect a genomic locus from transposon integration, and enrich for Cas9-mutated cells. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  19. Regulation of trichome development in tobacco by JcZFP8, a C2H2 zinc finger protein gene from Jatropha curcas L.


    Shi, Xiaodong; Gu, Yuxi; Dai, Tingwei; Wu, Yang; Wu, Peng; Xu, Ying; Chen, Fang


    Trichomes are epidermal outgrowths of plant tissues that can secrete or store large quantities of secondary metabolites, which contribute to plant defense responses against stress. The use of bioengineering methods for regulating the development of trichomes and metabolism is a widely researched topic. In the present study, we demonstrate that JcZFP8, a C2H2 zinc finger protein gene from Jatropha curcas L., can regulate trichome development in transgenic tobacco. To understand the underlying mechanisms, we performed transcriptome profiling of overexpression JcZFP8 transgenic plants and wild-type tobacco. Based on the analysis of differentially expressed genes, we determined that genes of the plant hormone signal transduction pathway was significantly enriched, suggesting that these pathways were modulated in the transgenic plants. In addition, the transcript levels of the known trichome-related genes in Arabidopsis were not significantly changed, whereas CycB2 and MYB genes were differentially expressed in the transgenic plants. Despite tobacco and Arabidopsis have different types of trichomes, all the pathways were associated with C2H2 zinc finger protein genes. Our findings help us to understand the regulation of multicellular trichome formation and suggest a new metabolic engineering method for the improvement of plants. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Transcriptional activation of the suppressor of cytokine signaling-3 (SOCS-3) gene via STAT3 is increased in F9 REX1 (ZFP-42) knockout teratocarcinoma stem cells relative to wild-type cells.


    Xu, Juliana; Sylvester, Renia; Tighe, Ann P; Chen, Siming; Gudas, Lorraine J


    Rex1 (Zfp42), first identified as a gene that is transcriptionally repressed by retinoic acid (RA), encodes a zinc finger transcription factor expressed at high levels in F9 teratocarcinoma stem cells, embryonic stem cells, and other stem cells. Loss of both alleles of Rex1 by homologous recombination alters the RA-induced differentiation of F9 cells, a model of pluripotent embryonic stem cells. We identified Suppressor of Cytokine Signaling-3 (SOCS-3) as a gene that exhibits greatly increased transcriptional activation in RA, cAMP, and theophylline (RACT)-treated F9 Rex1(-/-) cells (approximately 25-fold) as compared to wild-type (WT) cells ( approximately 2.5-fold). By promoter deletion, mutation, and transient transfection analyses, we have shown that this transcriptional increase is mediated by the STAT3 DNA-binding elements located between -99 to -60 in the SOCS-3 promoter. Overexpression of STAT3 dominant-negative mutants greatly diminishes this SOCS-3 transcriptional increase in F9 Rex1(-/-) cells. This increase in SOCS-3 transcription is associated with a four- to fivefold higher level of tyrosine-phosphorylated STAT3 in the RACT-treated F9 Rex1(-/-) cells as compared to WT. Dominant-negative Src tyrosine kinase, Jak2, and protein kinase A partially reduce the transcriptional activation of the SOCS 3 gene in RACT-treated F9 Rex1 null cells. In contrast, parathyroid hormone peptide enhances the effect of RA in F9 Rex1(-/-) cells, but not in F9 WT. Thus, Rex1, which is highly expressed in stem cells, inhibits signaling via the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway, thereby modulating the differentiation of F9 cells.

  1. Non-Destructive Impermeability Testing of Land-Based Sewage Systems (zerstoerungsfreie dichtheitspruefung con grundstuecksentwaesserungsleitungen)

    DTIC Science & Technology


    CYberdeckungsh6he zunehmen. Ffr die Stabilitdt des Str ~mungszustandes ist dagegen ein weniger empfindlicher Ansaugstutzen von Vorteil, weil geringe Schwankungen im...Gerinnestr() mung mit einem Laser-Doppler- Anemometer und einem Pitot-Rohr Ltd. BD Dipl.-Ing. B. Ftirmaier M6glichkeiten der Verwertung von HausmUll und...GrundstticksentwAsserungsleitungen ISBN 3-486-26517-2 * diese Hefte k6nnen beim Oldenbourg Industrieverlag GmbH, Rosenheimer Str . 145, 81671 MUnchen bezogen werden (Preis pro Heft: 35,00 DM, Stand 2001)

  2. An A20/AN1-type zinc finger protein modulates gibberellins and abscisic acid contents and increases sensitivity to abiotic stress in rice (Oryza sativa).


    Zhang, Ye; Lan, Hongxia; Shao, Qiaolin; Wang, Ruqin; Chen, Hui; Tang, Haijuan; Zhang, Hongsheng; Huang, Ji


    The plant hormones gibberellins (GA) and abscisic acid (ABA) play important roles in plant development and stress responses. Here we report a novel A20/AN1-type zinc finger protein ZFP185 involved in GA and ABA signaling in the regulation of growth and stress response. ZFP185 was constitutively expressed in various rice tissues. Overexpression of ZFP185 in rice results in a semi-dwarfism phenotype, reduced cell size, and the decrease of endogenous GA3 content. By contrast, higher GA3 content was observed in RNAi plants. The application of exogenous GA3 can fully rescue the semi-dwarfism phenotype of ZFP185 overexpressing plants, suggesting the negative role of ZFP185 in GA biosynthesis. Besides GA, overexpression of ZFP185 decreased ABA content and expression of several ABA biosynthesis-related genes. Moreover, it was found that ZFP185, unlike previously known A20/AN1-type zinc finger genes, increases sensitivity to drought, cold, and salt stresses, implying the negative role of ZFP185 in stress tolerance. ZFP185 was localized in the cytoplasm and lacked transcriptional activation potential. Our study suggests that ZFP185 regulates plant growth and stress responses by affecting GA and ABA biosynthesis in rice. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email:

  3. Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

    SciTech Connect

    Ichida, Yu, E-mail:; Utsunomiya, Yuko; Onodera, Masafumi


    Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remainsmore » unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.« less

  4. A novel germ cell-specific protein, SHIP1, forms a complex with chromatin remodeling activity during spermatogenesis.


    Choi, Eunyoung; Han, Cecil; Park, Inju; Lee, Boyeon; Jin, Sora; Choi, Heejin; Kim, Do Han; Park, Zee Yong; Eddy, Edward M; Cho, Chunghee


    To determine the mechanisms of spermatogenesis, it is essential to identify and characterize germ cell-specific genes. Here we describe a protein encoded by a novel germ cell-specific gene, Mm.290718/ZFP541, identified from the mouse spermatocyte UniGene library. The protein contains specific motifs and domains potentially involved in DNA binding and chromatin reorganization. An antibody against Mm.290718/ZFP541 revealed the existence of the protein in testicular spermatogenic cells (159 kDa) but not testicular and mature sperm. Immunostaining analysis of cells at various stages of spermatogenesis consistently showed that the protein is present in spermatocytes and round spermatids only. Transfection assays and immunofluorescence studies indicate that the protein is localized specifically in the nucleus. Proteomic analyses performed to explore the functional characteristics of Mm.290718/ZFP541 showed that the protein forms a unique complex. Other major components of the complex included histone deacetylase 1 (HDAC1) and heat-shock protein A2. Disappearance of Mm.290718/ZFP541 was highly correlated with hyperacetylation in spermatids during spermatogenesis, and specific domains of the protein were involved in the regulation of interactions and nuclear localization of HDAC1. Furthermore, we found that premature hyperacetylation, induced by an HDAC inhibitor, is associated with an alteration in the integrity of Mm.290718/ZFP541 in spermatogenic cells. Our results collectively suggest that the Mm.290718/ZFP541 complex is implicated in chromatin remodeling during spermatogenesis, and we provide further information on the previously unknown molecular mechanism. Consequently, we re-designate Mm.290718/ZFP541 as "SHIP1" representing spermatogenic cell HDAC-interacting protein 1.

  5. Interactome analysis reveals ZNF804A, a schizophrenia risk gene, as a novel component of protein translational machinery critical for embryonic neurodevelopment

    PubMed Central

    Zhou, Y; Dong, F; Lanz, T A; Reinhart, V; Li, M; Liu, L; Zou, J; Xi, H S; Mao, Y


    Recent genome-wide association studies identified over 100 genetic loci that significantly associate with schizophrenia (SZ). A top candidate gene, ZNF804A, was robustly replicated in different populations. However, its neural functions are largely unknown. Here we show in mouse that ZFP804A, the homolog of ZNF804A, is required for normal progenitor proliferation and neuronal migration. Using a yeast two-hybrid genome-wide screen, we identified novel interacting proteins of ZNF804A. Rather than transcriptional factors, genes involved in mRNA translation are highly represented in our interactome result. ZNF804A co-fractionates with translational machinery and modulates the translational efficiency as well as the mTOR pathway. The ribosomal protein RPSA interacts with ZNF804A and rescues the migration and translational defects caused by ZNF804A knockdown. RNA immunoprecipitation–RNAseq (RIP-Seq) identified transcripts bound to ZFP804A. Consistently, ZFP804A associates with many short transcripts involved in translational and mitochondrial regulation. Moreover, among the transcripts associated with ZFP804A, a SZ risk gene, neurogranin (NRGN), is one of ZFP804A targets. Interestingly, downregulation of ZFP804A decreases NRGN expression and overexpression of NRGN can ameliorate ZFP804A-mediated migration defect. To verify the downstream targets of ZNF804A, a Duolink in situ interaction assay confirmed genes from our RIP-Seq data as the ZNF804A targets. Thus, our work uncovered a novel mechanistic link of a SZ risk gene to neurodevelopment and translational control. The interactome-driven approach here is an effective way for translating genome-wide association findings into novel biological insights of human diseases. PMID:28924186

  6. Genetic Polymorphisms in RNA Binding Proteins Contribute to Breast Cancer Survival

    PubMed Central

    Upadhyay, Rohit; Sanduja, Sandhya; Kaza, Vimala; Dixon, Dan A.


    The RNA-binding proteins TTP and HuR control expression of numerous genes associated with breast cancer pathogenesis by regulating mRNA stability. However, the role of genetic variation in TTP (ZFP36) and HuR (ELAVL1) genes is unknown in breast cancer prognosis. A total of 251 breast cancer patients (170 Caucasians and 81 African-Americans) were enrolled and followed-up from 2001 to 2011 (or until death). Genotyping was performed for 10 SNPs in ZFP36 and 7 in ELAVL1 genes. On comparing both races with one another, significant differences were found for clinical and genetic variables. The influence of genetic polymorphisms on survival was analyzed by using Cox-regression, Kaplan-Meier analysis, and the log-rank test. Univariate (Kaplan-Meier/Cox-regression) and multivariate (Cox-regression) analysis showed that the TTP gene polymorphism ZFP36*2 A>G was significantly associated with poor prognosis of Caucasian patients (HR = 2.03; 95% CI = 1.09–3.76; P = 0.025; log-rank P = 0.022). None of the haplotypes, but presence of more than six risk genotypes in Caucasian patients, was significantly associated with poor prognosis (HR=2.42; 95% CI=1.17–4.99; P = 0.017; log-rank P = 0.007). The effect of ZFP36*2 A>G on gene expression was evaluated from patients' tissue samples. Both TTP mRNA and protein expression was significantly decreased in ZFP36*2 G allele carriers compared to A allele homozygotes. Conversely, upregulation of the TTP-target gene COX-2 was observed ZFP36*2 G allele carriers. Through its ability to attenuate TTP gene expression, the ZFP36*2 A>G gene polymorphism has appeared as a novel prognostic breast cancer marker in Caucasian patients. PMID:22907529

  7. Zinc-finger protein-targeted gene regulation: Genomewide single-gene specificity

    PubMed Central

    Tan, Siyuan; Guschin, Dmitry; Davalos, Albert; Lee, Ya-Li; Snowden, Andrew W.; Jouvenot, Yann; Zhang, H. Steven; Howes, Katherine; McNamara, Andrew R.; Lai, Albert; Ullman, Chris; Reynolds, Lindsey; Moore, Michael; Isalan, Mark; Berg, Lutz-Peter; Campos, Bradley; Qi, Hong; Spratt, S. Kaye; Case, Casey C.; Pabo, Carl O.; Campisi, Judith; Gregory, Philip D.


    Zinc-finger protein transcription factors (ZFP TFs) can be designed to control the expression of any desired target gene, and thus provide potential therapeutic tools for the study and treatment of disease. Here we report that a ZFP TF can repress target gene expression with single-gene specificity within the human genome. A ZFP TF repressor that binds an 18-bp recognition sequence within the promoter of the endogenous CHK2 gene gives a >10-fold reduction in CHK2 mRNA and protein. This level of repression was sufficient to generate a functional phenotype, as demonstrated by the loss of DNA damage-induced CHK2-dependent p53 phosphorylation. We determined the specificity of repression by using DNA microarrays and found that the ZFP TF repressed a single gene (CHK2) within the monitored genome in two different cell types. These data demonstrate the utility of ZFP TFs as precise tools for target validation, and highlight their potential as clinical therapeutics. PMID:14514889

  8. A Conserved PHD Finger Protein and Endogenous RNAi Modulate Insulin Signaling in Caenorhabditis elegans

    PubMed Central

    Hoersch, Sebastian; Jensen, Morten B.; Kawli, Trupti; Kennedy, Lisa M.; Chavez, Violeta; Tan, Man-Wah; Lieb, Jason D.; Grishok, Alla


    Insulin signaling has a profound effect on longevity and the oxidative stress resistance of animals. Inhibition of insulin signaling results in the activation of DAF-16/FOXO and SKN-1/Nrf transcription factors and increased animal fitness. By studying the biological functions of the endogenous RNA interference factor RDE-4 and conserved PHD zinc finger protein ZFP-1 (AF10), which regulate overlapping sets of genes in Caenorhabditis elegans, we identified an important role for these factors in the negative modulation of transcription of the insulin/PI3 signaling-dependent kinase PDK-1. Consistently, increased expression of pdk-1 in zfp-1 and rde-4 mutants contributed to their reduced lifespan and sensitivity to oxidative stress and pathogens due to the reduction in the expression of DAF-16 and SKN-1 targets. We found that the function of ZFP-1 in modulating pdk-1 transcription was important for the extended lifespan of the age-1(hx546) reduction-of-function PI3 kinase mutant, since the lifespan of the age-1; zfp-1 double mutant strain was significantly shorter compared to age-1(hx546). We further demonstrate that overexpression of ZFP-1 caused an increased resistance to oxidative stress in a DAF-16–dependent manner. Our findings suggest that epigenetic regulation of key upstream signaling components in signal transduction pathways through chromatin and RNAi may have a large impact on the outcome of signaling and expression of numerous downstream genes. PMID:21980302

  9. A conserved PHD finger protein and endogenous RNAi modulate insulin signaling in Caenorhabditis elegans.


    Mansisidor, Andres R; Cecere, Germano; Hoersch, Sebastian; Jensen, Morten B; Kawli, Trupti; Kennedy, Lisa M; Chavez, Violeta; Tan, Man-Wah; Lieb, Jason D; Grishok, Alla


    Insulin signaling has a profound effect on longevity and the oxidative stress resistance of animals. Inhibition of insulin signaling results in the activation of DAF-16/FOXO and SKN-1/Nrf transcription factors and increased animal fitness. By studying the biological functions of the endogenous RNA interference factor RDE-4 and conserved PHD zinc finger protein ZFP-1 (AF10), which regulate overlapping sets of genes in Caenorhabditis elegans, we identified an important role for these factors in the negative modulation of transcription of the insulin/PI3 signaling-dependent kinase PDK-1. Consistently, increased expression of pdk-1 in zfp-1 and rde-4 mutants contributed to their reduced lifespan and sensitivity to oxidative stress and pathogens due to the reduction in the expression of DAF-16 and SKN-1 targets. We found that the function of ZFP-1 in modulating pdk-1 transcription was important for the extended lifespan of the age-1(hx546) reduction-of-function PI3 kinase mutant, since the lifespan of the age-1; zfp-1 double mutant strain was significantly shorter compared to age-1(hx546). We further demonstrate that overexpression of ZFP-1 caused an increased resistance to oxidative stress in a DAF-16-dependent manner. Our findings suggest that epigenetic regulation of key upstream signaling components in signal transduction pathways through chromatin and RNAi may have a large impact on the outcome of signaling and expression of numerous downstream genes.

  10. DNA Origami Scaffolds as Templates for Functional Tetrameric Kir3 K+ Channels.


    Kurokawa, Tatsuki; Kiyonaka, Shigeki; Nakata, Eiji; Endo, Masayuki; Koyama, Shohei; Mori, Emiko; Tran, Nam Ha; Dinh, Huyen; Suzuki, Yuki; Hidaka, Kumi; Kawata, Masaaki; Sato, Chikara; Sugiyama, Hiroshi; Morii, Takashi; Mori, Yasuo


    In native systems, scaffolding proteins play important roles in assembling proteins into complexes to transduce signals. This concept is yet to be applied to the assembly of functional transmembrane protein complexes in artificial systems. To address this issue, DNA origami has the potential to serve as scaffolds that arrange proteins at specific positions in complexes. Herein, we report that Kir3 K + channel proteins are assembled through zinc-finger protein (ZFP)-adaptors at specific locations on DNA origami scaffolds. Specific binding of the ZFP-fused Kir3 channels and ZFP-based adaptors on DNA origami were confirmed by atomic force microscopy and gel electrophoresis. Furthermore, the DNA origami with ZFP binding sites nearly tripled the K + channel current activity elicited by heterotetrameric Kir3 channels in HEK293T cells. Thus, our method provides a useful template to control the oligomerization states of membrane protein complexes in vitro and in living cells. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.


    Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A


    In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

  12. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans

    PubMed Central

    Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.


    In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934

  13. Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response

    PubMed Central

    Zhang, Xu; Chen, Xiaoli; Liu, Qiuying; Zhang, Shaojie; Hu, Wenqian


    Gene expression is precisely regulated during the inflammatory response to control infection and limit the detrimental effects of inflammation. Here, we profiled global mRNA translation dynamics in the mouse primary macrophage-mediated inflammatory response and identified hundreds of differentially translated mRNAs. These mRNAs’ 3’UTRs have enriched binding motifs for several RNA-binding proteins, which implies extensive translational regulatory networks. We characterized one such protein, Zfp36, as a translation repressor. Using primary macrophages from a Zfp36-V5 epitope tagged knock-in mouse generated by CRISPR/Cas9-mediated genome editing, we found that the endogenous Zfp36 directly interacts with the cytoplasmic poly(A)-binding protein. Importantly, this interaction is required for the translational repression of Zfp36’s target mRNAs in resolving inflammation. Altogether, these results uncovered critical roles of translational regulations in controlling appropriate gene expression during the inflammatory response and revealed a new biologically relevant molecular mechanism of translational repression via modulating the cytoplasmic poly(A)-binding protein. DOI: PMID:28635594

  14. An Atypical Late Embryogenesis Abundant Protein OsLEA5 Plays a Positive Role in ABA-Induced Antioxidant Defense in Oryza sativa L.


    Huang, Liping; Zhang, MengYao; Jia, Jing; Zhao, Xixi; Huang, Xingxiu; Ji, E; Ni, Lan; Jiang, Mingyi


    OsLEA5 acts as a co-regulator of a transcriptional fact ZFP36 to enhance the expression and the activity of ascorbate peroxidase OsAPX1 to regulate seed germination in rice, but it it unknown whether OsLEA5 is also crucial in plant seedlings under stress conditions. To determine this, we generated OsLEA5 overexpression and knockdown rice plants. We found that overexpression of OsLEA5 in rice plants enhanced the tolerance to drought and salt stress; in contrast, an RNA interference (RNAi) mutant of OsLEA5 rice plants was more sensitive to drought and salinity. Further investigation found that various stimuli and ABA could induce OsLEA5 expression, and OsLEA5 acted downstream of ZFP36 to be involved in ABA-induced generation of hydrogen peroxide (H2O2), and the regulation of the expression and the activities of antioxidant defense enzymes in plants leaves, and OsLEA5 contributed to stabilize ZFP36. Additionally, OsLEA5 participates in the accumulation of ABA by up-regulating ABA biosynthesis genes and down-regulating ABA metabolism genes. Moreover, we found that two homologs of OsLEA5 (5C700, short for Os05g0526700; and 5C300, short for Os05g0584300) which were induced by ABA also interacted with ZFP36 separately; interestingly, the nuclear-located 5C700 could also act as a co-activator of ZFP36 to modulate OsAPX1, while 5C300 which was down-regulated by ABA induction acted as an ABA-induced inhibitor of ZFP36 to regulate OsAPX1. Hence, our conclusion is that OsLEA5 participates in the ABA-mediated antioxidant defense to function in drought and salt stress response in rice, and the 5C subgroup of LEAs contribute by acting as co-regulators of the transcription factor ZFP36.

  15. Downregulation of the glucocorticoid-induced leucine zipper (GILZ) promotes vascular inflammation.


    Hahn, Rebecca T; Hoppstädter, Jessica; Hirschfelder, Kerstin; Hachenthal, Nina; Diesel, Britta; Kessler, Sonja M; Huwer, Hanno; Kiemer, Alexandra K


    Glucocorticoid-induced leucine zipper (GILZ) represents an anti-inflammatory mediator, whose downregulation has been described in various inflammatory processes. Aim of our study was to decipher the regulation of GILZ in vascular inflammation. Degenerated aortocoronary saphenous vein bypass grafts (n = 15), which exhibited inflammatory cell activation as determined by enhanced monocyte chemoattractrant protein 1 (MCP-1, CCL2) and Toll-like receptor 2 (TLR2) expression, showed significantly diminished GILZ protein and mRNA levels compared to healthy veins (n = 23). GILZ was also downregulated in human umbilical vein endothelial cells (HUVEC) and macrophages upon treatment with the inflammatory cytokine TNF-α in a tristetraprolin (ZFP36, TTP)- and p38 MAPK-dependent manner. To assess the functional implications of decreased GILZ expression, we determined NF-κB activation after GILZ knockdown by siRNA and found that NF-κB activity and inflammatory gene expression were significantly enhanced. Importantly, ZFP36 is induced in TNF-α-activated HUVEC as well as in degenerated vein bypasses. When atheroprotective laminar shear stress was employed, GILZ levels in HUVEC increased on mRNA and protein level. Laminar flow also counteracted TNF-α-induced ZFP36 expression and GILZ downregulation. MAP kinase phosphatase 1 (MKP-1, DUSP1), a negative regulator of ZFP36 expression, was distinctly upregulated under laminar shear stress conditions and downregulated in degenerated vein bypasses. Our data show a diminished expression of the anti-inflammatory mediator GILZ in the inflamed vasculature and indicate that GILZ downregulation requires the mRNA binding protein ZFP36. We suggest that reduced GILZ levels play a role in cardiovascular disease. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Anti-inflammatory genes associated with multiple sclerosis: a gene expression study.


    Perga, S; Montarolo, F; Martire, S; Berchialla, P; Malucchi, S; Bertolotto, A


    Multiple sclerosis (MS) is an autoimmune inflammatory disease of the central nervous system caused by a complex interaction between multiple genes and environmental factors. HLA region is the strongest susceptibility locus, but recent huge genome-wide association studies identified new susceptibility genes. Among these, BACH2, PTGER4, RGS1 and ZFP36L1 were highlighted. Here, a gene expression analysis revealed that three of them, namely BACH2, PTGER4 and ZFP36L1, are down-regulated in MS patients' blood cells compared to healthy subjects. Interestingly, all these genes are involved in the immune system regulation with predominant anti-inflammatory role and their reduction could predispose to MS development. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Improvement of acetic acid tolerance of Saccharomyces cerevisiae using a zinc-finger-based artificial transcription factor and identification of novel genes involved in acetic acid tolerance.


    Ma, Cui; Wei, Xiaowen; Sun, Cuihuan; Zhang, Fei; Xu, Jianren; Zhao, Xinqing; Bai, Fengwu


    Acetic acid is present in cellulosic hydrolysate as a potent inhibitor, and the superior acetic acid tolerance of Saccharomyces cerevisiae ensures good cell viability and efficient ethanol production when cellulosic raw materials are used as substrates. In this study, a mutant strain of S. cerevisiae ATCC4126 (Sc4126-M01) with improved acetic acid tolerance was obtained through screening strains transformed with an artificial zinc finger protein transcription factor (ZFP-TF) library. Further analysis indicated that improved acetic acid tolerance was associated with improved catalase (CAT) activity. The ZFP coding sequence associated with the improved phenotype was identified, and real-time RT-PCR analysis revealed that three of the possible genes involved in the enhanced acetic acid tolerance regulated by this ZFP-TF, namely YFL040W, QDR3, and IKS1, showed decreased transcription levels in Sc4126-M01 in the presence of acetic acid, compared to those in the control strain. Sc4126-M01 mutants having QDR3 and IKS1 deletion (ΔQDR3 and ΔIKS1) exhibited higher acetic acid tolerance than the wild-type strain under acetic acid treatment. Glucose consumption rate and ethanol productivity in the presence of 5 g/L acetic acid were improved in the ΔQDR3 mutant compared to the wild-type strain. Our studies demonstrated that the synthetic ZFP-TF library can be used to improve acetic acid tolerance of S. cerevisiae and that the employment of an artificial transcription factor can facilitate the exploration of novel functional genes involved in stress tolerance of S. cerevisiae.

  18. Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.


    Shows, Kathryn H; Shiang, Rita


    Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

  19. Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

    PubMed Central

    Shiang, Rita


    Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

  20. A Method for Estimating Zero-Flow Pressure and Intracranial Pressure

    PubMed Central

    Caren, Marzban; Paul, Raymond Illian; David, Morison; Anne, Moore; Michel, Kliot; Marek, Czosnyka; Pierre, Mourad


    Background It has been hypothesized that critical closing pressure of cerebral circulation, or zero-flow pressure (ZFP), can estimate intracranial pressure (ICP). One ZFP estimation method employs extrapolation of arterial blood pressure versus blood-flow velocity. The aim of this study is to improve ICP predictions. Methods Two revisions are considered: 1) The linear model employed for extrapolation is extended to a nonlinear equation, and 2) the parameters of the model are estimated by an alternative criterion (not least-squares). The method is applied to data on transcranial Doppler measurements of blood-flow velocity, arterial blood pressure, and ICP, from 104 patients suffering from closed traumatic brain injury, sampled across the United States and England. Results The revisions lead to qualitative (e.g., precluding negative ICP) and quantitative improvements in ICP prediction. In going from the original to the revised method, the ±2 standard deviation of error is reduced from 33 to 24 mm Hg; the root-mean-squared error (RMSE) is reduced from 11 to 8.2 mm Hg. The distribution of RMSE is tighter as well; for the revised method the 25th and 75th percentiles are 4.1 and 13.7 mm Hg, respectively, as compared to 5.1 and 18.8 mm Hg for the original method. Conclusions Proposed alterations to a procedure for estimating ZFP lead to more accurate and more precise estimates of ICP, thereby offering improved means of estimating it noninvasively. The quality of the estimates is inadequate for many applications, but further work is proposed which may lead to clinically useful results. PMID:22824923

  1. Impaired preadipocyte differentiation into adipocytes in subcutaneous abdominal adipose of PCOS-like female rhesus monkeys.


    Keller, Erica; Chazenbalk, Gregorio D; Aguilera, Paul; Madrigal, Vanessa; Grogan, Tristan; Elashoff, David; Dumesic, Daniel A; Abbott, David H


    Metabolic characteristics of polycystic ovary syndrome women and polycystic ovary syndrome-like, prenatally androgenized (PA) female monkeys worsen with age, with altered adipogenesis of sc abdominal adipose potentially contributing to age-related adverse effects on metabolism. This study examines whether adipocyte morphology and gene expression in sc abdominal adipose differ between late reproductive-aged PA female rhesus monkeys compared with age-matched controls (C). Subcutaneous abdominal adipose of both groups was obtained for histological imaging and mRNA determination of zinc finger protein 423 (Zfp423) as a marker of adipose stem cell commitment to preadipocytes, and CCAAT/enhancer binding protein (C/EBP)α/peroxisome proliferator-activated receptor (PPAR)δ as well as C/EBPα/PPARγ as respective markers of early- and late-stage differentiation of preadipocytes to adipocytes. In all females combined, serum testosterone (T) levels positively correlated with fasting serum levels of total free fatty acid (r(2) = 0.73, P < .002). PA females had a greater population of small adipocytes vs C (P < .001) in the presence of increased Zfp423 (P < .025 vs C females) and decreased C/EBPα (P < .003, vs C females) mRNA expression. Moreover, Zfp423 mRNA expression positively correlated with circulating total free fatty acid levels during iv glucose tolerance testing (P < .004, r(2) = 0.66), whereas C/EBPα mRNA expression negatively correlated with serum T levels (P < .02, r(2) = 0.43). Gene expression of PPARδ and PPARγ were comparable between groups (P = .723 and P = .18, respectively). Early-to-mid gestational T excess in female rhesus monkeys impairs adult preadipocyte differentiation to adipocytes in sc abdominal adipose and may constrain the ability of this adipose depot to safely store fat with age.

  2. Clinical and Molecular Characterization of Children with Neonatal Diabetes Mellitus at a Tertiary Care Center in Northern India.


    Jain, Vandana; Satapathy, Amit; Yadav, Jaivinder; Sharma, Rajni; Radha, Venkatesan; Mohan, Viswanathan; De Franco, Elisa; Ellard, Sian


    To study the genetic mutations and clinical profile in children with neonatal diabetes mellitus. Genetic evaluation, clinical management and follow-up of infants with neonatal diabetes. Eleven infants were studied of which eight had permanent neonatal diabetes. Median age at presentation was 8 weeks and mean (SD) birth weight was 2.4 (0.5) kg. Pathogenic genetic mutations were identified in 7 (63.6%) children; 3 infants with mutations in KCNJ11 gene and 1 in ABCC8 were switched to oral sulfonylureas; 2 infants had mutations in INS and 1 in ZFP57. Neonatal diabetes mellitus is a heterogeneous disorder. Identification of genetic cause guides clinical management.

  3. The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic leukemia | Office of Cancer Genomics

    Genetic alterations that activate NOTCH1 signaling and T cell transcription factors, coupled with inactivation of the INK4/ARF tumor suppressors, are hallmarks of T-lineage acute lymphoblastic leukemia (T-ALL), but detailed genome-wide sequencing of large T-ALL cohorts has not been carried out. Using integrated genomic analysis of 264 T-ALL cases, we identified 106 putative driver genes, half of which had not previously been described in childhood T-ALL (for example, CCND3, CTCF, MYB, SMARCA4, ZFP36L2 and MYCN).

  4. Identification of genes mediating thyroid hormone action in the developing mouse cerebellum.


    Takahashi, Masaki; Negishi, Takayuki; Tashiro, Tomoko


    Despite the indispensable role thyroid hormone (TH) plays in brain development, only a small number of genes have been identified to be directly regulated by TH and its precise mechanism of action remains largely unknown, partly because most of the previous studies have been carried out at postnatal day 15 or later. In the present study, we screened for TH-responsive genes in the developing mouse cerebellum at postnatal day 4 when morphological alterations because of TH status are not apparent. Among the new candidate genes selected by comparing gene expression profiles of experimentally hypothyroid, hypothyroid with postnatal thyroxine replacement, and control animals using oligoDNA microarrays, six genes were confirmed by real-time PCR to be positively (orc1l, galr3, sort1, nlgn3, cdk5r2, and zfp367) regulated by TH. Among these, sort1, cdk5r2, and zfp367 were up-regulated already at 1 h after a single injection of thyroxine to the hypothyroid or control animal, suggesting them to be possible primary targets of the hormone. Cell proliferation and apoptosis examined by BrdU incorporation and terminal deoxynucleotide transferase-mediated dUTP nick-end labeling assay revealed that hypothyroidism by itself did not enhance apoptosis at this stage, but rather increased cell survival, possibly through regulation of these newly identified genes.

  5. Immunosuppressive potential of bardoxolone methyl using a modified murine local lymph node assay (LLNA).


    Kitsukawa, Mika; Tsuchiyama, Hiromi; Maeda, Akihisa; Oshida, Keiyu; Miyamoto, Yohei


    2-Cyano-3, 12-dioxooleana-1, 9-dien-28-oic acid methyl ester (CDDO-Me; bardoxolone methyl) is one of the synthetic oleanane triterpenoids (SOs). It is known that it is the strongest Nrf2/ARE signaling inducer of SOs and slightly inhibits immune response. Little was known about the immunomodulatory action of CDDO-Me in vivo. We assessed its immunosuppressive potential by using the modified mouse lymph node assay (LLNA) including immunosuppression-related gene expression analysis. In the modified LLNA, CDDO-Me showed a significant decrease in lymph node weight and changes in expressions of the immunosuppression-related genes, Zfp459 and Fmo2. It has been already reported that a decrease in lymph node weight was induced by several types of immunosuppressive chemicals such as calcineurin inhibitors, antimetabolites, steroids, and alkylators. In addition, changes in Zfp459 and Fmo2 expression was reported in response after only treatment of antimetabolites. From these results, CDDO-Me is considered to have an immunosuppressive action and similar mechanism to antimetabolites.

  6. Dietary vitamin A impacts DNA methylation patterns of adipogenesis-related genes in suckling rats.


    Arreguín, A; Ribot, J; Mušinović, H; von Lintig, J; Palou, A; Bonet, M L


    We previously showed that vitamin A supplementation in early life impacts white adipose tissue (WAT) biology. We here studied the vitamin's effects on DNA methylation of genes crucial for WAT cell development, determination and metabolism. CpG promoter methylation and mRNA expression of Pparg, Zfp423, Pcna, and Rbp4 was compared in inguinal WAT of 21-day-old rats supplemented during the suckling period with vehicle (controls) or an emulsion of vitamin A as retinyl ester (RE) or β-carotene (BC). The methylation profile of promoters was affected by vitamin A supplementation with pronounced differences between the RE and BC groups. In the RE group, hypermethylation of the Rbp4 (at multiple CpGs) and the Pparg2 (at a specific CpG) promoters and hypomethylation of the Pcna promoter (at multiple CpGs) was observed, together with inverse changes in gene expression levels. In the BC group, hypomethylation of the Rbp4 and hypermethylation of the Pcna promoter at distinct CpGs was observed, with no effects on gene expression. In both supplemention groups, hypomethylation and increased expression was found for Zfp423. Thus, modest vitamin A supplementation in early postnatal life impacts methylation marks in developing WAT. Differential epigenetic effects of RE and BC in early life may affect adipose tissue programming activity. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Early molecular events during retinoic acid induced differentiation of neuromesodermal progenitors

    PubMed Central

    Cunningham, Thomas J.; Colas, Alexandre


    ABSTRACT Bipotent neuromesodermal progenitors (NMPs) residing in the caudal epiblast drive coordinated body axis extension by generating both posterior neuroectoderm and presomitic mesoderm. Retinoic acid (RA) is required for body axis extension, however the early molecular response to RA signaling is poorly defined, as is its relationship to NMP biology. As endogenous RA is first seen near the time when NMPs appear, we used WNT/FGF agonists to differentiate embryonic stem cells to NMPs which were then treated with a short 2-h pulse of 25 nM RA or 1 µM RA followed by RNA-seq transcriptome analysis. Differential expression analysis of this dataset indicated that treatment with 25 nM RA, but not 1 µM RA, provided physiologically relevant findings. The 25 nM RA dataset yielded a cohort of previously known caudal RA target genes including Fgf8 (repressed) and Sox2 (activated), plus novel early RA signaling targets with nearby conserved RA response elements. Importantly, validation of top-ranked genes in vivo using RA-deficient Raldh2−/− embryos identified novel examples of RA activation (Nkx1-2, Zfp503, Zfp703, Gbx2, Fgf15, Nt5e) or RA repression (Id1) of genes expressed in the NMP niche or progeny. These findings provide evidence for early instructive and permissive roles of RA in controlling differentiation of NMPs to neural and mesodermal lineages. PMID:27793834

  8. Color transitions in coral's fluorescent proteins by site-directed mutagenesis

    PubMed Central

    Gurskaya, Nadya G; Savitsky, Alexander P; Yanushevich, Yurii G; Lukyanov, Sergey A; Lukyanov, Konstantin A


    Background Green Fluorescent Protein (GFP) cloned from jellyfish Aequorea victoria and its homologs from corals Anthozoa have a great practical significance as in vivo markers of gene expression. Also, they are an interesting puzzle of protein science due to an unusual mechanism of chromophore formation and diversity of fluorescent colors. Fluorescent proteins can be subdivided into cyan (~ 485 nm), green (~ 505 nm), yellow (~ 540 nm), and red (>580 nm) emitters. Results Here we applied site-directed mutagenesis in order to investigate the structural background of color variety and possibility of shifting between different types of fluorescence. First, a blue-shifted mutant of cyan amFP486 was generated. Second, it was established that cyan and green emitters can be modified so as to produce an intermediate spectrum of fluorescence. Third, the relationship between green and yellow fluorescence was inspected on closely homologous green zFP506 and yellow zFP538 proteins. The following transitions of colors were performed: yellow to green; yellow to dual color (green and yellow); and green to yellow. Fourth, we generated a mutant of cyan emitter dsFP483 that demonstrated dual color (cyan and red) fluorescence. Conclusions Several amino acid substitutions were found to strongly affect fluorescence maxima. Some positions primarily found by sequence comparison were proved to be crucial for fluorescence of particular color. These results are the first step towards predicting the color of natural GFP-like proteins corresponding to newly identified cDNAs from corals. PMID:11459517

  9. Genome-Wide Survey and Expression Profiling of CCCH-Zinc Finger Family Reveals a Functional Module in Macrophage Activation

    PubMed Central

    Liang, Jian; Song, Wenjun; Tromp, Gail; Kolattukudy, Pappachan E.; Fu, Mingui


    Previously, we have identified a novel CCCH zinc finger protein family as negative regulators of macrophage activation. To gain an overall insight into the entire CCCH zinc finger gene family and to evaluate their potential role in macrophage activation, here we performed a genome-wide survey of CCCH zinc finger genes in mouse and human. Totally 58 CCCH zinc finger genes in mouse and 55 in human were identified and most of them have not been reported previously. Phylogenetic analysis revealed that the mouse CCCH family was divided into 6 groups. Meanwhile, we employed quantitative real-time PCR to profile their tissue expression patterns in adult mice. Clustering analysis showed that most of CCCH genes were broadly expressed in all of tissues examined with various levels. Interestingly, several CCCH genes Mbnl3, Zfp36l2, Zfp36, Zc3h12a, Zc3h12d, Zc3h7a and Leng9 were enriched in macrophage-related organs such as thymus, spleen, lung, intestine and adipose. Consistently, a comprehensive assessment of changes in expression of the 58 members of the mouse CCCH family during macrophage activation also revealed that these CCCH zinc finger genes were associated with the activation of bone marrow-derived macrophages by lipopolysaccharide. Taken together, this study not only identified a functional module of CCCH zinc finger genes in the regulation of macrophage activation but also provided the framework for future studies to dissect the function of this emerging gene family. PMID:18682727

  10. Custom-Designed Molecular Scissors for Site-Specific Manipulation of the Plant and Mammalian Genomes

    NASA Astrophysics Data System (ADS)

    Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan

    Zinc finger nucleases (ZFNs) are custom-designed molecular scissors, engineered to cut at specific DNA sequences. ZFNs combine the zinc finger proteins (ZFPs) with the nonspecific cleavage domain of the FokI restriction enzyme. The DNA-binding specificity of ZFNs can be easily altered experimentally. This easy manipulation of the ZFN recognition specificity enables one to deliver a targeted double-strand break (DSB) to a genome. The targeted DSB stimulates local gene targeting by several orders of magnitude at that specific cut site via homologous recombination (HR). Thus, ZFNs have become an important experimental tool to make site-specific and permanent alterations to genomes of not only plants and mammals but also of many other organisms. Engineering of custom ZFNs involves many steps. The first step is to identify a ZFN site at or near the chosen chromosomal target within the genome to which ZFNs will bind and cut. The second step is to design and/or select various ZFP combinations that will bind to the chosen target site with high specificity and affinity. The DNA coding sequence for the designed ZFPs are then assembled by polymerase chain reaction (PCR) using oligonucleotides. The third step is to fuse the ZFP constructs to the FokI cleavage domain. The ZFNs are then expressed as proteins by using the rabbit reticulocyte in vitro transcription/translation system and the protein products assayed for their DNA cleavage specificity.

  11. Stress-Responsive Mitogen-Activated Protein Kinases Interact with the EAR Motif of a Poplar Zinc Finger Protein and Mediate Its Degradation through the 26S Proteasome1[W][OA

    PubMed Central

    Hamel, Louis-Philippe; Benchabane, Meriem; Nicole, Marie-Claude; Major, Ian T.; Morency, Marie-Josée; Pelletier, Gervais; Beaudoin, Nathalie; Sheen, Jen; Séguin, Armand


    Mitogen-activated protein kinases (MAPKs) contribute to the establishment of plant disease resistance by regulating downstream signaling components, including transcription factors. In this study, we identified MAPK-interacting proteins, and among the newly discovered candidates was a Cys-2/His-2-type zinc finger protein named PtiZFP1. This putative transcription factor belongs to a family of transcriptional repressors that rely on an ERF-associated amphiphilic repression (EAR) motif for their repression activity. Amino acids located within this repression motif were also found to be essential for MAPK binding. Close examination of the primary protein sequence revealed a functional bipartite MAPK docking site that partially overlaps with the EAR motif. Transient expression assays in Arabidopsis (Arabidopsis thaliana) protoplasts suggest that MAPKs promote PtiZFP1 degradation through the 26S proteasome. Since features of the MAPK docking site are conserved among other EAR repressors, our study suggests a novel mode of defense mechanism regulation involving stress-responsive MAPKs and EAR repressors. PMID:21873571

  12. ZifBASE: a database of zinc finger proteins and associated resources.


    Jayakanthan, Mannu; Muthukumaran, Jayaraman; Chandrasekar, Sanniyasi; Chawla, Konika; Punetha, Ankita; Sundar, Durai


    Information on the occurrence of zinc finger protein motifs in genomes is crucial to the developing field of molecular genome engineering. The knowledge of their target DNA-binding sequences is vital to develop chimeric proteins for targeted genome engineering and site-specific gene correction. There is a need to develop a computational resource of zinc finger proteins (ZFP) to identify the potential binding sites and its location, which reduce the time of in vivo task, and overcome the difficulties in selecting the specific type of zinc finger protein and the target site in the DNA sequence. ZifBASE provides an extensive collection of various natural and engineered ZFP. It uses standard names and a genetic and structural classification scheme to present data retrieved from UniProtKB, GenBank, Protein Data Bank, ModBase, Protein Model Portal and the literature. It also incorporates specialized features of ZFP including finger sequences and positions, number of fingers, physiochemical properties, classes, framework, PubMed citations with links to experimental structures (PDB, if available) and modeled structures of natural zinc finger proteins. ZifBASE provides information on zinc finger proteins (both natural and engineered ones), the number of finger units in each of the zinc finger proteins (with multiple fingers), the synergy between the adjacent fingers and their positions. Additionally, it gives the individual finger sequence and their target DNA site to which it binds for better and clear understanding on the interactions of adjacent fingers. The current version of ZifBASE contains 139 entries of which 89 are engineered ZFPs, containing 3-7F totaling to 296 fingers. There are 50 natural zinc finger protein entries ranging from 2-13F, totaling to 307 fingers. It has sequences and structures from literature, Protein Data Bank, ModBase and Protein Model Portal. The interface is cross linked to other public databases like UniprotKB, PDB, ModBase and Protein Model

  13. Cytoplasmic poly (A)-binding protein critically regulates epidermal maintenance and turnover in the planarian Schmidtea mediterranea

    PubMed Central

    Bansal, Dhiru; Kulkarni, Jahnavi; Nadahalli, Kavana; Lakshmanan, Vairavan; Krishna, Srikar; Sasidharan, Vidyanand; Dilipkumar, Shilpa; Gulyani, Akash; Raghavan, Srikala


    Identifying key cellular events that facilitate stem cell function and tissue organization is crucial for understanding the process of regeneration. Planarians are powerful model system to study regeneration and stem cell (neoblast) function. Here, using planaria, we show that the initial events of regeneration, such as epithelialization and epidermal organization are critically regulated by a novel cytoplasmic poly A-binding protein, SMED-PABPC2. Knockdown of smed-pabpc2 leads to defects in epidermal lineage specification, disorganization of epidermis and ECM, and deregulated wound healing, resulting in the selective failure of neoblast proliferation near the wound region. Polysome profiling suggests that epidermal lineage transcripts, including zfp-1, are translationally regulated by SMED-PABPC2. Together, our results uncover a novel role for SMED-PABPC2 in the maintenance of epidermal and ECM integrity, critical for wound healing and subsequent processes for regeneration. PMID:28807897

  14. Modular synthetic inverters from zinc finger proteins and small RNAs


    Hsia, Justin; Holtz, William J.; Maharbiz, Michel M.; ...


    Synthetic zinc finger proteins (ZFPs) can be created to target promoter DNA sequences, repressing transcription. The binding of small RNA (sRNA) to ZFP mRNA creates an ultrasensitive response to generate higher effective Hill coefficients. Here we combined three “off the shelf” ZFPs and three sRNAs to create new modular inverters in E. coli and quantify their behavior using induction fold. We found a general ordering of the effects of the ZFPs and sRNAs on induction fold that mostly held true when combining these parts. We then attempted to construct a ring oscillator using our new inverters. In conclusion, our chosenmore » parts performed insufficiently to create oscillations, but we include future directions for improvement upon our work presented here.« less

  15. Cytoplasmic poly (A)-binding protein critically regulates epidermal maintenance and turnover in the planarian Schmidtea mediterranea.


    Bansal, Dhiru; Kulkarni, Jahnavi; Nadahalli, Kavana; Lakshmanan, Vairavan; Krishna, Srikar; Sasidharan, Vidyanand; Geo, Jini; Dilipkumar, Shilpa; Pasricha, Renu; Gulyani, Akash; Raghavan, Srikala; Palakodeti, Dasaradhi


    Identifying key cellular events that facilitate stem cell function and tissue organization is crucial for understanding the process of regeneration. Planarians are powerful model system to study regeneration and stem cell (neoblast) function. Here, using planaria, we show that the initial events of regeneration, such as epithelialization and epidermal organization are critically regulated by a novel cytoplasmic poly A-binding protein, SMED-PABPC2. Knockdown of smed-pabpc2 leads to defects in epidermal lineage specification, disorganization of epidermis and ECM, and deregulated wound healing, resulting in the selective failure of neoblast proliferation near the wound region. Polysome profiling suggests that epidermal lineage transcripts, including zfp-1 , are translationally regulated by SMED-PABPC2 . Together, our results uncover a novel role for SMED-PABPC2 in the maintenance of epidermal and ECM integrity, critical for wound healing and subsequent processes for regeneration. © 2017. Published by The Company of Biologists Ltd.

  16. Glucocorticoid and cytokine crosstalk: Feedback, feedforward, and co-regulatory interactions determine repression or resistance.


    Newton, Robert; Shah, Suharsh; Altonsy, Mohammed O; Gerber, Antony N


    Inflammatory signals induce feedback and feedforward systems that provide temporal control. Although glucocorticoids can repress inflammatory gene expression, glucocorticoid receptor recruitment increases expression of negative feedback and feedforward regulators, including the phosphatase, DUSP1, the ubiquitin-modifying enzyme, TNFAIP3, or the mRNA-destabilizing protein, ZFP36. Moreover, glucocorticoid receptor cooperativity with factors, including nuclear factor-κB (NF-κB), may enhance regulator expression to promote repression. Conversely, MAPKs, which are inhibited by glucocorticoids, provide feedforward control to limit expression of the transcription factor IRF1, and the chemokine, CXCL10. We propose that modulation of feedback and feedforward control can determine repression or resistance of inflammatory gene expression toglucocorticoid. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Glucocorticoid and cytokine crosstalk: Feedback, feedforward, and co-regulatory interactions determine repression or resistance

    PubMed Central

    Shah, Suharsh; Altonsy, Mohammed O.; Gerber, Antony N.


    Inflammatory signals induce feedback and feedforward systems that provide temporal control. Although glucocorticoids can repress inflammatory gene expression, glucocorticoid receptor recruitment increases expression of negative feedback and feedforward regulators, including the phosphatase, DUSP1, the ubiquitin-modifying enzyme, TNFAIP3, or the mRNA-destabilizing protein, ZFP36. Moreover, glucocorticoid receptor cooperativity with factors, including nuclear factor-κB (NF-κB), may enhance regulator expression to promote repression. Conversely, MAPKs, which are inhibited by glucocorticoids, provide feedforward control to limit expression of the transcription factor IRF1, and the chemokine, CXCL10. We propose that modulation of feedback and feedforward control can determine repression or resistance of inflammatory gene expression toglucocorticoid. PMID:28283576

  18. miR-451 regulates dendritic cell cytokine responses to influenza infection1

    PubMed Central

    Rosenberger, Carrie M.; Podyminogin, Rebecca L.; Navarro, Garnet; Zhao, Guo-Wei; Askovich, Peter S.; Weiss, Mitchell J.; Aderem, Alan


    MicroRNAs are important post-transcriptional regulators in immune cells, but how viral infection regulates microRNA expression to shape dendritic cell responses has not been well characterized. We identified 20 miRNAs that were differentially expressed in primary murine dendritic cells in response to the double-stranded RNA agonist poly(I:C), a subset of which were modestly regulated by influenza infection. miR-451 was unique because it was induced more strongly in primary splenic and lung dendritic cells by live viral infection than by purified agonists of pattern recognition receptors. We determined that miR-451 regulates a subset of pro-inflammatory cytokine responses. Three types of primary dendritic cells treated with anti-sense RNA antagomirs directed against miR-451 secreted elevated levels of IL-6, TNF, CCL5/RANTES, and CCL3/MIP1α, and these results were confirmed using miR-451null cells. miR-451 negatively regulates YWHAZ/14-3-3ζ protein levels in various cell types, and we measured a similar inhibition of YWHAZ levels in dendritic cells. It is known that YWHAZ can control the activity of two negative regulators of cytokine production: FOXO3, which is an inhibitory transcription factor, and ZFP36/Tristetraprolin, which binds to AU-rich elements within 3′-UTRs to destabilize cytokine mRNAs. Inhibition of miR-451 expression correlated with increased YWHAZ protein expression and decreased ZFP36 expression, providing a possible mechanism for the elevated secretion of IL-6, TNF, CCL5/RANTES, and CCL3/MIP1α. miR-451 levels are themselves increased by IL-6 and type I interferon, potentially forming a regulatory loop. These data suggest that viral infection specifically induces a miRNA that directs a negative regulatory cascade to tune dendritic cell cytokine production. PMID:23169590

  19. Microarray‑based screening of differentially expressed genes in glucocorticoid‑induced avascular necrosis.


    Huang, Gangyong; Wei, Yibing; Zhao, Guanglei; Xia, Jun; Wang, Siqun; Wu, Jianguo; Chen, Feiyan; Chen, Jie; Shi, Jingshen


    The underlying mechanisms of glucocorticoid (GC)‑induced avascular necrosis of the femoral head (ANFH) have yet to be fully understood, in particular the mechanisms associated with the change of gene expression pattern. The present study aimed to identify key genes with a differential expression pattern in GC‑induced ANFH. E‑MEXP‑2751 microarray data were downloaded from the ArrayExpress database. Differentially expressed genes (DEGs) were identified in 5 femoral head samples of steroid‑induced ANFH rats compared with 5 placebo‑treated rat samples. Gene Ontology (GO) and pathway enrichment analyses were performed upon these DEGs. A total 93 DEGs (46 upregulated and 47 downregulated genes) were identified in GC‑induced ANFH samples. These DEGs were enriched in different GO terms and pathways, including chondrocyte differentiation and detection of chemical stimuli. The enrichment map revealed that skeletal system development was interconnected with several other GO terms by gene overlap. The literature mined network analysis revealed that 5 upregulated genes were associated with femoral necrosis, including parathyroid hormone receptor 1 (PTHR1), vitamin D (1,25‑Dihydroxyvitamin D3) receptor (VDR), collagen, type II, α1, proprotein convertase subtilisin/kexin type 6 and zinc finger protein 354C (ZFP354C). In addition, ZFP354C and VDR were identified to transcription factors. Furthermore, PTHR1 was revealed to interact with VDR, and α‑2‑macroglobulin (A2M) interacted with fibronectin 1 (FN1) in the PPI network. PTHR1 may be involved in GC‑induced ANFH via interacting with VDR. A2M may also be involved in the development of GC‑induced ANFH through interacting with FN1. An improved understanding of the molecular mechanisms underlying GC‑induced ANFH may provide novel targets for diagnostics and therapeutic treatment.

  20. Microarray-based screening of differentially expressed genes in glucocorticoid-induced avascular necrosis

    PubMed Central

    Huang, Gangyong; Wei, Yibing; Zhao, Guanglei; Xia, Jun; Wang, Siqun; Wu, Jianguo; Chen, Feiyan; Chen, Jie; Shi, Jingshen


    The underlying mechanisms of glucocorticoid (GC)-induced avascular necrosis of the femoral head (ANFH) have yet to be fully understood, in particular the mechanisms associated with the change of gene expression pattern. The present study aimed to identify key genes with a differential expression pattern in GC-induced ANFH. E-MEXP-2751 microarray data were downloaded from the ArrayExpress database. Differentially expressed genes (DEGs) were identified in 5 femoral head samples of steroid-induced ANFH rats compared with 5 placebo-treated rat samples. Gene Ontology (GO) and pathway enrichment analyses were performed upon these DEGs. A total 93 DEGs (46 upregulated and 47 downregulated genes) were identified in GC-induced ANFH samples. These DEGs were enriched in different GO terms and pathways, including chondrocyte differentiation and detection of chemical stimuli. The enrichment map revealed that skeletal system development was interconnected with several other GO terms by gene overlap. The literature mined network analysis revealed that 5 upregulated genes were associated with femoral necrosis, including parathyroid hormone receptor 1 (PTHR1), vitamin D (1,25-Dihydroxyvitamin D3) receptor (VDR), collagen, type II, α1, proprotein convertase subtilisin/kexin type 6 and zinc finger protein 354C (ZFP354C). In addition, ZFP354C and VDR were identified to transcription factors. Furthermore, PTHR1 was revealed to interact with VDR, and α-2-macroglobulin (A2M) interacted with fibronectin 1 (FN1) in the PPI network. PTHR1 may be involved in GC-induced ANFH via interacting with VDR. A2M may also be involved in the development of GC-induced ANFH through interacting with FN1. An improved understanding of the molecular mechanisms underlying GC-induced ANFH may provide novel targets for diagnostics and therapeutic treatment. PMID:28393228

  1. Knockdown of miR-128a induces Lin28a expression and reverts myeloid differentiation blockage in acute myeloid leukemia

    PubMed Central

    De Luca, Luciana; Trino, Stefania; Laurenzana, Ilaria; Tagliaferri, Daniela; Falco, Geppino; Grieco, Vitina; Bianchino, Gabriella; Nozza, Filomena; Campia, Valentina; D'Alessio, Francesca; La Rocca, Francesco; Caivano, Antonella; Villani, Oreste; Cilloni, Daniela; Musto, Pellegrino; Del Vecchio, Luigi


    Lin28A is a highly conserved RNA-binding protein that concurs to control the balance between stemness and differentiation in several tissue lineages. Here, we report the role of miR-128a/Lin28A axis in blocking cell differentiation in acute myeloid leukemia (AML), a genetically heterogeneous disease characterized by abnormally controlled proliferation of myeloid progenitor cells accompanied by partial or total inability to undergo terminal differentiation. First, we found Lin28A underexpressed in blast cells from AML patients and AML cell lines as compared with CD34+ normal precursors. In vitro transfection of Lin28A in NPM1-mutated OCI-AML3 cell line significantly triggered cell-cycle arrest and myeloid differentiation, with increased expression of macrophage associate genes (EGR2, ZFP36 and ANXA1). Furthermore, miR-128a, a negative regulator of Lin28A, was found overexpressed in AML cells compared with normal precursors, especially in acute promyelocytic leukemia (APL) and in ‘AML with maturation’ (according to 2016 WHO classification of myeloid neoplasms and acute leukemia). Its forced overexpression by lentiviral infection in OCI-AML3 downregulated Lin28A with ensuing repression of macrophage-oriented differentiation. Finally, knockdown of miR-128a in OCI-AML3 and in APL/AML leukemic cells (by transfection and lentiviral infection, respectively) induced myeloid cell differentiation and increased expression of Lin28A, EGR2, ZFP36 and ANXA1, reverting myeloid differentiation blockage. In conclusion, our findings revealed a new mechanism for AML differentiation blockage, suggesting new strategies for AML therapy based upon miR-128a inhibition. PMID:28569789

  2. Inflammatory gene changes associated with the repeated-bout effect.


    Hubal, Monica J; Chen, Trevor C; Thompson, Paul D; Clarkson, Priscilla M


    This study proposed that attenuated expression of inflammatory factors is an underlying mechanism driving the repeated-bout effect (rapid adaptation to eccentric exercise). We investigated changes in mRNA levels and protein localization of inflammatory genes after two bouts of muscle-lengthening exercise. Seven male subjects performed two bouts of lower body exercise (separated by 4 wk) in which one leg performed 300 eccentric-concentric actions, and the contralateral leg performed 300 concentric actions only. Vastus lateralis biopsies were collected at 6 h, and strength was assessed at baseline and at 0, 3, and 5 days after exercise. mRNA levels were measured via semiquantitative RT-PCR for the following genes: CYR61, HSP40, HSP70, IL1R1, TCF8, ZFP36, CEBPD, and MCP1. Muscle functional adaptation was demonstrated via attenuated strength loss (16% less, P = 0.04) at 5 days after bout 2 compared with bout 1 in the eccentrically exercised leg. mRNA expression of three of the eight genes tested was significantly elevated in the eccentrically exercised leg from bout 1 to bout 2 (+3.9-fold for ZFP36, +2.3-fold for CEBPD, and +2.6-fold for MCP1), while all eight mRNA levels were unaffected by bout in the concentrically exercised leg. Immunohistochemistry further localized the protein of one of the elevated factors [monocyte chemoattractant protein-1 (MCP1)] within the tissue. MCP1 colocalized with resident macrophage and satellite cell populations, suggesting that alterations in cytokine signaling between these cell populations may play a role in muscle adaptation to exercise. Contrary to our hypothesis, several inflammatory genes were transcriptionally upregulated (rather than attenuated) after a repeated exercise bout, potentially indicating a role for these genes in the adaptation process.

  3. A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in Caenorhabditis elegans

    PubMed Central

    Gysi, Stephan; Rhiner, Christa; Flibotte, Stephane; Moerman, Donald G.; Hengartner, Michael O.


    Heparan sulfate proteoglycans (HSPGs) are proteins with long covalently attached sugar side chains of the heparan sulfate (HS) type. Depending on the cellular context HS chains carry multiple structural modifications such as sulfate residues or epimerized sugars allowing them to bind to a wide range of molecules. HSPGs have been found to play extremely diverse roles in animal development and were shown to interact with certain axon guidance molecules. In this study we describe the role of the Caenorhabditis elegans HSPG core proteins Syndecan (SDN-1) and Glypican (LON-2) and the HS modifying enzymes in the dorsal guidance of D-type motor axons, a process controlled mainly by the conserved axon guidance molecule UNC-6/Netrin. Our genetic analysis established the specific HS code relevant for this axon guidance event. Using two sensitized genetic backgrounds, we isolated novel components influencing D-type motor axon guidance with a link to HSPGs, as well as new alleles of several previously characterized axon guidance genes. Interestingly, the dorsal axon guidance defects induced by mutations in zfp-1 or lin-35 depended on the transgene oxIs12 used to visualize the D-type motor neurons. oxIs12 is a large multi-copy transgene that enlarges the X chromosome by approximately 20%. In a search for genes with a comparable phenotype we found that a mutation in the known dosage compensation gene dpy-21 showed similar axon guidance defects as zfp-1 or lin-35 mutants. Thus, derepression of genes on X, where many genes relevant for HS dependent axon guidance are located, might also influence axon guidance of D-type motor neurons. PMID:24066155

  4. Computational Reconstruction of NFκB Pathway Interaction Mechanisms during Prostate Cancer

    PubMed Central

    Börnigen, Daniela; Tyekucheva, Svitlana; Wang, Xiaodong; Rider, Jennifer R.; Lee, Gwo-Shu; Mucci, Lorelei A.; Sweeney, Christopher; Huttenhower, Curtis


    Molecular research in cancer is one of the largest areas of bioinformatic investigation, but it remains a challenge to understand biomolecular mechanisms in cancer-related pathways from high-throughput genomic data. This includes the Nuclear-factor-kappa-B (NFκB) pathway, which is central to the inflammatory response and cell proliferation in prostate cancer development and progression. Despite close scrutiny and a deep understanding of many of its members’ biomolecular activities, the current list of pathway members and a systems-level understanding of their interactions remains incomplete. Here, we provide the first steps toward computational reconstruction of interaction mechanisms of the NFκB pathway in prostate cancer. We identified novel roles for ATF3, CXCL2, DUSP5, JUNB, NEDD9, SELE, TRIB1, and ZFP36 in this pathway, in addition to new mechanistic interactions between these genes and 10 known NFκB pathway members. A newly predicted interaction between NEDD9 and ZFP36 in particular was validated by co-immunoprecipitation, as was NEDD9's potential biological role in prostate cancer cell growth regulation. We combined 651 gene expression datasets with 1.4M gene product interactions to predict the inclusion of 40 additional genes in the pathway. Molecular mechanisms of interaction among pathway members were inferred using recent advances in Bayesian data integration to simultaneously provide information specific to biological contexts and individual biomolecular activities, resulting in a total of 112 interactions in the fully reconstructed NFκB pathway: 13 (11%) previously known, 29 (26%) supported by existing literature, and 70 (63%) novel. This method is generalizable to other tissue types, cancers, and organisms, and this new information about the NFκB pathway will allow us to further understand prostate cancer and to develop more effective prevention and treatment strategies. PMID:27078000

  5. C/EBPβ Mediates Growth Hormone-Regulated Expression of Multiple Target Genes

    PubMed Central

    Cui, Tracy X.; Lin, Grace; LaPensee, Christopher R.; Calinescu, Anda-Alexandra; Rathore, Maanjot; Streeter, Cale; Piwien-Pilipuk, Graciela; Lanning, Nathan; Jin, Hui; Carter-Su, Christin; Qin, Zhaohui S.


    Regulation of c-Fos transcription by GH is mediated by CCAAT/enhancer binding protein β (C/EBPβ). This study examines the role of C/EBPβ in mediating GH activation of other early response genes, including Cyr61, Btg2, Socs3, Zfp36, and Socs1. C/EBPβ depletion using short hairpin RNA impaired responsiveness of these genes to GH, as seen for c-Fos. Rescue with wild-type C/EBPβ led to GH-dependent recruitment of the coactivator p300 to the c-Fos promoter. In contrast, rescue with C/EBPβ mutated at the ERK phosphorylation site at T188 failed to induce GH-dependent recruitment of p300, indicating that ERK-mediated phosphorylation of C/EBPβ at T188 is required for GH-induced recruitment of p300 to c-Fos. GH also induced the occupancy of phosphorylated C/EBPβ and p300 on Cyr61, Btg2, and Socs3 at predicted C/EBP-cAMP response element-binding protein motifs in their promoters. Consistent with a role for ERKs in GH-induced expression of these genes, treatment with U0126 to block ERK phosphorylation inhibited their GH-induced expression. In contrast, GH-dependent expression of Zfp36 and Socs1 was not inhibited by U0126. Thus, induction of multiple early response genes by GH in 3T3-F442A cells is mediated by C/EBPβ. A subset of these genes is regulated similarly to c-Fos, through a mechanism involving GH-stimulated ERK 1/2 activation, phosphorylation of C/EBPβ, and recruitment of p300. Overall, these studies suggest that C/EBPβ, like the signal transducer and activator of transcription proteins, regulates multiple genes in response to GH. PMID:21292824

  6. Can weighing lysimeter ET represent surrounding field ET well enough to test flux station measurements of daily and sub-daily ET?

    NASA Astrophysics Data System (ADS)

    Evett, Steven R.; Schwartz, Robert C.; Howell, Terry A.; Louis Baumhardt, R.; Copeland, Karen S.


    Weighing lysimeters and neutron probes (NP) are both used to determine the change in soil water storage needed to solve for evapotranspiration (ET) using the soil water balance equation. We compared irrigated cotton ET determined using two large (3 × 3 × 2.4-m deep) weighing lysimeters and eight NP soil water profiles located outside the lysimeters in cotton fields during the BEAREX08 field campaign (see [16] Evett et al., 2012). The objectives were to (i) determine if lysimeter-based ET fluxes were representative of those from the fields, designated NE and SE, in which the lysimeters were centered, and (ii) investigate different methods of computing the soil water balance using NP data. Field fluxes were determined from the soil water balance using neutron probe measurements of change in profile water content storage. Fluxes of ET from the SE lysimeter were representative of those from the field throughout the season and can be used with reasonable certainty for comparisons of ET fluxes and energy balance closure derived from Bowen ratio (BR) and eddy covariance (EC) measurements whose footprints lay in the SE field. Comparisons of ET fluxes from EC and BR systems to those from the NE lysimeter should consider that NE lysimeter fluxes were up to 18% larger than those from the NE field during the period of rapid vegetative growth. This was due to plants on the lysimeter having greater height and width than those in the field. Nevertheless, the data from this and companion studies documents substantial underestimation of crop ET by EC stations under the conditions of BEAREX08. Comparison of zero flux plane (ZFP) and simple soil water balance methods of calculating ET from NP data showed them to be equivalent in this study; and for the ZFP method, the depth of the control volume should be determined by the depth at which the hydraulic gradient reverses, not by the depth of calculated minimum flux. If supported by a sufficiently dense and widespread network of deep

  7. Genetic dissection of the fatty liver QTL Fl1sa by using congenic mice and identification of candidate genes in the liver and epididymal fat.


    Suzuki, Miyako; Kobayashi, Misato; Ohno, Tamio; Kanamori, Shinsaku; Tateishi, Soushi; Murai, Atsushi; Horio, Fumihiko


    Nonalcoholic fatty liver disease (NAFLD) is a multifactorial disease caused by interactions between environmental and genetic factors. The SMXA-5 mouse is a high-fat diet-induced fatty liver model established from SM/J and A/J strains. We have previously identified Fl1sa, a quantitative trait locus (QTL) for fatty liver on chromosome 12 (centromere-53.06 Mb) of SMXA-5 mice. However, the chromosomal region containing Fl1sa was too broad. The aim of this study was to narrow the Fl1sa region by genetic dissection using novel congenic mice and to identify candidate genes within the narrowed Fl1sa region. We established two congenic strains, R2 and R3, from parental A/J-12 SM and A/J strains. R2 and R3 strains have genomic intervals of centromere-29.20 Mb and 29.20-46.75 Mb of chromosome 12 derived from SM/J, respectively. Liver triglyceride content in R2 and R3 mice was significantly lower than that in A/J mice fed with a high-fat diet for 7 weeks. This result suggests that at least one of the genes responsible for fatty liver exists within the two chromosomal regions centromere-29.20 Mb (R2) and 29.20-46.75 Mb (R3). We found that liver triglyceride accumulation is inversely correlated with epididymal fat weight among the parental and congenic strains. Therefore, the ectopic fat accumulation in the liver may be due to organ-organ interactions between the liver and epididymal fat. To identify candidate genes in Fl1sa, we performed a DNA microarray analysis using the liver and epididymal fat in A/J and A/J-12 SM mice fed with a high-fat diet for 7 weeks. In epididymal fat, mRNA levels of Zfp125 (in R2) and Nrcam (in R3) were significantly different in A/J-12 SM mice from those in A/J mice. In the liver, mRNA levels of Iah1 (in R2) and Rrm2 (in R2) were significantly different in A/J-12 SM mice from those in A/J mice. In this study, using congenic mice analysis, we narrowed the chromosomal region containing Fl1sa to two regions of mouse chromosome 12. We then

  8. Traditional GFP-type cyclization and unexpected fragmentation site in a purple chromoprotein from Anemonia sulcata, asFP595.


    Zagranichny, Vasily E; Rudenko, Natalia V; Gorokhovatsky, Andrey Yu; Zakharov, Mikhail V; Balashova, Tamara A; Arseniev, Alexander S


    The purple chromoprotein (asFP595) from Anemonia sulcata belongs to the family of green fluorescent protein (GFP). Absorption and emission spectra of asFP595 are similar to those of a number of recently cloned GFP-like red proteins of the DsRed subfamily. The earlier proposed asFP595 chromophore structure [Martynov, V. I.; et al. (2001) J. Biol. Chem. 276, 21012-21016] was postulated to result from an "alternative cyclization" giving rise to a pyrazine-type six-membered heterocycle. Here we report that the asFP595 chromophore is actually very close in chemical structure to that of zFP538, a yellow fluorescent protein [Zagranichny, V. E.; et al. (2004) Biochemistry 43, 4764-4772]. NMR spectroscopic studies of four chromophore-containing peptides (chromopeptides) isolated under mild conditions from enzymatic digests of asFP595 and one chromopeptide obtained from DsRed revealed that all of them contain a p-hydroxybenzylideneimidazolinone moiety formed by Met-65/Gln-66, Tyr-66/67, and Gly-67/68 of asFP595/DsRed, respectively. Two asFP595 chromopeptides are proteolysis products of an isolated full-length polypeptide containing a GFP-type chromophore already formed and arrested at an earlier stage of maturation. The two other asFP595 chromopeptides were isolated as proteolysis products of the purified chromophore-containing C-terminal fragment. One of these has an oxo group at Met-65 C(alpha) and is a hydrolysis product of another one, with the imino group at Met-65 C(alpha). The N-unsubstituted imino moiety of the latter is generated by spontaneous polypeptide chain cleavage at a very unexpected site, the former peptide bond between Cys-64 C' and Met-65 N(alpha). Our data strongly suggest that both zFP538 and asFP595 could be attributed to the DsRed subfamily of GFP-like proteins.

  9. The ISTIMES project: a new integrated system for monitoring critical transport infrastructures interested by natural hazards

    NASA Astrophysics Data System (ADS)

    Proto, Monica; Massimo, Bavusi; Francesco, Soldovieri


    , Eidgenoessische Materialpruefungs-und Forschungsanstalt (EMPA) from Switzerland, Laboratoire Central des Ponts et Chaussées (LCPC) from France, Lund University (ULUND) from Sweden, Tel Aviv University (TAU) from Israel, Territorial Data Elaboration (TDE) from Romania and Norsk Elektro Optikk (NEO) from Norway.

  10. Natural compound cudraflavone B shows promising anti-inflammatory properties in vitro.


    Hošek, Jan; Bartos, Milan; Chudík, Stanislav; Dall'Acqua, Stefano; Innocenti, Gabbriella; Kartal, Murat; Kokoška, Ladislav; Kollár, Peter; Kutil, Zsófia; Landa, Přemysl; Marek, Radek; Závalová, Veronika; Žemlička, Milan; Šmejkal, Karel


    Cudraflavone B (1) is a prenylated flavonoid found in large amounts in the roots of Morus alba, a plant used as a herbal remedy for its reputed anti-inflammatory properties. The present study shows that this compound causes a significant inhibition of inflammatory mediators in selected in vitro models. Thus, 1 was identified as a potent inhibitor of tumor necrosis factor α (TNFα) gene expression and secretion by blocking the translocation of nuclear factor κB (NF-κB) from the cytoplasm to the nucleus in macrophages derived from a THP-1 human monocyte cell line. The NF-κB activity reduction resulted in the inhibition of cyclooxygenase 2 (COX-2) gene expression. Compound 1 acts as a COX-2 and COX-1 inhibitor with higher selectivity toward COX-2 than indomethacin. Pretreatment of cells by 1 shifted the peak in an regulatory gene zinc-finger protein 36 (ZFP36) expression assay. This natural product has noticeable anti-inflammatory properties, suggesting that 1 potentially could be used for development as a nonsteroidal anti-inflammatory drug lead.

  11. Recent advances in lossy compression of scientific floating-point data

    NASA Astrophysics Data System (ADS)

    Lindstrom, P.


    With a continuing exponential trend in supercomputer performance, ever larger data sets are being generated through numerical simulation. Bandwidth and storage capacity are, however, not keeping pace with this increase in data size, causing significant data movement bottlenecks in simulation codes and substantial monetary costs associated with archiving vast volumes of data. Worse yet, ever smaller fractions of data generated can be stored for further analysis, where scientists frequently rely on decimating or averaging large data sets in time and/or space. One way to mitigate these problems is to employ data compression to reduce data volumes. However, lossless compression of floating-point data can achieve only very modest size reductions on the order of 10-50%. We present ZFP and FPZIP, two state-of-the-art lossy compressors for structured floating-point data that routinely achieve one to two orders of magnitude reduction with little to no impact on the accuracy of visualization and quantitative data analysis. We provide examples of the use of such lossy compressors in climate and seismic modeling applications to effectively accelerate I/O and reduce storage requirements. We further discuss how the design decisions behind these and other compressors impact error distributions and other statistical and differential properties, including derived quantities of interest relevant to each science application.

  12. Temporal Control of Trichome Distribution by MicroRNA156-Targeted SPL Genes in Arabidopsis thaliana[W][OA

    PubMed Central

    Yu, Nan; Cai, Wen-Juan; Wang, Shucai; Shan, Chun-Min; Wang, Ling-Jian; Chen, Xiao-Ya


    The production and distribution of plant trichomes is temporally and spatially regulated. After entering into the flowering stage, Arabidopsis thaliana plants have progressively reduced numbers of trichomes on the inflorescence stem, and the floral organs are nearly glabrous. We show here that SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) genes, which define an endogenous flowering pathway and are targeted by microRNA 156 (miR156), temporally control the trichome distribution during flowering. Plants overexpressing miR156 developed ectopic trichomes on the stem and floral organs. By contrast, plants with elevated levels of SPLs produced fewer trichomes. During plant development, the increase in SPL transcript levels is coordinated with the gradual loss of trichome cells on the stem. The MYB transcription factor genes TRICHOMELESS1 (TCL1) and TRIPTYCHON (TRY) are negative regulators of trichome development. We show that SPL9 directly activates TCL1 and TRY expression through binding to their promoters and that this activation is independent of GLABROUS1 (GL1). The phytohormones cytokinin and gibberellin were reported to induce trichome formation on the stem and inflorescence via the C2H2 transcription factors GIS, GIS2, and ZFP8, which promote GL1 expression. We show that the GIS-dependent pathway does not affect the regulation of TCL1 and TRY by miR156-targeted SPLs, represented by SPL9. These results demonstrate that the miR156-regulated SPLs establish a direct link between developmental programming and trichome distribution. PMID:20622149

  13. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.


    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A


    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  14. Effect of water withdrawal on formation of free radical, proline accumulation and activities of antioxidant enzymes in ZAT12-transformed transgenic tomato plants.


    Chandra Rai, Avinash; Singh, Major; Shah, Kavita


    Water stress often leads to the accumulation of reactive oxygen species (ROS) and their excessive production alters the activities of enzymes involved in their removal. ZAT12 is a member of stress-responsive C(2)H(2) type Zinc Finger Protein (ZFP) reported to control the expression of several stress-activated genes in plants through ROS signaling. The ZAT12-transformed tomato lines (cv. H-86 variety Kashi Vishesh) when subjected to water withdrawal for 7, 14 and 21 days revealed significant and consistent changes in activities of enzymes SOD, CAT, APX, GR and POD paralleled with an increased proline levels. Unlike that in wild-type tomato, the leaf superoxide anion and hydrogen peroxide concentrations in the transformed tomato plants did not alter much, suggesting a well regulated formation of free radicals suppressing oxidative stress in the latter. Results suggest BcZAT12-transformed tomato lines ZT1, ZT2 and ZT6 to be better adapted to drought stress tolerance by accumulation of osmolyte proline and increased antioxidant response triggered by the ZAT12 gene. Therefore, the ZAT12-transformed tomato cv. H-86 lines will prove useful for higher yield of tomato crop in regions affected with severe drought stress. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  15. Histone deacetylase 3 is required for maintenance of bone mass during aging

    PubMed Central

    McGee-Lawrence, Meghan E.; Bradley, Elizabeth W.; Dudakovic, Amel; Carlson, Samuel W.; Ryan, Zachary C.; Kumar, Rajiv; Dadsetan, Mahrokh; Yaszemski, Michael J.; Chen, Qingshan; An, Kai-Nan; Westendorf, Jennifer J.


    Histone deacetylase 3 (Hdac3) is a nuclear enzyme that removes acetyl groups from lysine residues in histones and other proteins to epigenetically regulate gene expression. Hdac3 interacts with bone-related transcription factors and co-factors such as Runx2 and Zfp521, and thus is poised to play a key role in the skeletal system. To understand the role of Hdac3 in osteoblasts and osteocytes, Hdac3 conditional knockout (CKO) mice were created with the Osteocalcin (OCN) promoter driving Cre expression. Hdac3 CKOOCN mice were of normal size and weight, but progressively lost trabecular and cortical bone mass with age. The Hdac3 CKOOCN mice exhibited reduced cortical bone mineralization and material properties and suffered frequent fractures. Bone resorption was lower, not higher, in the Hdac3 CKOOCN mice, suggesting that primary defects in osteoblasts caused the reduced bone mass. Indeed, reductions in bone formation were observed. Osteoblasts and osteocytes from Hdac3 CKOOCN mice showed increased DNA damage and reduced functional activity in vivo and in vitro. Thus, Hdac3 expression in osteoblasts and osteocytes is essential for bone maintenance during aging. PMID:23085085

  16. An Integrated Systems Genetics and Omics Toolkit to Probe Gene Function.


    Li, Hao; Wang, Xu; Rukina, Daria; Huang, Qingyao; Lin, Tao; Sorrentino, Vincenzo; Zhang, Hongbo; Bou Sleiman, Maroun; Arends, Danny; McDaid, Aaron; Luan, Peiling; Ziari, Naveed; Velázquez-Villegas, Laura A; Gariani, Karim; Kutalik, Zoltan; Schoonjans, Kristina; Radcliffe, Richard A; Prins, Pjotr; Morgenthaler, Stephan; Williams, Robert W; Auwerx, Johan


    Identifying genetic and environmental factors that impact complex traits and common diseases is a high biomedical priority. Here, we developed, validated, and implemented a series of multi-layered systems approaches, including (expression-based) phenome-wide association, transcriptome-/proteome-wide association, and (reverse-) mediation analysis, in an open-access web server ( to expedite the systems dissection of gene function. We applied these approaches to multi-omics datasets from the BXD mouse genetic reference population, and identified and validated associations between genes and clinical and molecular phenotypes, including previously unreported links between Rpl26 and body weight, and Cpt1a and lipid metabolism. Furthermore, through mediation and reverse-mediation analysis we established regulatory relations between genes, such as the co-regulation of BCKDHA and BCKDHB protein levels, and identified targets of transcription factors E2F6, ZFP277, and ZKSCAN1. Our multifaceted toolkit enabled the identification of gene-gene and gene-phenotype links that are robust and that translate well across populations and species, and can be universally applied to any populations with multi-omics datasets. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Long-Term Fructose Intake Increases Adipogenic Potential: Evidence of Direct Effects of Fructose on Adipocyte Precursor Cells

    PubMed Central

    Zubiría, María Guillermina; Alzamendi, Ana; Moreno, Griselda; Rey, María Amanda; Spinedi, Eduardo; Giovambattista, Andrés


    We have previously addressed that fructose rich diet (FRD) intake for three weeks increases the adipogenic potential of stromal vascular fraction cells from the retroperitoneal adipose tissue (RPAT). We have now evaluated the effect of prolonged FRD intake (eight weeks) on metabolic parameters, number of adipocyte precursor cells (APCs) and in vitro adipogenic potential from control (CTR) and FRD adult male rats. Additionally, we have examined the direct fructose effects on the adipogenic capacity of normal APCs. FRD fed rats had increased plasma levels of insulin, triglyceride and leptin, and RPAT mass and adipocyte size. FACS studies showed higher APCs number and adipogenic potential in FRD RPAT pads; data is supported by high mRNA levels of competency markers: PPARγ2 and Zfp423. Complementary in vitro experiments indicate that fructose-exposed normal APCs displayed an overall increased adipogenic capacity. We conclude that the RPAT mass expansion observed in eight week-FRD fed rats depends on combined accelerated adipogenesis and adipocyte hypertrophy, partially due to a direct effect of fructose on APCs. PMID:27049396

  18. Long-Term Fructose Intake Increases Adipogenic Potential: Evidence of Direct Effects of Fructose on Adipocyte Precursor Cells.


    Zubiría, María Guillermina; Alzamendi, Ana; Moreno, Griselda; Rey, María Amanda; Spinedi, Eduardo; Giovambattista, Andrés


    We have previously addressed that fructose rich diet (FRD) intake for three weeks increases the adipogenic potential of stromal vascular fraction cells from the retroperitoneal adipose tissue (RPAT). We have now evaluated the effect of prolonged FRD intake (eight weeks) on metabolic parameters, number of adipocyte precursor cells (APCs) and in vitro adipogenic potential from control (CTR) and FRD adult male rats. Additionally, we have examined the direct fructose effects on the adipogenic capacity of normal APCs. FRD fed rats had increased plasma levels of insulin, triglyceride and leptin, and RPAT mass and adipocyte size. FACS studies showed higher APCs number and adipogenic potential in FRD RPAT pads; data is supported by high mRNA levels of competency markers: PPARγ2 and Zfp423. Complementary in vitro experiments indicate that fructose-exposed normal APCs displayed an overall increased adipogenic capacity. We conclude that the RPAT mass expansion observed in eight week-FRD fed rats depends on combined accelerated adipogenesis and adipocyte hypertrophy, partially due to a direct effect of fructose on APCs.


    PubMed Central

    Liu, Yu; Easton, John; Shao, Ying; Maciaszek, Jamie; Wang, Zhaoming; Wilkinson, Mark R.; McCastlain, Kelly; Edmonson, Michael; Pounds, Stanley B.; Shi, Lei; Zhou, Xin; Ma, Xiaotu; Sioson, Edgar; Li, Yongjin; Rusch, Michael; Gupta, Pankaj; Pei, Deqing; Cheng, Cheng; Smith, Malcolm A.; Auvil, Jaime Guidry; Gerhard, Daniela S.; Relling, Mary V.; Winick, Naomi J.; Carroll, Andrew J.; Heerema, Nyla A.; Raetz, Elizabeth; Devidas, Meenakshi; Willman, Cheryl L.; Harvey, Richard C.; Carroll, William L.; Dunsmore, Kimberly P.; Winter, Stuart S.; Wood, Brent L; Sorrentino, Brian P.; Downing, James R.; Loh, Mignon L.; Hunger, Stephen P; Zhang, Jinghui; Mullighan, Charles G.


    Genetic alterations activating NOTCH1 signaling and T cell transcription factors, coupled with inactivation of the INK4/ARF tumor suppressors are hallmarks of T-ALL, but detailed genome-wide sequencing of large T-ALL cohorts has not been performed. Using integrated genomic analysis of 264 T-ALL cases, we identify 106 putative driver genes, half of which were not previously described in childhood T-ALL (e.g. CCND3, CTCF, MYB, SMARCA4, ZFP36L2 and MYCN). We described new mechanisms of coding and non-coding alteration, and identify 10 recurrently altered pathways, with associations between mutated genes and pathways, and stage or subtype of T-ALL. For example, NRAS/FLT3 mutations were associated with immature T-ALL, JAK3/STAT5B mutations in HOX1 deregulated ALL, PTPN2 mutations in TLX1 T-ALL, and PIK3R1/PTEN mutations in TAL1 ALL, suggesting that different signaling pathways have distinct roles according to maturational stage. This genomic landscape provides a logical framework for the development of faithful genetic models and new therapeutic approaches. PMID:28671688

  20. Regulation of p21/CIP1/WAF-1 mediated cell-cycle arrest by RNase L and tristetraprolin, and involvement of AU-rich elements

    PubMed Central

    Al-Haj, Latifa; Blackshear, Perry J.; Khabar, Khalid S.A.


    The p21Cip1/WAF1 plays an important role in cell-cycle arrest. Here, we find that RNase L regulates p21-mediated G1 growth arrest in AU-rich elements-dependent manner. We found a significant loss of p21 mRNA expression in RNASEL−/− MEFs and that the overexpression of RNase L in HeLa cells induces p21 mRNA expression. The p21 mRNA half-life significantly changes as a result of RNase L modulation, indicating a post-transcriptional effect. Indeed, we found that RNase L promotes tristetraprolin (TTP/ZFP36) mRNA decay. This activity was not seen with dimerization- and nuclease-deficient RNase L mutants. Deficiency in TTP led to increases in p21 mRNA and protein. With induced ablation of RNase L, TTP mRNA and protein expressions were higher, while p21 expression became reduced. We further establish that TTP, but not C124R TTP mutant, binds to, and accelerates the decay of p21 mRNA. The p21 mRNA half-life was prolonged in TTP−/− MEFs. The TTP regulation of p21 mRNA decay required functional AU-rich elements. Thus, we demonstrate a novel mechanism of regulating G1 growth arrest by an RNase L-TTP-p21 axis. PMID:22718976

  1. A Survey for Novel Imprinted Genes in the Mouse Placenta by mRNA-seq

    PubMed Central

    Wang, Xu; Soloway, Paul D.; Clark, Andrew G.


    Many questions about the regulation, functional specialization, computational prediction, and evolution of genomic imprinting would be better addressed by having an exhaustive genome-wide catalog of genes that display parent-of-origin differential expression. As a first-pass scan for novel imprinted genes, we performed mRNA-seq experiments on embryonic day 17.5 (E17.5) mouse placenta cDNA samples from reciprocal cross F1 progeny of AKR and PWD mouse strains and quantified the allele-specific expression and the degree of parent-of-origin allelic imbalance. We confirmed the imprinting status of 23 known imprinted genes in the placenta and found that 12 genes reported previously to be imprinted in other tissues are also imprinted in mouse placenta. Through a well-replicated design using an orthogonal allelic-expression technology, we verified 5 novel imprinted genes that were not previously known to be imprinted in mouse (Pde10, Phf17, Phactr2, Zfp64, and Htra3). Our data suggest that most of the strongly imprinted genes have already been identified, at least in the placenta, and that evidence supports perhaps 100 additional weakly imprinted genes. Despite previous appearance that the placenta tends to display an excess of maternally expressed imprinted genes, with the addition of our validated set of placenta-imprinted genes, this maternal bias has disappeared. PMID:21705755

  2. Central Role of the PPARγ Gene Network in Coordinating Beef Cattle Intramuscular Adipogenesis in Response to Weaning Age and Nutrition

    PubMed Central

    Moisá, Sonia J.; Shike, Daniel W.; Faulkner, Dan B.; Meteer, William T.; Keisler, Duane; Loor, Juan J.


    Adipogenic/lipogenic transcriptional networks regulating intramuscular fat deposition (IMF) in response to weaning age and dietary starch level were studied. The longissimus muscle (LM) of beef steers on an early weaning (141 days age) plus high-starch diet (EWS) or a normal weaning (NW, 222 days age) plus starch creep-feed diet (CFS) was biopsied at 0 (EW), 25, 50, 96 (NW), 167, and 222 (pre-slaughter) days. Expression patterns of 35 target genes were studied. From NW through slaughter, all steers received the same high-starch diet. In EWS steers the expression of PPARG, other adipogenic (CEBPA, ZFP423) and lipogenic (THRSP, SREBF1, INSIG1) activators, and several enzymes (FASN, SCD, ELOVL6, PCK1, DGAT2) that participate in the process of IMF increased gradually to a peak between 96 and 167 days on treatment. Steers in NW did not achieve similar expression levels even by 222 days on treatment, suggesting a blunted response even when fed a high-starch diet after weaning. High-starch feeding at an early age (EWS) triggers precocious and sustained adipogenesis, resulting in greater marbling. PMID:24516329

  3. Zinc finger protein 521 antagonizes early B-cell factor 1 and modulates the B-lymphoid differentiation of primary hematopoietic progenitors.


    Mega, Tiziana; Lupia, Michela; Amodio, Nicola; Horton, Sarah J; Mesuraca, Maria; Pelaggi, Daniela; Agosti, Valter; Grieco, Michele; Chiarella, Emanuela; Spina, Raffaella; Moore, Malcolm A S; Schuringa, Jan Jacob; Bond, Heather M; Morrone, Giovanni


    Zinc finger protein 521 (EHZF/ZNF521) is a multi-functional transcription co-factor containing 30 zinc fingers and an amino-terminal motif that binds to the nucleosome remodelling and histone deacetylase (NuRD) complex. ZNF521 is believed to be a relevant player in the regulation of the homeostasis of the hematopoietic stem/progenitor cell compartment, however the underlying molecular mechanisms are still largely unknown. Here, we show that this protein plays an important role in the control of B-cell development by inhibiting the activity of early B-cell factor-1 (EBF1), a master factor in B-lineage specification. In particular, our data demonstrate that: (1) ZNF521 binds to EBF1 via its carboxyl-terminal portion and this interaction is required for EBF1 inhibition; (2) NuRD complex recruitment by ZNF521 is not essential for the inhibition of transactivation of EBF1-dependent promoters; (3) ZNF521 represses EBF1 target genes in a human B-lymphoid molecular context; and (4) RNAi-mediated silencing of ZNF521/Zfp521 in primary human and murine hematopoietic progenitors strongly enhances the generation of B-lymphocytes in vitro. Taken together, our data indicate that ZNF521 can antagonize B-cell development and lend support to the notion that it may contribute to conserve the multipotency of primitive lympho-myeloid progenitors by preventing or delaying their EBF1-driven commitment toward the B-cell lineage.

  4. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    PubMed Central

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik


    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  5. Central Role of the PPARγ Gene Network in Coordinating Beef Cattle Intramuscular Adipogenesis in Response to Weaning Age and Nutrition.


    Moisá, Sonia J; Shike, Daniel W; Faulkner, Dan B; Meteer, William T; Keisler, Duane; Loor, Juan J


    Adipogenic/lipogenic transcriptional networks regulating intramuscular fat deposition (IMF) in response to weaning age and dietary starch level were studied. The longissimus muscle (LM) of beef steers on an early weaning (141 days age) plus high-starch diet (EWS) or a normal weaning (NW, 222 days age) plus starch creep-feed diet (CFS) was biopsied at 0 (EW), 25, 50, 96 (NW), 167, and 222 (pre-slaughter) days. Expression patterns of 35 target genes were studied. From NW through slaughter, all steers received the same high-starch diet. In EWS steers the expression of PPARG, other adipogenic (CEBPA, ZFP423) and lipogenic (THRSP, SREBF1, INSIG1) activators, and several enzymes (FASN, SCD, ELOVL6, PCK1, DGAT2) that participate in the process of IMF increased gradually to a peak between 96 and 167 days on treatment. Steers in NW did not achieve similar expression levels even by 222 days on treatment, suggesting a blunted response even when fed a high-starch diet after weaning. High-starch feeding at an early age (EWS) triggers precocious and sustained adipogenesis, resulting in greater marbling.

  6. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots.


    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang


    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.

  7. [Psychiatric care between World War II and "Psychiatrie-Enquête": early approaches of reformation in Württemberg].


    Croissant, Daniela; Längle, Gerhard


    The article describes care in a psychiatric clinic between 1946 and 1975. This happens against the background of the current psychiatry-historical literature in which this phase of psychiatric care is described often summarily with the destructive words of the report of the 'Psychiatrie-Enquête' of 1975. Improvements achieved in this time were hardly examined up to now though they contributed substantially to the later effects of the 'Psychiatrie-Enquête'. The medical annual reports of the psychiatric clinic of Zwiefalten, today ZfP Südwürttemberg, refering to the mentioned period were sighted and evaluated concerning their contents. In the called period evident organizational and structural defects are deplored in the annual reports. Nevertheless, from the late 1940 s on, modern care elements appear, as for example the broadening of the range of the therapeutic offers, multiprofessional treatment, diagnosis-specific concepts for the wards, opening of stations and extensive outpatient care. It is shown that already before the appearance of the final report of the Enquête commission clear progress concerning psychiatric care was achieved. © Georg Thieme Verlag KG Stuttgart · New York.

  8. Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes

    PubMed Central

    Lam, Tze Hau; Tay, Matthew Zirui; Wang, Bei; Xiao, Ziwei; Ren, Ee Chee


    Distinct regions of long-range genetic fixation in the human MHC region, known as conserved extended haplotypes (CEHs), possess unique genomic characteristics and are strongly associated with numerous diseases. While CEHs appear to be homogeneous by SNP analysis, the nature of fine variations within their genomic structure is unknown. Using multiple, MHC-homozygous cell lines, we demonstrate extensive sequence conservation in two common Asian MHC haplotypes: A33-B58-DR3 and A2-B46-DR9. However, characterization of phase-resolved MHC haplotypes revealed unique intra-CEH patterns of variation and uncovered 127 single nucleotide variants (SNVs) which are missing from public databases. We further show that the strong linkage disequilibrium structure within the human MHC that typically confounds precise identification of genetic features can be resolved using intra-CEH variants, as evidenced by rs3129063 and rs448489, which affect expression of ZFP57, a gene important in methylation and epigenetic regulation. This study demonstrates an improved strategy that can be used towards genetic dissection of diseases. PMID:26593880

  9. A post-transcriptional mechanism pacing expression of neural genes with precursor cell differentiation status.


    Dai, Weijun; Li, Wencheng; Hoque, Mainul; Li, Zhuyun; Tian, Bin; Makeyev, Eugene V


    Nervous system (NS) development relies on coherent upregulation of extensive sets of genes in a precise spatiotemporal manner. How such transcriptome-wide effects are orchestrated at the molecular level remains an open question. Here we show that 3'-untranslated regions (3' UTRs) of multiple neural transcripts contain AU-rich cis-elements (AREs) recognized by tristetraprolin (TTP/Zfp36), an RNA-binding protein previously implicated in regulation of mRNA stability. We further demonstrate that the efficiency of ARE-dependent mRNA degradation declines in the neural lineage because of a decrease in the TTP protein expression mediated by the NS-enriched microRNA miR-9. Importantly, TTP downregulation in this context is essential for proper neuronal differentiation. On the other hand, inactivation of TTP in non-neuronal cells leads to dramatic upregulation of multiple NS-specific genes. We conclude that the newly identified miR-9/TTP circuitry limits unscheduled accumulation of neuronal mRNAs in non-neuronal cells and ensures coordinated upregulation of these transcripts in neurons.

  10. A post-transcriptional mechanism pacing expression of neural genes with precursor cell differentiation status

    PubMed Central

    Dai, Weijun; Li, Wencheng; Hoque, Mainul; Li, Zhuyun; Tian, Bin; Makeyev, Eugene V.


    Nervous system (NS) development relies on coherent upregulation of extensive sets of genes in a precise spatiotemporal manner. How such transcriptome-wide effects are orchestrated at the molecular level remains an open question. Here we show that 3′-untranslated regions (3′ UTRs) of multiple neural transcripts contain AU-rich cis-elements (AREs) recognized by tristetraprolin (TTP/Zfp36), an RNA-binding protein previously implicated in regulation of mRNA stability. We further demonstrate that the efficiency of ARE-dependent mRNA degradation declines in the neural lineage because of a decrease in the TTP protein expression mediated by the NS-enriched microRNA miR-9. Importantly, TTP downregulation in this context is essential for proper neuronal differentiation. On the other hand, inactivation of TTP in non-neuronal cells leads to dramatic upregulation of multiple NS-specific genes. We conclude that the newly identified miR-9/TTP circuitry limits unscheduled accumulation of neuronal mRNAs in non-neuronal cells and ensures coordinated upregulation of these transcripts in neurons. PMID:26144867

  11. Histone methyltransferase Ash1L mediates activity-dependent repression of neurexin-1α

    PubMed Central

    Zhu, Τao; Liang, Chen; Li, Dongdong; Tian, Miaomiao; Liu, Sanxiong; Gao, Guanjun; Guan, Ji-Song


    Activity-dependent transcription is critical for the regulation of long-term synaptic plasticity and plastic rewiring in the brain. Here, we report that the transcription of neurexin1α (nrxn1α), a presynaptic adhesion molecule for synaptic formation, is regulated by transient neuronal activation. We showed that 10 minutes of firing at 50 Hz in neurons repressed the expression of nrxn1α for 24 hours in a primary cortical neuron culture through a transcriptional repression mechanism. By performing a screening assay using a synthetic zinc finger protein (ZFP) to pull down the proteins enriched near the nrxn1α promoter region in vivo, we identified that Ash1L, a histone methyltransferase, is enriched in the nrxn1α promoter. Neuronal activity triggered binding of Ash1L to the promoter and enriched the histone marker H3K36me2 at the nrxn1α promoter region. Knockout of Ash1L in mice completely abolished the activity-dependent repression of nrxn1α. Taken together, our results reveal that a novel process of activity-dependent transcriptional repression exists in neurons and that Ash1L mediates the long-term repression of nrxn1α, thus implicating an important role for epigenetic modification in brain functioning. PMID:27229316

  12. Culture medium, gas atmosphere and MAPK inhibition affect regulation of RNA-binding protein targets during mouse preimplantation development.


    Calder, Michele D; Watson, Patricia H; Watson, Andrew J


    During oogenesis, mammalian oocytes accumulate maternal mRNAs that support the embryo until embryonic genome activation. RNA-binding proteins (RBP) may regulate the stability and turnover of maternal and embryonic mRNAs. We hypothesised that varying embryo culture conditions, such as culture medium, oxygen tension and MAPK inhibition, affects regulation of RBPs and their targets during preimplantation development. STAU1, ELAVL1, KHSRP and ZFP36 proteins and mRNAs were detected throughout mouse preimplantation development, whereas Elavl2 mRNA decreased after the two-cell stage. Potential target mRNAs of RBP regulation, Gclc, Slc2a1 and Slc7a1 were detected during mouse preimplantation development. Gclc mRNA was significantly elevated in embryos cultured in Whitten's medium compared with embryos cultured in KSOMaa, and Gclc mRNA was elevated under high-oxygen conditions. Inhibition of the p38 MAPK pathway reduced Slc7a1 mRNA expression while inhibition of ERK increased Slc2a1 mRNA expression. The half-lives of the potential RBP mRNA targets are not regulated in parallel; Slc2a1 mRNA displayed the longest half-life. Our results indicate that mRNAs and proteins encoding five RBPs are present during preimplantation development and more importantly, demonstrate that expression of RBP target mRNAs are regulated by culture medium, gas atmosphere and MAPK pathways.

  13. Selectivity of arsenite interaction with zinc finger proteins.


    Zhao, Linhong; Chen, Siming; Jia, Liangyuan; Shu, Shi; Zhu, Pingping; Liu, Yangzhong


    Arsenic is a carcinogenic element also used for the treatment of acute promyelocytic leukemia. The reactivity of proteins to arsenic must be associated with the various biological functions of As. Here, we investigated the selectivity of arsenite to zinc finger proteins (ZFPs) with different zinc binding motifs (C2H2, C3H, and C4). Single ZFP domain proteins were used for the direct comparison of the reactivity of different ZFPs. The binding constants and the reaction rates have been studied quantitatively. Results show that both the binding affinity and reaction rates of single-domain ZFPs follow the trend of C4 > C3H ≫ C2H2. Compared with the C2H2 motif ZFPs, the binding affinities of C3H and C4 motif ZFPs are nearly two orders of magnitude higher and the reaction rates are approximately two-fold higher. The formation of multi-domain ZFPs significantly enhances the reactivity of C2H2 type ZFPs, but has negligible effects on C3H and C4 ZFPs. Consequently, the reactivities of the three types of multi-domain ZFPs are rather similar. The 2D NMR spectra indicate that the As(III)-bound ZFPs are also unfolded, suggesting that arsenic binding interferes with the function of ZFPs.

  14. The novel 19q13 KRAB zinc-finger tumour suppressor ZNF382 is frequently methylated in oesophageal squamous cell carcinoma and antagonises Wnt/β-catenin signalling.


    Zhang, Chong; Xiang, Tingxiu; Li, Shuman; Ye, Lin; Feng, Yixiao; Pei, Lijiao; Li, Lili; Wang, Xiangyu; Sun, Ran; Tao, Qian; Ren, Guosheng


    Zinc finger proteins (ZFPs) are the largest transcription factor family in mammals. About one-third of ZFPs are Krüppel-associated box domain (KRAB)-ZFPs and involved in the regulation of cell differentiation/proliferation/apoptosis and neoplastic transformation. We recently identified ZNF382 as a novel KRAB-ZFP epigenetically inactivated in multiple cancers due to frequent promoter CpG methylation. However, its epigenetic alterations, biological functions/mechanism and clinical significance in oesophageal squamous cell carcinoma (ESCC) are still unknown. Here, we demonstrate that ZNF382 expression was suppressed in ESCC due to aberrant promoter methylation, but highly expressed in normal oesophagus tissues. ZNF382 promoter methylation is correlated with ESCC differentiation levels. Restoration of ZNF382 expression in silenced ESCC cells suppressed tumour cell proliferation and metastasis through inducing cell apoptosis. Importantly, ZNF382 suppressed Wnt/β-catenin signalling and downstream target gene expression, likely through binding directly to FZD1 and DVL2 promoters. In summary, our findings demonstrate that ZNF382 functions as a bona fide tumour suppressor inhibiting ESCC pathogenesis through inhibiting the Wnt/β-catenin signalling pathway.

  15. SALT-RESPONSIVE ERF1 Regulates Reactive Oxygen Species–Dependent Signaling during the Initial Response to Salt Stress in Rice[W

    PubMed Central

    Schmidt, Romy; Mieulet, Delphine; Hubberten, Hans-Michael; Obata, Toshihiro; Hoefgen, Rainer; Fernie, Alisdair R.; Fisahn, Joachim; San Segundo, Blanca; Guiderdoni, Emmanuel; Schippers, Jos H.M.; Mueller-Roeber, Bernd


    Early detection of salt stress is vital for plant survival and growth. Still, the molecular processes controlling early salt stress perception and signaling are not fully understood. Here, we identified SALT-RESPONSIVE ERF1 (SERF1), a rice (Oryza sativa) transcription factor (TF) gene that shows a root-specific induction upon salt and hydrogen peroxide (H2O2) treatment. Loss of SERF1 impairs the salt-inducible expression of genes encoding members of a mitogen-activated protein kinase (MAPK) cascade and salt tolerance–mediating TFs. Furthermore, we show that SERF1-dependent genes are H2O2 responsive and demonstrate that SERF1 binds to the promoters of MAPK KINASE KINASE6 (MAP3K6), MAPK5, DEHYDRATION-RESPONSIVE ELEMENT BINDING2A (DREB2A), and ZINC FINGER PROTEIN179 (ZFP179) in vitro and in vivo. SERF1 also directly induces its own gene expression. In addition, SERF1 is a phosphorylation target of MAPK5, resulting in enhanced transcriptional activity of SERF1 toward its direct target genes. In agreement, plants deficient for SERF1 are more sensitive to salt stress compared with the wild type, while constitutive overexpression of SERF1 improves salinity tolerance. We propose that SERF1 amplifies the reactive oxygen species–activated MAPK cascade signal during the initial phase of salt stress and translates the salt-induced signal into an appropriate expressional response resulting in salt tolerance. PMID:23800963

  16. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots

    PubMed Central

    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang


    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. ‘MAPK cascade’), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway’), reactive oxygen species (ROS) metabolic process (e.g. ‘hydrogen peroxide catabolic process’) and transcription factors (e.g., ‘MYB, ZFP and bZIP’) were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment. PMID:28165059

  17. Longitudinal analyses of the DNA methylome in deployed military servicemen identify susceptibility loci for post-traumatic stress disorder.


    Rutten, B P F; Vermetten, E; Vinkers, C H; Ursini, G; Daskalakis, N P; Pishva, E; de Nijs, L; Houtepen, L C; Eijssen, L; Jaffe, A E; Kenis, G; Viechtbauer, W; van den Hove, D; Schraut, K G; Lesch, K-P; Kleinman, J E; Hyde, T M; Weinberger, D R; Schalkwyk, L; Lunnon, K; Mill, J; Cohen, H; Yehuda, R; Baker, D G; Maihofer, A X; Nievergelt, C M; Geuze, E; Boks, M P M


    In order to determine the impact of the epigenetic response to traumatic stress on post-traumatic stress disorder (PTSD), this study examined longitudinal changes of genome-wide blood DNA methylation profiles in relation to the development of PTSD symptoms in two prospective military cohorts (one discovery and one replication data set). In the first cohort consisting of male Dutch military servicemen (n=93), the emergence of PTSD symptoms over a deployment period to a combat zone was significantly associated with alterations in DNA methylation levels at 17 genomic positions and 12 genomic regions. Evidence for mediation of the relation between combat trauma and PTSD symptoms by longitudinal changes in DNA methylation was observed at several positions and regions. Bioinformatic analyses of the reported associations identified significant enrichment in several pathways relevant for symptoms of PTSD. Targeted analyses of the significant findings from the discovery sample in an independent prospective cohort of male US marines (n=98) replicated the observed relation between decreases in DNA methylation levels and PTSD symptoms at genomic regions in ZFP57, RNF39 and HIST1H2APS2. Together, our study pinpoints three novel genomic regions where longitudinal decreases in DNA methylation across the period of exposure to combat trauma marks susceptibility for PTSD.

  18. Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

    PubMed Central

    Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E


    Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: PMID:27351255

  19. Mesenchymal and embryonic characteristics of stem cells obtained from mouse dental pulp.


    Guimarães, Elisalva Teixeira; Cruz, Gabriela Silva; de Jesus, Alan Araújo; Lacerda de Carvalho, Acácia Fernandes; Rogatto, Silvia Regina; Pereira, Lygia da Veiga; Ribeiro-dos-Santos, Ricardo; Soares, Milena Botelho Pereira


    Several studies have demonstrated that human dental pulp is a source of mesenchymal stem cells. To better understand the biological properties of these cells we isolated and characterized stem cells from the dental pulp of EGFP transgenic mice. The pulp tissue was gently separated from the roots of teeth extracted from C57BL/6 mice, and cultured under appropriate conditions. Flow cytometry, RT-PCR, light microscopy (staining for alkaline phosphatase) and immunofluorescence were used to investigate the expression of stem cell markers. The presence of chromosomal abnormalities was evaluated by G banding. The mouse dental pulp stem cells (mDPSC) were highly proliferative, plastic-adherent, and exhibited a polymorphic morphology predominantly with stellate or fusiform shapes. The presence of cell clusters was observed in cultures of mDPSC. Some cells were positive for alkaline phosphatase. The karyotype was normal until the 5th passage. The Pou5f1/Oct-4 and ZFP42/Rex-1, but not Nanog transcripts were detected in mDPSC. Flow cytometry and fluorescence analyses revealed the presence of a heterogeneous population positive for embryonic and mesenchymal cell markers. Adipogenic, chondrogenic and osteogenic differentiation was achieved after two weeks of cell culture under chemically defined in vitro conditions. In addition, some elongated cells spontaneously acquired a contraction capacity. Our results reinforce that the dental pulp is an important source of adult stem cells and encourage studies on therapeutic potential of mDPSC in experimental disease models. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. OsDOG, a gibberellin-induced A20/AN1 zinc-finger protein, negatively regulates gibberellin-mediated cell elongation in rice.


    Liu, Yaju; Xu, Yunyuan; Xiao, Jun; Ma, Qibin; Li, Dan; Xue, Zhen; Chong, Kang


    The A20/AN1 zinc-finger proteins (ZFPs) play pivotal roles in animal immune responses and plant stress responses. From previous gibberellin (GA) microarray data and A20/AN1 ZFP family member association, we chose Oryza sativa dwarf rice with overexpression of gibberellin-induced gene (OsDOG) to examine its function in the GA pathway. OsDOG was induced by gibberellic acid (GA(3)) and repressed by the GA-synthesis inhibitor paclobutrazol. Different transgenic lines with constitutive expression of OsDOG showed dwarf phenotypes due to deficiency of cell elongation. Additional GA(1) and real-time PCR quantitative assay analyses confirmed that the decrease of GA(1) in the overexpression lines resulted from reduced expression of GA3ox2 and enhanced expression of GA2ox1 and GA2ox3. Adding exogenous GA rescued the constitutive expression phenotypes of the transgenic lines. OsDOG has a novel function in regulating GA homeostasis and in negative maintenance of plant cell elongation in rice. Copyright © 2011 Elsevier GmbH. All rights reserved.

  1. An eleven gene molecular signature for extra-capsular spread in oral squamous cell carcinoma serves as a prognosticator of outcome in patients without nodal metastases.


    Wang, Weining; Lim, Weng Khong; Leong, Hui Sun; Chong, Fui Teen; Lim, Tony K H; Tan, Daniel S W; Teh, Bin Tean; Iyer, N Gopalakrishna


    Extracapsular spread (ECS) is an important prognostic factor for oral squamous cell carcinoma (OSCC) and is used to guide management. In this study, we aimed to identify an expression profile signature for ECS in node-positive OSCC using data derived from two different sources: a cohort of OSCC patients from our institution (National Cancer Centre Singapore) and The Cancer Genome Atlas (TCGA) head and neck squamous cell carcinoma (HNSCC) cohort. We also sought to determine if this signature could serve as a prognostic factor in node negative cancers. Patients with a histological diagnosis of OSCC were identified from an institutional database and fresh tumor samples were retrieved. RNA was extracted and gene expression profiling was performed using the Affymetrix GeneChip Human Genome U133 Plus 2.0 microarray platform. RNA sequence data and corresponding clinical data for the TCGA HNSCC cohort were downloaded from the TCGA Data Portal. All data analyses were conducted using R package and SPSS. We identified an 11 gene signature (GGH, MTFR1, CDKN3, PSRC1, SMIM3, CA9, IRX4, CPA3, ZSCAN16, CBX7 and ZFP3) which was robust in segregating tumors by ECS status. In node negative patients, patients harboring this ECS signature had a significantly worse overall survival (p=0.04). An eleven gene signature for ECS was derived. Our results also suggest that this signature is prognostic in a separate subset of patients with no nodal metastasis Further validation of this signature on other datasets and immunohistochemical studies are required to establish utility of this signature in stratifying early stage OSCC patients. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Zinc finger protein designed to target 2-long terminal repeat junctions interferes with human immunodeficiency virus integration.


    Sakkhachornphop, Supachai; Barbas, Carlos F; Keawvichit, Rassamee; Wongworapat, Kanlaya; Tayapiwatana, Chatchai


    Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine-adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future.

  3. Zinc Finger Protein Designed to Target 2-Long Terminal Repeat Junctions Interferes with Human Immunodeficiency Virus Integration

    PubMed Central

    Sakkhachornphop, Supachai; Barbas, Carlos F.; Keawvichit, Rassamee; Wongworapat, Kanlaya


    Abstract Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine–adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future. PMID:22429108

  4. Molecular Factors Underlying the Deposition of Intramuscular Fat and Collagen in Skeletal Muscle of Nellore and Angus Cattle

    PubMed Central

    Martins, Taiane S.; Sanglard, Letícia M. P.; Silva, Walmir; Chizzotti, Mário L.; Rennó, Luciana N.; Serão, Nick V. L.; Silva, Fabyano F.; Guimarães, Simone E. F.; Ladeira, Márcio M.; Dodson, Michael V.; Du, Min; Duarte, Marcio S.


    Studies have shown that intramuscular adipogenesis and fibrogenesis may concomitantly occur in skeletal muscle of beef cattle. Thus, we hypothesized that the discrepancy of intramuscular fat content in beef from Nellore and Angus was associated with differences in intramuscular adipogenesis and fibrogenesis during the finishing phase. To test our hypothesis, longissimus muscle samples of Nellore (n = 6; BW = 372.5 ± 37.3 kg) and Angus (n = 6; BW = 382.8 ± 23.9 kg) cattle were collected for analysis of gene and protein expression, and quantification of intramuscular fat and collagen. Least-squares means were estimated for the effect of Breed and differences were considered at P ≤ 0.05. A greater intramuscular fat content was observed in skeletal muscle of Angus compared to Nellore cattle (P≤0.05). No differences were observed for mRNA expression of lipogenic and lipolytic markers ACC, FAS, FABP4, SERBP–1, CPT–2, LPL, and ACOX (P > 0.05) in skeletal muscle of Nellore and Angus cattle. Similarly, no differences were observed in mRNA expression of adipogenic markers Zfp423, PPARγ, and C/EBPα (P>0.05) However, a greater PPARγ protein content was observed in skeletal muscle of Angus compared to Nellore cattle (P≤0.05). A greater abundance of adipo/fibrogenic cells, evaluated by the PDGFRα content, was observed in skeletal muscle of Angus than Nellore cattle (P≤0.05). No differences in fibrogenesis were observed in skeletal muscle of Angus and Nellore cattle, which is in accordance with the lack of differences in intramuscular collagen content in beef from both breeds (P>0.05). These findings demonstrate that difference in intramuscular fat content is associated with a slightly enhanced adipogenesis in skeletal muscle of Angus compared to Nellore cattle, while no difference in fibrogenesis. PMID:26436893

  5. Identification of Genes Whose Expression Profile Is Associated with Non-Progression towards AIDS Using eQTLs

    PubMed Central

    Le Clerc, Sigrid; van Manen, Daniëlle; Coulonges, Cédric; Ulveling, Damien; Laville, Vincent; Labib, Taoufik; Taing, Lieng; Delaneau, Olivier; Montes, Matthieu; Schuitemaker, Hanneke; Zagury, Jean-François


    Background Many genome-wide association studies have been performed on progression towards the acquired immune deficiency syndrome (AIDS) and they mainly identified associations within the HLA loci. In this study, we demonstrate that the integration of biological information, namely gene expression data, can enhance the sensitivity of genetic studies to unravel new genetic associations relevant to AIDS. Methods We collated the biological information compiled from three databases of expression quantitative trait loci (eQTLs) involved in cells of the immune system. We derived a list of single nucleotide polymorphisms (SNPs) that are functional in that they correlate with differential expression of genes in at least two of the databases. We tested the association of those SNPs with AIDS progression in two cohorts, GRIV and ACS. Tests on permuted phenotypes of the GRIV and ACS cohorts or on randomised sets of equivalent SNPs allowed us to assess the statistical robustness of this method and to estimate the true positive rate. Results Eight genes were identified with high confidence (p = 0.001, rate of true positives 75%). Some of those genes had previously been linked with HIV infection. Notably, ENTPD4 belongs to the same family as CD39, whose expression has already been associated with AIDS progression; while DNAJB12 is part of the HSP90 pathway, which is involved in the control of HIV latency. Our study also drew our attention to lesser-known functions such as mitochondrial ribosomal proteins and a zinc finger protein, ZFP57, which could be central to the effectiveness of HIV infection. Interestingly, for six out of those eight genes, down-regulation is associated with non-progression, which makes them appealing targets to develop drugs against HIV. PMID:26367535

  6. The RNA-binding protein TTP is a global post-transcriptional regulator of feedback control in inflammation

    PubMed Central

    Tiedje, Christopher; Diaz-Muñoz, Manuel D.; Trulley, Philipp; Ahlfors, Helena; Laaß, Kathrin; Blackshear, Perry J.; Turner, Martin; Gaestel, Matthias


    RNA-binding proteins (RBPs) facilitate post-transcriptional control of eukaryotic gene expression at multiple levels. The RBP tristetraprolin (TTP/Zfp36) is a signal-induced phosphorylated anti-inflammatory protein guiding unstable mRNAs of pro-inflammatory proteins for degradation and preventing translation. Using iCLIP, we have identified numerous mRNA targets bound by wild-type TTP and by a non-MK2-phosphorylatable TTP mutant (TTP-AA) in 1 h LPS-stimulated macrophages and correlated their interaction with TTP to changes at the level of mRNA abundance and translation in a transcriptome-wide manner. The close similarity of the transcriptomes of TTP-deficient and TTP-expressing macrophages upon short LPS stimulation suggested an effective inactivation of TTP by MK2, whereas retained RNA-binding capacity of TTP-AA to 3′UTRs caused profound changes in the transcriptome and translatome, altered NF-κB-activation and induced cell death. Increased TTP binding to the 3′UTR of feedback inhibitor mRNAs, such as Ier3, Dusp1 or Tnfaip3, in the absence of MK2-dependent TTP neutralization resulted in a strong reduction of their protein synthesis contributing to the deregulation of the NF-κB-signaling pathway. Taken together, our study uncovers a role of TTP as a suppressor of feedback inhibitors of inflammation and highlights the importance of fine-tuned TTP activity-regulation by MK2 in order to control the pro-inflammatory response. PMID:27220464

  7. SOX9 as a Predictor for Neurogenesis Potentiality of Amniotic Fluid Stem Cells

    PubMed Central

    Wei, Pei-Cih; Chao, Angel; Peng, Hsiu-Huei; Chao, An-Shine; Chang, Yao-Lung; Chang, Shuenn-Dyh; Wang, Hsin-Shih; Chang, Yu-Jen; Tsai, Ming-Song; Sieber, Martin; Chen, Hua-Chien; Chen, Shu-Jen; Lee, Yun-Shien


    Preclinical studies of amniotic fluid-derived cell therapy have been successful in the research of neurodegenerative diseases, peripheral nerve injury, spinal cord injury, and brain ischemia. Transplantation of human amniotic fluid stem cells (AFSCs) into rat brain ventricles has shown improvement in symptoms of Parkinson's disease and also highlighted the minimal immune rejection risk of AFSCs, even between species. Although AFSCs appeared to be a promising resource for cell-based regenerative therapy, AFSCs contain a heterogeneous pool of distinct cell types, rendering each preparation of AFSCs unique. Identification of predictive markers for neuron-prone AFSCs is necessary before such stem cell-based therapeutics can become a reality. In an attempt to identify markers of AFSCs to predict their ability for neurogenesis, we performed a two-phase study. In the discovery phase of 23 AFSCs, we tested ZNF521/Zfp521, OCT6, SOX1, SOX2, SOX3, and SOX9 as predictive markers of AFSCs for neural differentiation. In the validation phase, the efficacy of these predictive markers was tested in independent sets of 18 AFSCs and 14 dental pulp stem cells (DPSCs). We found that high expression of SOX9 in AFSCs is associated with good neurogenetic ability, and these positive correlations were confirmed in independent sets of AFSCs and DPSCs. Furthermore, knockdown of SOX9 in AFSCs inhibited their neuronal differentiation. In conclusion, the discovery of SOX9 as a predictive marker for neuron-prone AFSCs could expedite the selection of useful clones for regenerative medicine, in particular, in neurological diseases and injuries. PMID:25154783

  8. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

    PubMed Central

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina


    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

  9. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.


    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina


    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

  10. Cosmological Particle Data Compression in Practice

    NASA Astrophysics Data System (ADS)

    Zeyen, M.; Ahrens, J.; Hagen, H.; Heitmann, K.; Habib, S.


    In cosmological simulations trillions of particles are handled and several terabytes of unstructured particle data are generated in each time step. Transferring this data directly from memory to disk in an uncompressed way results in a massive load on I/O and storage systems. Hence, one goal of domain scientists is to compress the data before storing it to disk while minimizing the loss of information. To prevent reading back uncompressed data from disk, this can be done in an in-situ process. Since the simulation continuously generates data, the available time for the compression of one time step is limited. Therefore, the evaluation of compression techniques has shifted from only focusing on compression rates to include run-times and scalability.In recent years several compression techniques for cosmological data have become available. These techniques can be either lossy or lossless, depending on the technique. For both cases, this study aims to evaluate and compare the state of the art compression techniques for unstructured particle data. This study focuses on the techniques available in the Blosc framework with its multi-threading support, the XZ Utils toolkit with the LZMA algorithm that achieves high compression rates, and the widespread FPZIP and ZFP methods for lossy compressions.For the investigated compression techniques, quantitative performance indicators such as compression rates, run-time/throughput, and reconstruction errors are measured. Based on these factors, this study offers a comprehensive analysis of the individual techniques and discusses their applicability for in-situ compression. In addition, domain specific measures are evaluated on the reconstructed data sets, and the relative error rates and statistical properties are analyzed and compared. Based on this study future challenges and directions in the compression of unstructured cosmological particle data were identified.

  11. Molecular Factors Underlying the Deposition of Intramuscular Fat and Collagen in Skeletal Muscle of Nellore and Angus Cattle.


    Martins, Taiane S; Sanglard, Letícia M P; Silva, Walmir; Chizzotti, Mário L; Rennó, Luciana N; Serão, Nick V L; Silva, Fabyano F; Guimarães, Simone E F; Ladeira, Márcio M; Dodson, Michael V; Du, Min; Duarte, Marcio S


    Studies have shown that intramuscular adipogenesis and fibrogenesis may concomitantly occur in skeletal muscle of beef cattle. Thus, we hypothesized that the discrepancy of intramuscular fat content in beef from Nellore and Angus was associated with differences in intramuscular adipogenesis and fibrogenesis during the finishing phase. To test our hypothesis, longissimus muscle samples of Nellore (n = 6; BW = 372.5 ± 37.3 kg) and Angus (n = 6; BW = 382.8 ± 23.9 kg) cattle were collected for analysis of gene and protein expression, and quantification of intramuscular fat and collagen. Least-squares means were estimated for the effect of Breed and differences were considered at P ≤ 0.05. A greater intramuscular fat content was observed in skeletal muscle of Angus compared to Nellore cattle (P≤0.05). No differences were observed for mRNA expression of lipogenic and lipolytic markers ACC, FAS, FABP4, SERBP-1, CPT-2, LPL, and ACOX (P > 0.05) in skeletal muscle of Nellore and Angus cattle. Similarly, no differences were observed in mRNA expression of adipogenic markers Zfp423, PPARγ, and C/EBPα (P>0.05) However, a greater PPARγ protein content was observed in skeletal muscle of Angus compared to Nellore cattle (P≤0.05). A greater abundance of adipo/fibrogenic cells, evaluated by the PDGFRα content, was observed in skeletal muscle of Angus than Nellore cattle (P≤0.05). No differences in fibrogenesis were observed in skeletal muscle of Angus and Nellore cattle, which is in accordance with the lack of differences in intramuscular collagen content in beef from both breeds (P>0.05). These findings demonstrate that difference in intramuscular fat content is associated with a slightly enhanced adipogenesis in skeletal muscle of Angus compared to Nellore cattle, while no difference in fibrogenesis.

  12. Enhancement of adipogenesis and fibrogenesis in skeletal muscle of Wagyu compared with Angus cattle.


    Duarte, M S; Paulino, P V R; Das, A K; Wei, S; Serão, N V L; Fu, X; Harris, S M; Dodson, M V; Du, M


    Intramuscular fat and collagen content are major factors affecting beef quality, but mechanisms regulating intramuscular adipose and connective tissue deposition are far from clear. Japanese Wagyu cattle are well known for their extremely high marbling. The objective of this study was to evaluate intramuscular fat (IMF) and collagen deposition in the muscle of Wagyu compared with Angus cattle. Animals were managed under the same condition and slaughtered at an averaging 585 ± 12.1 kg of BW. Samples of sternomandibularis muscle were collected from Wagyu (n = 3) and Angus (n = 3) for molecular and histological investigations of adipogenesis and fibrogenesis. With exception of C/EBPβ (P = 0.2864), the expression of the adipogenic markers C/EBPα (P = 0.008), PPARγ (P = 0.028), and zip finger protein 423 (Zfp423; P = 0.047) in Wagyu were greater than in Angus muscle, which was consistent with greater IMF deposition in Wagyu (P < 0.05). In addition, more adipocytes and preadipocytes were detected intramuscularly in Wagyu cattle. Similarly, fibrogenesis was also enhanced in Wagyu, with a greater expression of fibroblast growth factor (FGF)-2 (P = 0.028), FGF receptor 1 (P = 0.030), transforming growth factor (TGF)-β (P = 0.028), collagen I (P = 0.012), and collagen III (P = 0.025). Similarly, Wagyu muscle had greater collagen content (P = 0.002) and decreased collagen solubility (P = 0.005). In addition, muscle fiber diameter was larger (P < 0.0001) in Wagyu than in Angus cattle. These results clearly show that both IMF and collagen contents are enhanced in Wagyu cattle and more adipogenic cells are detected in Wagyu muscle, indicating intramuscular adipogenesis is enhanced in Wagyu compared with Angus muscle.

  13. Critical role of zinc finger protein 521 in the control of growth, clonogenicity and tumorigenic potential of medulloblastoma cells

    PubMed Central

    Iaccino, Enrico; Scicchitano, Stefania; Lupia, Michela; Chiarella, Emanuela; Mega, Tiziana; Bernaudo, Francesca; Pelaggi, Daniela; Mesuraca, Maria; Pazzaglia, Simonetta; Semenkow, Samantha; Bar, Eli E.; Kool, Marcel; Pfister, Stefan; Bond, Heather M.; Eberhart, Charles G.; Steinkühler, Christian; Morrone, Giovanni


    The stem cell-associated transcription co-factor ZNF521 has been implicated in the control of hematopoietic, osteo-adipogenic and neural progenitor cells. ZNF521 is highly expressed in cerebellum and in particular in the neonatal external granule layer that contains candidate medulloblastoma cells-of-origin, and in the majority of human medulloblastomas. Here we have explored its involvement in the control of human and murine medulloblastoma cells. The effect of ZNF521 on growth and tumorigenic potential of human medulloblastoma cell lines as well as primary Ptc1−/+ mouse medulloblastoma cells was investigated in a variety of in vitro and in vivo assays, by modulating its expression using lentiviral vectors carrying the ZNF521 cDNA, or shRNAs that silence its expression. Enforced overexpression of ZNF521 in DAOY medulloblastoma cells significantly increased their proliferation, growth as spheroids and ability to generate clones in single-cell cultures and semisolid media, and enhanced their migratory ability in wound-healing assays. Importantly, ZNF521-expressing cells displayed a greatly enhanced tumorigenic potential in nude mice. All these activities required the ZNF521 N-terminal motif that recruits the nucleosome remodeling and histone deacetylase complex, which might therefore represent an appealing therapeutic target. Conversely, silencing of ZNF521 in human UW228 medulloblastoma cells that display high baseline expression decreased their proliferation, clonogenicity, sphere formation and wound-healing ability. Similarly, Zfp521 silencing in mouse Ptc1−/+ medulloblastoma cells drastically reduced their growth and tumorigenic potential. Our data strongly support the notion that ZNF521, through the recruitment of the NuRD complex, contributes to the clonogenic growth, migration and tumorigenicity of medulloblastoma cells. PMID:23907569

  14. Critical role of zinc finger protein 521 in the control of growth, clonogenicity and tumorigenic potential of medulloblastoma cells.


    Spina, Raffaella; Filocamo, Gessica; Iaccino, Enrico; Scicchitano, Stefania; Lupia, Michela; Chiarella, Emanuela; Mega, Tiziana; Bernaudo, Francesca; Pelaggi, Daniela; Mesuraca, Maria; Pazzaglia, Simonetta; Semenkow, Samantha; Bar, Eli E; Kool, Marcel; Pfister, Stefan; Bond, Heather M; Eberhart, Charles G; Steinkühler, Christian; Morrone, Giovanni


    The stem cell-associated transcription co-factor ZNF521 has been implicated in the control of hematopoietic, osteo-adipogenic and neural progenitor cells. ZNF521 is highly expressed in cerebellum and in particular in the neonatal external granule layer that contains candidate medulloblastoma cells-of-origin, and in the majority of human medulloblastomas. Here we have explored its involvement in the control of human and murine medulloblastoma cells. The effect of ZNF521 on growth and tumorigenic potential of human medulloblastoma cell lines as well as primary Ptc1-/+ mouse medulloblastoma cells was investigated in a variety of in vitro and in vivo assays, by modulating its expression using lentiviral vectors carrying the ZNF521 cDNA, or shRNAs that silence its expression. Enforced overexpression of ZNF521 in DAOY medulloblastoma cells significantly increased their proliferation, growth as spheroids and ability to generate clones in single-cell cultures and semisolid media, and enhanced their migratory ability in wound-healing assays. Importantly, ZNF521-expressing cells displayed a greatly enhanced tumorigenic potential in nude mice. All these activities required the ZNF521 N-terminal motif that recruits the nucleosome remodeling and histone deacetylase complex, which might therefore represent an appealing therapeutic target. Conversely, silencing of ZNF521 in human UW228 medulloblastoma cells that display high baseline expression decreased their proliferation, clonogenicity, sphere formation and wound-healing ability. Similarly, Zfp521 silencing in mouse Ptc1-/+ medulloblastoma cells drastically reduced their growth and tumorigenic potential. Our data strongly support the notion that ZNF521, through the recruitment of the NuRD complex, contributes to the clonogenic growth, migration and tumorigenicity of medulloblastoma cells.

  15. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.


    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein


    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  16. Transcriptional profiling and biomarker identification reveal tissue specific effects of expanded ataxin-3 in a spinocerebellar ataxia type 3 mouse model.


    Toonen, Lodewijk J A; Overzier, Maurice; Evers, Melvin M; Leon, Leticia G; van der Zeeuw, Sander A J; Mei, Hailiang; Kielbasa, Szymon M; Goeman, Jelle J; Hettne, Kristina M; Magnusson, Olafur Th; Poirel, Marion; Seyer, Alexandre; 't Hoen, Peter A C; van Roon-Mom, Willeke M C


    Spinocerebellar ataxia type 3 (SCA3) is a progressive neurodegenerative disorder caused by expansion of the polyglutamine repeat in the ataxin-3 protein. Expression of mutant ataxin-3 is known to result in transcriptional dysregulation, which can contribute to the cellular toxicity and neurodegeneration. Since the exact causative mechanisms underlying this process have not been fully elucidated, gene expression analyses in brains of transgenic SCA3 mouse models may provide useful insights. Here we characterised the MJD84.2 SCA3 mouse model expressing the mutant human ataxin-3 gene using a multi-omics approach on brain and blood. Gene expression changes in brainstem, cerebellum, striatum and cortex were used to study pathological changes in brain, while blood gene expression and metabolites/lipids levels were examined as potential biomarkers for disease. Despite normal motor performance at 17.5 months of age, transcriptional changes in brain tissue of the SCA3 mice were observed. Most transcriptional changes occurred in brainstem and striatum, whilst cerebellum and cortex were only modestly affected. The most significantly altered genes in SCA3 mouse brain were Tmc3, Zfp488, Car2, and Chdh. Based on the transcriptional changes, α-adrenergic and CREB pathways were most consistently altered for combined analysis of the four brain regions. When examining individual brain regions, axon guidance and synaptic transmission pathways were most strongly altered in striatum, whilst brainstem presented with strongest alterations in the pi-3 k cascade and cholesterol biosynthesis pathways. Similar to other neurodegenerative diseases, reduced levels of tryptophan and increased levels of ceramides, di- and triglycerides were observed in SCA3 mouse blood. The observed transcriptional changes in SCA3 mouse brain reveal parallels with previous reported neuropathology in patients, but also shows brain region specific effects as well as involvement of adrenergic signalling and CREB

  17. Mechanical Strain Promotes Oligodendrocyte Differentiation by Global Changes of Gene Expression

    PubMed Central

    Jagielska, Anna; Lowe, Alexis L.; Makhija, Ekta; Wroblewska, Liliana; Guck, Jochen; Franklin, Robin J. M.; Shivashankar, G. V.; Van Vliet, Krystyn J.


    Differentiation of oligodendrocyte progenitor cells (OPC) to oligodendrocytes and subsequent axon myelination are critical steps in vertebrate central nervous system (CNS) development and regeneration. Growing evidence supports the significance of mechanical factors in oligodendrocyte biology. Here, we explore the effect of mechanical strains within physiological range on OPC proliferation and differentiation, and strain-associated changes in chromatin structure, epigenetics, and gene expression. Sustained tensile strain of 10–15% inhibited OPC proliferation and promoted differentiation into oligodendrocytes. This response to strain required specific interactions of OPCs with extracellular matrix ligands. Applied strain induced changes in nuclear shape, chromatin organization, and resulted in enhanced histone deacetylation, consistent with increased oligodendrocyte differentiation. This response was concurrent with increased mRNA levels of the epigenetic modifier histone deacetylase Hdac11. Inhibition of HDAC proteins eliminated the strain-mediated increase of OPC differentiation, demonstrating a role of HDACs in mechanotransduction of strain to chromatin. RNA sequencing revealed global changes in gene expression associated with strain. Specifically, expression of multiple genes associated with oligodendrocyte differentiation and axon-oligodendrocyte interactions was increased, including cell surface ligands (Ncam, ephrins), cyto- and nucleo-skeleton genes (Fyn, actinins, myosin, nesprin, Sun1), transcription factors (Sox10, Zfp191, Nkx2.2), and myelin genes (Cnp, Plp, Mag). These findings show how mechanical strain can be transmitted to the nucleus to promote oligodendrocyte differentiation, and identify the global landscape of signaling pathways involved in mechanotransduction. These data provide a source of potential new therapeutic avenues to enhance OPC differentiation in vivo. PMID:28473753

  18. Drought response in wheat: key genes and regulatory mechanisms controlling root system architecture and transpiration efficiency

    NASA Astrophysics Data System (ADS)

    Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh


    Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome

  19. Genome-Wide Association Analysis of Sasang Constitution in the Korean Population

    PubMed Central

    Kim, Bu-Yeo; Jin, Hee-Jeong


    Abstract Objectives Sasang constitutional medicine is a traditional Korean medicine in which an individual is classified into one of four types of constitution: Taeum (TE), Soeum (SE) Soyang (SY), and Taeyang (TY). These constitution types are determined with biologic and physiologic characteristics, so it has been assumed that genetic factors are associated with each constitution type. Identifying the genetic elements underlying each constitution is necessary for the elucidation of the molecular mechanism of Sasang constitutional medicine. Design A total of 341,998 genetic loci across the whole genome were genotyped for 1222 subjects of defined constitution type. The genetic loci associated with each constitution type were identified and the functional connectivity of genes within these loci was analyzed using statistical text mining. Results From the difference in allele frequencies between constitution types, significant genetic loci associated with each type were identified. Chromosomes 3q27.3 (rs10937331, p=2.71×10−6), 15q22.2 (rs7180547, p=1.58×10−6), and 14q22.3 (rs12431592, p=1.31×10−6) were most significantly associated with TE, SE, and SY constitution types, respectively. From the functional relationship analysis using all loci with a p-value≤10−4, genes associated with each constitution type were identified. Fifteen (15) genes, including GPM6A, SYT4, and GRIK1, were significantly associated with the TE constitution type (p<0.05); 12 genes, including DRGX and AKAP11, were significantly associated with the SE constitution type (p<0.05); and 17 genes, including ZFP42, CDH22, ALDH1A2, OTX2, and EN2, were significantly associated with the SY constitution type (p<0.05). Conclusions Genetic loci and genes associated with Sasang constitution types were systematically identified from a genome-wide association study using a large number of subjects. PMID:22394158

  20. Signed weighted gene co-expression network analysis of transcriptional regulation in murine embryonic stem cells

    PubMed Central

    Mason, Mike J; Fan, Guoping; Plath, Kathrin; Zhou, Qing; Horvath, Steve


    Background Recent work has revealed that a core group of transcription factors (TFs) regulates the key characteristics of embryonic stem (ES) cells: pluripotency and self-renewal. Current efforts focus on identifying genes that play important roles in maintaining pluripotency and self-renewal in ES cells and aim to understand the interactions among these genes. To that end, we investigated the use of unsigned and signed network analysis to identify pluripotency and differentiation related genes. Results We show that signed networks provide a better systems level understanding of the regulatory mechanisms of ES cells than unsigned networks, using two independent murine ES cell expression data sets. Specifically, using signed weighted gene co-expression network analysis (WGCNA), we found a pluripotency module and a differentiation module, which are not identified in unsigned networks. We confirmed the importance of these modules by incorporating genome-wide TF binding data for key ES cell regulators. Interestingly, we find that the pluripotency module is enriched with genes related to DNA damage repair and mitochondrial function in addition to transcriptional regulation. Using a connectivity measure of module membership, we not only identify known regulators of ES cells but also show that Mrpl15, Msh6, Nrf1, Nup133, Ppif, Rbpj, Sh3gl2, and Zfp39, among other genes, have important roles in maintaining ES cell pluripotency and self-renewal. We also report highly significant relationships between module membership and epigenetic modifications (histone modifications and promoter CpG methylation status), which are known to play a role in controlling gene expression during ES cell self-renewal and differentiation. Conclusion Our systems biologic re-analysis of gene expression, transcription factor binding, epigenetic and gene ontology data provides a novel integrative view of ES cell biology. PMID:19619308

  1. Identification of key microRNAs and genes in preeclampsia by bioinformatics analysis

    PubMed Central

    Luo, Shouling; Cao, Nannan; Tang, Yao; Gu, Weirong


    Preeclampsia is a leading cause of perinatal maternal–foetal mortality and morbidity. The aim of this study is to identify the key microRNAs and genes in preeclampsia and uncover their potential functions. We downloaded the miRNA expression profile of GSE84260 and the gene expression profile of GSE73374 from the Gene Expression Omnibus database. Differentially expressed miRNAs and genes were identified and compared to miRNA-target information from MiRWalk 2.0, and a total of 65 differentially expressed miRNAs (DEMIs), including 32 up-regulated miRNAs and 33 down-regulated miRNAs, and 91 differentially expressed genes (DEGs), including 83 up-regulated genes and 8 down-regulated genes, were identified. The pathway enrichment analyses of the DEMIs showed that the up-regulated DEMIs were enriched in the Hippo signalling pathway and MAPK signalling pathway, and the down-regulated DEMIs were enriched in HTLV-I infection and miRNAs in cancers. The gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) enrichment analyses of the DEGs were performed using Multifaceted Analysis Tool for Human Transcriptome. The up-regulated DEGs were enriched in biological processes (BPs), including the response to cAMP, response to hydrogen peroxide and cell-cell adhesion mediated by integrin; no enrichment of down-regulated DEGs was identified. KEGG analysis showed that the up-regulated DEGs were enriched in the Hippo signalling pathway and pathways in cancer. A PPI network of the DEGs was constructed by using Cytoscape software, and FOS, STAT1, MMP14, ITGB1, VCAN, DUSP1, LDHA, MCL1, MET, and ZFP36 were identified as the hub genes. The current study illustrates a characteristic microRNA profile and gene profile in preeclampsia, which may contribute to the interpretation of the progression of preeclampsia and provide novel biomarkers and therapeutic targets for preeclampsia. PMID:28594854

  2. Physiological and molecular characterization of drought responses and identification of candidate tolerance genes in cassava

    PubMed Central

    Turyagyenda, Laban F.; Kizito, Elizabeth B.; Ferguson, Morag; Baguma, Yona; Agaba, Morris; Harvey, Jagger J. W.; Osiru, David S. O.


    Cassava is an important root crop to resource-poor farmers in marginal areas, where its production faces drought stress constraints. Given the difficulties associated with cassava breeding, a molecular understanding of drought tolerance in cassava will help in the identification of markers for use in marker-assisted selection and genes for transgenic improvement of drought tolerance. This study was carried out to identify candidate drought-tolerance genes and expression-based markers of drought stress in cassava. One drought-tolerant (improved variety) and one drought-susceptible (farmer-preferred) cassava landrace were grown in the glasshouse under well-watered and water-stressed conditions. Their morphological, physiological and molecular responses to drought were characterized. Morphological and physiological measurements indicate that the tolerance of the improved variety is based on drought avoidance, through reduction of water loss via partial stomatal closure. Ten genes that have previously been biologically validated as conferring or being associated with drought tolerance in other plant species were confirmed as being drought responsive in cassava. Four genes (MeALDH, MeZFP, MeMSD and MeRD28) were identified as candidate cassava drought-tolerance genes, as they were exclusively up-regulated in the drought-tolerant genotype to comparable levels known to confer drought tolerance in other species. Based on these genes, we hypothesize that the basis of the tolerance at the cellular level is probably through mitigation of the oxidative burst and osmotic adjustment. This study provides an initial characterization of the molecular response of cassava to drought stress resembling field conditions. The drought-responsive genes can now be used as expression-based markers of drought stress tolerance in cassava, and the candidate tolerance genes tested in the context of breeding (as possible quantitative trait loci) and engineering drought tolerance in transgenics

  3. Evolutionally dynamic L1 regulation in embryonic stem cells

    PubMed Central

    Castro-Diaz, Nathaly; Ecco, Gabriela; Coluccio, Andrea; Kapopoulou, Adamandia; Yazdanpanah, Benyamin; Friedli, Marc; Duc, Julien; Jang, Suk Min; Turelli, Priscilla; Trono, Didier


    Mobile elements are important evolutionary forces that challenge genomic integrity. Long interspersed element-1 (L1, also known as LINE-1) is the only autonomous transposon still active in the human genome. It displays an unusual pattern of evolution, with, at any given time, a single active L1 lineage amplifying to thousands of copies before getting replaced by a new lineage, likely under pressure of host restriction factors, which act notably by silencing L1 expression during early embryogenesis. Here, we demonstrate that in human embryonic stem (hES) cells, KAP1 (KRAB [Krüppel-associated box domain]-associated protein 1), the master cofactor of KRAB-containing zinc finger proteins (KRAB-ZFPs) previously implicated in the restriction of endogenous retroviruses, represses a discrete subset of L1 lineages predicted to have entered the ancestral genome between 26.8 million and 7.6 million years ago. In mice, we documented a similar chronologically conditioned pattern, albeit with a much contracted time scale. We could further identify an L1-binding KRAB-ZFP, suggesting that this rapidly evolving protein family is more globally responsible for L1 recognition. KAP1 knockdown in hES cells induced the expression of KAP1-bound L1 elements, but their younger, human-specific counterparts (L1Hs) were unaffected. Instead, they were stimulated by depleting DNA methyltransferases, consistent with recent evidence demonstrating that the PIWI–piRNA (PIWI-interacting RNA) pathway regulates L1Hs in hES cells. Altogether, these data indicate that the early embryonic control of L1 is an evolutionarily dynamic process and support a model in which newly emerged lineages are first suppressed by DNA methylation-inducing small RNA-based mechanisms before KAP1-recruiting protein repressors are selected. PMID:24939876

  4. Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation

    PubMed Central

    Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin


    Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

  5. Macaca specific exon creation event generates a novel ZKSCAN5 transcript.


    Kim, Young-Hyun; Choe, Se-Hee; Song, Bong-Seok; Park, Sang-Je; Kim, Myung-Jin; Park, Young-Ho; Yoon, Seung-Bin; Lee, Youngjeon; Jin, Yeung Bae; Sim, Bo-Woong; Kim, Ji-Su; Jeong, Kang-Jin; Kim, Sun-Uk; Lee, Sang-Rae; Park, Young-Il; Huh, Jae-Won; Chang, Kyu-Tae


    ZKSCAN5 (also known as ZFP95) is a zinc-finger protein belonging to the Krűppel family. ZKSCAN5 contains a SCAN box and a KRAB A domain and is proposed to play a distinct role during spermatogenesis. In humans, alternatively spliced ZKSCAN5 transcripts with different 5'-untranslated regions (UTRs) have been identified. However, investigation of our Macaca UniGene Database revealed novel alternative ZKSCAN5 transcripts that arose due to an exon creation event. Therefore, in this study, we identified the full-length sequences of ZKSCAN5 and its alternative transcripts in Macaca spp. Additionally, we investigated different nonhuman primate sequences to elucidate the molecular mechanism underlying the exon creation event. We analyzed the evolutionary features of the ZKSCAN5 transcripts by reverse transcription polymerase chain reaction (RT-PCR) and genomic PCR, and by sequencing various nonhuman primate DNA and RNA samples. The exon-created transcript was only detected in the Macaca lineage (crab-eating monkey and rhesus monkey). Full-length sequence analysis by rapid amplification of cDNA ends (RACE) identified ten full-length transcripts and four functional isoforms of ZKSCAN5. Protein sequence analyses revealed the presence of two groups of isoforms that arose because of differences in start-codon usage. Together, our results demonstrate that there has been specific selection for a discrete set of ZKSCAN5 variants in the Macaca lineage. Furthermore, study of this locus (and perhaps others) in Macaca spp. might facilitate our understanding of the evolutionary pressures that have shaped the mechanism of exon creation in primates. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels.


    Hupe, Mike; Li, Minerva Xueting; Kneitz, Susanne; Davydova, Daria; Yokota, Chika; Kele-Olovsson, Julianna; Hot, Belma; Stenman, Jan M; Gessler, Manfred


    The blood-brain barrier is a dynamic interface that separates the brain from the circulatory system, and it is formed by highly specialized endothelial cells. To explore the molecular mechanisms defining the unique nature of vascular development and differentiation in the brain, we generated high-resolution gene expression profiles of mouse embryonic brain endothelial cells using translating ribosome affinity purification and single-cell RNA sequencing. We compared the brain vascular translatome with the vascular translatomes of other organs and analyzed the vascular translatomes of the brain at different time points during embryonic development. Because canonical Wnt signaling is implicated in the formation of the blood-brain barrier, we also compared the brain endothelial translatome of wild-type mice with that of mice lacking the transcriptional cofactor β-catenin ( Ctnnb1 ). Our analysis revealed extensive molecular changes during the embryonic development of the brain endothelium. We identified genes encoding brain endothelium-specific transcription factors ( Foxf2 , Foxl2 , Foxq1 , Lef1 , Ppard , Zfp551 , and Zic3 ) that are associated with maturation of the blood-brain barrier and act downstream of the Wnt-β-catenin signaling pathway. Profiling of individual brain endothelial cells revealed substantial heterogeneity in the population. Nevertheless, the high abundance of Foxf2 , Foxq1 , Ppard , or Zic3 transcripts correlated with the increased expression of genes encoding markers of brain endothelial cell differentiation. Expression of Foxf2 and Zic3 in human umbilical vein endothelial cells induced the production of blood-brain barrier differentiation markers. This comprehensive data set may help to improve the engineering of in vitro blood-brain barrier models. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  7. Long Noncoding RNA-Associated Transcriptomic Changes in Resiliency or Susceptibility to Depression and Response to Antidepressant Treatment

    PubMed Central

    Roy, Bhaskar; Wang, Qingzhong; Dwivedi, Yogesh


    Abstract Background Recent emergence of long noncoding RNAs in regulating gene expression and thereby modulating physiological functions in brain has manifested their possible role in psychiatric disorders. In this study, the roles of long noncoding RNAs in susceptibility and resiliency to develop stress-induced depression and their response to antidepressant treatment were examined. Methods Microarray-based transcriptome-wide changes in long noncoding RNAs were determined in hippocampus of male Holtzman rats who showed susceptibility (learned helplessness) or resiliency (nonlearned helplessness) to develop depression. Changes in long noncoding RNA expression were also ascertained after subchronic administration of fluoxetine to learned helplessness rats. Bioinformatic and target prediction analyses (cis- and trans-acting) and qPCR-based assays were performed to decipher the functional role of altered long noncoding RNAs. Results Group-wise comparison showed an overrepresented class of long noncoding RNAs that were uniquely associated with nonlearned helplessness or learned helplessness behavior. Chromosomal mapping within the 5-kbp flank region of the top 20 dysregulated long noncoding RNAs in the learned helplessness group showed several target genes that were regulated through cis- or trans-actions, including Zbtb20 and Zfp385b from zinc finger binding protein family. Genomic context of differentially expressed long noncoding RNAs showed an overall blunted response in the learned helplessness group regardless of the long noncoding RNA classes analyzed. Gene ontology exhibited the functional clustering for anatomical structure development, cellular architecture modulation, protein metabolism, and cellular communications. Fluoxetine treatment reversed learned helplessness-induced changes in many long noncoding RNAs and target genes. Conclusions The involvement of specific classes of long noncoding RNAs with distinctive roles in modulating target gene expression

  8. Genome-wide Association Study of Subtype-Specific Epithelial Ovarian Cancer Risk Alleles Using Pooled DNA

    PubMed Central

    Earp, Madalene A.; Kelemen, Linda E.; Magliocco, Anthony M.; Swenerton, Kenneth D.; Chenevix–Trench, Georgia; Lu, Yi; Hein, Alexander; Ekici, Arif B.; Beckmann, Matthias W.; Fasching, Peter A.; Lambrechts, Diether; Despierre, Evelyn; Vergote, Ignace; Lambrechts, Sandrina; Doherty, Jennifer A.; Rossing, Mary Anne; Chang-Claude, Jenny; Rudolph, Anja; Friel, Grace; Moysich, Kirsten B.; Odunsi, Kunle; Sucheston-Campbell, Lara; Lurie, Galina; Goodman, Marc T.; Carney, Michael E.; Thompson, Pamela J.; Runnebaum, Ingo B.; Dürst, Matthias; Hillemanns, Peter; Dörk, Thilo; Antonenkova, Natalia; Bogdanova, Natalia; Leminen, Arto; Nevanlinna, Heli; Pelttari, Liisa M.; Butzow, Ralf; Bunker, Clareann H.; Modugno, Francesmary; Edwards, Robert P.; Ness, Roberta B.; du Bois, Andreas; Heitz, Florian; Schwaab, Ira; Harter, Philipp; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; Jensen, Allan; Kjær, Susanne K.; Høgdall, Claus K.; Høgdall, Estrid; Lundvall, Lene; Sellers, Thomas A.; Fridley, Brooke L.; Goode, Ellen L.; Cunningham, Julie M.; Vierkant, Robert A.; Giles, Graham G.; Baglietto, Laura; Severi, Gianluca; Southey, Melissa C.; Liang, Dong; Wu, Xifeng; Lu, Karen; Hildebrandt, Michelle A.T.; Levine, Douglas A.; Bisogna, Maria; Schildkraut, Joellen M.; Iversen, Edwin S.; Weber, Rachel Palmieri; Berchuck, Andrew; Cramer, Daniel W.; Terry, Kathryn L.; Poole, Elizabeth M.; Tworoger, Shelley S.; Bandera, Elisa V.; Chandran, Urmila; Orlow, Irene; Olson, Sara H.; Wik, Elisabeth; Salvesen, Helga B.; Bjorge, Line; Halle, Mari K.; van Altena, Anne M.; Aben, Katja K.H.; Kiemeney, Lambertus A.; Massuger, Leon F.A.G.; Pejovic, Tanja; Bean, Yukie T.; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Wentzensen, Nicolas; Brinton, Louise A.; Lissowska, Jolanta; Garcia–Closas, Montserrat; Dicks, Ed; Dennis, Joe; Easton, Douglas F.; Song, Honglin; Tyrer, Jonathan P.; Pharoah, Paul D. P.; Eccles, Diana; Campbell, Ian G.; Whittemore, Alice S.; McGuire, Valerie; Sieh, Weiva; Rothstein, Joseph H.; Flanagan, James M.; Paul, James; Brown, Robert; Phelan, Catherine M.; Risch, Harvey A.; McLaughlin, John R.; Narod, Steven A.; Ziogas, Argyrios; Anton-Culver, Hoda; Gentry-Maharaj, Aleksandra; Menon, Usha; Gayther, Simon A.; Ramus, Susan J.; Wu, Anna H.; Pearce, Celeste L.; Pike, Malcolm C.; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K; Szafron, Lukasz M; Kupryjanczyk, Jolanta; Cook, Linda S.; Le, Nhu D.; Brooks–Wilson, Angela


    Epithelial ovarian cancer (EOC) is a heterogeneous cancer with both genetic and environmental risk factors. Variants influencing the risk of developing the less-common EOC subtypes have not been fully investigated. We performed a genome-wide association study (GWAS) of EOC according to subtype by pooling genomic DNA from 545 cases and 398 controls of European descent, and testing for allelic associations. We evaluated for replication 188 variants from the GWAS (56 variants for mucinous, 55 for endometrioid and clear cell, 53 for low malignant potential (LMP) serous, and 24 for invasive serous EOC), selected using pre-defined criteria. Genotypes from 13,188 cases and 23,164 controls of European descent were used to perform unconditional logistic regression under the log-additive genetic model; odds ratios (OR) and 95% confidence intervals are reported. Nine variants tagging 6 loci were associated with subtype-specific EOC risk at P<0.05, and had an OR that agreed in direction of effect with the GWAS results. Several of these variants are in or near genes with a biological rationale for conferring EOC risk, including ZFP36L1 and RAD51B for mucinous EOC (rs17106154, OR=1.17, P=0.029, n=1,483 cases), GRB10 for endometrioid and clear cell EOC (rs2190503, P=0.014, n=2,903 cases), and C22orf26/BPIL2 for LMP serous EOC (rs9609538, OR=0.86, P=0.0043, n=892 cases). In analyses that included the 75 GWAS samples, the association between rs9609538 (OR=0.84, P=0.0007) and LMP serous EOC risk remained statistically significant at P<0.0012 adjusted for multiple testing. Replication in additional samples will be important to verify these results for the less-common EOC subtypes. PMID:24190013

  9. Repositioning of Memantine as a Potential Novel Therapeutic Agent against Meningitic E. coli–Induced Pathogenicities through Disease-Associated Alpha7 Cholinergic Pathway and RNA Sequencing-Based Transcriptome Analysis of Host Inflammatory Responses

    PubMed Central

    Peng, Liang; Wu, Chun-Hua; Cao, Hong; Zhong, John F.; Hoffman, Jill; Huang, Sheng-He


    Neonatal sepsis and meningitis (NSM) remains a leading cause worldwide of mortality and morbidity in newborn infants despite the availability of antibiotics over the last several decades. E. coli is the most common gram-negative pathogen causing NSM. Our previous studies show that α7 nicotinic receptor (α7 nAChR), an essential regulator of inflammation, plays a detrimental role in the host defense against NSM. Despite notable successes, there still exists an unmet need for new effective therapeutic approaches to treat this disease. Using the in vitro/in vivo models of the blood-brain barrier (BBB) and RNA-seq, we undertook a drug repositioning study to identify unknown antimicrobial activities for known drugs. We have demonstrated for the first time that memantine (MEM), a FDA-approved drug for treatment of Alzheimer’s disease, could very efficiently block E. coli-caused bacteremia and meningitis in a mouse model of NSM in a manner dependent on α7 nAChR. MEM was able to synergistically enhance the antibacterial activity of ampicillin in HBMEC infected with E. coli K1 (E44) and in neonatal mice with E44-caused bacteremia and meningitis. Differential gene expression analysis of RNA-Seq data from mouse BMEC infected with E. coli K1 showed that several E44-increased inflammatory factors, including IL33, IL18rap, MMP10 and Irs1, were significantly reduced by MEM compared to the infected cells without drug treatment. MEM could also significantly up-regulate anti-inflammatory factors, including Tnfaip3, CISH, Ptgds and Zfp36. Most interestingly, these factors may positively and negatively contribute to regulation of NF-κB, which is a hallmark feature of bacterial meningitis. Furthermore, we have demonstrated that circulating BMEC (cBMEC) are the potential novel biomarkers for NSM. MEM could significantly reduce E44-increased blood level of cBMEC in mice. Taken together, our data suggest that memantine can efficiently block host inflammatory responses to bacterial

  10. Deficiency in Aryl Hydrocarbon Receptor (AHR) Expression throughout Aging Alters Gene Expression Profiles in Murine Long-Term Hematopoietic Stem Cells

    PubMed Central

    Bennett, John A.; Singh, Kameshwar P.; Unnisa, Zeenath; Welle, Stephen L.; Gasiewicz, Thomas A.


    Dysregulation of hematopoietic stem cell (HSC) signaling can contribute to the development of diseases of the blood system. Lack of aryl hydrocarbon receptor (AhR) has been associated with alterations in gene expression related to HSC function and the subsequent development of a myeloproliferative disorder in aging female mice. We sorted the most primitive population of HSCs with the highest stem cell potential (Long-term, or LT-HSCs) from 18-month-old AhR-null-allele (AhR-KO) and WT mice and analyzed gene expression using microarray to determine alterations in gene expression and cell signaling networks in HSCs that could potentially contribute to the aging phenotype of AhR-KO mice. Comparisons with previous array data from 8-week old mice indicated that aging alone is sufficient to alter gene expression. In addition, a significant number of gene expression differences were observed in aged LT-HSCs that are dependent on both aging and lack of AhR. Pathway analysis of these genes revealed networks related to hematopoietic stem cell activity or function. qPCR was used to confirm the differential expression of a subset of these genes, focusing on genes that may represent novel AhR targets due to the presence of a putative AhR binding site in their upstream regulatory region. We verified differential expression of PDGF-D, Smo, Wdfy1, Zbtb37 and Zfp382. Pathway analysis of this subset of genes revealed overlap between cellular functions of the novel AhR targets and AhR itself. Lentiviral-mediated knockdown of AhR in lineage-negative hematopoietic cells was sufficient to induce changes in all five of the candidate AhR targets identified. Taken together, these data suggest a role for AhR in HSC functional regulation, and identify novel HSC AhR target genes that may contribute to the phenotypes observed in AhR-KO mice. PMID:26208102

  11. Expression levels of brown/beige adipocyte-related genes in fat depots of vitamin A-restricted fattening cattle.


    Chen, Hsuan-Ju; Ihara, Tsubasa; Yoshioka, Hidetugu; Itoyama, Erina; Kitamura, Shoko; Nagase, Hiroshi; Murakami, Hiroaki; Hoshino, Yoichiro; Murakami, Masaru; Tomonaga, Shozo; Matsui, Tohru; Funaba, Masayuki


    Brown/beige adipocytes dissipate energy as heat. We previously showed that brown/beige adipocytes are present in white adipose tissue (WAT) of fattening cattle. The present study examined the effect of vitamin A restriction on mRNA expression of brown/beige adipocyte-related genes. In Japan, fattening cattle are conventionally fed a vitamin A-restricted diet to improve beef marbling. Twelve Japanese Black steers aged 10 months were fed control feed (n=6) or vitamin A-restricted feed (n=6) for 20 months. Subcutaneous WAT (scWAT) and mesenteric WAT (mesWAT) were collected, and mRNA expression levels of molecules related to function of brown/beige adipocytes (Ucp1, Cidea, Dio2, Cox7a and Cox8b) as well as transcriptional regulators related to brown/beige adipogenesis (Zfp516, Nfia, Prdm16, and Pgc-1α) were evaluated. The vitamin A restriction significantly increased or tended to increase expression levels of Cidea and Pgc-1α in scWAT, and Cidea, Dio2, and Nfia in mesWAT. Previous studies revealed that the bone morphogenetic protein (BMP) pathway was responsible for commitment of mesenchymal stem cells to brown/beige adipocyte-lineage cells. The vitamin A restriction increased expression of Bmp7 and some Bmp receptors in WAT. The interrelationship between gene expression levels indicated that expression levels of Nfia, Prdm16, and Pgc-1α were closely related to those of genes related to function of brown/beige adipocytes in scWAT. Also, expression levels of Nfia, Prdm16, and Pgc-1α were highly correlated with those of Alk3 in scWAT. In summary, the present results suggest that the vitamin A restriction increases the number or activity of brown/beige adipocytes through regulatory expression of transcriptional regulators to induce brown/beige adipogenesis especially in scWAT of fattening cattle, which may be governed by the Bmp pathway.

  12. Gene expression profiles following exposure to a developmental neurotoxicant, Aroclor 1254: Pathway analysis for possible mode(s) of action

    SciTech Connect

    Royland, Joyce E.; Kodavanti, Prasada Rao S.


    Epidemiological studies indicate that low levels of polychlorinated biphenyl (PCB) exposure can adversely affect neurocognitive development. In animal models, perturbations in calcium signaling, neurotransmitters, and thyroid hormones have been postulated as potential mechanisms for PCB-induced developmental neurotoxicity. In order to understand the role of these proposed mechanisms and to identify other mechanisms in PCB-induced neurotoxicity, we have chosen a global approach utilizing oligonucleotide microarrays to examine gene expression profiles in the brain following developmental exposure to Aroclor 1254 (0 or 6 mg/kg/day from gestation day 6 through postnatal day (PND) 21) in Long-Evans rats. Gene expression levels in the cerebellummore » and hippocampus from PNDs 7 and 14 animals were determined on Affymetrix rat 230A{sub 2}.0 chips. In the cerebellum, 87 transcripts were altered at PND7 compared to 27 transcripts at PND14 by Aroclor 1254 exposure, with only one transcript affected at both ages. In hippocampus, 175 transcripts and 50 transcripts were altered at PND7 and PND14, respectively, by Aroclor 1254 exposure with five genes commonly affected. Functional analysis suggests that pathways related to calcium homeostasis (Gng3, Ryr2, Trdn, Cacna1a), intracellular signaling (Camk2d, Stk17b, Pacsin2, Ryr2, Trio, Fert2, Ptk2b), axonal guidance (Lum, Mxd3, Akap11, Gucy1b3), aryl hydrocarbon receptor signaling (Nfia, Col1a2), and transcripts involved in cell proliferation (Gspt2, Cdkn1c, Ptk2b) and differentiation (Ifitm31, Hpca, Zfp260, Igsf4a, Hes5) leading to the development of nervous system were significantly altered by Aroclor 1254 exposure. Of the two brain regions examined, Aroclor 1254-induced genomic changes were greater in the hippocampus than the cerebellum. The genomic data suggests that PCB-induced neurotoxic effects were due to disruption of normal ontogenetic pattern of nervous system growth and development by altering intracellular signaling

  13. Drought Response in Wheat: Key Genes and Regulatory Mechanisms Controlling Root System Architecture and Transpiration Efficiency.


    Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G; Kagale, Sateesh


    Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold

  14. Gene expression of stem cells at different stages of ontological human development.


    Allegra, Adolfo; Altomare, Roberta; Curcio, Patrizia; Santoro, Alessandra; Lo Monte, Attilio I; Mazzola, Sergio; Marino, Angelo


    To compare multipotent mesenchymal stem cells (MSCs) obtained from chorionic villi (CV), amniotic fluid (AF) and placenta, with regard to their phenotype and gene expression, in order to understand if MSCs derived from different extra-embryonic tissues, at different stages of human ontological development, present distinct stemness characteristics. MSCs obtained from 30 samples of CV, 30 of AF and 10 placentas (obtained from elective caesarean sections) were compared. MSCs at second confluence cultures were characterized by immunophenotypic analysis with flow cytometry using FACS CANTO II. The expression of the genes Oct-4 (Octamer-binding transcription factor 4, also known as POU5F1), Sox-2 (SRY box-containing factor 2), Nanog, Rex-1 (Zfp-42) and Pax-6 (Paired Box Protein-6), was analyzed. Real-time quantitative PCR was performed by ABI Prism 7700, after RNA isolation and retro-transcription in cDNA. Statistical analysis was performed using non-parametric test Kruskal-Wallis (XLSTAT 2011) and confirmed by REST software, to estimate fold changes between samples. Each gene was defined differentially expressed if p-value was <0.05. Cells from all samples were negative for haematopoietic antigens CD45, CD34, CD117 and CD33 and positive for the typical MSCs antigens CD13, CD73 and CD90. Nevertheless, MSCs from AF and placentas showed different fluorescence intensity, reflecting the heterogeneity of these tissues. The gene expression of OCT-4, SOX-2, NANOG was not significantly different among the three groups. In AF, REX-1 and PAX-6 showed a higher expression in comparison to CV. MSCs of different extra-embryonic tissues showed no differences in immunophenotype when collected from second confluence cultures. The expression of OCT-4, NANOG and SOX-2 was not significantly different, demonstrating that all fetal sources are suitable for obtaining MSCs. These results open new possibilities for the clinical use of MSCs derived from easily accessible sources, in order to

  15. Cinnamon polyphenols regulate multiple metabolic pathways involved in insulin signaling and intestinal lipoprotein metabolism of small intestinal enterocytes.


    Qin, Bolin; Dawson, Harry D; Schoene, Norberta W; Polansky, Marilyn M; Anderson, Richard A


    Increasing evidence suggests that dietary factors may affect the expression of multiple genes and signaling pathways, which regulate intestinal lipoprotein metabolism. The small intestine is actively involved in the regulation of dietary lipid absorption, intracellular transport, and metabolism and is closely linked to systemic lipid metabolism. Cinnamon polyphenols have been shown to improve glucose, insulin, and lipid metabolism and improve inflammation in cell culture, animal, and human studies. However, little is known of the effects of an aqueous cinnamon extract (CE) on the regulation of genes and signaling pathways related to intestinal metabolism. The aim of the study was to investigate the effects of a CE on the primary enterocytes of chow-fed rats. Freshly isolated intestinal enterocytes were used to investigate apolipoprotein-B48 secretion by immunoprecipitation; gene expressions by quantitative reverse transcriptase-polymerase chain reaction and the protein and phosphorylation levels were evaluated by western blot and flow cytometric analyses. Ex vivo, the CE significantly decreased the amount of apolipoprotein-B48 secretion into the media, inhibited the mRNA expression of genes of the inflammatory cytokines, interleukin-1β, interleukin-6, and tumor necrosis factor-α, and induced the expression of the anti-inflammatory gene, Zfp36. CE also increased the mRNA expression of genes leading to increased insulin sensitivity, including Ir, Irs1, Irs2, Pi3k, and Akt1, and decreased Pten expression. CE also inhibited genes associated with increased cholesterol, triacylglycerols, and apolipoprotein-B48 levels, including Abcg5, Npc1l1, Cd36, Mttp, and Srebp1c, and facilitated Abca1 expression. CE also stimulated the phospho-p38 mitogen-activated protein kinase, c-Jun N-terminal kinase, and extracellular-signal-regulated kinase expressions determined by flow cytometry, with no changes in protein levels. These results demonstrate that the CE regulates genes

  16. ABP9, a maize bZIP transcription factor, enhances tolerance to salt and drought in transgenic cotton.


    Wang, Chunling; Lu, Guoqing; Hao, Yuqiong; Guo, Huiming; Guo, Yan; Zhao, Jun; Cheng, Hongmei


    ABP9 , encoding a bZIP transcription factor from maize, enhances tolerance to multiple stresses and may participate in the ABA signaling pathway in transgenic cotton by altering physiological and biochemical processes and stress-related gene expression. Abiotic stresses, such as soil salinity and drought, negatively affect growth, development, and yield in cotton. Gene ABP9, which encodes a bZIP transcription factor, binds to the abscisic acid (ABA)-responsive-element (ABRE2) motif of the maize catalase1 gene. Its expression significantly improves tolerance in Arabidopsis to multiple abiotic stresses, but little is known about its role in cotton. In the present study, the ABP9 gene was introduced into upland cotton (Gossypium hirsutum L.) cultivar R15 by Agrobacterium tumefaciens-mediated transformation, and 12 independent transgenic cotton lines were obtained. Cotton plants over-expressing ABP9 have enhanced tolerance to salt and osmotic stress. Under stress, they developed better root systems in a greenhouse and higher germination, reduced stomatal aperture, and stomatal density in a growth chamber. Under drought conditions, survival rate and relative water content (RWC) of transgenic cotton were higher than those of R15 plants. Under salt and osmotic stresses, chlorophyll, proline, and soluble sugar contents significantly increased in transgenic cotton leaves and the malondialdehyde (MDA) content was lower than in R15. Overexpression of ABP9 also enhanced oxidative stress tolerance, reduced cellular levels of reactive oxygen species (ROS) through increased activities of antioxidative enzymes, and alleviated oxidative damage to cell. Interestingly, ABP9 over-expressing cotton was more sensitive to exogenous ABA than R15 at seed germination, root growth, stomatal aperture, and stomatal density. Moreover, ABP9 overexpression upregulated significantly the transcription levels of stress-related genes such as GhDBP2, GhNCED2, GhZFP1, GhERF1, GhHB1, and GhSAP1 under

  17. Genome-Wide Analysis of C2H2 Zinc-Finger Family Transcription Factors and Their Responses to Abiotic Stresses in Poplar (Populus trichocarpa)

    PubMed Central

    Liu, Quangang; Wang, Zhanchao; Xu, Xuemei; Zhang, Haizhen; Li, Chenghao


    Background C2H2 zinc-finger (C2H2-ZF) proteins are a large gene family in plants that participate in various aspects of normal plant growth and development, as well as in biotic and abiotic stress responses. To date, no overall analysis incorporating evolutionary history and expression profiling of the C2H2-ZF gene family in model tree species poplar (Populus trichocarpa) has been reported. Principal Findings Here, we identified 109 full-length C2H2-ZF genes in P. trichocarpa, and classified them into four groups, based on phylogenetic analysis. The 109 C2H2-ZF genes were distributed unequally on 19 P. trichocarpa linkage groups (LGs), with 39 segmental duplication events, indicating that segmental duplication has been important in the expansion of the C2H2-ZF gene family. Promoter cis-element analysis indicated that most of the C2H2-ZF genes contain phytohormone or abiotic stress-related cis-elements. The expression patterns of C2H2-ZF genes, based on heatmap analysis, suggested that C2H2-ZF genes are involved in tissue and organ development, especially root and floral development. Expression analysis based on quantitative real-time reverse transcription polymerase chain reaction indicated that C2H2-ZF genes are significantly involved in drought, heat and salt response, possibly via different mechanisms. Conclusions This study provides a thorough overview of the P. trichocarpa C2H2-ZF gene family and presents a new perspective on the evolution of this gene family. In particular, some C2H2-ZF genes may be involved in environmental stress tolerance regulation. PtrZFP2, 19 and 95 showed high expression levels in leaves and/or roots under environmental stresses. Additionally, this study provided a solid foundation for studying the biological roles of C2H2-ZF genes in Populus growth and development. These results form the basis for further investigation of the roles of these candidate genes and for future genetic engineering and gene functional studies in Populus. PMID

  18. The Metastasis Suppressor NME1 Regulates Expression of Genes Linked to Metastasis and Patient Outcome in Melanoma and Breast Carcinoma

    PubMed Central



    NME1 is a well-documented metastasis suppressor gene, with suppressor activity demonstrated across a wide spectrum of human cancers including melanoma and carcinomas of the breast, stomach and thyroid. A primary aim of the current study was to identify profiles of genes whose expression is regulated by NME1 in cell lines of melanoma and thyroid carcinoma origin. Impact of NME1 was determined by forcing its expression transiently in cell lines using a novel Ad5-based adenoviral vector (Ad5-NME1), followed 48 h later by analysis of RNA expression profiles using the U133A microarray chip. Robust NME1 expression was achieved following infection with the Ad5-NME1 adenovirus in the human metastasis-derived cell lines WM1158 (melanoma) and WRO82 (follicular thyroid carcinoma), resulting in wide-ranging effects on gene expression in both settings. A substantial proportion of the NME1-regulated genes identified in the analyses were of clear potential relevance to metastasis, such as matrix metalloproteinase-1 (MMP1), angiopoeitin-2 (ANGPT2), SERPINB9 and colony stimulating factor receptor-2B (CSFR2B). Nine genes were identified (false discovery rate ≥0.1) that were regulated by NME1 in both the WM1158 and WRO82 cell lines, each possessing one of more such metastasis-relevant activities as stress fiber formation and focal adhesion (PPM1E, ZYX, PFN1), chemotaxis (CCR1) epithelial-mesenchymal signaling (WNT1), differentiation and morphogenesis (TBX4, ZFP36L2), and G protein modulation (GPR52 and PFN1). In addition, a number of the NME1-regulated genes were shown to be of prognostic value for distant disease-free survival and overall survival in melanoma and breast cancer. The combined expression of three NME1-regulated genes CSFR2B, MSF4A1 and SERPINB9 provided a strongly synergistic correlation with distant disease-free survival in the basal subtype of breast cancer (p<3.5e−5, hazard ratio=0.33). Our study demonstrates that analysis of NME1-dependent gene expression is a

  19. The metastasis suppressor NME1 regulates expression of genes linked to metastasis and patient outcome in melanoma and breast carcinoma.


    McCorkle, Joseph R; Leonard, Mary K; Kraner, Susan D; Blalock, Eric M; Ma, Deqin; Zimmer, Stephen G; Kaetzel, David M


    NME1 is a well-documented metastasis suppressor gene, with suppressor activity demonstrated across a wide spectrum of human cancers including melanoma and carcinomas of the breast, stomach and thyroid. A primary aim of the current study was to identify profiles of genes whose expression is regulated by NME1 in cell lines of melanoma and thyroid carcinoma origin. Impact of NME1 was determined by forcing its expression transiently in cell lines using a novel Ad5-based adenoviral vector (Ad5-NME1), followed 48 h later by analysis of RNA expression profiles using the U133A microarray chip. Robust NME1 expression was achieved following infection with the Ad5-NME1 adenovirus in the human metastasis-derived cell lines WM1158 (melanoma) and WRO82 (follicular thyroid carcinoma), resulting in wide-ranging effects on gene expression in both settings. A substantial proportion of the NME1-regulated genes identified in the analyses were of clear potential relevance to metastasis, such as matrix metalloproteinase-1 (MMP1), angiopoietin-2 (ANGPT2), SERPINB9 and colony stimulating factor receptor-2B (CSFR2B). Nine genes were identified (false discovery rate <0.1) that were regulated by NME1 in both the WM1158 and WRO82 cell lines, each possessing one or more such metastasis-relevant activities as stress fiber formation and focal adhesion (PPM1E, ZYX, PFN1), chemotaxis (CCR1) epithelial-mesenchymal signaling (WNT6), differentiation and morphogenesis (TBX4, ZFP36L2), and G protein modulation (GPR52 and PFN1). In addition, a number of the NME1-regulated genes were shown to be of prognostic value for distant disease-free survival and overall survival in melanoma and breast cancer. The combined expression of three NME1-regulated genes CSFR2B, MSF4A1 and SERPINB9 provided a strongly synergistic correlation with distant disease-free survival in the basal subtype of breast cancer (p<3.5e(-5), hazard ratio=0.33). Our study demonstrates that analysis of NME1-dependent gene expression is a

  20. Repositioning of Memantine as a Potential Novel Therapeutic Agent against Meningitic E. coli-Induced Pathogenicities through Disease-Associated Alpha7 Cholinergic Pathway and RNA Sequencing-Based Transcriptome Analysis of Host Inflammatory Responses.


    Yu, Jing-Yi; Zhang, Bao; Peng, Liang; Wu, Chun-Hua; Cao, Hong; Zhong, John F; Hoffman, Jill; Huang, Sheng-He


    Neonatal sepsis and meningitis (NSM) remains a leading cause worldwide of mortality and morbidity in newborn infants despite the availability of antibiotics over the last several decades. E. coli is the most common gram-negative pathogen causing NSM. Our previous studies show that α7 nicotinic receptor (α7 nAChR), an essential regulator of inflammation, plays a detrimental role in the host defense against NSM. Despite notable successes, there still exists an unmet need for new effective therapeutic approaches to treat this disease. Using the in vitro/in vivo models of the blood-brain barrier (BBB) and RNA-seq, we undertook a drug repositioning study to identify unknown antimicrobial activities for known drugs. We have demonstrated for the first time that memantine (MEM), a FDA-approved drug for treatment of Alzheimer's disease, could very efficiently block E. coli-caused bacteremia and meningitis in a mouse model of NSM in a manner dependent on α7 nAChR. MEM was able to synergistically enhance the antibacterial activity of ampicillin in HBMEC infected with E. coli K1 (E44) and in neonatal mice with E44-caused bacteremia and meningitis. Differential gene expression analysis of RNA-Seq data from mouse BMEC infected with E. coli K1 showed that several E44-increased inflammatory factors, including IL33, IL18rap, MMP10 and Irs1, were significantly reduced by MEM compared to the infected cells without drug treatment. MEM could also significantly up-regulate anti-inflammatory factors, including Tnfaip3, CISH, Ptgds and Zfp36. Most interestingly, these factors may positively and negatively contribute to regulation of NF-κB, which is a hallmark feature of bacterial meningitis. Furthermore, we have demonstrated that circulating BMEC (cBMEC) are the potential novel biomarkers for NSM. MEM could significantly reduce E44-increased blood level of cBMEC in mice. Taken together, our data suggest that memantine can efficiently block host inflammatory responses to bacterial

  1. A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits

    PubMed Central

    Volkov, Petr; Olsson, Anders H.; Gillberg, Linn; Jørgensen, Sine W.; Brøns, Charlotte; Eriksson, Karl-Fredrik; Groop, Leif; Jansson, Per-Anders; Nilsson, Emma; Rönn, Tina; Vaag, Allan; Ling, Charlotte


    Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men, where 592,794 single nucleotide polymorphisms (SNPs) were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs) in cis and 5,342 SNP-CpG pairs in trans showing significant associations between genotype and DNA methylation in adipose tissue after correction for multiple testing, where cis is defined as distance less than 500 kb between a SNP and CpG site. These mQTLs include reported obesity, lipid and type 2 diabetes loci, e.g. ADCY3/POMC, APOA5, CETP, FADS2, GCKR, SORT1 and LEPR. Significant mQTLs were overrepresented in intergenic regions meanwhile underrepresented in promoter regions and CpG islands. We further identified 635 SNPs in significant cis-mQTLs associated with expression of 86 genes in adipose tissue including CHRNA5, G6PC2, GPX7, RPL27A, THNSL2 and ZFP57. SNPs in significant mQTLs were also associated with body mass index (BMI), lipid traits and glucose and insulin levels in our study cohort and public available consortia data. Importantly, the Causal Inference Test (CIT) demonstrates how genetic variants mediate their effects on metabolic traits (e.g. BMI, cholesterol, high-density lipoprotein (HDL), hemoglobin A1c (HbA1c) and homeostatic model assessment of insulin resistance (HOMA-IR)) via altered DNA methylation in human adipose tissue. This study identifies genome-wide interactions between genetic and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dys)metabolic traits associated with the development of obesity and