N2 gas is an effective fertilizer for bioethanol production by Zymomonas mobilis

PubMed Central

Kremer, Timothy A.; LaSarre, Breah; Posto, Amanda L.; McKinlay, James B.

2015-01-01

A nascent cellulosic ethanol industry is struggling to become cost-competitive against corn ethanol and gasoline. Millions of dollars are spent on nitrogen supplements to make up for the low nitrogen content of the cellulosic feedstock. Here we show for the first time to our knowledge that the ethanol-producing bacterium, Zymomonas mobilis, can use N2 gas in lieu of traditional nitrogen supplements. Despite being an electron-intensive process, N2 fixation by Z. mobilis did not divert electrons away from ethanol production, as the ethanol yield was greater than 97% of the theoretical maximum. In a defined medium, Z. mobilis produced ethanol 50% faster per cell and generated half the unwanted biomass when supplied N2 instead of ammonium. In a cellulosic feedstock-derived medium, Z. mobilis achieved a similar cell density and a slightly higher ethanol yield when supplied N2 instead of the industrial nitrogen supplement, corn steep liquor. We estimate that N2-utilizing Z. mobilis could save a cellulosic ethanol production facility more than $1 million/y. PMID:25646422

Improving furfural tolerance of Zymomonas mobilis by rewiring a sigma factor RpoD protein.

PubMed

Tan, Fu-Rong; Dai, Li-Chun; Wu, Bo; Qin, Han; Shui, Zong-Xia; Wang, Jing-Li; Zhu, Qi-Li; Hu, Qi-Chun; Ruan, Zhi-Yong; He, Ming-Xiong

2015-06-01

Furfural from lignocellulosic hydrolysates is the key inhibitor for bio-ethanol fermentation. In this study, we report a strategy of improving the furfural tolerance in Zymomonas mobilis on the transcriptional level by engineering its global transcription sigma factor (σ(70), RpoD) protein. Three furfural tolerance RpoD mutants (ZM4-MF1, ZM4-MF2, and ZM4-MF3) were identified from error-prone PCR libraries. The best furfural-tolerance strain ZM4-MF2 reached to the maximal cell density (OD600) about 2.0 after approximately 30 h, while control strain ZM4-rpoD reached its highest cell density of about 1.3 under the same conditions. ZM4-MF2 also consumed glucose faster and yield higher ethanol; expression levels and key Entner-Doudoroff (ED) pathway enzymatic activities were also compared to control strain under furfural stress condition. Our results suggest that global transcription machinery engineering could potentially be used to improve stress tolerance and ethanol production in Z. mobilis.

Recombinant Zymomonas for pentose fermentation

DOEpatents

Picataggio, S.K.; Min Zhang; Eddy, C.K.; Deanda, K.A.

1998-03-10

The invention relates to microorganisms which normally do not ferment pentose sugar and which are genetically altered to ferment pentose sugar to produce ethanol, and fermentation processes utilizing the same. Examples include Zymomonas mobilis which has been transformed with combinations of E. coli genes for xylose isomerase, xylulokinase, transaldolase, transketolase, L-arabinose isomerase, L-ribulokinase, and L-ribulose-5-phosphate 4-epimerase. Expression of the added genes are under the control of Zymomonas mobilis promoters. These newly created microorganisms are useful for fermenting pentoses and glucose, produced by hydrolysis of hemicellulose and cellulose, to produce ethanol. 7 figs.

Pentose fermentation by recombinant Zymomonas

DOEpatents

Picataggio, S.K.; Zhang, M.; Eddy, C.K.; Deanda, K.A.; Finkelstein, M.; Mohagheghi, A.; Newman, M.M.; McMillan, J.D.

1998-01-27

The invention relates to microorganisms which normally do not ferment pentose sugar and which are genetically altered to ferment pentose sugar to produce ethanol, and fermentation processes utilizing the same. Examples include Zymomonas mobilis which has been transformed with combinations of E. coli genes for xylose isomerase, xylulokinase, transaldolase, transketolase, L-arabinose isomerase, L-ribulokinase, and L-ribulose 5-phosphate 4-epimerase. Expression of the added genes are under the control of Zymomonas mobilis promoters. These newly created microorganisms are useful for fermenting pentoses and glucose, produced by hydrolysis of hemicellulose and cellulose, to produce ethanol. 7 figs.

Pentose fermentation by recombinant zymomonas

DOEpatents

Picataggio, Stephen K.; Zhang, Min; Eddy, Christina K.; Deanda, Kristine A.; Finkelstein, Mark; Mohagheghi, Ali; Newman, Mildred M.; McMillan, James D.

1998-01-01

The invention relates to microorganisms which normally do not ferment pentose sugar and which are genetically altered to ferment pentose sugar to produce ethanol, and fermentation processes utilizing the same. Examples include Zymomonas mobilis which has been transformed with combinations of E. coli genes for xylose isomerase, xylulokinase, transaldolase, transketolase, L-arabinose isomerase, L-ribulokinase, and L-ribulose 5-phosphate 4-epimerase. Expression of the added genes are under the control of Zymomonas mobilis promoters. These newly created microorganisms are useful for fermenting pentoses and glucose, produced by hydrolysis of hemicellulose and cellulose, to produce ethanol.

Recombinant Zymomonas for pentose fermentation

DOEpatents

Picataggio, Stephen K.; Zhang, Min; Eddy, Christina K.; Deanda, Kristine A.

1998-01-01

The invention relates to microorganisms which normally do not ferment pentose sugar and which are genetically altered to ferment pentose sugar to produce ethanol, and fermentation processes utilizing the same. Examples include Zymomonas mobilis which has been transformed with combinations of E. coli genes for xylose isomerase, xylulokinase, transaldolase, transketolase, L-arabinose isomerase, L-ribulokinase, and L-ribulose-5-phosphate 4-epimerase. Expression of the added genes are under the control of Zymomonas mobilis promoters. These newly created microorganisms are useful for fermenting pentoses and glucose, produced by hydrolysis of hemicellulose and cellulose, to produce ethanol.

Inhibition of growth of Zymomonas mobilis by model compounds found in lignocellulosic hydrolysates

PubMed Central

2013-01-01

Background During the pretreatment of biomass feedstocks and subsequent conditioning prior to saccharification, many toxic compounds are produced or introduced which inhibit microbial growth and in many cases, production of ethanol. An understanding of the toxic effects of compounds found in hydrolysate is critical to improving sugar utilization and ethanol yields in the fermentation process. In this study, we established a useful tool for surveying hydrolysate toxicity by measuring growth rates in the presence of toxic compounds, and examined the effects of selected model inhibitors of aldehydes, organic and inorganic acids (along with various cations), and alcohols on growth of Zymomonas mobilis 8b (a ZM4 derivative) using glucose or xylose as the carbon source. Results Toxicity strongly correlated to hydrophobicity in Z. mobilis, which has been observed in Escherichia coli and Saccharomyces cerevisiae for aldehydes and with some exceptions, organic acids. We observed Z. mobilis 8b to be more tolerant to organic acids than previously reported, although the carbon source and growth conditions play a role in tolerance. Growth in xylose was profoundly inhibited by monocarboxylic organic acids compared to growth in glucose, whereas dicarboxylic acids demonstrated little or no effects on growth rate in either substrate. Furthermore, cations can be ranked in order of their toxicity, Ca++ > > Na+ > NH4+ > K+. HMF (5-hydroxymethylfurfural), furfural and acetate, which were observed to contribute to inhibition of Z. mobilis growth in dilute acid pretreated corn stover hydrolysate, do not interact in a synergistic manner in combination. We provide further evidence that Z. mobilis 8b is capable of converting the aldehydes furfural, vanillin, 4-hydroxybenzaldehyde and to some extent syringaldehyde to their alcohol forms (furfuryl, vanillyl, 4-hydroxybenzyl and syringyl alcohol) during fermentation. Conclusions Several key findings in this report provide a

Fermentation of Soybean Meal Hydrolyzates with Saccharomyces cerevisiae and Zymomonas mobilis for Ethanol Production.

PubMed

Luján-Rhenals, Deivis E; Morawicki, Rubén O; Gbur, Edward E; Ricke, Steven C

2015-07-01

Most of the ethanol currently produced by fermentation is derived from sugar cane, corn, or beets. However, it makes good ecological and economic sense to use the carbohydrates contained in by-products and coproducts of the food processing industry for ethanol production. Soybean meal, a co-product of the production of soybean oil, has a relatively high carbohydrate content that could be a reasonable substrate for ethanol production after fermentable sugars are released via hydrolysis. In this research, the capability of Saccharomyces cerevisiae NRRL Y-2233 and Zymomonas mobilis subsp. mobilis NRRL B-4286 to produce ethanol was evaluated using soybean meal hydrolyzates as substrates for the fermentation. These substrates were produced from the dilute-acid hydrolysis of soybean meal at 135 °C for 45 min with 0, 0.5%, 1.25%, and 2% H2 SO4 and at 120 °C for 30 min with 1.25% H2 SO4 . Kinetic parameters of the fermentation were estimated using the logistic model. Ethanol production using S. cerevisiae was highest with the substrates obtained at 135 °C, 45 min, and 0.5% H2 SO4 and fermented for 8 h, 8 g/L (4 g ethanol/100 g fresh SBM), while Z. mobilis reached its maximum ethanol production, 9.2 g/L (4.6 g ethanol/100 g fresh SBM) in the first 20 h of fermentation with the same hydrolyzate. © 2015 Institute of Food Technologists®

Continuous production of ethanol with Zymomonas mobilis growing on Jerusalem artichoke juice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allais, J.J.; Torres, E.F.; Baratti, J.

1987-04-01

Recent work from the authors laboratory has shown that, compared to yeasts, much higher ethanol productivity and yield can be obtained in batch or continuous cultures using the bacterium Zymomonas mobilis grown on fructose media. In batch culture, hydrolyzed Jerusalem artichoke juice with sugar concentrations ranging from 100 to 250 g/L can be converted efficiently to ethanol. The present work describes the conversion of the hydrolyzed juice to ethanol in continuous culture. The extraction and enzymatic hydrolysis of inulin from the tubers of Jerusalem artichoke is also reported.

Pre-treatment step with Leuconostoc mesenteroides or L. pseudomesenteroides strains removes furfural from Zymomonas mobilis ethanolic fermentation broth

USDA-ARS?s Scientific Manuscript database

Furfural (furan-2-carboxaldehyde), formed during dilute acid hydrolysis of biomass, is an inhibitor of growth and ethanol production by Zymomonas mobilis. The present study used a biological pre-treatment to reduce that amount of furfural in a model biofuel fermentation broth. The pre-treatment in...

Flocculating Zymomonas mobilis is a promising host to be engineered for fuel ethanol production from lignocellulosic biomass.

PubMed

Zhao, Ning; Bai, Yun; Liu, Chen-Guang; Zhao, Xin-Qing; Xu, Jian-Feng; Bai, Feng-Wu

2014-03-01

Whereas Saccharomyces cerevisiae uses the Embden-Meyerhof-Parnas pathway to metabolize glucose, Zymomonas mobilis uses the Entner-Doudoroff (ED) pathway. Employing the ED pathway, 50% less ATP is produced, which could lead to less biomass being accumulated during fermentation and an improved yield of ethanol. Moreover, Z. mobilis cells, which have a high specific surface area, consume glucose faster than S. cerevisiae, which could improve ethanol productivity. We performed ethanol fermentations using these two species under comparable conditions to validate these speculations. Increases of 3.5 and 3.3% in ethanol yield, and 58.1 and 77.8% in ethanol productivity, were observed in ethanol fermentations using Z. mobilis ZM4 in media containing ∼100 and 200 g/L glucose, respectively. Furthermore, ethanol fermentation bythe flocculating Z. mobilis ZM401 was explored. Although no significant difference was observed in ethanol yield and productivity, the flocculation of the bacterial species enabled biomass recovery by cost-effective sedimentation, instead of centrifugation with intensive capital investment and energy consumption. In addition, tolerance to inhibitory byproducts released during biomass pretreatment, particularly acetic acid and vanillin, was improved. These experimental results indicate that Z. mobilis, particularly its flocculating strain, is superior to S. cerevisiae as a host to be engineered for fuel ethanol production from lignocellulosic biomass. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Recombinant zymomonas for pentose fermentation

DOEpatents

Picataggio, Stephen K.; Zhang, Min; Eddy, Christina K.; Deanda, Kristine A.; Finkelstein, Mark

1996-01-01

The invention relates to microorganisms which normally do not ferment a pentose sugar and which are genetically altered to ferment this pentose to produce ethanol. A representative example is Zymomonas mobilis which has been transformed with E. coli xylose isomerase, xylulokinase, transaldolase and transketolase genes. Expression of the added genes are under the control of Zymomonas mobilis promoters. This newly created microorganism is useful for fermenting pentoses and glucose, produced by hydrolysis of hemicellulose and cellulose, to produce ethanol.

Improvement of ethanol productivity and energy efficiency by degradation of inhibitors using recombinant Zymomonas mobilis (pHW20a-fdh).

PubMed

Dong, Hong-Wei; Fan, Li-Qiang; Luo, Zichen; Zhong, Jian-Jiang; Ryu, Dewey D Y; Bao, Jie

2013-09-01

Toxic compounds, such as formic acid, furfural, and hydroxymethylfurfural (HMF) generated during pretreatment of corn stover (CS) at high temperature and low pH, inhibit growth of Zymomonas mobilis and lower the conversion efficiency of CS to biofuel and other products. The inhibition of toxic compounds is considered as one of the major technical barriers in the lignocellulose bioconversion. In order to detoxify and/or degrade these toxic compounds by the model ethanologenic strain Z. mobilis itself in situ the fermentation medium, we constructed a recombinant Z. mobilis ZM4 (pHW20a-fdh) strain that is capable of degrading toxic inhibitor, formate. This is accomplished by cloning heterologous formate dehydrogenase gene (fdh) from Saccharomyces cerevisiae and by coupling this reaction of NADH regeneration reaction system with furfural and HMF degradation in the recombinant Z. mobilis strain. The NADH regeneration reaction also improved both the energy efficiency and cell physiological activity of the recombinant organism, which were definitely confirmed by the improved cell growth, ethanol yield, and ethanol productivity during fermentation with CS hydrolysate. Copyright © 2013 Wiley Periodicals, Inc.

Recombinant Zymomonas for pentose fermentation

DOEpatents

Picataggio, S.K.; Zhang, M.; Eddy, C.K.; Deanda, K.A.; Finkelstein, M.

1996-05-07

The invention relates to microorganisms which normally do not ferment a pentose sugar and which are genetically altered to ferment this pentose to produce ethanol. A representative example is Zymomonas mobilis which has been transformed with E. coli xylose isomerase, xylulokinase, transaldolase and transketolase genes. Expression of the added genes are under the control of Zymomonas mobilis promoters. This newly created microorganism is useful for fermenting pentoses and glucose, produced by hydrolysis of hemicellulose and cellulose, to produce ethanol. 2 figs.

Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

PubMed Central

Yomano, L P; Scopes, R K; Ingram, L O

1993-01-01

Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

Crystal structure of cbbF from Zymomonas mobilis and its functional implication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Hyo-Jeong; Park, Suk-Youl; Kim, Jeong-Sun, E-mail: jsunkim@chonnam.ac.kr

2014-02-28

Highlights: • The crystal structure of one cbbF from Zymomonas mobilis was revealed. • Scores of residues form two secondary structures with a non-polar protruded residue. • It exists as a dimeric form in solution. - Abstract: A phosphate group at the C1-atom of inositol-monophosphate (IMP) and fructose-1,6-bisphosphate (FBP) is hydrolyzed by a phosphatase IMPase and FBPase in a metal-dependent way, respectively. The two enzymes are almost indiscernible from each other because of their highly similar sequences and structures. Metal ions are bound to residues on the β1- and β2-strands and one mobile loop. However, FBP has another phosphate andmore » FBPases exist as a higher oligomeric state, which may discriminate FBPases from IMPases. There are three genes annotated as FBPases in Zymomonas mobilis, termed also cbbF (ZmcbbF). The revealed crystal structure of one ZmcbbF shows a globular structure formed by five stacked layers. Twenty-five residues in the middle of the sequence form an α-helix and a β-strand, which occupy one side of the catalytic site. A non-polar Leu residue among them is protruded to the active site, pointing out unfavorable access of a bulky charged group to this side. In vitro assays have shown its dimeric form in solution. Interestingly, two β-strands of β1 and β2 are disordered in the ZmcbbF structure. These data indicate that ZmcbbF might structurally belong to IMPase, and imply that its active site would be reorganized in a yet unreported way.« less

Adaptive laboratory evolution of ethanologenic Zymomonas mobilis strain tolerant to furfural and acetic acid inhibitors.

PubMed

Shui, Zong-Xia; Qin, Han; Wu, Bo; Ruan, Zhi-yong; Wang, Lu-shang; Tan, Fu-Rong; Wang, Jing-Li; Tang, Xiao-Yu; Dai, Li-Chun; Hu, Guo-Quan; He, Ming-Xiong

2015-07-01

Furfural and acetic acid from lignocellulosic hydrolysates are the prevalent inhibitors to Zymomonas mobilis during cellulosic ethanol production. Developing a strain tolerant to furfural or acetic acid inhibitors is difficul by using rational engineering strategies due to poor understanding of their underlying molecular mechanisms. In this study, strategy of adaptive laboratory evolution (ALE) was used for development of a furfural and acetic acid-tolerant strain. After three round evolution, four evolved mutants (ZMA7-2, ZMA7-3, ZMF3-2, and ZMF3-3) that showed higher growth capacity were successfully obtained via ALE method. Based on the results of profiling of cell growth, glucose utilization, ethanol yield, and activity of key enzymes, two desired strains, ZMA7-2 and ZMF3-3, were achieved, which showed higher tolerance under 7 g/l acetic acid and 3 g/l furfural stress condition. Especially, it is the first report of Z. mobilis strain that could tolerate higher furfural. The best strain, Z. mobilis ZMF3-3, has showed 94.84% theoretical ethanol yield under 3-g/l furfural stress condition, and the theoretical ethanol yield of ZM4 is only 9.89%. Our study also demonstrated that ALE method might also be used as a powerful metabolic engineering tool for metabolic engineering in Z. mobilis. Furthermore, the two best strains could be used as novel host for further metabolic engineering in cellulosic ethanol or future biorefinery. Importantly, the two strains may also be used as novel-tolerant model organisms for the genetic mechanism on the "omics" level, which will provide some useful information for inverse metabolic engineering.

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Genetic improvement of Escherichia coli for ethanol production: Chromosomal integration of Zymomonas mobilis genes encoding pyruvate decarboxylase and alcohol dehydrogenase II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohta, Kazuyoshi; Beall, D.S.; Mejia, J.P.

1991-04-01

Zymomonas mobilis genes for pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adhB) were integrated into the Escherichia coli chromosome within or near the pyruvate formate-lyase gene (pfl). Integration improved the stability of the Z. mobilis genes in E. coli, but further selection was required to increase expression. Spontaneous mutants were selected for resistance to high levels of chloramphenicol that also expressed high levels of the Z. mobilis genes. Analogous mutants were selected for increased expression of alcohol dehydrogenase on aldehyde indicator plates. These mutants were functionally equivalent to the previous plasmid-based strains for the fermentation of xylose and glucose tomore » ethanol. Ethanol concentrations of 54.4 and 41.6 g/liter were obtained from 10% glucose and 8% xylose, respectively. The efficiency of conversion exceeded theoretical limits (0.51 g of ethanol/g of sugar) on the basis of added sugars because of the additional production of ethanol from the catabolism of complex nutrients. Further mutations were introduced to inactivate succinate production (frd) and to block homologous recombination (recA).« less

Very high gravity ethanol and fatty acid production of Zymomonas mobilis without amino acid and vitamin.

PubMed

Wang, Haoyong; Cao, Shangzhi; Wang, William Tianshuo; Wang, Kaven Tianyv; Jia, Xianhui

2016-06-01

Very high gravity (VHG) fermentation is the mainstream technology in ethanol industry, which requires the strains be resistant to multiple stresses such as high glucose concentration, high ethanol concentration, high temperature and harsh acidic conditions. To our knowledge, it was not reported previously that any ethanol-producing microbe showed a high performance in VHG fermentations without amino acid and vitamin. Here we demonstrate the engineering of a xylose utilizing recombinant Zymomonas mobilis for VHG ethanol fermentations. The recombinant strain can produce ethanol up to 136 g/L without amino acid and vitamin with a theoretical yield of 90 %, which is significantly superior to that produced by all the reported ethanol-producing strains. The intracellular fatty acids of the bacterial were about 16 % of the bacterial dry biomass, with the ratio of ethanol:fatty acids was about 273:1 (g/g). The recombinant strain was achieved by a multivariate-modular strategy tackles with the multiple stresses which are closely linked to the ethanol productivity of Z. mobilis. The over-expression of metB/yfdZ operon enabled the growth of the recombinant Z. mobilis in a chemically defined medium without amino acid and vitamin; and the fatty acids overproduction significantly increased ethanol tolerance and ethanol production. The coupled production of ethanol with fatty acids of the Z. mobilis without amino acid and vitamin under VHG fermentation conditions may permit a significant reduction of the production cost of ethanol and microbial fatty acids.

Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars

DOE PAGES

Yang, Shihui; Mohagheghi, Ali; Franden, Mary Ann; ...

2016-09-02

To develop pathways for advanced biofuel production, and to understand the impact of host metabolism and environmental conditions on heterologous pathway engineering for economic advanced biofuels production from biomass, we seek to redirect the carbon flow of the model ethanologen Zymomonas mobilis to produce desirable hydrocarbon intermediate 2,3-butanediol (2,3-BDO). 2,3-BDO is a bulk chemical building block, and can be upgraded in high yields to gasoline, diesel, and jet fuel. 2,3-BDO biosynthesis pathways from various bacterial species were examined, which include three genes encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase. Bioinformatics analysis was carried out to pinpoint potential bottlenecks formore » high 2,3-BDO production. Different combinations of 2,3-BDO biosynthesis metabolic pathways using genes from different bacterial species have been constructed. Our results demonstrated that carbon flux can be deviated from ethanol production into 2,3-BDO biosynthesis, and all three heterologous genes are essential to efficiently redirect pyruvate from ethanol production for high 2,3-BDO production in Z. mobilis. The down-selection of best gene combinations up to now enabled Z. mobilis to reach the 2,3-BDO production of more than 10 g/L from glucose and xylose, as well as mixed C6/C5 sugar streams derived from the deacetylation and mechanical refining process. In conclusion, this study confirms the value of integrating bioinformatics analysis and systems biology data during metabolic engineering endeavors, provides guidance for value-added chemical production in Z. mobilis, and reveals the interactions between host metabolism, oxygen levels, and a heterologous 2,3-BDO biosynthesis pathway. Taken together, this work provides guidance for future metabolic engineering efforts aimed at boosting 2,3-BDO titer anaerobically.« less

Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Shihui; Mohagheghi, Ali; Franden, Mary Ann

To develop pathways for advanced biofuel production, and to understand the impact of host metabolism and environmental conditions on heterologous pathway engineering for economic advanced biofuels production from biomass, we seek to redirect the carbon flow of the model ethanologen Zymomonas mobilis to produce desirable hydrocarbon intermediate 2,3-butanediol (2,3-BDO). 2,3-BDO is a bulk chemical building block, and can be upgraded in high yields to gasoline, diesel, and jet fuel. 2,3-BDO biosynthesis pathways from various bacterial species were examined, which include three genes encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase. Bioinformatics analysis was carried out to pinpoint potential bottlenecks formore » high 2,3-BDO production. Different combinations of 2,3-BDO biosynthesis metabolic pathways using genes from different bacterial species have been constructed. Our results demonstrated that carbon flux can be deviated from ethanol production into 2,3-BDO biosynthesis, and all three heterologous genes are essential to efficiently redirect pyruvate from ethanol production for high 2,3-BDO production in Z. mobilis. The down-selection of best gene combinations up to now enabled Z. mobilis to reach the 2,3-BDO production of more than 10 g/L from glucose and xylose, as well as mixed C6/C5 sugar streams derived from the deacetylation and mechanical refining process. In conclusion, this study confirms the value of integrating bioinformatics analysis and systems biology data during metabolic engineering endeavors, provides guidance for value-added chemical production in Z. mobilis, and reveals the interactions between host metabolism, oxygen levels, and a heterologous 2,3-BDO biosynthesis pathway. Taken together, this work provides guidance for future metabolic engineering efforts aimed at boosting 2,3-BDO titer anaerobically.« less

Impact of expression of EMP enzymes on glucose metabolism in Zymomonas mobilis.

PubMed

Chen, Rachel Ruizhen; Agrawal, Manoj; Mao, Zichao

2013-06-01

Zymomonas mobilis is the only known microorganism that utilizes the Entner-Doudoroff (ED) pathway anaerobically. In this work, we investigated whether the overexpression of a phosphofructokinase (PFK), the only missing Embden-Meyerhof-Parnas (EMP) pathway enzyme, could establish the pathway in this organism. Introduction of a pyrophosphate-dependent PFK, along with co-expression of homologous fructose-1,6-bisphosphate aldolase and triosephosphate isomerase, did not result in an EMP flux to any appreciable level. However, the metabolism of glucose was impacted significantly. Eight percent of glucose was metabolized to form a new metabolite, dihydroxyacetone. Reducing flux through the ED pathway by as much as 40 % through antisense of a key enzyme, ED aldolase, did not result in a fully functional EMP pathway, suggesting that the ED pathway, especially the lower arm, downstream from glyceraldehyde-3-phosphate, is very rigid, possibly due to redox balance.

Evaluation and optimization of ethanol production from carob pod extract by Zymomonas mobilis using response surface methodology.

PubMed

Vaheed, Hossein; Shojaosadati, Seyed Abbas; Galip, Hasan

2011-01-01

In this research, ethanol production from carob pod extract (extract) using Zymomonas mobilis with medium optimized by Plackett-Burman (P-B) and response surface methodologies (RSM) was studied. Z. mobilis was recognized as useful for ethanol production from carob pod extract. The effects of initial concentrations of sugar, peptone, and yeast extract as well as agitation rate (rpm), pH, and culture time in nonhydrolyzed carob pod extract were investigated. Significantly affecting variables (P = 0.05) in the model obtained from RSM studies were: weights of bacterial inoculum, initial sugar, peptone, and yeast extract. Acid hydrolysis was useful to complete conversion of sugars to glucose and fructose. Nonhydrolyzed extract showed higher ethanol yield and residual sugar compared with hydrolyzed extract. Ethanol produced (g g(-1) initial sugar, as the response) was not significantly different (P = 0.05) when Z. mobilis performance was compared in hydrolyzed and nonhydrolyzed extract. The maximum ethanol of 0.34 ± 0.02 g g(-1) initial sugar was obtained at 30°C, initial pH 5.2, and 80 rpm, using concentrations (g per 50 mL culture media) of: inoculum bacterial dry weight, 0.017; initial sugar, 5.78; peptone, 0.43; yeast extract, 0.43; and culture time of 36 h.

Pre-treatment step with Leuconostoc mesenteroides or L. pseudomesenteroides strains removes furfural from Zymomonas mobilis ethanolic fermentation broth.

PubMed

Hunter, William J; Manter, Daniel K

2014-10-01

Furfural is an inhibitor of growth and ethanol production by Zymomonas mobilis. This study used a naturally occurring (not GMO) biological pre-treatment to reduce that amount of furfural in a model fermentation broth. Pre-treatment involved inoculating and incubating the fermentation broth with strains of Leuconostoc mesenteroides or Leuconostoc pseudomesenteroides. The Leuconostoc strains converted furfural to furfuryl alcohol without consuming large amounts of dextrose in the process. Coupling this pre-treatment to ethanolic fermentation reduced furfural in the broth and improved growth, dextrose uptake and ethanol formation. Pre-treatment permitted ethanol formation in the presence of 5.2 g L(-1) furfural, which was otherwise inhibitive. The pre-treatment and presence of the Leuconostoc strains in the fermentation broth did not interfere with Z. mobilis ethanolic fermentation or the amounts of ethanol produced. The method suggests a possible technique for reducing the effect that furfural has on the production of ethanol for use as a biofuel. Published by Elsevier Ltd.

Fermentable metabolite of Zymomonas mobilis controls collagen reduction in photoaging skin by improving TGF-beta/Smad signaling suppression.

PubMed

Tanaka, Hiroshi; Yamaba, Hiroyuki; Kosugi, Nobuhiko; Mizutani, Hiroshi; Nakata, Satoru

2008-04-01

Solar ultraviolet (UV) irradiation causes damages on human skin and premature skin aging (photoaging). UV-induced reduction of type I collagen in dermis is widely considered primarily induction of wrinkled appearance of photoaging skin. Type I procollagen synthesis is reduced under UV irradiation by blocking transforming growth factor-beta (TGF-beta)/Smad signaling; more specifically, it is down-regulation of TGF-beta type II receptor (T beta RII). Therefore, preventing UV-induced loss of T beta RII results decreased type I collagen reduction in photoaging skin. Zymomonas mobilis is an alcohol fermentable, gram-negative facultative anaerobic bacterium whose effect on skin tissue is scarcely studied. We investigated the protective effects of fermentable metabolite of Z. mobilis (FM of Z. mobilis) against reduction of type I procollagen synthesis of UV-induced down-regulation of T beta RII in human dermal fibroblasts FM of Z. mobilis was obtained from lyophilization of bacterium culture supernatant. The levels of T beta RII and type I procollagen mRNA in human dermal fibroblasts were measured by quantitative real-time RT-PCR, and T beta RII protein levels were assayed by western blotting. T beta RII, type I procollagen, and type I collagen proteins in human dermal fibroblasts or hairless mouse skin were detected by immunostaining. FM of Z. mobilis inhibited down regulation of T beta RII mRNA, and protein levels in UVB irradiated human dermal fibroblasts consequently recover reduced type I procollagen synthesis. These results indicate UVB irradiation inhibits type I procollagen synthesis by suppression of TGF-beta/Smad signaling pathway, and FM of Z. mobilis has inhibitory effect on UVB-induced reduction of type I procollagen synthesis. While short period UVB irradiation decreased both T beta RII and type I procollagen protein levels in hairless mouse skin, topical application of FM of Z. mobilis prevented this decrease. Wrinkle formation in hairless mouse skin

High expression Zymomonas promoters

DOEpatents

Viitanen, Paul V [West Chester, PA; Tao, Luan [Havertown, PA; Zhang, Yuying [New Hope, PA; Caimi, Perry G [Kennett Square, PA; McCole, Laura : Zhang, Min; Chou, Yat-Chen [Lakewood, CO; McCutchen, Carol M [Wilmington, DE; Franden, Mary Ann [Centennial, CO

2011-08-02

Identified are mutants of the promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene, which direct improved expression levels of operably linked heterologous nucleic acids. These are high expression promoters useful for expression of chimeric genes in Zymomonas, Zymobacter, and other related bacteria.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Shihui; Vera, Jessica M.; Grass, Jeff

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE PAGES

Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...

2018-05-02

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two

Detrimental effect of increasing sugar concentrations on ethanol production from maize or decorticated sorghum mashes fermented with Saccharomyces cerevisiae or Zymomonas mobilis: biofuels and environmental biotechnology.

PubMed

Pérez-Carrillo, Esther; Luisa Cortés-Callejas, M; Sabillón-Galeas, Luis E; Montalvo-Villarreal, Jorge L; Canizo, Jesica R; Georgina Moreno-Zepeda, M; Serna-Saldivar, Sergio O

2011-02-01

The efficiency of ethanol fermentation, as affected by grain source (maize and decorticated red sorghum), total sugar concentration (13 or 20° Plato) and type of microorganism (Saccharomyces cerevisiae or Zymomonas mobilis) was studied. Maize mashes yielded 0.32 l ethanol kg(-1) ground grain whereas mashes prepared with decorticated red sorghum produced 0.28 l ethanol kg(-1). Both microorganisms yielded similar amounts of ethanol. However, high-gravity mashes (20° Plato) yielded lower amounts of ethanol compared to counterparts adjusted to 13° Plato (0.28 vs. 0.22 l ethanol kg(-1) ground grains). In decorticated sorghum mashes adjusted to 20° P, Z. mobilis produced 40 ml kg(-1) more ethanol compared to S. cerevisiae. In addition, Z. mobilis had a lower dependency on nitrogenous compounds.

Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis

PubMed Central

Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M.; Bartlam, Mark

2016-01-01

Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate. PMID:26919520

Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis.

PubMed

Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M; Bartlam, Mark

2016-03-01

Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate.

Zymomonas with improved xylose utilization

DOEpatents

Viitanen, Paul V [West Chester, PA; Tao, Luan [Havertown, PA; Zhang, Yuying [New Hope, PA; Caimi, Perry G [Kennett Square, PA; McCutchen, Carol M [Wilmington, DE; McCole, Laura [East Fallowfield, PA; Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO; Franden, Mary Ann [Centennial, CO

2011-08-16

Strains of Zymomonas were engineered by introducing a chimeric xylose isomerase gene that contains a mutant promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene. The promoter directs increased expression of xylose isomerase, and when the strain is in addition engineered for expression of xylulokinase, transaldolase and transketolase, improved utilization of xylose is obtained.

Effect of acetic acid on ethanol production by Zymomonas mobilis mutant strains through continuous adaptation.

PubMed

Liu, Yu-Fan; Hsieh, Chia-Wen; Chang, Yao-Sheng; Wung, Being-Sun

2017-08-01

Acetic acid is a predominant by-product of lignocellulosic biofuel process, which inhibits microbial biocatalysts. Development of bacterial strains that are tolerant to acetic acid is challenging due to poor understanding of the underlying molecular mechanisms. In this study, we generated and characterized two acetic acid-tolerant strains of Zymomonas mobilis using N-methyl-N'-nitro-N-nitrosoguanidine (NTG)-acetate adaptive breeding. Two mutants, ZMA-142 and ZMA-167, were obtained, showing a significant growth rate at a concentration of 244 mM sodium acetate, while the growth of Z. mobilis ATCC 31823 were completely inhibited in presence of 195 mM sodium acetate. Our data showed that acetate-tolerance of ZMA-167 was attributed to a co-transcription of nhaA from ZMO0117, whereas the co-transcription was absent in ATCC 31823 and ZMA-142. Moreover, ZMA-142 and ZMA-167 exhibited a converstion rate (practical ethanol yield to theorical ethanol yield) of 90.16% and 86% at 195 mM acetate-pH 5 stress condition, respectively. We showed that acid adaptation of ZMA-142 and ZMA-167 to 146 mM acetate increased ZMA-142 and ZMA-167 resulted in an increase in ethanol yield by 32.21% and 21.16% under 195 mM acetate-pH 5 stress condition, respectively. The results indicate the acetate-adaptive seed culture of acetate-tolerant strains, ZMA-142 and ZMA-167, could enhance the ethanol production during fermentation.

Method of inactivation of an end product of energy metabolism in Zymomonas mobilis

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO

2008-05-20

The present invention briefly provides a method of site-specific insertion in Zymomonas, comprising, providing a Zymomonas gene fragment, interrupting a DNA sequence the fragment, and transforming the Zymomonas through homologous recombination with the interrupted fragment.

Zymomonas pentose-sugar fermenting strains and uses thereof

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Golden, CO; Howe, William [Golden, CO; Eddy, Christine [Golden, CO; Evans, Kent [Littleton, CO; Mohagheghi, Ali [Northglenn, CO

2007-05-29

Disclosed in the present invention is a Zymomonas integrant and derivatives of these integrants that posses the ability to ferment pentose into ethanol. The genetic sequences encoding for the pentose-fermenting enzymes are integrated into the Zymomonas in a two-integration event of homologous recombination and transposition. Each operon includes more than one pentose-reducing enzyme encoding sequence. The integrant in some embodiments includes enzyme sequences encoding xylose isomerase, xylulokinase, transketolase and transketolase. The Zymomonas integrants are highly stable, and retain activity for producing the pentose-fermenting enzyme for between 80 to 160 generations. The integrants are also resistant to acetate inhibition, as the integrants demonstrate efficient ethanol production even in the presence of 8 up to 16 grams acetate per liter media. These stably integrated sequences provide a unique Zymomonas that may then be used for the efficient conversion of pentose sugars (xylose, arabinose) to ethanol. Method of using the Zymomonas integrants and derivatives thereof in production of ethanol from cellulosic feedstock is also disclosed. The invention also provides a method for preparing a Zymomonas integrant as part of the present invention. The host Zymomonas strain found particularly useful in the creation of these compositions and methods is Zymomonas mobilis 31821.

Open fermentative production of fuel ethanol from food waste by an acid-tolerant mutant strain of Zymomonas mobilis.

PubMed

Ma, Kedong; Ruan, Zhiyong; Shui, Zongxia; Wang, Yanwei; Hu, Guoquan; He, Mingxiong

2016-03-01

The aim of present study was to develop a process for open ethanol fermentation from food waste using an acid-tolerant mutant of Zymomonas mobilis (ZMA7-2). The mutant showed strong tolerance to acid condition of food waste hydrolysate and high ethanol production performance. By optimizing fermentation parameters, ethanol fermentation with initial glucose concentration of 200 g/L, pH value around 4.0, inoculum size of 10% and without nutrient addition was considered as best conditions. Moreover, the potential of bench scales fermentation and cell reusability was also examined. The fermentation in bench scales (44 h) was faster than flask scale (48 h), and the maximum ethanol concentration and ethanol yield (99.78 g/L, 0.50 g/g) higher than that of flask scale (98.31 g/L, 0.49 g/g). In addition, the stable cell growth and ethanol production profile in five cycles successive fermentation was observed, indicating the mutant was suitable for industrial ethanol production. Copyright © 2015 Elsevier Ltd. All rights reserved.

Improving a recombinant Zymomonas mobilis strain 8b through continuous adaptation on dilute acid pretreated corn stover hydrolysate

DOE PAGES

Mohagheghi, Ali; Linger, Jeffrey G.; Yang, Shihui; ...

2015-03-31

Complete conversion of the major sugars of biomass including both the C 5 and C 6 sugars is critical for biofuel production processes. Several inhibitory compounds like acetate, hydroxymethylfurfural (HMF), and furfural are produced from the biomass pretreatment process leading to ‘hydrolysate toxicity,’ a major problem for microorganisms to achieve complete sugar utilization. Therefore, development of more robust microorganisms to utilize the sugars released from biomass under toxic environment is critical. In this study, we use continuous culture methodologies to evolve and adapt the ethanologenic bacterium Zymomonas mobilis to improve its ethanol productivity using corn stover hydrolysate. The results aremore » the following: A turbidostat was used to adapt the Z. mobilis strain 8b in the pretreated corn stover liquor. The adaptation was initiated using pure sugar (glucose and xylose) followed by feeding neutralized liquor at different dilution rates. Once the turbidostat reached 60% liquor content, the cells began washing out and the adaptation was stopped. Several ‘sub-strains’ were isolated, and one of them, SS3 (sub-strain 3), had 59% higher xylose utilization than the parent strain 8b when evaluated on 55% neutralized PCS (pretreated corn stover) liquor. Using saccharified PCS slurry generated by enzymatic hydrolysis from 25% solids loading, SS3 generated an ethanol yield of 75.5% compared to 64% for parent strain 8b. Furthermore, the total xylose utilization was 57.7% for SS3 versus 27.4% for strain 8b. To determine the underlying genotypes in these new sub-strains, we conducted genomic resequencing and identified numerous single-nucleotide mutations (SNPs) that had arisen in SS3. We further performed quantitative reverse transcription PCR (qRT-PCR) on genes potentially affected by these SNPs and identified significant down-regulation of two genes, ZMO0153 and ZMO0776, in SS3 suggesting potential genetic mechanisms behind SS3’s improved

Improving a recombinant Zymomonas mobilis strain 8b through continuous adaptation on dilute acid pretreated corn stover hydrolysate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohagheghi, Ali; Linger, Jeffrey G.; Yang, Shihui

Complete conversion of the major sugars of biomass including both the C 5 and C 6 sugars is critical for biofuel production processes. Several inhibitory compounds like acetate, hydroxymethylfurfural (HMF), and furfural are produced from the biomass pretreatment process leading to ‘hydrolysate toxicity,’ a major problem for microorganisms to achieve complete sugar utilization. Therefore, development of more robust microorganisms to utilize the sugars released from biomass under toxic environment is critical. In this study, we use continuous culture methodologies to evolve and adapt the ethanologenic bacterium Zymomonas mobilis to improve its ethanol productivity using corn stover hydrolysate. The results aremore » the following: A turbidostat was used to adapt the Z. mobilis strain 8b in the pretreated corn stover liquor. The adaptation was initiated using pure sugar (glucose and xylose) followed by feeding neutralized liquor at different dilution rates. Once the turbidostat reached 60% liquor content, the cells began washing out and the adaptation was stopped. Several ‘sub-strains’ were isolated, and one of them, SS3 (sub-strain 3), had 59% higher xylose utilization than the parent strain 8b when evaluated on 55% neutralized PCS (pretreated corn stover) liquor. Using saccharified PCS slurry generated by enzymatic hydrolysis from 25% solids loading, SS3 generated an ethanol yield of 75.5% compared to 64% for parent strain 8b. Furthermore, the total xylose utilization was 57.7% for SS3 versus 27.4% for strain 8b. To determine the underlying genotypes in these new sub-strains, we conducted genomic resequencing and identified numerous single-nucleotide mutations (SNPs) that had arisen in SS3. We further performed quantitative reverse transcription PCR (qRT-PCR) on genes potentially affected by these SNPs and identified significant down-regulation of two genes, ZMO0153 and ZMO0776, in SS3 suggesting potential genetic mechanisms behind SS3’s improved

Sequence and genetic organization of a Zymomonas mobilis gene cluster that encodes several enzymes of glucose metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnell, W.O.; Kyung Cheol Yi; Conway, T.

1990-12-01

The Zymomonas mobilis genes that encode glucose-6-phosphate dehydrogenase (zwf), 6-phosphogluconate dehydratase (edd), and glucokinase (glk) were cloned independently by genetic complementation of specific defects in Escherichia coli metabolism. The identify of these cloned genes was confirmed by various biochemical means. Nucleotide sequence analysis established that these three genes are clustered on the genome and revealed an additional open reading frame in this region that has significant amino acid identity to the E.coli xylose-proton symporter and the human glucose transporter. On the basis of this evidence and structural analysis of the deduced primary amino acid sequence, this gene is believed tomore » encode the Z. mobilis glucose-facilitated diffusion protein, glf. The four genes in the 6-kb cluster are organized in the order glf, zwf, edd, glk. The glf and zwf genes are separated by 146 bp. The zwf and edd genes overlap by 8 bp, and their expression may be translationally coupled. The edd and glk genes are separated by 203 bp. The glk gene is followed by tandem transcriptional terminators. The four genes appear to be organized in an operon. Such an arrangement of the genes that govern glucose uptake and the first three steps of the Entner-Doudoroff glycolytic pathway provides the organism with a mechanism for carefully regulating the levels of the enzymes that control carbon flux into the pathway.« less

Development of corn silk as a biocarrier for Zymomonas mobilis biofilms in ethanol production from rice straw.

PubMed

Todhanakasem, Tatsaporn; Tiwari, Rashmi; Thanonkeo, Pornthap

2016-01-01

Z. mobilis cell immobilization has been proposed as an effective means of improving ethanol production. In this work, polystyrene and corn silk were used as biofilm developmental matrices for Z. mobilis ethanol production with rice straw hydrolysate as a substrate. Rice straw was hydrolyzed by dilute sulfuric acid (H2SO4) and enzymatic hydrolysis. The final hydrolysate contained furfural (271.95 ± 76.30 ppm), 5-hydroxymethyl furfural (0.07 ± 0.00 ppm), vanillin (1.81 ± 0.00 ppm), syringaldehyde (5.07 ± 0.83 ppm), 4-hydroxybenzaldehyde (4-HB) (2.39 ± 1.20 ppm) and acetic acid (0.26 ± 0.08%). Bacterial attachment or biofilm formation of Z. mobilis strain TISTR 551 on polystyrene and delignified corn silk carrier provided significant ethanol yields. Results showed up to 0.40 ± 0.15 g ethanol produced/g glucose consumed when Z. mobilis was immobilized on a polystyrene carrier and 0.51 ± 0.13 g ethanol produced/g glucose consumed when immobilized on delignified corn silk carrier under batch fermentation by Z. mobilis TISTR 551 biofilm. The higher ethanol yield from immobilized, rather than free living, Z. mobilis could possibly be explained by a higher cell density, better control of anaerobic conditions and higher toxic tolerance of Z. mobilis biofilms over free cells.

Effect of Brönsted acidic ionic liquid 1-(1-propylsulfonic)-3-methylimidazolium chloride on growth and co-fermentation of glucose, xylose and arabinose by Zymomonas mobilis AX101.

PubMed

Gyamerah, M; Ampaw-Asiedu, M; Mackey, J; Menezes, B; Woldesenbet, S

2018-06-01

The potential of large-scale lignocellulosic biomass hydrolysis to fermentable sugars using ionic liquids has increased interest in this green chemistry route to fermentation for fuel-ethanol production. The ionic liquid 1-(1-propylsulfonic)-3-methylimidazolium chloride compared to other reported ionic liquids has the advantage of hydrolysing lignocellulosic biomass to reducing sugars at catalytic concentrations (≤0·032 mol l -1 ) in a single step. However, effects of this ionic liquid on co-fermentation of glucose, xylose and arabinose to ethanol by recombinant Zymomonas mobilisAX101 has not been studied. Authentic glucose, xylose and arabinose were used to formulate fermentation media at varying catalytic 1-(1-propylsulfonic)-3-methylimidazolium chloride concentrations for batch co-fermentation of the sugars using Z. mobilisAX101. The results showed that at 0·008, 0·016 and 0·032 mol l -1 ionic liquid in the culture medium, cell growth decreased by 10, 27 and 67% respectively compared to the control. Ethanol yields were 62·6, 61·8, 50·5 and 23·1% for the control, 0·008, 0·016 and 0·032 mol l -1 ionic liquid respectively. The results indicate that lignocellulosic biomass hydrolysed using 0·008 mol l -1 of 1-(1-propylsulfonic)-3-methylimidazolium chloride would eliminate an additional separation step and provide a ready to use fermentation substrate. This is the first reported study of the effect of the Brönsted acidic ionic liquid 1-(1-propylsulfonic)-3-methylimidazolium chloride on growth and co-fermentation of glucose, xylose and arabinose by Zymomonas mobilisAX101 in batch culture. Growth on and co-fermentation of the sugars by Z. mobilisAX 101 with no significant inhibition by the ionic liquid at the same catalytic amounts of 0·008 mol l -1 used to hydrolyse lignocellulosic biomass to reducing sugars overcome two major hurdles that adversely affect the process economics of large-scale industrial cellulosic fuel ethanol production

Structure of the Zymomonas mobilis respiratory chain: oxygen affinity of electron transport and the role of cytochrome c peroxidase.

PubMed

Balodite, Elina; Strazdina, Inese; Galinina, Nina; McLean, Samantha; Rutkis, Reinis; Poole, Robert K; Kalnenieks, Uldis

2014-09-01

The genome of the ethanol-producing bacterium Zymomonas mobilis encodes a bd-type terminal oxidase, cytochrome bc1 complex and several c-type cytochromes, yet lacks sequences homologous to any of the known bacterial cytochrome c oxidase genes. Recently, it was suggested that a putative respiratory cytochrome c peroxidase, receiving electrons from the cytochrome bc1 complex via cytochrome c552, might function as a peroxidase and/or an alternative oxidase. The present study was designed to test this hypothesis, by construction of a cytochrome c peroxidase mutant (Zm6-perC), and comparison of its properties with those of a mutant defective in the cytochrome b subunit of the bc1 complex (Zm6-cytB). Disruption of the cytochrome c peroxidase gene (ZZ60192) caused a decrease of the membrane NADH peroxidase activity, impaired the resistance of growing culture to exogenous hydrogen peroxide and hampered aerobic growth. However, this mutation did not affect the activity or oxygen affinity of the respiratory chain, or the kinetics of cytochrome d reduction. Furthermore, the peroxide resistance and membrane NADH peroxidase activity of strain Zm6-cytB had not decreased, but both the oxygen affinity of electron transport and the kinetics of cytochrome d reduction were affected. It is therefore concluded that the cytochrome c peroxidase does not terminate the cytochrome bc1 branch of Z. mobilis, and that it is functioning as a quinol peroxidase. © 2014 The Authors.

Genetic engineering and improvement of a Zymomonas mobilis for arabinose utilization and its performance on pretreated corn stover hydrolyzate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, Yat -Chen; Linger, Jeffrey; Yang, Shihui

In this paper, a glucose, xylose and arabinose utilizing Zymomonas mobilis strain was constructed by incorporating arabinose catabolic pathway genes, araBAD encoding L-ribulokinase, L-arabinose isomerase and L-ribulose-5-phosphate- 4-epimerase in a glucose, xylose co-fermenting host, 8b, using a transposition integration approach. Further improvement on this arabinose-capable integrant, 33C was achieved by applying a second transposition to create a genomic knockout (KO) mutant library. Using arabinose as a sole carbon source and a selection pressure, the KO library was subjected to a growth-enrichment process involving continuous sub-culturing for over 120 generations. Strain 13-1-17, isolated from such process demonstrated significant improvement in metabolizingmore » arabinose in a dilute acid pretreated, saccharified corn stover slurry. Through Next Generation Sequencing (NGS) analysis, integration sites of the transposons were identified. Furthermore, multiple additional point mutations (SNPs: Single Nucleotide Polymorphisms) were discovered in 13-1-17, affecting genes araB and RpiB in the genome. Finally, we speculate that these mutations may have impacted the expression of the enzymes coded by these genes, ribulokinase and Ribose 5-P-isomerase, thus attributing to the improvement of the arabinose utilization.« less

Genetic engineering and improvement of a Zymomonas mobilis for arabinose utilization and its performance on pretreated corn stover hydrolyzate

DOE PAGES

Chou, Yat -Chen; Linger, Jeffrey; Yang, Shihui; ...

2015-04-28

In this paper, a glucose, xylose and arabinose utilizing Zymomonas mobilis strain was constructed by incorporating arabinose catabolic pathway genes, araBAD encoding L-ribulokinase, L-arabinose isomerase and L-ribulose-5-phosphate- 4-epimerase in a glucose, xylose co-fermenting host, 8b, using a transposition integration approach. Further improvement on this arabinose-capable integrant, 33C was achieved by applying a second transposition to create a genomic knockout (KO) mutant library. Using arabinose as a sole carbon source and a selection pressure, the KO library was subjected to a growth-enrichment process involving continuous sub-culturing for over 120 generations. Strain 13-1-17, isolated from such process demonstrated significant improvement in metabolizingmore » arabinose in a dilute acid pretreated, saccharified corn stover slurry. Through Next Generation Sequencing (NGS) analysis, integration sites of the transposons were identified. Furthermore, multiple additional point mutations (SNPs: Single Nucleotide Polymorphisms) were discovered in 13-1-17, affecting genes araB and RpiB in the genome. Finally, we speculate that these mutations may have impacted the expression of the enzymes coded by these genes, ribulokinase and Ribose 5-P-isomerase, thus attributing to the improvement of the arabinose utilization.« less

Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes

DOEpatents

Ingram, Lonnie O.; Conway, Tyrrell; Alterthum, Flavio

1991-01-01

A novel operon and plasmids comprising genes which code for the alcohol dehydrogenase and pyruvate decarboxylase activities of Zymomonas mobilis are described. Also disclosed are methods for increasing the growth of microorganisms or eukaryotic cells and methods for reducing the accumulation of undesirable metabolic products in the growth medium of microorganisms or cells.

Performance testing of Zymomonas mobilis metabolically engineered for cofermentation of glucose, xylose, and arabinose.

PubMed

Lawford, Hugh G; Rousseau, Joyce D

2002-01-01

IOGEN Corporation of Ottawa, Canada, has recently built a 40t/d biomass-to-ethanol demonstration plant adjacent to its enzyme production facility. It has partnered with the University of Toronto to test the C6/C5 cofermenta-tion performance characteristics of the National Renewable Energy Labora-tory's metabolically engineered Zymomonas mobilis using various biomass hydrolysates. IOGEN's feedstocks are primarily agricultural wastes such as corn stover and wheat straw. Integrated recombinant Z. mobilis strain AX101 grows on D-xylose and/or L-arabinose as the sole carbon/energy sources and ferments these pentose sugars to ethanol in high yield. Strain AX101 lacks the tetracycline resistance gene that was a common feature of other recombinant Zm constructs. Genomic integration provides reliable cofermentation performance in the absence of antibiotics, another characteristic making strain AX101 attractive for industrial cellulosic ethanol production. In this work, IOGEN's biomass hydrolysate was simulated by a pure sugar medium containing 6% (w/v) glucose, 3% xylose, and 0.35% arabinose. At a level of 3 g/L (dry solids), corn steep liquor with inorganic nitrogen (0.8 g/L of ammonium chloride or 1.2 g/L of diammonium phosphate) was a cost-effective nutritional supplement. In the absence of acetic acid, the maximum volumetric ethanol productivity of a continuous fermentation at pH 5.0 was 3.54 g/L x h. During prolonged continuous fermentation, the efficiency of sugar-to-ethanol conversion (based on total sugar load) was maintained at >85%. At a level of 0.25% (w/v) acetic acid, the productivity decreased to 1.17 g/L x h at pH 5.5. Unlike integrated, xylose-utilizing rec Zm strain C25, strain AX101 produces less lactic acid as byproduct, owing to the fact that the Escherichia coli arabinose genes are inserted into a region of the host chromosome tentatively assigned to the gene for D-lactic acid dehydrogenase. In pH-controlled batch fermentations with sugar mixtures, the

Development of a high-throughput method to evaluate the impact of inhibitory compounds from lignocellulosic hydrolysates on the growth of Zymomonas mobilis.

PubMed

Franden, Mary Ann; Pienkos, Philip T; Zhang, Min

2009-12-01

Overcoming the effects of hydrolysate toxicity towards ethanologens is a key technical barrier in the biochemical conversion process for biomass feedstocks to ethanol. Despite its importance, the complexity of the hydrolysate toxicity phenomena and the lack of systematic studies, analysis and tools surrounding this issue have blocked a full understanding of relationships involving toxic compounds in hydrolysates and their effects on ethanologen growth and fermentation. In this study, we developed a quantitative, high-throughput biological growth assay using an automated turbidometer to obtain detailed inhibitory kinetics for individual compounds present in lignocellulosic biomass hydrolysate. Information about prolonged lag time and final cell densities can also be obtained. The effects of furfural, hydroxymethylfurfural (HMF), acetate and ethanol on growth rate and final cell densities of Zymomonas mobilis 8b on glucose are presented. This method was also shown to be of value in toxicity studies of hydrolysate itself, despite the highly colored nature of this material. Using this approach, we can generate comprehensive inhibitory profiles with many individual compounds and develop models that predict and examine toxic effects in the complex mixture of hydrolysates, leading to the development of improved pretreatment and conditioning processes as well as fermentation organisms.

Biotransformation of pineapple juice sugars into dietetic derivatives by using a cell free oxidoreductase from Zymomonas mobilis together with commercial invertase.

PubMed

Aziz, M G; Michlmayr, H; Kulbe, K D; Del Hierro, A M

2011-01-05

An easy procedure for cell free biotransformation of pineapple juice sugars into dietetic derivatives was accomplished using a commercial invertase and an oxidoreductase from Zymomonas mobilis. First, pineapple juice sucrose was quantitatively converted into glucose and fructose by invertase, thus increasing the concentration of each monosaccharide in the original juice to almost twice. In a second step, glucose-fructose oxidoreductase (GFOR) transformed glucose into gluconolactone, and fructose into the low calorie sweetener sorbitol. The advantage of using GFOR is simultaneous reduction of fructose and oxidation of glucose, allowing the continuous regeneration of the essential coenzyme NADP(H), that is tightly bound to the enzyme. The yield of GFOR catalyzed sugar conversion depends on initial pH and control of pH during the reaction. At optimal conditions (pH control at 6.2) a maximum of 80% (w/v) sugar conversion was obtained. Without pH control, GFOR is inactivated rapidly due to gluconic acid formation. Therefore, conversion yields are relatively low at the natural pH of pineapple juice. The application of this process might be more advantageous on juices of other tropical fruits (papaya, jackfruit, mango) due to their naturally given higher pH. Copyright © 2010 Elsevier Inc. All rights reserved.

Identification of yeast and bacteria involved in the mezcal fermentation of Agave salmiana.

PubMed

Escalante-Minakata, P; Blaschek, H P; Barba de la Rosa, A P; Santos, L; De León-Rodríguez, A

2008-06-01

To identify the yeast and bacteria present in the mezcal fermentation from Agave salmiana. The restriction and sequence analysis of the amplified region, between 18S and 28S rDNA and 16S rDNA genes, were used for the identification of yeast and bacteria, respectively. Eleven different micro-organisms were identified in the mezcal fermentation. Three of them were the following yeast: Clavispora lusitaniae, Pichia fermentans and Kluyveromyces marxianus. The bacteria found were Zymomonas mobilis subsp. mobilis and Zymomonas mobilis subsp. pomaceae, Weissella cibaria, Weissella paramesenteroides, Lactobacillus pontis, Lactobacillus kefiri, Lactobacillus plantarum and Lactobacillus farraginis. The phylogenetic analysis of 16S rDNA and ITS sequences showed that microbial diversity present in mezcal is dominated by bacteria, mainly lactic acid bacteria species and Zymomonas mobilis. Pichia fermentans and K. marxianus could be micro-organisms with high potential for the production of some volatile compounds in mezcal. We identified the community of bacteria and yeast present in mezcal fermentation from Agave salmiana.

From lin-benzoguanines to lin-benzohypoxanthines as ligands for Zymomonas mobilis tRNA-guanine transglycosylase: replacement of protein-ligand hydrogen bonding by importing water clusters.

PubMed

Barandun, Luzi Jakob; Immekus, Florian; Kohler, Philipp C; Tonazzi, Sandro; Wagner, Björn; Wendelspiess, Severin; Ritschel, Tina; Heine, Andreas; Kansy, Manfred; Klebe, Gerhard; Diederich, François

2012-07-23

The foodborne illness shigellosis is caused by Shigella bacteria that secrete the highly cytotoxic Shiga toxin, which is also formed by the closely related enterohemorrhagic Escherichia coli (EHEC). It has been shown that tRNA-guanine transglycosylase (TGT) is essential for the pathogenicity of Shigella flexneri. Herein, the molecular recognition properties of a guanine binding pocket in Zymomonas mobilis TGT are investigated with a series of lin-benzohypoxanthine- and lin-benzoguanine-based inhibitors that bear substituents to occupy either the ribose-33 or the ribose-34 pocket. The three inhibitor scaffolds differ by the substituent at C(6) being H, NH(2), or NH-alkyl. These differences lead to major changes in the inhibition constants, pK(a) values, and binding modes. Compared to the lin-benzoguanines, with an exocyclic NH(2) at C(6), the lin-benzohypoxanthines without an exocyclic NH(2) group have a weaker affinity as several ionic protein-ligand hydrogen bonds are lost. X-ray cocrystal structure analysis reveals that a new water cluster is imported into the space vacated by the lacking NH(2) group and by a conformational shift of the side chain of catalytic Asp102. In the presence of an N-alkyl group at C(6) in lin-benzoguanine ligands, this water cluster is largely maintained but replacement of one of the water molecules in the cluster leads to a substantial loss in binding affinity. This study provides new insight into the role of water clusters at enzyme active sites and their challenging substitution by ligand parts, a topic of general interest in contemporary structure-based drug design. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Optical mapping and sequencing of the Escherichia coli KO11 genome reveal extensive chromosomal rearrangements, and multiple tandem copies of the Zymomonas mobilis pdc and adhB genes.

PubMed

Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O

2012-04-01

Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.

Comparing the fermentation performance of Escherichia coli KO11, Saccharomyces cerevisiae 424A(LNH-ST) and Zymomonas mobilis AX101 for cellulosic ethanol production

PubMed Central

2010-01-01

Background Fermentations using Escherichia coli KO11, Saccharomyces cerevisiae 424A(LNH-ST), and Zymomonas mobilis AX101 are compared side-by-side on corn steep liquor (CSL) media and the water extract and enzymatic hydrolysate from ammonia fiber expansion (AFEX)-pretreated corn stover. Results The three ethanologens are able produce ethanol from a CSL-supplemented co-fermentation at a metabolic yield, final concentration and rate greater than 0.42 g/g consumed sugars, 40 g/L and 0.7 g/L/h (0-48 h), respectively. Xylose-only fermentation of the tested ethanologenic bacteria are five to eight times faster than 424A(LNH-ST) in the CSL fermentation. All tested strains grow and co-ferment sugars at 15% w/v solids loading equivalent of ammonia fiber explosion (AFEX)-pretreated corn stover water extract. However, both KO11 and 424A(LNH-ST) exhibit higher growth robustness than AX101. In 18% w/w solids loading lignocellulosic hydrolysate from AFEX pretreatment, complete glucose fermentations can be achieved at a rate greater than 0.77 g/L/h. In contrast to results from fermentation in CSL, S. cerevisiae 424A(LNH-ST) consumed xylose at the greatest extent and rate in the hydrolysate compared to the bacteria tested. Conclusions Our results confirm that glucose fermentations among the tested strains are effective even at high solids loading (18% by weight). However, xylose consumption in the lignocellulosic hydrolysate is the major bottleneck affecting overall yield, titer or rate of the process. In comparison, Saccharomyces cerevisiae 424A(LNH-ST) is the most relevant strains for industrial production for its ability to ferment both glucose and xylose from undetoxified and unsupplemented hydrolysate from AFEX-pretreated corn stover at high yield. PMID:20507563

Pantothenic acid biosynthesis in zymomonas

DOEpatents

Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

2014-07-01

Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

Zymomonas with improved xylose utilization in stress conditions

DOEpatents

Caimi, Perry G; Emptage, Mark; Li, Xu; Viitanen, Paul V; Chou, Yat-Chen; Franden, Mary Ann; Zhang, Min

2013-06-18

Strains of xylose utilizing Zymomonas with improved xylose utilization and ethanol production during fermentation in stress conditions were obtained using an adaptation method. The adaptation involved continuously growing xylose utilizing Zymomonas in media containing high sugars, acetic acid, ammonia, and ethanol.

Similarity of Escherichia coli propanediol oxidoreductase (fucO product) and an unusual alcohol dehydrogenase from Zymomonas mobilis and Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conway, T.; Ingram, L.O.

1989-07-01

The gene that encodes 1,2-propanediol oxidoreductase (fucO) from Escherichia coli was sequenced. The reading frame specified a protein of 383 amino acids (including the N-terminal methionine), with an aggregate molecular weight of 40,642. The induction of fucO transcription, which occurred in the presence of fucose, was confirmed by Northern blot analysis. In E. coli, the primary fucO transcript was approximately 2.1 kilobases in length. The 5{prime} end of the transcript began more than 0.7 kilobase upstream of the fucO start codon within or beyond the fucA gene. Propanediol oxidoreductase exhibited 41.7% identity with the iron-containing alcohol dehydrogenase II from Zymomonasmore » mobilis and 39.5% identity with ADH4 from Saccharomyces cerevisiae. These three proteins did not share homology with either short-chain or long-chain zinc-containing alcohol dehydrogenase enzymes. We propose that these three unusual alcohol dehydrogenases define a new family of enzymes.« less

Zymomonas with improved ethanol production in medium containing concentrated sugars and acetate

DOEpatents

Caimi, Perry G.; Chou, Yat-Chen; Franden, Mary Ann; Knoke, Kyle; Tao, Luan; Viitanen, Paul V.; Zhang, Min; Zhang, Yuying

2010-09-28

Through screening of a Zymomonas mutant library the himA gene was found to be involved in the inhibitory effect of acetate on Zymomonas performance. Xylose-utilizing Zymomonas further engineered to reduce activity of the himA gene were found to have increased ethanol production in comparison to a parental strain, when cultured in medium comprising xylose and acetate.

Zymomonas with improved ethanol production in medium containing concentrated sugars and acetate

DOEpatents

Caimi, Perry G [Kennett Square, PA; Chou, Yat-Chen [Lakewood, CO; Franden, Mary Ann [Centennial, CO; Knoke, Kyle [Newark, DE; Tao, Luan [Havertown, PA; Viitanen, Paul V [West Chester, PA; Zhang, Min [Lakewood, CO; Zhang, Yuying [New Hope, PA

2011-03-01

Through screening of a Zymomonas mutant library the himA gene was found to be involved in the inhibitory effect of acetate on Zymomonas performance. Xylose-utilizing Zymomonas strains further engineered to reduce activity of the himA gene were found to have increased ethanol production in comparison to a parental strain, when cultured in mixed-sugars medium comprising xylose, and, in particular, in the presence of acetate.

CP4 miracle: shaping Yukawa sector with CP symmetry of order four

NASA Astrophysics Data System (ADS)

Ferreira, P. M.; Ivanov, Igor P.; Jiménez, Enrique; Pasechnik, Roman; Serôdio, Hugo

2018-01-01

We explore the phenomenology of a unique three-Higgs-doublet model based on the single CP symmetry of order 4 (CP4) without any accidental symmetries. The CP4 symmetry is imposed on the scalar potential and Yukawa interactions, strongly shaping both sectors of the model and leading to a very characteristic phenomenology. The scalar sector is analyzed in detail, and in the Yukawa sector we list all possible CP4-symmetric structures which do not run into immediate conflict with experiment, namely, do not lead to massless or mass-degenerate quarks nor to insufficient mixing or CP -violation in the CKM matrix. We show that the parameter space of the model, although very constrained by CP4, is large enough to comply with the electroweak precision data and the LHC results for the 125 GeV Higgs boson phenomenology, as well as to perfectly reproduce all fermion masses, mixing, and CP violation. Despite the presence of flavor changing neutral currents mediated by heavy Higgs scalars, we find through a parameter space scan many points which accurately reproduce the kaon CP -violating parameter ɛ K as well as oscillation parameters in K and B ( s) mesons. Thus, CP4 offers a novel minimalistic framework for building models with very few assumptions, sufficient predictive power, and rich phenomenology yet to be explored.

Xylose utilization in recombinant zymomonas

DOEpatents

Caimi, Perry G; McCole, Laura; Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V

2014-03-25

Xylose-utilizing Zymomonas strains studied were found to accumulate ribulose when grown in xylose-containing media. Engineering these strains to increase ribose-5-phosphate isomerase activity led to reduced ribulose accumulation, improved growth, improved xylose utilization, and increased ethanol production.

Simultaneous saccharification and cofermentation of peracetic acid-pretreated biomass.

PubMed

Teixeira, L C; Linden, J C; Schroeder, H A

2000-01-01

Previous work in our laboratories has demonstrated the effectiveness of peracetic acid for improving enzymatic digestibility of lignocellulosic materials. The use of dilute alkali solutions as a pre-pretreatment prior to peracetic acid lignin oxidation increased carbohydrate hydrolysis yields in a synergistic as opposed to additive manner. Deacetylation of xylan is easily achieved using dilute alkali solutions under mild conditions. In this article, we evaluate the effectiveness of peracetic acid combined with an alkaline pre-pretreatment through simultaneous saccharification and cofermentation (SSCF) of pretreated hybrid poplar wood and sugar cane bagasse. Respective ethanol yields of 92.8 and 91.9% of theoretical are achieved using 6% NaOH/15% peracetic acid-pretreated substrates and recombinant Zymomonas mobilis CP4/pZB5. Reduction of acetyl groups of the lignocellulosic materials is demonstrated following alkaline pre-pretreatments. Such processing may be helpful in reducing peracetic acid requirements. The influence of deacetylation is more significant in combined pretreatments using lower peracetic acid loadings.

Xylose utilization in recombinant Zymomonas

DOEpatents

Kahsay, Robel Y; Qi, Min; Tao, Luan; Viitanen, Paul V; Yang, Jianjun

2013-01-07

Zymomonas expressing xylose isomerase from A. missouriensis was found to have improved xylose utilization, growth, and ethanol production when grown in media containing xylose. Xylose isomerases related to that of A. missouriensis were identified structurally through molecular phylogenetic and Profile Hidden Markov Model analyses, providing xylose isomerases that may be used to improve xylose utilization.

Completing the Heterocubane Family [Cp*AlE]4 (E = O, S, Se, and Te) by Selective Oxygenation and Sulfuration of [Cp*Al]4: Density Functional Theory Calculations of [Cp*AlE]4 and Reactivity of [Cp*AlO]4 toward Hydrolysis.

PubMed

Stelzer, Adrian C; Hrobárik, Peter; Braun, Thomas; Kaupp, Martin; Braun-Cula, Beatrice

2016-05-16

The subvalent aluminum compound [Cp*Al]4 (1) reacts with dioxygen, N2O, or sulfur to yield the heterocubane complexes [Cp*AlX]4 [X = O (2) and S (3)]. Treatment of [Cp*AlO]4 (2) with (tBuO)3SiOH gave [(tBuO)3SiOAlO]4 (6) and Cp*H. The structures and spectroscopic data of the Al clusters are supported by density functional theory (DFT) calculations, which also demonstrate the importance of noncovalent interactions (NCI) in oligomeric Al(I) complexes as well as in [Cp*AlS]4 and the heavier homologues of Se and Te. The computed (27)Al NMR shifts indicate a deshielding at the Al centers with increasing electronegativity of the chalcogen atom as well as significant spin-orbit shielding effects within the heavier heterocubane [Al4E4] cores. Further hydrolysis of 6 with an additional amount of silanol in the presence of water resulted in the formation of [Al4(OH)6(OH2)2(OSiOtBu3)6] (7), which shows a structural motif found in boehmite and diaspore.

CP Violation (4/4)

ScienceCinema

Raven, G.

2018-05-23

Existence of antimatter is a consequence of the combination of special relativity and quantum mechanics. No 'primordial' antimatter's observed, need CP violation. CP broken by the charged weak interaction. The weak and mass eigenstates of quarks are different, and this difference is described by the CKM matrix. There is a clear (and unexplained!) hierarchical structure to the CKM matrix...with 3 (or more families, one can have a complex phase(s) in the CKM matrix, and this allows for CP violation! Measurements show that CKM describes the dominant (only?) source of CP violation (at the EW scale). But it doesn't explain the matter--antimatter asymmetry of the universe.

Ethanol production in recombinant hosts

DOEpatents

Ingram, Lonnie O'Neal; Barbosa-Alleyne, Maria D.

2005-02-01

The subject invention concerns the transformation of Gram-positive bacteria with heterologous genes which confer upon these microbes the ability to produce ethanol as a fermentation product. Specifically exemplified is the transformation of bacteria with genes, obtainable from Zymomonas mobilis, which encode pyruvate decarboxylase and alcohol dehydrogenase.

Ethanol production in gram-positive microbes

DOEpatents

Ingram, Lonnie O'Neal; Barbosa-Alleyne, Maria D. F.

1999-01-01

The subject invention concerns the transformation of Gram-positive bacteria with heterologous genes which confer upon these microbes the ability to produce ethanol as a fermentation product. Specifically exemplified is the transformation of bacteria with genes, obtainable from Zymomonas mobilis, which encode pyruvate decarboxylase and alcohol dehydrogenase.

Ethanol production in Gram-positive microbes

DOEpatents

Ingram, Lonnie O'Neal; Barbosa-Alleyne, Maria D. F.

1996-01-01

The subject invention concerns the transformation of Gram-positive bacteria with heterologous genes which confer upon these microbes the ability to produce ethanol as a fermentation product. Specifically exemplified is the transformation of bacteria with genes, obtainable from Zymomonas mobilis, which encode pyruvate decarboxylase and alcohol dehydrogenase.

Radiative neutrino masses from order-4 CP symmetry

NASA Astrophysics Data System (ADS)

Ivanov, Igor P.

2018-02-01

Generalized CP symmetry of order 4 (CP4) is surprisingly powerful in shaping scalar and quark sectors of multi-Higgs models. Here, we extend this framework to the neutrino sector. We build two simple Majorana neutrino mass models with unbroken CP4, which are analogous to Ma's scotogenic model. Both models use three Higgs doublets and two or three right-handed (RH) neutrinos. The minimal CP4 symmetric scotogenic model uses only two RH neutrinos, leads to three non-zero light neutrino masses, and contains a built-in mechanism to further suppress them via phase alignment. With three RH neutrinos, one generates a type I seesaw mass matrix of rank 1, which is then corrected by the same scotogenic mechanism, naturally leading to two neutrino mass scales with mild hierarchy. These minimal CP4-based constructions emerge as a primer for introducing additional symmetry structures and exploring their phenomenological consequences.

Ethanol production in Gram-positive microbes

DOEpatents

Ingram, L.O.; Barbosa-Alleyne, M.D.F.

1999-06-29

The subject invention concerns the transformation of Gram-positive bacteria with heterologous genes which confer upon these microbes the ability to produce ethanol as a fermentation product. Specifically exemplified is the transformation of bacteria with genes, obtainable from Zymomonas mobilis, which encode pyruvate decarboxylase and alcohol dehydrogenase. 2 figs.

Ethanol production in Gram-positive microbes

DOEpatents

Ingram, L.O.; Barbosa-Alleyne, M.D.F.

1996-01-09

The subject invention concerns the transformation of Gram-positive bacteria with heterologous genes which confer upon these microbes the ability to produce ethanol as a fermentation product. Specifically exemplified is the transformation of bacteria with genes, obtainable from Zymomonas mobilis, which encode pyruvate decarboxylase and alcohol dehydrogenase. 2 figs.

Global occurrence and heterogeneity of the Roseobacter-clade species Ruegeria mobilis

PubMed Central

Sonnenschein, Eva C; Nielsen, Kristian F; D'Alvise, Paul; Porsby, Cisse H; Melchiorsen, Jette; Heilmann, Jens; Kalatzis, Panos G; López-Pérez, Mario; Bunk, Boyke; Spröer, Cathrin; Middelboe, Mathias; Gram, Lone

2017-01-01

Tropodithietic acid (TDA)-producing Ruegeria mobilis strains of the Roseobacter clade have primarily been isolated from marine aquaculture and have probiotic potential due to inhibition of fish pathogens. We hypothesized that TDA producers with additional novel features are present in the oceanic environment. We isolated 42 TDA-producing R. mobilis strains during a global marine research cruise. While highly similar on the 16S ribosomal RNA gene level (99–100% identity), the strains separated into four sub-clusters in a multilocus sequence analysis. They were further differentiated to the strain level by average nucleotide identity using pairwise genome comparison. The four sub-clusters could not be associated with a specific environmental niche, however, correlated with the pattern of sub-typing using co-isolated phages, the number of prophages in the genomes and the distribution in ocean provinces. Major genomic differences within the sub-clusters include prophages and toxin-antitoxin systems. In general, the genome of R. mobilis revealed adaptation to a particle-associated life style and querying TARA ocean data confirmed that R. mobilis is more abundant in the particle-associated fraction than in the free-living fraction occurring in 40% and 6% of the samples, respectively. Our data and the TARA data, although lacking sufficient data from the polar regions, demonstrate that R. mobilis is a globally distributed marine bacterial species found primarily in the upper open oceans. It has preserved key phenotypic behaviors such as the production of TDA, but contains diverse sub-clusters, which could provide new capabilities for utilization in aquaculture. PMID:27552638

Dissecting a complex chemical stress: chemogenomic profiling of plant hydrolysates

PubMed Central

Skerker, Jeffrey M; Leon, Dacia; Price, Morgan N; Mar, Jordan S; Tarjan, Daniel R; Wetmore, Kelly M; Deutschbauer, Adam M; Baumohl, Jason K; Bauer, Stefan; Ibáñez, Ana B; Mitchell, Valerie D; Wu, Cindy H; Hu, Ping; Hazen, Terry; Arkin, Adam P

2013-01-01

The efficient production of biofuels from cellulosic feedstocks will require the efficient fermentation of the sugars in hydrolyzed plant material. Unfortunately, plant hydrolysates also contain many compounds that inhibit microbial growth and fermentation. We used DNA-barcoded mutant libraries to identify genes that are important for hydrolysate tolerance in both Zymomonas mobilis (44 genes) and Saccharomyces cerevisiae (99 genes). Overexpression of a Z. mobilis tolerance gene of unknown function (ZMO1875) improved its specific ethanol productivity 2.4-fold in the presence of miscanthus hydrolysate. However, a mixture of 37 hydrolysate-derived inhibitors was not sufficient to explain the fitness profile of plant hydrolysate. To deconstruct the fitness profile of hydrolysate, we profiled the 37 inhibitors against a library of Z. mobilis mutants and we modeled fitness in hydrolysate as a mixture of fitness in its components. By examining outliers in this model, we identified methylglyoxal as a previously unknown component of hydrolysate. Our work provides a general strategy to dissect how microbes respond to a complex chemical stress and should enable further engineering of hydrolysate tolerance. PMID:23774757

Biological conversion system

DOEpatents

Scott, C.D.

A system for bioconversion of organic material comprises a primary bioreactor column wherein a biological active agent (zymomonas mobilis) converts the organic material (sugar) to a product (alcohol), a rejuvenator column wherein the biological activity of said biological active agent is enhanced, and means for circulating said biological active agent between said primary bioreactor column and said rejuvenator column.

Bioethanol Production From Banana Stem By Using Simultaneous Saccharification and Fermentation (SSF)

NASA Astrophysics Data System (ADS)

Kusmiyati; Mustofa, A.; Jumarmi

2018-05-01

The rapid growth and development of industries in the world result in a greater energy needs. Some studies show that ethanol can be used as an alternative energy. However, bioethanol production from food raw materials such as sugar and starch has drawback that cause the food crisis. This aim of this study was to convert banana stem into bioethanol. Banana stem contained of 44.6% cellulose, 36.0% hemicellulose and 19.4% lignin. After banana stems were pretreated with acid (H2SO4) and alkaline (NaOH) at a concentration of 2% w/v at 121 °C for 30 minutes, then subsequently the simultaneous saccharification and fermentation (SSF) were carried out by using mixed cultures of Aspergillus niger, Trichoderma reesei and Zymomonas mobilis at various enzymes ratios of (1:1:1), (1:2:1), (1:2:2), (1:1:2) and various pH (4, 5 and 6) with SSF time for 144 hours and temperature of 30°C. The results show that acid pretreatment showed better results than the alkali pretreatment. After acid pretreatment and alkali pretreatment, lignin content of pretreted banana stem reduced to 15.92% and 16.34%, respectively, cellulose increased to 52.11% and 50.6% respectively, hemicellulose reduced to 28.45% and 28.83%, respectively The SSF showed that pH 5 gave the highest bioethanol. The highest concentration of bioethanol (8.51 g/L) was achieved at the SSF process at pH 5 with a ratio Aspergillus niger, Trichoderma reesei and Zymomonas mobilis enzymes of (1:1:2).

Increase in furfural tolerance in ethanologenic Escherichia coli LY180 by plasmid-based expression of thyA.

PubMed

Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P; Shanmugam, Keelnatham T; Ingram, Lonnie O

2012-06-01

Furfural is an inhibitory side product formed during the depolymerization of hemicellulose by mineral acids. Genomic libraries from three different bacteria (Bacillus subtilis YB886, Escherichia coli NC3, and Zymomonas mobilis CP4) were screened for genes that conferred furfural resistance on plates. Beneficial plasmids containing the thyA gene (coding for thymidylate synthase) were recovered from all three organisms. Expression of this key gene in the de novo pathway for dTMP biosynthesis improved furfural resistance on plates and during fermentation. A similar benefit was observed by supplementation with thymine, thymidine, or the combination of tetrahydrofolate and serine (precursors for 5,10-methylenetetrahydrofolate, the methyl donor for ThyA). Supplementation with deoxyuridine provided a small benefit, and deoxyribose was of no benefit for furfural tolerance. A combination of thymidine and plasmid expression of thyA was no more effective than either alone. Together, these results demonstrate that furfural tolerance is increased by approaches that increase the supply of pyrimidine deoxyribonucleotides. However, ThyA activity was not directly affected by the addition of furfural. Furfural has been previously shown to damage DNA in E. coli and to activate a cellular response to oxidative damage in yeast. The added burden of repairing furfural-damaged DNA in E. coli would be expected to increase the cellular requirement for dTMP. Increased expression of thyA (E. coli, B. subtilis, or Z. mobilis), supplementation of cultures with thymidine, and supplementation with precursors for 5,10-methylenetetrahydrofolate (methyl donor) are each proposed to increase furfural tolerance by increasing the availability of dTMP for DNA repair.

Ethanol production using xylitol synthesis mutant of xylose-utilizing zymomonas

DOEpatents

Viitanen, Paul V.; McCutchen, Carol M.; Emptage, Mark; Caimi, Perry G.; Zhang, Min; Chou, Yat-Chen

2010-06-22

Production of ethanol using a strain of xylose-utilizing Zymomonas with a genetic modification of the glucose-fructose oxidoreductase gene was found to be improved due to greatly reduced production of xylitol, a detrimental by-product of xylose metabolism synthesized during fermentation.

Comparative fermentation behaviour and chemical characteristics of Saccharomyces and Zymomonas fermented culled apple juice.

PubMed

Sandhu, D K; Joshi, V K

1994-12-01

Ethanol production from culled apple juice showed that fermentability of the juice could be enhanced by addition of DAHP or ammonium sulphate in Saccharomyces and DAHP in Zymomonas fermentation. Addition of trace elements inhibited both the fermentations and ethanol, consequently. With respect to by-products of fermentation, no clear advantage of Zymomnas fermentation of culled apple juice could be observed. Differences in physico-chemical characteristics of the fermented apple juice were also noted. Saccharomyces cerevisiae proved to be better than Zymomonas in most of the parameters and is preferrable from handling and spoilage point of view.

Solar photocatalytic degradation of chlorophenols mixture (4-CP and 2,4-DCP): Mechanism and kinetic modelling.

PubMed

Abeish, Abdulbasit M; Ang, Ha Ming; Znad, Hussein

2015-01-01

The solar-photocatalytic degradation mechanisms and kinetics of 4-chlorophenol (4-CP) and 2,4-dichlorophenol (2,4-DCP) using TiO2 have been investigated both individually and combined. The individual solar-photocatalytic degradation of both phenolic compounds showed that the reaction rates follow pseudo-first-order reaction. During the individual photocatalytic degradation of both 4-CP and 2,4-DCP under the same condition of TiO2 (0.5 g L(-1)) and light intensities (1000 mW cm(-2)) different intermediates were detected, three compounds associated with 4-CP (hydroquinone (HQ), phenol (Ph) and 4-chlorocatechol (4-cCat)) and two compounds associated with 2,4-DCP (4-CP and Ph). The photocatalytic degradation of the combined mixture (4-CP and 2,4-DCP) was also investigated at the same conditions and different 2,4-DCP initial concentrations. The results showed that the degradation rate of 4-CP decreases when the 2,4-DCP concentration increases. Furthermore, the intermediates detected were similar to that found in the individual degradation but with high Ph concentration. Therefore, a possible reaction mechanism for degradation of this combined mixture was proposed. Moreover, a modified Langmuir-Hinshelwood (L-H) kinetic model considering all detected intermediates was developed. A good agreement between experimental and estimated results was achieved. This model can be useful for scaling-up purposes more accurately as its considering the intermediates formed, which has a significant effect on degrading the main pollutants (4-CP and 2,4-DCP).

Bioethanol production from leafy biomass of mango (Mangifera indica) involving naturally isolated and recombinant enzymes.

PubMed

Das, Saprativ P; Ravindran, Rajeev; Deka, Deepmoni; Jawed, Mohammad; Das, Debasish; Goyal, Arun

2013-01-01

The present study describes the usage of dried leafy biomass of mango (Mangifera indica) containing 26.3% (w/w) cellulose, 54.4% (w/w) hemicellulose, and 16.9% (w/w) lignin, as a substrate for bioethanol production from Zymomonas mobilis and Candida shehatae. The substrate was subjected to two different pretreatment strategies, namely, wet oxidation and an organosolv process. An ethanol concentration (1.21 g/L) was obtained with Z. mobilis in a shake-flask simultaneous saccharification and fermentation (SSF) trial using 1% (w/v) wet oxidation pretreated mango leaves along with mixed enzymatic consortium of Bacillus subtilis cellulase and recombinant hemicellulase (GH43), whereas C. shehatae gave a slightly higher (8%) ethanol titer of 1.31 g/L. Employing 1% (w/v) organosolv pretreated mango leaves and using Z. mobilis and C. shehatae separately in the SSF, the ethanol titers of 1.33 g/L and 1.52 g/L, respectively, were obtained. The SSF experiments performed with 5% (w/v) organosolv-pretreated substrate along with C. shehatae as fermentative organism gave a significantly enhanced ethanol titer value of 8.11 g/L using the shake flask and 12.33 g/L at the bioreactor level. From the bioreactor, 94.4% (v/v) ethanol was recovered by rotary evaporator with 21% purification efficiency.

Purification and characterization of an oxygen-labile, NAD-dependent alcohol dehydrogenase from Desulfovibrio gigas.

PubMed Central

Hensgens, C M; Vonck, J; Van Beeumen, J; van Bruggen, E F; Hansen, T A

1993-01-01

A NAD-dependent, oxygen-labile alcohol dehydrogenase was purified from Desulfovibrio gigas. It was decameric, with subunits of M(r) 43,000. The best substrates were ethanol (Km, 0.15 mM) and 1-propanol (Km, 0.28 mM). N-terminal amino acid sequence analysis showed that the enzyme belongs to the same family of alcohol dehydrogenases as Zymomonas mobilis ADH2 and Bacillus methanolicus MDH. Images PMID:8491707

Towards an informative mutant phenotype for every bacterial gene

DOE PAGES

Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; ...

2014-08-11

Mutant phenotypes provide strong clues to the functions of the underlying genes and could allow annotation of the millions of sequenced yet uncharacterized bacterial genes. However, it is not known how many genes have a phenotype under laboratory conditions, how many phenotypes are biologically interpretable for predicting gene function, and what experimental conditions are optimal to maximize the number of genes with a phenotype. To address these issues, we measured the mutant fitness of 1,586 genes of the ethanol-producing bacterium Zymomonas mobilis ZM4 across 492 diverse experiments and found statistically significant phenotypes for 89% of all assayed genes. Thus, inmore » Z. mobilis, most genes have a functional consequence under laboratory conditions. We demonstrate that 41% of Z. mobilis genes have both a strong phenotype and a similar fitness pattern (cofitness) to another gene, and are therefore good candidates for functional annotation using mutant fitness. Among 502 poorly characterized Z. mobilis genes, we identified a significant cofitness relationship for 174. For 57 of these genes without a specific functional annotation, we found additional evidence to support the biological significance of these gene-gene associations, and in 33 instances, we were able to predict specific physiological or biochemical roles for the poorly characterized genes. Last, we identified a set of 79 diverse mutant fitness experiments in Z. mobilis that are nearly as biologically informative as the entire set of 492 experiments. Therefore, our work provides a blueprint for the functional annotation of diverse bacteria using mutant fitness.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.

Mutant phenotypes provide strong clues to the functions of the underlying genes and could allow annotation of the millions of sequenced yet uncharacterized bacterial genes. However, it is not known how many genes have a phenotype under laboratory conditions, how many phenotypes are biologically interpretable for predicting gene function, and what experimental conditions are optimal to maximize the number of genes with a phenotype. To address these issues, we measured the mutant fitness of 1,586 genes of the ethanol-producing bacterium Zymomonas mobilis ZM4 across 492 diverse experiments and found statistically significant phenotypes for 89% of all assayed genes. Thus, inmore » Z. mobilis, most genes have a functional consequence under laboratory conditions. We demonstrate that 41% of Z. mobilis genes have both a strong phenotype and a similar fitness pattern (cofitness) to another gene, and are therefore good candidates for functional annotation using mutant fitness. Among 502 poorly characterized Z. mobilis genes, we identified a significant cofitness relationship for 174. For 57 of these genes without a specific functional annotation, we found additional evidence to support the biological significance of these gene-gene associations, and in 33 instances, we were able to predict specific physiological or biochemical roles for the poorly characterized genes. Last, we identified a set of 79 diverse mutant fitness experiments in Z. mobilis that are nearly as biologically informative as the entire set of 492 experiments. Therefore, our work provides a blueprint for the functional annotation of diverse bacteria using mutant fitness.« less

Xylitol synthesis mutant of xylose-utilizing zymomonas for ethanol production

DOEpatents

Viitanen, Paul V.; Chou, Yat-Chen; McCutchen, Carol M.; Zhang, Min

2010-06-22

A strain of xylose-utilizing Zymomonas was engineered with a genetic modification to the glucose-fructose oxidoreductase gene resulting in reduced expression of GFOR enzyme activity. The engineered strain exhibits reduced production of xylitol, a detrimental by-product of xylose metabolism. It also consumes more xylose and produces more ethanol during mixed sugar fermentation under process-relevant conditions.

Increase in Furfural Tolerance in Ethanologenic Escherichia coli LY180 by Plasmid-Based Expression of thyA

PubMed Central

Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P.; Shanmugam, Keelnatham T.

2012-01-01

Furfural is an inhibitory side product formed during the depolymerization of hemicellulose by mineral acids. Genomic libraries from three different bacteria (Bacillus subtilis YB886, Escherichia coli NC3, and Zymomonas mobilis CP4) were screened for genes that conferred furfural resistance on plates. Beneficial plasmids containing the thyA gene (coding for thymidylate synthase) were recovered from all three organisms. Expression of this key gene in the de novo pathway for dTMP biosynthesis improved furfural resistance on plates and during fermentation. A similar benefit was observed by supplementation with thymine, thymidine, or the combination of tetrahydrofolate and serine (precursors for 5,10-methylenetetrahydrofolate, the methyl donor for ThyA). Supplementation with deoxyuridine provided a small benefit, and deoxyribose was of no benefit for furfural tolerance. A combination of thymidine and plasmid expression of thyA was no more effective than either alone. Together, these results demonstrate that furfural tolerance is increased by approaches that increase the supply of pyrimidine deoxyribonucleotides. However, ThyA activity was not directly affected by the addition of furfural. Furfural has been previously shown to damage DNA in E. coli and to activate a cellular response to oxidative damage in yeast. The added burden of repairing furfural-damaged DNA in E. coli would be expected to increase the cellular requirement for dTMP. Increased expression of thyA (E. coli, B. subtilis, or Z. mobilis), supplementation of cultures with thymidine, and supplementation with precursors for 5,10-methylenetetrahydrofolate (methyl donor) are each proposed to increase furfural tolerance by increasing the availability of dTMP for DNA repair. PMID:22504824

Pnp gene modification for improved xylose utilization in Zymomonas

DOEpatents

Caimi, Perry G G; Qi, Min; Tao, Luan; Viitanen, Paul V; Yang, Jianjun

2014-12-16

The endogenous pnp gene encoding polynucleotide phosphorylase in the Zymomonas genome was identified as a target for modification to provide improved xylose utilizing cells for ethanol production. The cells are in addition genetically modified to have increased expression of ribose-5-phosphate isomerase (RPI) activity, as compared to cells without this genetic modification, and are not limited in xylose isomerase activity in the absence of the pnp modification.

Permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, a thermoacidophilic sulfur-reducing crenarchaeon isolated from acidic hot springs of Hveravellir, Iceland

DOE PAGES

Susanti, Dwi; Johnson, Eric F.; Lapidus, Alla; ...

2016-01-13

Our report presents the permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, an obligate anaerobic hyperthermophilic crenarchaeon that was isolated from acidic hot springs in Hveravellir, Iceland. D. mobilis utilizes peptides as carbon and energy sources and reduces elemental sulfur to H 2S. A metabolic construction derived from the draft genome identified putative pathways for peptide degradation and sulfur respiration in this archaeon. Existence of several hydrogenase genes in the genome supported previous findings that H 2 is produced during the growth of D. mobilis in the absence of sulfur. Interestingly, genes encoding glucose transport and utilizationmore » systems also exist in the D. mobilis genome though this archaeon does not utilize carbohydrate for growth. The draft genome of D. mobilis provides an additional mean for comparative genomic analysis of desulfurococci. In addition, our analysis on the Average Nucleotide Identity between D. mobilis and Desulfurococcus mucosus suggested that these two desulfurococci are two different strains of the same species.« less

Permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, a thermoacidophilic sulfur-reducing crenarchaeon isolated from acidic hot springs of Hveravellir, Iceland.

PubMed

Susanti, Dwi; Johnson, Eric F; Lapidus, Alla; Han, James; Reddy, T B K; Pilay, Manoj; Ivanova, Natalia N; Markowitz, Victor M; Woyke, Tanja; Kyrpides, Nikos C; Mukhopadhyay, Biswarup

2016-01-01

This report presents the permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, an obligate anaerobic hyperthermophilic crenarchaeon that was isolated from acidic hot springs in Hveravellir, Iceland. D. mobilis utilizes peptides as carbon and energy sources and reduces elemental sulfur to H2S. A metabolic construction derived from the draft genome identified putative pathways for peptide degradation and sulfur respiration in this archaeon. Existence of several hydrogenase genes in the genome supported previous findings that H2 is produced during the growth of D. mobilis in the absence of sulfur. Interestingly, genes encoding glucose transport and utilization systems also exist in the D. mobilis genome though this archaeon does not utilize carbohydrate for growth. The draft genome of D. mobilis provides an additional mean for comparative genomic analysis of desulfurococci. In addition, our analysis on the Average Nucleotide Identity between D. mobilis and Desulfurococcus mucosus suggested that these two desulfurococci are two different strains of the same species.

Permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, a thermoacidophilic sulfur-reducing crenarchaeon isolated from acidic hot springs of Hveravellir, Iceland

DOE Office of Scientific and Technical Information (OSTI.GOV)

Susanti, Dwi; Johnson, Eric F.; Lapidus, Alla

Our report presents the permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, an obligate anaerobic hyperthermophilic crenarchaeon that was isolated from acidic hot springs in Hveravellir, Iceland. D. mobilis utilizes peptides as carbon and energy sources and reduces elemental sulfur to H 2S. A metabolic construction derived from the draft genome identified putative pathways for peptide degradation and sulfur respiration in this archaeon. Existence of several hydrogenase genes in the genome supported previous findings that H 2 is produced during the growth of D. mobilis in the absence of sulfur. Interestingly, genes encoding glucose transport and utilizationmore » systems also exist in the D. mobilis genome though this archaeon does not utilize carbohydrate for growth. The draft genome of D. mobilis provides an additional mean for comparative genomic analysis of desulfurococci. In addition, our analysis on the Average Nucleotide Identity between D. mobilis and Desulfurococcus mucosus suggested that these two desulfurococci are two different strains of the same species.« less

Fine structure and ecdysis of mandibular sensilla associated with the lacinia mobilis in Neomysis integer (Leach, 1814) (Crustacea, Malacostraca, Peracarida).

PubMed

Geiselbrecht, Hannes; Melzer, Roland R

2014-05-01

The external and internal structures of adult Neomysis integer mandibles were studied using light and electron microscopy with special reference to the lacinia mobilis, a highly specialized appendage on the gnathal edge of many crustaceans. The right and left lacinia mobilis are equipped with ciliary primary sensory cells revealing that both laciniae are also mechanosensory organs in addition to their mechanical function during mastication. A detailed character analyses indicated that the right lacinia is probably a highly derived sensory seta, whereas two alternative interpretations are considered for the left lacinia; it could be a sensillar appendage equipped with two mechanosensory units, or it could be a movable appendage of the incisor process containing two sensilla deprived of external appendages. The ecdysis of the lacinia mobilis corresponds very well to type I sensillar ecdysis, suggesting classification as a sensillar appendage. These features support a possible homology of the right lacinia mobilis in Peracarida and Decapoda, tracing them to an origin as a member of the setal row. Whether the left lacinia mobilis is a sensillum or an appendage with sensilla cannot be resolved presently. Copyright © 2014 Elsevier Ltd. All rights reserved.

Heterometallic niobium complexes containing the {open_quotes}CpNb{close_quotes} unit. X-ray crystal structures of CpNbCl{sub 2}({mu}-SEt){sub 2}NiCp and CpNb(PhCCPh)({mu}-SPr{sup 1}){sub 2}Mo(CO){sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woodward, S.; Curtis, M.D.; Rheingold, A.L.

1992-06-01

Cp{sub 2}Nb{sub 2}Cl{sub 2}({mu}-Cl{sub 2})(CO){sub 4} reacts with Cp{sub 2}Ni{sub 2}({mu}-SEt){sub 2} to yield paramagnetic CpNbCl{sub 2}({mu}-SEt){sub 2}NiCp: (g) = 2.004, A = 129 G; space group = P2{sub 1}/c,a = 7.466 (1) {Angstrom}, b = 28.427 (5) {Angstrom}, c = 8.620 (2) {Angstrom}, {beta} = 104.81 (1){degree}. CpNb(PhCCPh)({mu}-SPr{sup i}){sub 2}Mo(CO){sub 4} is synthesized by the addition of LiSPr{sup i} to CpNbCl{sub 2}PhCCPh resulting in formation of CpNb(SPr{sup i}){sub 2}(PhCCPh) followed by the reaction of the thiolate complex with Mo(MeCN){sub 3}(CO){sub 3} and CO (1 equiv). The crystal structure for CpNb(PhCCPh)({mu}-SPr{sup i}){sub 2}Mo(CO){sub 4} is reported and EHMO calculations ofmore » the bonding in CpNbCl{sub 2}({mu}-SEt{sub 2})NiCp were discussed. 27 refs., 5 figs., 5 tabs.« less

Physical properties of superbulky lanthanide metallocenes: synthesis and extraordinary luminescence of [Eu(II)(Cp(BIG))2] (Cp(BIG) = (4-nBu-C6H4)5-cyclopentadienyl).

PubMed

Harder, Sjoerd; Naglav, Dominik; Ruspic, Christian; Wickleder, Claudia; Adlung, Matthias; Hermes, Wilfried; Eul, Matthias; Pöttgen, Rainer; Rego, Daniel B; Poineau, Frederic; Czerwinski, Kenneth R; Herber, Rolfe H; Nowik, Israel

2013-09-09

The superbulky deca-aryleuropocene [Eu(Cp(BIG))2], Cp(BIG) = (4-nBu-C6H4)5-cyclopentadienyl, was prepared by reaction of [Eu(dmat)2(thf)2], DMAT = 2-Me2N-α-Me3Si-benzyl, with two equivalents of Cp(BIG)H. Recrystallizyation from cold hexane gave the product with a surprisingly bright and efficient orange emission (45% quantum yield). The crystal structure is isomorphic to those of [M(Cp(BIG))2] (M = Sm, Yb, Ca, Ba) and shows the typical distortions that arise from Cp(BIG)⋅⋅⋅Cp(BIG) attraction as well as excessively large displacement parameter for the heavy Eu atom (U(eq) = 0.075). In order to gain information on the true oxidation state of the central metal in superbulky metallocenes [M(Cp(BIG))2] (M = Sm, Eu, Yb), several physical analyses have been applied. Temperature-dependent magnetic susceptibility data of [Yb(Cp(BIG))2] show diamagnetism, indicating stable divalent ytterbium. Temperature-dependent (151)Eu Mössbauer effect spectroscopic examination of [Eu(Cp(BIG))2] was examined over the temperature range 93-215 K and the hyperfine and dynamical properties of the Eu(II) species are discussed in detail. The mean square amplitude of vibration of the Eu atom as a function of temperature was determined and compared to the value extracted from the single-crystal X-ray data at 203 K. The large difference in these two values was ascribed to the presence of static disorder and/or the presence of low-frequency torsional and librational modes in [Eu(Cp(BIG))2]. X-ray absorbance near edge spectroscopy (XANES) showed that all three [Ln(Cp(BIG))2] (Ln = Sm, Eu, Yb) compounds are divalent. The XANES white-line spectra are at 8.3, 7.3, and 7.8 eV, for Sm, Eu, and Yb, respectively, lower than the Ln2O3 standards. No XANES temperature dependence was found from room temperature to 100 K. XANES also showed that the [Ln(Cp(BIG))2] complexes had less trivalent impurity than a [EuI2(thf)x] standard. The complex [Eu(Cp(BIG))2] shows already at room temperature

Isolation, characterization, and primary structure of rubredoxin from the photosynthetic bacterium, Heliobacillus mobilis

NASA Technical Reports Server (NTRS)

Lee, W. Y.; Brune, D. C.; LoBrutto, R.; Blankenship, R. E.

1995-01-01

Rubredoxin is a small nonheme iron protein that serves as an electron carrier in bacterial systems. Rubredoxin has now been isolated and characterized from the strictly anaerobic phototroph, Heliobacillus mobilis. THe molecular mass (5671.3 Da from the amino acid sequence) was confirmed and partial formylation of the N-terminal methionyl residue was established by matrix-assisted laser desorption mass spectroscopy. The complete 52-amino-acid sequence was determined by a combination of N-terminal sequencing by Edman degradation and C-terminal sequencing by a novel method using carboxypeptidase treatment in conjunction with amino acid analysis and laser desorption time of flight mass spectrometry. The molar absorption coefficient of Hc. mobilis rubredoxin at 490 nm is 6.9 mM-1 cm-1 and the midpoint redox potential at pH 8.0 is -46 mV. The EPR spectrum of the oxidized form shows resonances at g = 9.66 and 4.30 due to a high-spin ferric iron. The amino acid sequence is homologous to those of rubredoxins from other species, in particular, the gram-positive bacteria, and the phototrophic green sulfur bacteria, and the evolutionary implications of this are discussed.

Presence of CP4-EPSPS Component in Roundup Ready Soybean-Derived Food Products

PubMed Central

Wu, Honghong; Zhang, Yu; Zhu, Changqing; Xiao, Xiao; Zhou, Xinghu; Xu, Sheng; Shen, Wenbiao; Huang, Ming

2012-01-01

With the widespread use of Roundup Ready soya (event 40-3-2) (RRS), the traceability of transgenic components, especially protein residues, in different soya-related foodstuffs has become an important issue. In this report, transgenic components in commercial soya (including RRS) protein concentrates were firstly detected by using polymerase chain reaction (PCR) and western blot. The results illustrated the different degradation patterns of the cp4-epsps gene and corresponding protein in RRS-derived protein concentrates. Furthermore, western blot was applied to investigate the single factor of food processing and the matrix on the disintegration of CP4-EPSPS protein in RRS powder and soya-derived foodstuffs, and trace the degradation patterns during the food production chain. Our results suggested that the exogenous full length of CP4-EPSPS protein in RRS powder was distinctively sensitive to various heat treatments, including heat, microwave and autoclave (especially), and only one degradation fragment (23.4 kD) of CP4-EPSPS protein was apparently observed when autoclaving was applied. By tracing the protein degradation during RRS-related products, including tofu, tou-kan, and bean curd sheets, however, four degradation fragments (42.9, 38.2, 32.2 and 23.4 kD) were displayed, suggesting that both boiling and bittern adding procedures might have extensive effects on CP4-EPSPS protein degradation. Our results thus confirmed that the distinctive residues of the CP4-EPSPS component could be traced in RRS-related foodstuffs. PMID:22408431

Template-directed synthesis on the pentanucleotide CpCpGpCpC

NASA Technical Reports Server (NTRS)

Inoue, T.; Joyce, G. F.; Grzeskowiak, K.; Orgel, L. E.; Brown, J. M.; Reese, C. B.

1984-01-01

Experiments in which CpCpGpCpC is used as a template to facilitate the co-oligomerization of 2-MeImpG and 2-MeImpC are described. It is shown that 3' to 5' prime-linked pGpGpCpGpG, whose sequence is complementary to that of the template, is substantially the most adundant pentameric product of the template-directed reaction. The yield of pGpGpCpGpG is never large (less than 20 percent), presumably becauase off-template reactions consume template-directed products. Thus pGpGpCpGpG is converted to the various isomers of G5C and G4C2 by off-template terminal addition of G or C. The 3' to 5' isomer of GpG is elongated on the template to give GpGpC, GpGpCpG, and GpGpCpGpG, while the 2' to 5' isomer does not initiate the synthesis of detectable amounts of longer oligomers.

Bio-based extraction and stabilization of anthocyanins.

PubMed

Roy, Anirban; Mukherjee, Rudra Palash; Howard, Luke; Beitle, Robert

2016-05-01

This work reports a novel method of recovering anthocyanin compounds from highly-pigmented grapes via a fermentation based approach. It was hypothesized that batch growth of Zymomonas mobilis on simple medium would produce both ethanol and enzymes/biomass-acting materials, the combination of which will provide a superior extraction when compared to simple alcohol extraction. To examine this hypothesis, Z. mobilis was fermented in a batch consisting of mashed Vitis vinifera and glucose, and the recovered anthocyanin pool was compared to that recovered via extraction with ethanol. Data indicated higher amounts of anthocyanins were recovered when compared to simple solvent addition. Additionally, the percent polymeric form of the anthocyanins could be manipulated by the level of aeration maintained in the fermentation. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:601-605, 2016. © 2016 American Institute of Chemical Engineers.

MeCP2 Deficiency Leads to Loss of Glial Kir4.1

PubMed Central

Cuddapah, Vishnu A.; Pacheco, Natasha L.; Holt, Leanne M.; Percy, Alan K.

2018-01-01

Abstract Rett syndrome (RTT) is an X-linked neurodevelopmental disorder usually caused by mutations in methyl-CpG-binding protein 2 (MeCP2). RTT is typified by apparently normal development until 6–18 mo of age, when motor and communicative skills regress and hand stereotypies, autonomic symptoms, and seizures present. Restoration of MeCP2 function selectively to astrocytes reversed several deficits in a murine model of RTT, but the mechanism of this rescue is unknown. Astrocytes carry out many essential functions required for normal brain functioning, including extracellular K+ buffering. Kir4.1, an inwardly rectifying K+ channel, is largely responsible for the channel-mediated K+ regulation by astrocytes. Loss-of-function mutations in Kir4.1 in human patients result in a severe neurodevelopmental disorder termed EAST or SESAME syndrome. Here, we evaluated astrocytic Kir4.1 expression in a murine model of Rett syndrome. We demonstrate by chromatin immunoprecipitation analysis that Kir4.1 is a direct molecular target of MeCP2. Astrocytes from Mecp2-deficient mice express significantly less Kir4.1 mRNA and protein, which translates into a >50% deficiency in Ba2+-sensitive Kir4.1-mediated currents, and impaired extracellular potassium dynamics. By examining astrocytes in isolation, we demonstrate that loss of Kir4.1 is cell autonomous. Assessment through postnatal development revealed that Kir4.1 expression in Mecp2-deficient animals never reaches adult, wild-type levels, consistent with a neurodevelopmental disorder. These are the first data implicating a direct MeCP2 molecular target in astrocytes and provide novel mechanistic insight explaining a potential mechanism by which astrocytic dysfunction may contribute to RTT. PMID:29464197

Fuel alcohol biosynthesis by Zymomonas anaerobia: optimization studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kosaric, N.; Ong, S.L.; Davnjak, Z.

1982-03-01

The optimum operating conditions for growth and ethanol production of Zymomonas anaerobia ATCC 29501 were established. The optimum pH range and temperature were found to be 5.0-6.0 and 35/sup 0/C, respectively. Based on the results obtained from the temperature optimization study, an Arrhenius-type temperature relationship for the specific growth rate was developed. The growth and ethanol production of this microbe also have been optimized in terms of concentrations of glucose, essential nutrients, and minerals. With optimum medium and operating conditions, an ethanol concentration of 96 g/L was obtained in 23h. Both growth and ethanol yield coefficients in dependence on initialmore » glucose concentrations were determined.« less

Fuel alcohol biosynthesis by Zymomonas anaerobia: optimization studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kosaric, N.; Ong, S.L.; Duvnjak, Z.

1982-03-01

The optimum operating conditions for growth and ethanol production of Zymomonas anaerobia ATCC 29501 were established. The optimum pH range and temperature were found to be 5.0-6.0 and 35 degrees C, respectively. Based on the results obtained from the temperature optimization study, an Arrhenius-type temperature relationship for the specific growth rate was developed. The growth and ethanol production of this microbe also have been optimized in terms of concentrations of glucose, essential nutrients, and minerals. With optimum medium and operating conditions, an ethanol concentration of 96 g/L was obtained in 23 hours. Both growth and ethanol yield coefficients in dependencemore » on initial glucose concentrations were determined. (Refs. 16).« less

Reduction of [Cp*Sb]4 with Subvalent Main-Group Metal Reductants: Syntheses and Structures of [(L1 Mg)4 (Sb4 )] and [(L2 Ga)2 (Sb4 )] Containing Edge-Missing Sb4 Units.

PubMed

Ganesamoorthy, Chelladurai; Krüger, Julia; Wölper, Christoph; Nizovtsev, Anton S; Schulz, Stephan

2017-02-16

[Cp*Sb] 4 (Cp*=C 5 Me 5 ) reacts with [L 1 Mg] 2 and L 2 Ga with formation of [(L 1 Mg) 4 (μ 4 ,η 1:2:2:2 -Sb 4 )] (L 1 =iPr 2 NC[N(2,6-iPr 2 C 6 H 3 )] 2 , 1) and [(L 2 Ga) 2 (μ,η 2:2 -Sb 4 )] (L 2 =HC[C(Me)N(2,6-iPr 2 C 6 H 3 )] 2 , 2). The cleavage of the Sb-Sb and Sb-C bonds in [Cp*Sb] 4 are the crucial steps in both reactions. The formation of 1 occurred by elimination of the Cp* anion and formation of Cp*MgL 1 , while 2 was formed by reductive elimination of Cp* 2 and oxidative addition of L 2 Ga to the Sb 4 unit. 1 and 2 were characterized by heteronuclear NMR spectroscopy and single-crystal X-ray diffraction, and their bonding situation was studied by quantum chemical calculations. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Clinical Protection of Goats against CpHV-1 Induced Genital Disease with a BoHV-4-Based Vector Expressing CpHV-1 gD

PubMed Central

Donofrio, Gaetano; Franceschi, Valentina; Lovero, Angela; Capocefalo, Antonio; Camero, Michele; Losurdo, Michele; Cavirani, Sandro; Marinaro, Mariarosaria; Grandolfo, Erika; Buonavoglia, Canio; Tempesta, Maria

2013-01-01

Caprine herpesvirus type 1 (CpHV-1) is an alphaherpesvirus causing genital disease leading to abortion in adult pregnant goats and a systemic disease with high morbility and mortality in kids. Further, Caprine herpesvirus 1 infection represents a valuable large animal model for human herpesvirus induced genital disease, exploitable for pathogenic studies, new vaccines and antiviral molecules testing. Here, the bovine herpesvirus 4 (BoHV-4) based vector derived from an apathogenic isolate of BoHV-4 and expressing the immunodominant CpHV-1 glycoprotein D (BoHV-4-A-gDcpgD106ΔTK) was constructed and its ability to protect goats against CpHV-1 induced genital disease evaluated. The subcutaneous route of recombinant BoHV-4 administration was first tested in vivo/ex vivo by in vivo image analysis and in vitro by goat skin primary cultures preparation and transduction. Next, an exploratory immunization and safety study in goats was performed with two recombinant BoHV4, BoHV-4-A-gDcpgD106ΔTK or BoHV-4-CMV-IgK-gE2gD-TM. In both cases no clinical signs were evident but a good titer of serum neutralizing antibodies was produced in all inoculated animals. When a challenge experiment was performed in a new group of animals using a highly pathogenic dose of CpHV-1, all the vaccinated goats with BoHV-4-A-gDcpgD106ΔTK were protected toward CpHV-1 induced genital disease respect to the unvaccinated control which showed typical vaginal lesions with a high grade of clinical score as well as a long lasting viral shedding. In summary, the data acquired in the present study validate BoHV-4-based vector as a safe and effective viral vector for goat vaccination against CpHV-1 induced genital disease and pave the way for further applications. PMID:23300989

Enterobacter aerogenes Hormaeche and Edwards 1960 (Approved Lists 1980) and Klebsiella mobilis Bascomb et al. 1971 (Approved Lists 1980) share the same nomenclatural type (ATCC 13048) on the Approved Lists and are homotypic synonyms, with consequences for the name Klebsiella mobilis Bascomb et al. 1971 (Approved Lists 1980).

PubMed

Tindall, B J; Sutton, G; Garrity, G M

2017-02-01

Enterobacter aerogenes Hormaeche and Edwards 1960 (Approved Lists 1980) and Klebsiella mobilis Bascomb et al. 1971 (Approved Lists 1980) were placed on the Approved Lists of Bacterial Names and were based on the same nomenclatural type, ATCC 13048. Consequently they are to be treated as homotypic synonyms. However, the names of homotypic synonyms at the rank of species normally are based on the same epithet. Examination of the Rules of the International Code of Nomenclature of Bacteria in force at the time indicates that the epithet mobilis in Klebsiella mobilis Bascomb et al. 1971 (Approved Lists 1980) was illegitimate at the time the Approved Lists were published and according to the Rules of the current International Code of Nomenclature of Prokaryotes continues to be illegitimate.

Synthesis, Structure, Bonding, and Reactivity of Metal Complexes Comprising Diborane(4) and Diborene(2): [{Cp*Mo(CO)2 }2 {μ-η2 :η2 -B2 H4 }] and [{Cp*M(CO)2 }2 B2 H2 M(CO)4 ], M=Mo,W.

PubMed

Mondal, Bijan; Bag, Ranjit; Ghorai, Sagar; Bakthavachalam, K; Jemmis, Eluvathingal D; Ghosh, Sundargopal

2018-07-02

The reaction of [(Cp*Mo) 2 (μ-Cl) 2 B 2 H 6 ] (1) with CO at room temperature led to the formation of the highly fluxional species [{Cp*Mo(CO) 2 } 2 {μ-η 2 :η 2 -B 2 H 4 }] (2). Compound 2, to the best of our knowledge, is the first example of a bimetallic diborane(4) conforming to a singly bridged C s structure. Theoretical studies show that 2 mimics the Cotton dimolybdenum-alkyne complex [{CpMo(CO) 2 } 2 C 2 H 2 ]. In an attempt to replace two hydrogen atoms of diborane(4) in 2 with a 2e [W(CO) 4 ] fragment, [{Cp*Mo(CO) 2 } 2 B 2 H 2 W(CO) 4 ] (3) was isolated upon treatment with [W(CO) 5 ⋅thf]. Compound 3 shows the intriguing presence of [B 2 H 2 ] with a short B-B length of 1.624(4) Å. We isolated the tungsten analogues of 3, [{Cp*W(CO) 2 } 2 B 2 H 2 W(CO) 4 ] (4) and [{Cp*W(CO) 2 } 2 B 2 H 2 Mo(CO) 4 ] (5), which provided direct proof of the existence of the tungsten analogue of 2. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photodissociation dynamics of gaseous CpCo(CO)2 and ligand exchange reactions of CpCoH2 with C3H4, C3H6, and NH3.

PubMed

Oana, Melania; Nakatsuka, Yumiko; Albert, Daniel R; Davis, H Floyd

2012-05-31

The photodissociation dynamics of CpCo(CO)(2) was studied in a molecular beam using photofragment translational energy spectroscopy with 157 nm photoionization detection of the metallic products. At 532 and 355 nm excitation, the dominant one-photon channel involved loss of a single CO ligand producing CpCoCO. The product angular distributions were isotropic, and a large fraction of excess energy appeared as product vibrational excitation. Production of CpCO + 2CO resulted from two-photon absorption processes. The two-photon dissociation of mixtures containing CpCo(CO)(2) and H(2) at the orifice of a pulsed nozzle was used to produce a novel 16-electron unsaturated species, CpCoH(2). Transition metal ligand exchange reactions, CpCoH(2) + L → CpCoL + H(2) (L = propyne, propene, or ammonia), were studied under single-collision conditions for the first time. In all cases, ligand exchange occurred via 18-electron association complexes with lifetimes comparable to their rotational periods. Although ligand exchange reactions were not detected from CpCoH(2) collisions with methane or propane (L = CH(4) or C(3)H(8)), a molecular beam containing CpCoCH(4) was produced by photolysis of mixtures containing CpCo(CO)(2) and CH(4).

Synthesis, structural characterization and conversion of dinuclear iron-sulfur clusters containing the disulfide ligand: [Cp*Fe(μ-η2:η2-bdt)(cis-μ-η1:η1-S2)FeCp*], [Cp*Fe(μ-S(C6H4S2))(cis-μ-η1:η1-S2)FeCp*], and [{Cp*Fe(bdt)}2(trans-μ-η1:η1-S2)].

PubMed

Ji, Xiaoxiao; Tong, Peng; Yang, Dawei; Wang, Baomin; Zhao, Jinfeng; Li, Yang; Qu, Jingping

2017-03-21

The treatment of [Cp*Fe(μ-η 2 :η 4 -bdt)FeCp*] (1, Cp* = η 5 -C 5 Me 5 , bdt = benzene-1,2-dithiolate) with 1/4 equiv. of elemental sulfur (S 8 ) gave a dinuclear iron-sulfur cluster [Cp*Fe(μ-η 2 :η 2 -bdt)(cis-μ-η 1 :η 1 -S 2 )FeCp*] (2), which contains a cis-1,2-disulfide ligand. When complex 2 further interacted with 1/8 equiv. of S 8 , another sulfur atom inserted into an Fe-S bond to give a rare product [Cp*Fe(μ-S(C 6 H 4 S 2 ))(cis-μ-η 1 :η 1 -S 2 )FeCp*] (3). Unexpectedly, a trans-1,2 disulfide-bridged diiron complex [{Cp*Fe(bdt)} 2 (trans-μ-η 1 :η 1 -S 2 )] (4) was isolated from the reaction of complex 1 with 1/2 equiv. of S 8 , which represents a structural isomer of [2Fe-2S] ferredoxin-type clusters. In addition, cis-1,2-disulfide-bridged complex 3 can slowly convert into trans-1,2-disulfide-bridged complex 4 and the complex [Cp*Fe(μ-η 2 :η 2 -S 2 )(cis-μ-η 1 :η 1 -S 2 )FeCp*] (5) by self-assembly reaction at ambient temperature, which is evidenced by time-dependent 1 H NMR spectroscopy.

The in vivo pharmacology of CP-80, 633, a selective inhibitor of phosphodiesterase 4.

PubMed

Turner, C R; Cohan, V L; Cheng, J B; Showell, H J; Pazoles, C J; Watson, J W

1996-09-01

The following studies were conducted to characterize the bron-chodilatory and antiinflammatory activity of the novel, selective phosphodiesterase-IV inhibitor, CP-80,633 (2'S)5-[3-(2'-exobicyclo[2.2.1]heptyloxy-4-methoxy-phenyl]te trahydro- 2(1H)-pyrimidone, a compound in clinical development for atopic disease. In IgG1 passively sensitized guinea pigs, aerosolized ovalbumin challenge increases both pulmonary eosinophil peroxidase levels and airway obstruction. CP-80,633, administered before ovalbumin challenge, significantly attenuated both the increase in tissue eosinophil peroxidase levels (ED50 = 1.4 mg/kg, p.o.) and airway obstruction (ED50 = 0.93 +/- 0.14 mg/kg,p.o.) 10 to 30 times more potently than theophyl-line. Intraarterially administered CP-80,633 also reversed an established bronchoconstriction initiated by continuous infusion of histamine to guinea pigs (ED50 of 8.2 micrograms/kg vs. 5.6 mg/kg for theophylline). The antiinflammatory effect of CP-80,633 was also examined in atopic monkeys challenged with Ascaris suum (Ag) aerosol. CP-80,633 (1 mg/kg, qid, s.c., 1 hr before antigen challenge) significantly reduced antigen-induced increases in bronchoalveolar lavage neutrophils (72.8 +/- 15.8% inhibition) and eosinophils (61.1 +/- 5.7% inhibition) 4 hr postchallenge, but did not reduce leukocytes 24 hr postchallenge. CP-80,633 did not inhibit antigen-induced increases in BAL levels of interleukin-1 beta, -6 or -8 as measured by enzyme-linked immunosorbant assay. These results indicate that CP-80,633 possesses bronchodilatory activity in guinea pigs and some antiinflammatory effects in both guinea pigs and monkeys.

Exometabolomics Assisted Design and Validation of Synthetic Obligate Mutualism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kosina, Suzanne M.; Danielewicz, Megan A.; Mohammed, Mujahid

Synthetic microbial ecology has the potential to enhance the productivity and resiliency of biotechnology processes compared to approaches using single isolates. Engineering microbial consortia is challenging; however, one approach that has attracted significant attention is the creation of synthetic obligate mutualism using auxotrophic mutants that depend on each other for exchange or cross-feeding of metabolites. In this paper, we describe the integration of mutant library fitness profiling with mass spectrometry based exometabolomics as a method for constructing synthetic mutualism based on cross-feeding. Two industrially important species lacking known ecological interactions, Zymomonas mobilis and Escherichia coli, were selected as the testmore » species. Amino acid exometabolites identified in the spent medium of Z. mobilis were used to select three corresponding E. coli auxotrophs (proA, pheA and IlvA), as potential E. coli counterparts for the coculture. A pooled mutant fitness assay with a Z. mobilis transposon mutant library was used to identify mutants with improved growth in the presence of E. coli. An auxotroph mutant in a gene (ZMO0748) with sequence similarity to cysteine synthase A (cysK), was selected as the Z. mobilis counterpart for the coculture. Exometabolomic analysis of spent E. coli medium identified glutathione related metabolites as potentially available for rescue of the Z. mobilis cysteine synthase mutant. Three sets of cocultures between the Z. mobilis auxotroph and each of the three E. coli auxotrophs were monitored by optical density for growth and analyzed by flow cytometry to confirm high cell counts for each species. Taken together, our methods provide a technological framework for creating synthetic mutualisms combining existing screening based methods and exometabolomics for both the selection of obligate mutualism partners and elucidation of metabolites involved in auxotroph rescue.« less

Exometabolomics Assisted Design and Validation of Synthetic Obligate Mutualism.

PubMed

Kosina, Suzanne M; Danielewicz, Megan A; Mohammed, Mujahid; Ray, Jayashree; Suh, Yumi; Yilmaz, Suzan; Singh, Anup K; Arkin, Adam P; Deutschbauer, Adam M; Northen, Trent R

2016-07-15

Synthetic microbial ecology has the potential to enhance the productivity and resiliency of biotechnology processes compared to approaches using single isolates. Engineering microbial consortia is challenging; however, one approach that has attracted significant attention is the creation of synthetic obligate mutualism using auxotrophic mutants that depend on each other for exchange or cross-feeding of metabolites. Here, we describe the integration of mutant library fitness profiling with mass spectrometry based exometabolomics as a method for constructing synthetic mutualism based on cross-feeding. Two industrially important species lacking known ecological interactions, Zymomonas mobilis and Escherichia coli, were selected as the test species. Amino acid exometabolites identified in the spent medium of Z. mobilis were used to select three corresponding E. coli auxotrophs (proA, pheA and IlvA), as potential E. coli counterparts for the coculture. A pooled mutant fitness assay with a Z. mobilis transposon mutant library was used to identify mutants with improved growth in the presence of E. coli. An auxotroph mutant in a gene (ZMO0748) with sequence similarity to cysteine synthase A (cysK), was selected as the Z. mobilis counterpart for the coculture. Exometabolomic analysis of spent E. coli medium identified glutathione related metabolites as potentially available for rescue of the Z. mobilis cysteine synthase mutant. Three sets of cocultures between the Z. mobilis auxotroph and each of the three E. coli auxotrophs were monitored by optical density for growth and analyzed by flow cytometry to confirm high cell counts for each species. Taken together, our methods provide a technological framework for creating synthetic mutualisms combining existing screening based methods and exometabolomics for both the selection of obligate mutualism partners and elucidation of metabolites involved in auxotroph rescue.

Exometabolomics Assisted Design and Validation of Synthetic Obligate Mutualism

DOE PAGES

Kosina, Suzanne M.; Danielewicz, Megan A.; Mohammed, Mujahid; ...

2016-02-17

Synthetic microbial ecology has the potential to enhance the productivity and resiliency of biotechnology processes compared to approaches using single isolates. Engineering microbial consortia is challenging; however, one approach that has attracted significant attention is the creation of synthetic obligate mutualism using auxotrophic mutants that depend on each other for exchange or cross-feeding of metabolites. In this paper, we describe the integration of mutant library fitness profiling with mass spectrometry based exometabolomics as a method for constructing synthetic mutualism based on cross-feeding. Two industrially important species lacking known ecological interactions, Zymomonas mobilis and Escherichia coli, were selected as the testmore » species. Amino acid exometabolites identified in the spent medium of Z. mobilis were used to select three corresponding E. coli auxotrophs (proA, pheA and IlvA), as potential E. coli counterparts for the coculture. A pooled mutant fitness assay with a Z. mobilis transposon mutant library was used to identify mutants with improved growth in the presence of E. coli. An auxotroph mutant in a gene (ZMO0748) with sequence similarity to cysteine synthase A (cysK), was selected as the Z. mobilis counterpart for the coculture. Exometabolomic analysis of spent E. coli medium identified glutathione related metabolites as potentially available for rescue of the Z. mobilis cysteine synthase mutant. Three sets of cocultures between the Z. mobilis auxotroph and each of the three E. coli auxotrophs were monitored by optical density for growth and analyzed by flow cytometry to confirm high cell counts for each species. Taken together, our methods provide a technological framework for creating synthetic mutualisms combining existing screening based methods and exometabolomics for both the selection of obligate mutualism partners and elucidation of metabolites involved in auxotroph rescue.« less

Heterologous Expression of Plant Cell Wall Degrading Enzymes for Effective Production of Cellulosic Biofuels

PubMed Central

Jung, Sang-Kyu; Parisutham, Vinuselvi; Jeong, Seong Hun; Lee, Sung Kuk

2012-01-01

A major technical challenge in the cost-effective production of cellulosic biofuel is the need to lower the cost of plant cell wall degrading enzymes (PCDE), which is required for the production of sugars from biomass. Several competitive, low-cost technologies have been developed to produce PCDE in different host organisms such as Escherichia coli, Zymomonas mobilis, and plant. Selection of an ideal host organism is very important, because each host organism has its own unique features. Synthetic biology-aided tools enable heterologous expression of PCDE in recombinant E. coli or Z. mobilis and allow successful consolidated bioprocessing (CBP) in these microorganisms. In-planta expression provides an opportunity to simplify the process of enzyme production and plant biomass processing and leads to self-deconstruction of plant cell walls. Although the future of currently available technologies is difficult to predict, a complete and viable platform will most likely be available through the integration of the existing approaches with the development of breakthrough technologies. PMID:22911272

2,5-dimethylthiophene coordination to three metal centers in (. eta. sup 4 ,S-. mu. sub 3 -2,5-Me sub 2 T)(IrCp sup * )(Mo(CO) sub 2 Cp) sub 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Jiabi; Angelici, R.J.

1990-03-01

The reaction of Cp{sup *}Ir({eta}{sup 4}-2,5-Me{sub 2}T), where {eta}{sup 4}-2,5-Me{sub 2}T is 2,5-dimethylthiophene coordinated through the four ring carbons, with Cp(CO){sub 2}Mo{triple bond}Mo(CO){sub 2}Cp gives ({eta}{sup 4},S-{mu}{sub 3}-2,5-Me{sub 2}T)(IrCp{sup *})(Mo(CO){sub 2}Cp){sub 2}, in which the bridging thiophene is {eta}{sup 4}-coordinated to the Ir and bonded via the sulfur to both Mo atoms. The same product is obtained from the ring-opened isomer of Cp{sup *}Ir(2,5-Me{sub 2}T). The structure of the product, which is the first example of a thiophene coordinated to three metal centers, was established by X-ray crystallography.

Synthesis and oxidation of CpIrIII compounds: functionalization of a Cp methyl group.

PubMed

Park-Gehrke, Lisa S; Freudenthal, John; Kaminsky, Werner; Dipasquale, Antonio G; Mayer, James M

2009-03-21

[CpIrCl(2)](2) () and new CpIr(III)(L-L)X complexes (L-L = N-O or C-N chelating ligands; X = Cl, I, Me) have been prepared and their reactivity with two-electron chemical oxidants explored. Reaction of with PhI(OAc)(2) in wet solvents yields a new chloro-bridged dimer in which each of the Cp ligands has been singly acetoxylated to form [Cp(OAc)Ir(III)Cl(2)](2) () (Cp(OAc) = eta(5)-C(5)Me(4)CH(2)OAc). Complex and related carboxy- and alkoxy-functionalized Cp(OR) complexes can also be prepared from plus (PhIO)(n) and ROH. [Cp(OAc)Ir(III)Cl(2)](2) () and the methoxy analogue [Cp(OMe)Ir(III)Cl(2)](2) () have been structurally characterized. Treatment of [CpIrCl(2)](2) () with 2-phenylpyridine yields CpIr(III)(ppy)Cl () (ppy = cyclometallated 2-phenylpyridyl) which is readily converted to its iodide and methyl analogues CpIr(III)(ppy)I and CpIr(III)(ppy)Me (). CpIr(III) complexes were also prepared with N-O chelating ligands derived from anthranilic acid (2-aminobenzoic acid) and alpha-aminoisobutyric acid (H(2)NCMe(2)COOH), ligands chosen to be relatively oxidation resistant. These complexes and were reacted with potential two-electron oxidants including PhI(OAc)(2), hexachlorocyclohexadienone (C(6)Cl(6)O), N-fluoro-2,4,6-trimethylpyridinium (Me(3)pyF(+)), [Me(3)O]BF(4) and MeOTf (OTf = triflate, CF(3)SO(3)). Iridium(V) complexes were not observed or implicated in these reactions, despite the similarity of the potential products to known CpIr(V) species. The carbon electrophiles [Me(3)O]BF(4) and MeOTf appear to react preferentially at the N-O ligands, to give methyl esters in some cases. Overall, the results indicate that Cp is not inert under oxidizing conditions and is therefore not a good supporting ligand for oxidizing organometallic complexes.

Karyopherin α 3 and karyopherin α 4 proteins mediate the nuclear import of methyl-CpG binding protein 2.

PubMed

Baker, Steven Andrew; Lombardi, Laura Marie; Zoghbi, Huda Yahya

2015-09-11

Methyl-CpG binding protein 2 (MeCP2) is a nuclear protein with important roles in regulating chromatin structure and gene expression, and mutations in MECP2 cause Rett syndrome (RTT). Within the MeCP2 protein sequence, the nuclear localization signal (NLS) is reported to reside between amino acids 255-271, and certain RTT-causing mutations overlap with the MeCP2 NLS, suggesting that they may alter nuclear localization. One such mutation, R270X, is predicted to interfere with the localization of MeCP2, but recent in vivo studies have demonstrated that this mutant remains entirely nuclear. To clarify the mechanism of MeCP2 nuclear import, we isolated proteins that interact with the NLS and identified karyopherin α 3 (KPNA3 or Kap-α3) and karyopherin α 4 (KPNA4 or Kap-α4) as key binding partners of MeCP2. MeCP2-R270X did not interact with KPNA4, consistent with a requirement for an intact NLS in this interaction. However, this mutant retains binding to KPNA3, accounting for the normal localization of MeCP2-R270X to the nucleus. These data provide a mechanism for MeCP2 nuclear import and have implications for the design of therapeutics aimed at modulating the function of MeCP2 in RTT patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Starch saccharification and fermentation of uncooked sweet potato roots for fuel ethanol production.

PubMed

Zhang, Peng; Chen, Caifa; Shen, Yanhu; Ding, Tielin; Ma, Daifu; Hua, Zichun; Sun, Dongxu

2013-01-01

An energy-saving ethanol fermentation technology was developed using uncooked fresh sweet potato as raw material. A mutant strain of Aspergillus niger isolated from mildewed sweet potato was used to produce abundant raw starch saccharification enzymes for treating uncooked sweet potato storage roots. The viscosity of the fermentation paste of uncooked sweet potato roots was lower than that of the cooked roots. The ethanol fermentation was carried out by Zymomonas mobilis, and 14.4 g of ethanol (87.2% of the theoretical yield) was produced from 100g of fresh sweet potato storage roots. Based on this method, an energy-saving, high efficient and environment-friendly technology can be developed for large-scale production of fuel ethanol from sweet potato roots. Copyright © 2012 Elsevier Ltd. All rights reserved.

Synthesis, spectral, and structural studies of porphyrins having sterically hindered [η(5)-CpCo(η(4)-C4Ph4)] cobalt sandwich units at the meso positions.

PubMed

Keshav, Karunesh; Kumar, Dheeraj; Elias, Anil J

2013-11-04

Synthesis, spectral, and structural studies of the first examples of porphyrins substituted at the meso positions with sterically hindered η(5)-CpCo(η(4)-C4Ph4) cobalt sandwich units are described. The novel dipyrromethane derived cobalt sandwich compound {η(5)-[(C4H4N)2CH]C5H4}Co(η(4)-C4Ph4) 1, as well as its parent aldehyde, η(5)-[C5H4(CHO)]Co(η(4)-C4Ph4), were used in the synthesis of porphyrins having one or two η(5)-CpCo(η(4)-C4Ph4) groups at their meso positions. 1,9-Diformyldipyrromethane derived η(5)-CpCo(η(4)-C4Ph4) 2 was synthesized using dipyrromethane 1 under Vilsmeier conditions. A reaction of 2 with unsubstituted dipyrromethane under basic conditions in the presence of Pd(C6H5CN)2Cl2 yielded an A-type palladium coordinated porphyrin 3 [where A = η(5)-CpCo(η(4)-C4Ph4)]. A similar reaction of 2 with meso aryl and ferrocenyl-substituted dipyrromethanes yielded trans-AB type palladium coordinated porphyrins 4-6 [where A = η(5)-CpCo(η(4)-C4Ph4) and B = 4-tert-butylphenyl 4, ferrocenyl 5, and pentafluorophenyl 6]. Reactions of 2 with 5-ferrocenyl dipyrromethane under the same reaction conditions in the presence of Ni(acac)2 and Zn(OAc)2 gave the trimetallic nickel(II) and zinc(II) complexed trans-AB type porphyrins 7 and 8 having both cobalt and iron sandwich units at the meso positions. Crystal structure of the Pd(II) porphyrin 5 and nickel(II) porphyrin 7 showed nonplanar structures having distinct ruffle type distortion of the porphyrin ring. Demetalation of the zinc(II) trans-AB type porphyrin 8 in the presence of trifluoroacetic acid gave the metal free base porphyrin 9. Reactions of the cobalt sandwich aldehyde [(η(5)-C5H4(CHO)]Co(η(4)-C4Ph4) with sterically hindered dipyrromethane derivatives under acid-catalyzed condensation reactions gave trans-A2B2 type porphyrins [where A = η(5)-CpCo(η(4)-C4Ph4) and B = pentafluorophenyl, 10 mesityl 11]. In contrast, reactions of [η(5)-C5H4(CHO)]Co(η(4)-C4Ph4) with sterically unhindered meso-4

Targeting the middle region of CP4-EPSPS protein for its traceability in highly processed soy-related products.

PubMed

Wu, Honghong; Wang, Xiaofu; Zhou, Xinghu; Zhang, Yihua; Huang, Ming; He, Jian; Shen, Wenbiao

2017-09-01

Transgenic components in genetically modified organisms consist not only of the transgenic genes, but also the transgenic protein. However, compared with transgenic DNA, less attention has been paid to the detection of expressed protein, especially those degraded from genetically modified soybean after food processing. In this study, the full length 5-enolpyruvyl-shikimate-3-phosphate synthase (CP4-EPSPS, 47.6 kD) protein was probed with the SC-16 (S19-R33) and the DC-16 (D219-K233) polyclonal antibodies in immunoblots. Both antibodies were able to detect the full length CP4-EPSPS and its residues in soy powder made from Roundup-Ready soybeans after heating and microwaving treatments which also reduced the molecular weight of the protein to 45.8 and 38.7 kD, respectively. Taken together the immunoblot results suggest that the middle region of the CP4-EPSPS protein possessed better stability than its N-terminal during thermal processing. This deduction was further validated by autoclave treatment, where a 37.4 kD residue of the protein was recognized by DC-16. A similar result was obtained in processed smoked sausage containing Roundup Ready soybean protein isolate (as an extender). The additional use of a further polyclonal antibody CK-17 (C372-K388), showed that compared with only the one signal for CP4-EPSPS detected by the SC-16 and CK-17 antibodies, the DC-16 middle region antibody detected four signals for CP4-EPSPS from five market sourced soy protein concentrates. Taken together, the study suggested that the middle region of CP4-EPSPS was more useful than the N- and C-terminal for tracing transgenic CP4-EPSPS protein and its remnants in highly processed soy-related products.

Charge transfer complexes of metal-free phthalocyanine radical anions with decamethylmetallocenium cations: (Cp*2Co+)(H2Pc˙-)·solvent and (Cp*2Cr+)(H2Pc˙-)·4C6H4Cl2.

PubMed

Konarev, Dmitri V; Khasanov, Salavat S; Ishikawa, Manabu; Otsuka, Akihiro; Yamochi, Hideki; Saito, Gunzi; Lyubovskaya, Rimma N

2017-03-14

Charge transfer complexes (Cp* 2 Co + )(H 2 Pc˙ - )·0.5C 6 H 4 Cl 2 ·0.7C 6 H 5 CN·0.3C 6 H 14 (1) and (Cp* 2 Cr + )(H 2 Pc˙ - )·4C 6 H 4 Cl 2 (2) have been obtained as single crystals. Both complexes contain metal-free phthalocyanine (Pc) radical anions and decamethylmetallocenium cations. Reduction of the Pc macrocycle leads to the appearance of new bands at 1026-1030 nm in the NIR range and blue shifts of both Soret and Q-bands of H 2 Pc in the spectra of 1 and 2. The geometry of the Pc macrocycles supports the formation of H 2 Pc˙ - by the alternation of shorter and longer C-N(imine) bonds in the macrocycles in 2. Complex 1 contains pairs of H 2 Pc˙ - having effective π-π interactions with two sandwiched Cp* 2 Co + cations, whereas complex 2 contains stacks composed of alternating Cp* 2 Cr + and H 2 Pc˙ - ions. The magnetic moment of 1 is 1.64 μ B at 300 K due to the contribution of the H 2 Pc˙ - spins with the S = 1/2 state and diamagnetism of Cp* 2 Co + . This is supported by the observation of a narrow EPR signal of 1 with g = 2.0032-2.0036 characteristic of H 2 Pc˙ - . Strong antiferromagnetic coupling of spins with a Weiss temperature of -23 K is observed between H 2 Pc˙ - in 1. This coupling is probably mediated by the Cp* 2 Co + cations. The magnetic moment of 2 is 4.18 μ B at 300 K indicating the contribution of both paramagnetic H 2 Pc˙ - (S = 1/2) and Cp* 2 Cr + (S = 3/2) species. In spite of the presence of stacks of alternating ions in 2, only weak magnetic coupling is observed with a Weiss temperature of -4 K most probably due to ineffective π-π interactions between Cp* 2 Cr + and H 2 Pc˙ - . The EPR spectrum of 2 contains an asymmetric signal attributed to Cr III (g 1 = 3.9059-3.9220) and a narrow Lorentzian signal from H 2 Pc˙ - with g 2 = 1.9943-1.9961. In addition to these signals, a broad EPR signal grows in intensity below 80 K with g 4 = 2.1085-2.2438 which can be attributed to both paramagnetic Cp* 2 Cr + and H 2 Pc

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Preparation and reactivity of the heterobimetallic ReIr face-shared bioctahedral compounds Cp*Ir(mu-Cl)(3)Re(CO)(3) and Cp*Ir(mu-SC6H4Me-4)(3)Re(CO)(3): X-ray diffraction structures and redox behavior

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xiaoping; Hammons, Casey; Richmond, Michael G.

2009-01-01

Thermolysis of the dinuclear compound [Cp*IrCl2](2) (1) with ClRe(CO)(5) (2) leads to the formation of the confacial bioctahedral compound Cp*Ir(mu-Cl)(3)Re(CO)(3) (3) in high yield. Whereas the substitution of the chloride ligands in 3 is observed on treatment with excess p-methylbenzenethiol to furnish the sulfido-bridged compound Cp*Ir(mu-SC6H4Me-4)(3)Re(CO)(3) (4), 3 undergoes fragmentation upon reaction with tertiary phosphines [PPh3 and P(OMe)(3)] to furnish the mononuclear compounds CP*IrCl2P and fac-ClRe-(CO3)P-2. Both 3 and 4 have been isolated and fully characterized in solution by IR and H-1 NMR spectroscopies, and their solid-state structures have been established by X-ray crystallography. The redox properties of 3 andmore » 4 have been explored by cyclic voltammetry, and the results are discussed relative to extended Huckel MO calculations.« less

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

Structural and Electrochemical Consequences of [Cp*] Ligand Protonation.

PubMed

Peng, Yun; Ramos-Garcés, Mario V; Lionetti, Davide; Blakemore, James D

2017-09-05

There are few examples of the isolation of analogous metal complexes bearing [η 5 -Cp*] and [η 4 -Cp*H] (Cp* = pentamethylcyclopentadienyl) complexes within the same metal/ligand framework, despite the relevance of such structures to catalytic applications. Recently, protonation of Cp*Rh(bpy) (bpy = 2,2'-bipyridyl) has been shown to yield a complex bearing the uncommon [η 4 -Cp*H] ligand, rather than generating a [Rh III -H] complex. We now report the purification and isolation of this protonated species, as well as characterization of analogous complexes of 1,10-phenanthroline (phen). Specifically, reaction of Cp*Rh(bpy) or Cp*Rh(phen) with 1 equiv of Et 3 NH + Br - affords rhodium compounds bearing endo-η 4 -pentamethylcyclopentadiene (η 4 -Cp*H) as a ligand. NMR spectroscopy and single-crystal X-ray diffraction studies confirm protonation of the Cp* ligand, rather than formation of metal hydride complexes. Analysis of new structural data and electronic spectra suggests that phen is significantly reduced in Cp*Rh(phen), similar to the case of Cp*Rh(bpy). Backbonding interactions with olefinic motifs are activated by formation of [η 4 -Cp*H]; protonation of [Cp*] stabilizes the low-valent metal center and results in loss of reduced character on the diimine ligands. In accord with these changes in electronic structure, electrochemical studies reveal a distinct manifold of redox processes that are accessible in the [Cp*H] complexes in comparison with their [Cp*] analogues; these processes suggest new applications in catalysis for the complexes bearing endo-η 4 -Cp*H.

Metal atom dynamics in superbulky metallocenes: a comparison of (Cp(BIG))2Sn and (Cp(BIG))2Eu.

PubMed

Harder, Sjoerd; Naglav, Dominik; Schwerdtfeger, Peter; Nowik, Israel; Herber, Rolfe H

2014-02-17

Cp(BIG)2Sn (Cp(BIG) = (4-n-Bu-C6H4)5cyclopentadienyl), prepared by reaction of 2 equiv of Cp(BIG)Na with SnCl2, crystallized isomorphous to other known metallocenes with this ligand (Ca, Sr, Ba, Sm, Eu, Yb). Similarly, it shows perfect linearity, C-H···C(π) bonding between the Cp(BIG) rings and out-of-plane bending of the aryl substituents toward the metal. Whereas all other Cp(BIG)2M complexes show large disorder in the metal position, the Sn atom in Cp(BIG)2Sn is perfectly ordered. In contrast, (119)Sn and (151)Eu Mößbauer investigations on the corresponding Cp(BIG)2M metallocenes show that Sn(II) is more dynamic and loosely bound than Eu(II). The large displacement factors in the group 2 and especially in the lanthanide(II) metallocenes Cp(BIG)2M can be explained by static metal disorder in a plane parallel to the Cp(BIG) rings. Despite parallel Cp(BIG) rings, these metallocenes have a nonlinear Cpcenter-M-Cpcenter geometry. This is explained by an ionic model in which metal atoms are polarized by the negatively charged Cp rings. The extent of nonlinearity is in line with trends found in M(2+) ion polarizabilities. The range of known calculated dipole polarizabilities at the Douglas-Kroll CCSD(T) level was extended with values (atomic units) for Sn(2+) 15.35, Sm(2+)(4f(6) (7)F) 9.82, Eu(2+)(4f(7) (8)S) 8.99, and Yb(2+)(4f(14) (1)S) 6.55. This polarizability model cannot be applied to predominantly covalently bound Cp(BIG)2Sn, which shows a perfectly ordered structure. The bent geometry of Cp*2Sn should therefore not be explained by metal polarizability but is due to van der Waals Cp*···Cp* attraction and (to some extent) to a small p-character component in the Sn lone pair.

Arsenic-Rich Polyarsenides Stabilized by Cp*Fe Fragments.

PubMed

Schmidt, Monika; Konieczny, David; Peresypkina, Eugenia V; Virovets, Alexander V; Balázs, Gabor; Bodensteiner, Michael; Riedlberger, Felix; Krauss, Hannes; Scheer, Manfred

2017-06-12

The redox chemistry of [Cp*Fe(η 5 -As 5 )] (1, Cp*=η 5 -C 5 Me 5 ) has been investigated by cyclic voltammetry, revealing a redox behavior similar to that of its lighter congener [Cp*Fe(η 5 -P 5 )]. However, the subsequent chemical reduction of 1 by KH led to the formation of a mixture of novel As n scaffolds with n up to 18 that are stabilized only by [Cp*Fe] fragments. These include the arsenic-poor triple-decker complex [K(dme) 2 ][{Cp*Fe(μ,η 2:2 -As 2 )} 2 ] (2) and the arsenic-rich complexes [K(dme) 3 ] 2 [(Cp*Fe) 2 (μ,η 4:4 -As 10 )] (3), [K(dme) 2 ] 2 [(Cp*Fe) 2 (μ,η 2:2:2:2 -As 14 )] (4), and [K(dme) 3 ] 2 [(Cp*Fe) 4 (μ 4 ,η 4:3:3:2:2:1:1 -As 18 )] (5). Compound 4 and the polyarsenide complex 5 are the largest anionic As n ligand complexes reported thus far. Complexes 2-5 were characterized by single-crystal X-ray diffraction, 1 H NMR spectroscopy, EPR spectroscopy (2), and mass spectrometry. Furthermore, DFT calculations showed that the intermediate [Cp*Fe(η 5 -As 5 )] - , which is presumably formed first, undergoes fast dimerization to the dianion [(Cp*Fe) 2 (μ,η 4:4 -As 10 )] 2- . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

PubMed Central

López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

2017-01-01

ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

New simple A{sub 4} neutrino model for nonzero {theta}{sub 13} and large {delta}{sub CP}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishimori, Hajime

In a new simple application of the non-Abelian discrete symmetry A{sub 4} to charged-lepton and neutrino mass matrices, we show that for the current experimental central value of sin{sup 2} 2{theta}{sub 13} Asymptotically-Equal-To 0.1, leptonic CP violation is necessarily large, i.e. Double-Vertical-Line tan{delta}{sub CP} Double-Vertical-Line > 1.3. We also consider T{sub 7} model with one parameter to be complex, thus allowing for one Dirac CP phase {delta}{sub CP} and two Majorana CP phases {alpha}{sub 1,2}. We find a slight modification to this correlation as a function of {delta}{sub CP}. For a given set of input values of {Delta}m{sup 2}{sub 21},more » {Delta}m{sup 2}{sub 32}, {theta}{sub 12}, and {theta}{sub 13}, we obtain sin{sup 2} 2{theta}{sub 23} and m{sub ee} (the effective Majorana neutrino mass in neutrinoless double beta decay) as functions of tan {delta}{sub CP}. We find that the structure of this model always yields small Double-Vertical-Line tan {delta}{sub CP} Double-Vertical-Line .« less

Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches

PubMed Central

Walavalkar, Ninad M.; Cramer, Jason M.; Buchwald, William A.; Scarsdale, J. Neel; Williams, David C.

2014-01-01

Unlike other members of the methyl-cytosine binding domain (MBD) family, MBD4 serves as a potent DNA glycosylase in DNA mismatch repair specifically targeting mCpG/TpG mismatches arising from spontaneous deamination of methyl-cytosine. The protein contains an N-terminal MBD (MBD4MBD) and a C-terminal glycosylase domain (MBD4GD) separated by a long linker. This arrangement suggests that the MBD4MBD either directly augments enzymatic catalysis by the MBD4GD or targets the protein to regions enriched for mCpG/TpG mismatches. Here we present structural and dynamic studies of MBD4MBD bound to dsDNA. We show that MBD4MBD binds with a modest preference formCpG as compared to mismatch, unmethylated and hydroxymethylated DNA. We find that while MBD4MBD exhibits slow exchange between molecules of DNA (intermolecular exchange), the domain exhibits fast exchange between two sites in the same molecule of dsDNA (intramolecular exchange). Introducing a single-strand defect between binding sites does not greatly reduce the intramolecular exchange rate, consistent with a local hopping mechanism for moving along the DNA. These results support a model in which the MBD4MBD4 targets the intact protein to mCpG islands and promotes scanning by rapidly exchanging between successive mCpG sites which facilitates repair of nearby mCpG/TpG mismatches by the glycosylase domain. PMID:25183517

Production of C4 and C5 branched-chain alcohols by engineered Escherichia. coli.

PubMed

Chen, Xiaoyan; Xu, Jingliang; Yang, Liu; Yuan, Zhenhong; Xiao, Shiyuan; Zhang, Yu; Liang, Cuiyi; He, Minchao; Guo, Ying

2015-11-01

Higher alcohols, longer chain alcohols, contain more than 3 carbon atoms, showed close energy advantages as gasoline, and were considered as the next generation substitution for chemical fuels. Higher alcohol biosynthesis by native microorganisms mainly needs gene expression of heterologous keto acid decarboxylase and alcohol dehydrogenases. In the present study, branched-chain α-keto acid decarboxylase gene from Lactococcus lactis subsp. lactis CICC 6246 (Kivd) and alcohol dehydrogenases gene from Zymomonas mobilis CICC 41465 (AdhB) were transformed into Escherichia coli for higher alcohol production. SDS-PAGE results showed these two proteins were expressed in the recombinant strains. The resulting strain was incubated in LB medium at 37 °C in Erlenmeyer flasks and much more 3-methyl-1-butanol (104 mg/L) than isobutanol (24 mg/L) was produced. However, in 5 g/L glucose-containing medium, the production of two alcohols was similar, 156 and 161 mg/L for C4 (isobutanol) and C5 (3-methyl-1-butanol) alcohol, respectively. Effects of fermentation factors including temperature, glucose content, and α-keto acid on alcohol production were also investigated. The increase of glucose content and the adding of α-keto acids facilitated the production of C4 and C5 alcohols. The enzyme activities of pure Kivd on α-ketoisovalerate and α-ketoisocaproate were 26.77 and 21.24 μmol min(-1) mg(-1), respectively. Due to its ability on decarboxylation of α-ketoisovalerate and α-ketoisocaproate, the recombinant E. coli strain showed potential application on isoamyl alcohol and isobutanol production.

CP-25 attenuates the inflammatory response of fibroblast-like synoviocytes co-cultured with BAFF-activated CD4(+) T cells.

PubMed

Jia, Xiaoyi; Wei, Fang; Sun, Xiaojing; Chang, Yan; Xu, Shu; Yang, Xuezhi; Wang, Chun; Wei, Wei

2016-08-02

Total glucosides of paeony (TGP) is the first anti-inflammatory immune regulatory drug approved for the treatment of rheumatoid arthritis in China. A novel compound, paeoniflorin-6'-O-benzene sulfonate (code CP-25), comes from the structural modification of paeoniflorin (Pae), which is the effective active ingredient of TGP. The aim of the present study is to investigate the effect of CP-25 on adjuvant arthritis (AA) fibroblast-like synoviocytes (FLS) co-cultured with BAFF-activated CD4(+) T cells and the expression of BAFF-R in CD4(+) T cells. The mRNA expression of BAFF and its receptors was assessed by qPCR. The expression of BAFF receptors in CD4(+) T cells was analyzed by flow cytometry. The effect of CP-25 on AA rats was evaluated by their joint histopathology. The cell culture growth of thymocytes and FLS was detected by cell counting kit (CCK-8). The concentrations of IL-1β, TNF-α, and IL-6 were measured by Enzyme-linked immunosorbent assay (ELISA). The mRNA expression levels of BAFF and BAFF-R were enhanced in the mesenteric lymph nodes of AA rats, TACI expression was reduced, and BCMA had no change. The expression of BAFF-R in CD4(+) T cells was also enhanced. CP-25 alleviated the joint histopathology and decreased the expression of BAFF-R in CD4(+) T cells from AA rats in vivo. In vitro, CP-25 inhibited the abnormal cell culture growth of BAFF-stimulated thymocytes and FLS. In the co-culture system, IL-1β, IL-6 and TNF-α production was enhanced by FLS co-cultured with BAFF-activated CD4(+) T cells. Moreover, BAFF-stimulated CD4(+) T cells promoted the cell culture growth of FLS. The addition of CP-25 decreased the expression of BAFF-R in CD4(+) T cells and inhibited the cell culture growth and cytokine secretion ability of FLS co-cultured with BAFF-activated CD4(+) T cells. The present study indicates that CP-25 may repress the cell culture growth and cytokine secretion ability of FLS, and its inhibitory effects might be associated with its ability

Semicontinuous production of ethanol from agricultural wastes by immobilised coculture in a two stage bioreactor.

PubMed

Dey, Sabita

2002-10-01

The seed testing laboratories of Maharashtra discard 10 tonnes of grains and oil seeds treated with pesticides per annum. These agricultural wastes could be converted to reducing sugar and ethanol in a two stage semicontinuous fluidised bed bioreactor containing immobilised, Bacillus sp. and Zymomonas mobilis in the 1st stage and Saccharomyces diastaticus and S. cerevisae in the 2nd stage. The optimum temperature and pH for fermentation in both the stages were 30 degrees C and 7.2 respectively. In this process 600 g (approximately 400 g starch) waste seeds could yield 402 g of reducing sugar in the 1st stage after 20 h and 205 g ethanol in the 2nd stage after 40 h incubation with a yield factor 0.51. Using these system 10 tonnes of agricultural wastes could be converted to 3.4 x 107 g of ethanol.

Cerebral palsy in a total population of 4-11 year olds in southern Sweden. Prevalence and distribution according to different CP classification systems.

PubMed

Westbom, Lena; Hagglund, Gunnar; Nordmark, Eva

2007-12-05

The aim of this study was to investigate the prevalence of cerebral palsy (CP) as well as to characterize the CP population, its participation in a secondary prevention programme (CPUP) and to validate the CPUP database. The study population was born 1990-1997 and resident in Skåne/Blekinge on Jan 1st 2002. Multiple sources were used. Irrespective of earlier diagnoses, neuropaediatrician and other professional medical records were evaluated for all children at the child habilitation units. The CPUP database and diagnosis registers at hospital departments were searched for children with CP or psychomotor retardation, whose records were then evaluated. To enhance early prevention, CP/probable CP was searched for also in children below four years of age born 1998-2001. The prevalence of CP was 2.4/1,000 (95% CI 2.1-2.6) in children 4-11 years of age born in Sweden, excluding post-neonatally acquired CP. Children born abroad had a higher prevalence of CP with more severe functional limitations. In the total population, the prevalence of CP was 2.7/1,000 (95% CI 2.4-3.0) and 48% were GMFCS-level I (the mildest limitation of gross motor function). One third of the children with CP, who were born or had moved into the area after a previous study in 1998, were not in the CPUP database. The subtype classification in the CPUP database was adjusted in the case of every fifth child aged 4-7 years not previously reviewed. The prevalence of CP and the subtype distribution did not differ from that reported in other studies, although the proportion of mild CP tended to be higher. The availability of a second opinion about the classification of CP/CP subtypes is necessary in order to keep a CP register valid, as well as an active search for undiagnosed CP among children with other impairments.

Small-GTPase-associated signaling by the guanine nucleotide exchange factors CpDock180 and CpCdc24, the GTPase effector CpSte20, and the scaffold protein CpBem1 in Claviceps purpurea.

PubMed

Herrmann, Andrea; Tillmann, Britta A M; Schürmann, Janine; Bölker, Michael; Tudzynski, Paul

2014-04-01

Monomeric GTPases of the Rho subfamily are important mediators of polar growth and NADPH (Nox) signaling in a variety of organisms. These pathways influence the ability of Claviceps purpurea to infect host plants. GTPase regulators contribute to the nucleotide loading cycle that is essential for proper functionality of the GTPases. Scaffold proteins gather GTPase complexes to facilitate proper function. The guanine nucleotide exchange factors (GEFs) CpCdc24 and CpDock180 activate GTPase signaling by triggering nucleotide exchange of the GTPases. Here we show that CpCdc24 harbors nucleotide exchange activity for both Rac and Cdc42 homologues. The GEFs partly share the cellular distribution of the GTPases and interact with the putative upstream GTPase CpRas1. Interaction studies show the formation of higher-order protein complexes, mediated by the scaffold protein CpBem1. Besides the GTPases and GEFs, these complexes also contain the GTPase effectors CpSte20 and CpCla4, as well as the regulatory protein CpNoxR. Functional characterizations suggest a role of CpCdc24 mainly in polarity, whereas CpDock180 is involved in stress tolerance mechanisms. These findings indicate the dynamic formation of small GTPase complexes and improve the model for GTPase-associated signaling in C. purpurea.

Measurement of CP-violating asymmetries in B0 decays to CP eigenstates.

PubMed

Aubert, B; Boutigny, D; De Bonis, I; Gaillard, J M; Jeremie, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Palano, A; Chen, G P; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Reinertsen, P L; Stugu, B; Abbott, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Clark, A R; Dardin, S; Day, C; Dow, S F; Elioff, T; Fan, Q; Gaponenko, I; Gill, M S; Goozen, F R; Gowdy, S J; Gritsan, A; Groysman, Y; Jacobsen, R G; Jared, R C; Kadel, R W; Kadyk, J; Karcher, A; Kerth, L T; Kipnis, I; Kluth, S; Kolomensky, Y G; Kral, J F; Lafever, R; LeClerc, C; Levi, M E; Lewis, S A; Lionberger, C; Liu, T; Long, M; Lynch, G; Marino, M; Marks, K; Meyer, A B; Mokhtarani, A; Momayezi, M; Nyman, M; Oddone, P J; Ohnemus, J; Oshatz, D; Patton, S; Perazzo, A; Peters, C; Pope, W; Pripstein, M; Quarrie, D R; Rasson, J E; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Stone, R; Telnov, A V; von der Lippe, H; Weber, T; Wenzel, W A; Zisman, M S; Bright-Thomas, P G; Harrison, T J; Hawkes, C M; Kirk, A; Knowles, D J; O'Neale, S W; Watson, A T; Watson, N K; Deppermann, T; Koch, H; Krug, J; Kunze, M; Lewandowski, B; Peters, K; Schmuecker, H; Steinke, M; Andress, J C; Barlow, N R; Bhimji, W; Chevalier, N; Clark, P J; Cottingham, W N; De Groot, N; Dyce, N; Foster, B; Mass, A; McFall, J D; Wallom, D; Wilson, F F; Abe, K; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Camanzi, B; Jolly, S; McKemey, A K; Tinslay, J; Blinov, V E; Bukin, A D; Bukin, D A; Buzykaev, A R; Dubrovin, M S; Golubev, V B; Ivanchenko, V N; Kolachev, G M; Korol, A A; Kravchenko, E A; Onuchin, A P; Salnikov, A A; Serednyakov, S I; Skovpen, Y I; Telnov, V I; Yushkov, A N; Lankford, A J; Mandelkern, M; McMahon, S; Stoker, D P; Ahsan, A; Buchanan, C; Chun, S; MacFarlane, D B; Prell, S; Rahatlou, S; Raven, G; Sharma, V; Burke, S; Campagnari, C; Dahmes, B; Hale, D; Hart, P A; Kuznetsova, N; Kyre, S; Levy, S L; Long, O; Lu, A; Richman, J D; Verkerke, W; Witherell, M; Yellin, S; Beringer, J; Dorfan, D E; Eisner, A M; Frey, A; Grillo, A A; Grothe, M; Heusch, C A; Johnson, R P; Kroeger, W; Lockman, W S; Pulliam, T; Sadrozinski, H; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Spencer, E N; Turri, M; Walkowiak, W; Williams, D C; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hanson, J E; Hitlin, D G; Metzler, S; Oyang, J; Porter, F C; Ryd, A; Samuel, A; Weaver, M; Yang, S; Zhu, R Y; Devmal, S; Geld, T L; Jayatilleke, S; Jayatilleke, S M; Mancinelli, G; Meadows, B T; Sokoloff, M D; Bloom, P; Fahey, S; Ford, W T; Gaede, F; van Hoek, W C; Johnson, D R; Michael, A K; Nauenberg, U; Olivas, A; Park, H; Rankin, P; Roy, J; Sen, S; Smith, J G; Wagner, D L; Blouw, J; Harton, J L; Krishnamurthy, M; Soffer, A; Toki, W H; Warner, D W; Wilson, R J; Zhang, J; Brandt, T; Brose, J; Colberg, T; Dahlinger, G; Dickopp, M; Dubitzky, R S; Eckstein, P; Futterschneider, H; Krause, R; Maly, E; Müller-Pfefferkorn, R; Otto, S; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Behr, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Ferrag, S; Fouque, G; Gastaldi, F; Matricon, P; Mora de Freitas, P; Renard, C; Roussot, E; T'Jampens, S; Thiebaux, C; Vasileiadis, G; Verderi, M; Anjomshoaa, A; Bernet, R; Di Lodovico, F; Khan, A; Muheim, F; Playfer, S; Swain, J E; Falbo, M; Bozzi, C; Dittongo, S; Folegani, M; Piemontese, L; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Xie, Y; Zallo, A; Bagnasco, S; Buzzo, A; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Pallavicini, M; Passaggio, S; Pastore, F C; Patrignani, C; Pia, M G; Robutti, E; Santroni, A; Morii, M; Bartoldus, R; Dignan, T; Hamilton, R; Mallik, U; Cochran, J; Crawley, H B; Fischer, P A; Lamsa, J; McKay, R; Meyer, W T; Rosenberg, E I; Albert, J N; Beigbeder, C; Benkebil, M; Breton, D; Cizeron, R; Du, S; Grosdidier, G; Hast, C; Höcker, A; LePeltier, V; Lutz, A M; Plaszczynski, S; Schune, M H; Trincaz-Duvoid, S; Truong, K; Valassi, A; Wormser, G; Bionta, R M; Brigljević, V; Brooks, A; Fackler, O; Fujino, D; Lange, D J; Mugge, M; O'Connor, T G; Pedrotti, B; Shi, X; van Bibber, K; Wenaus, T J; Wright, D M; Wuest, C R; Yamamoto, B; Carroll, M; Fry, J R; Gabathuler, E; Gamet, R; George, M; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Aspinwall, M L; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gunawardane, N J; Martin, R; Nash, J A; Price, D R; Sanders, P; Smith, D; Azzopardi, D E; Back, J J; Dixon, P; Harrison, P F; Newman-Coburn, D; Potter, R J; Shorthouse, H W; Strother, P; Vidal, P B; Williams, M I; Cowan, G; George, S; Green, M G; Kurup, A; Marker, C E; McGrath, P; McMahon, T R; Salvatore, F; Scott, I; Vaitsas, G; Brown, D; Davis, C L; Ford, K; Li, Y; Pavlovich, J; Allison, J; Barlow, R J; Boyd, J T; Fullwood, J; Jackson, F; Lafferty, G D; Savvas, N; Simopoulos, E T; Thompson, R J; Weatherall, J H; Bard, R; Farbin, A; Jawahery, A; Lillard, V; Olsen, J; Roberts, D A; Schieck, J R; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Lin, C S; Staengle, H; Willocq, S; Wittlin, J; Brau, B; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Britton, D I; Milek, M; Patel, P M; Trischuk, J; Lanni, F; Palombo, F; Bauer, J M; Booke, M; Cremaldi, L; Eschenberg, V; Kroeger, R; Reep, M; Reidy, J; Sanders, D A; Summers, D J; Beaulieu, M; Martin, J P; Nief, J Y; Seitz, R; Taras, P; Zacek, V; Nicholson, H; Sutton, C S; Cavallo, N; Cartaro, C; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; LoSecco, J M; Alsmiller, J R; Gabriel, T A; Handler, T; Heck, J; Brau, J E; Frey, R; Iwasaki, M; Sinev, N B; Strom, D; Borsato, E; Colecchia, F; Dal Corso, F; Galeazzi, F; Margoni, M; Marzolla, M; Michelon, G; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Torassa, E; Voci, C; Bailly, P; Benayoun, M; Briand, H; Chauveau, J; David, P; De La Vaissière, C; Del Buono, L; Genat, J F; Hamon, O; Le Diberder, F; Lebbolo, H; Leruste, P; Lory, J; Martin, L; Roos, L; Stark, J; Versillé, S; Zhang, B; Manfredi, P F; Ratti, L; Re, V; Speziali, V; Frank, E D; Gladney, L; Guo, Q H; Panetta, J H; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bosi, F; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Simi, G; Triggiani, G; Walsh, J; Hairre, M; Judd, D; Paick, K; Turnbull, L; Wagoner, D E; Albert, J; Bula, C; Fernholz, R; Lu, C; McDonald, K T; Miftakov, V; Sands, B; Schaffner, S F; Smith, A J; Tumanov, A; Varnes, E W; Bronzini, F; Buccheri, A; Bulfon, C; Cavoto, G; del Re, D; Faccini, R; Ferrarotto, F; Ferroni, F; Fratini, K; Lamanna, E; Leonardi, E; Mazzoni, M A; Morganti, S; Piredda, G; Safai Tehrani, F; Serra, M; Voena, C; Waldi, R; Jacques, P F; Kalelkar, M; Plano, R J; Adye, T; Claxton, B; Franek, B; Galagedera, S; Geddes, N I; Gopal, G P; Lidbury, J; Xella, S M; Aleksan, R; Besson, P; Bourgeois, P; De Domenico, G; Emery, S; Gaidot, A; Ganzhur, S F; Gosset, L; Hamel de Monchenault, G; Kozanecki, W; Langer, M; London, G W; Mayer, B; Serfass, B; Vasseur, G; Yeche, C; Zito, M; Copty, N; Purohit, M V; Singh, H; Yumiceva, F X; Adam, I; Anthony, P L; Aston, D; Baird, K; Bartelt, J; Becla, J; Bell, R; Bloom, E; Boeheim, C T; Boyarski, A M; Boyce, R F; Bulos, F; Burgess, W; Byers, B; Calderini, G; Claus, R; Convery, M R; Coombes, R; Cottrell, L; Coupal, D P; Coward, D H; Craddock, W W; DeStaebler, H; Dorfan, J; Doser, M; Dunwoodie, W; Ecklund, S; Fieguth, T H; Field, R C; Freytag, D R; Glanzman, T; Godfrey, G L; Grosso, P; Haller, G; Hanushevsky, A; Harris, J; Hasan, A; Hewett, J L; Himel, T; Huffer, M E; Innes, W R; Jessop, C P; Kawahara, H; Keller, L; Kelsey, M H; Kim, P; Klaisner, L A; Kocian, M L; Krebs, H J; Kunz, P F; Langenegger, U; Langeveld, W; Leith, D W; Louie, S K; Luitz, S; Luth, V; Lynch, H L; MacDonald, J; Manzin, G; Mariske, H; McCulloch, M; McShurley, D; Menke, S; Messner, R; Metcalfe, S; Moffeit, K C; Mount, R; Muller, D R; Nelson, D; Nordby, M; O'Grady, C P; O'Neill, F G; Oxoby, G; Pavel, T; Perl, J; Petrak, S; Putallaz, G; Quinn, H; Raines, P E; Ratcliff, B N; Reif, R; Robertson, S H; Rochester, L S; Roodman, A; Russell, J J; Sapozhnikov, L; Saxton, O H; Schietinger, T; Schindler, R H; Schwiening, J; Seeman, J T; Serbo, V V; Skarpass, K; Snyder, A; Soha, A; Spanier, S M; Stahl, A; Stelzer, J; Su, D; Sullivan, M K; Talby, M; Tanaka, H A; Va'vra, J; Wagner, S R; Weinstein, A J; White, J L; Wienands, U; Wisniewski, W J; Young, C C; Zioulas, G; Burchat, P R; Cheng, C H; Kirkby, D; Meyer, T I; Roat, C; De Silva, A; Henderson, R; Berridge, S; Bugg, W; Cohn, H; Hart, E; Weidemann, A W; Benninger, T; Izen, J M; Kitayama, I; Lou, X C; Turcotte, M; Bianchi, F; Bona, M; Di Girolamo, B; Gamba, D; Smol, A; Zanin, D; Bosisio, L; Della Ricca, G; Lanceri, L; Pompili, A; Poropat, P; Vuagnin, G; Panvini, R S; Brown, C M; Kowalewski, R; Roney, J M; Band, H R; Charles, E; Dasu, S; Elmer, P; Hu, H; Johnson, J R; Nielsen, J; Orejudos, W; Pan, Y; Prepost, R; Scott, I J; von Wimmersperg-Toeller, J H; Wu, S L; Yu, Z; Zobernig, H; Kordich, T M; Moore, T B; Neal, H

2001-03-19

We present measurements of time-dependent CP-violating asymmetries in neutral B decays to several CP eigenstates. The measurement uses a data sample of 23x10(6) Upsilon(4S)-->BbarB decays collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC. In this sample, we find events in which one neutral B meson is fully reconstructed in a CP eigenstate containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the standard model is proportional to sin2beta, is derived from the decay time distributions in such events. The result is sin2beta = 0.34+/-0.20 (stat)+/-0.05 (syst).

Novel reaction for new fuels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clyde, R.A.

Independent investigators have found that sugar can be fermented to alcohol for gasohol in 15 minutes by immobilizing organisms such as Zymomonas mobilis on rotating fibers. Half a pound of Celite has the surface area of a football field and it can be entrapped in the fibers to hold many cells. Many others take several hours. In another design, methanol can be dissociated to CO and H{sub 2} and 30% more energy obtained because waste heat is utilized. When one mol goes to three there is an expansion, and this is provided for. Both these designs result in clean fuelsmore » and are covered by U.S. patents.« less

Importance of stability study of continuous systems for ethanol production.

PubMed

Paz Astudillo, Isabel Cristina; Cardona Alzate, Carlos Ariel

2011-01-10

Fuel ethanol industry presents different problems during bioreactors operation. One of them is the unexpected variation in the output ethanol concentration from the bioreactor or a drastic fall in the productivity. In this paper, a compilation of concepts and relevant results of several experimental and theoretical studies about dynamic behavior of fermentation systems for bioethanol production with Saccharomyces cerevisiae and Zymomonas mobilis is done with the purpose of understanding the stability phenomena that could affect the productivity of industries producing fuel ethanol. It is shown that the design of high scale biochemical processes for fuel ethanol production must be done based on stability studies. © 2010 Elsevier B.V. All rights reserved.

Ultrastructure of the enteromonad flagellate Caviomonas mobilis.

PubMed

Brugerolle, G; Regnault, J P

2001-08-01

Caviomonas mobilis was collected from the caecum of mice harbouring a controlled fauna. Phase contrast and immunofluorescence microscopy using an anti-tubulin antibody and electron microscopy demonstrated the presence of one basal body bearing a flagellum and a second barren basal body, both inserted in the face of two cup-like depressions in the nuclear surface, as in other enteromonad/diplomonad genera. Three microtubular fibres arise close to the main basal body: the first, composed of three microtubules cross-linked with a dense structure, lies within a groove above the nuclear surface; the second is oriented antero-dorsally and corresponds to the peristyle as observed by light microscopy; and the third is situated ventrally, below the proximal part of the recurrent flagellum, and corresponds to the funis. There is no mitochondrion, no Golgi body, the endoplasmic reticulum is reduced, there is no cytostome, the cell feeds by pinocytosis and phagocytosis and the division spindle is intranuclear. The cytological characters of Caviomonas are homologous to those of genera which comprise the enteromonad/diplomonad evolutionary lineage, as previously presumed.

Biosynthetic burden and plasmid burden limit expression of chromosomally integrated heterologous genes (pdc, adhB) in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez, A.; York, S.W.; Yomano, L.P.

1999-10-01

Previous studies have shown an unexpectedly high nutrient requirement for efficient ethanol production by ethanologenic recombinants of Escherichia coli B such as LY01 which contain chromosomally integrated Zymomonas mobilis genes (pdc, adhB) encoding the ethanol pathway. The basis for this requirement has been identified as a media-dependent effect on the expression of the Z. mobilis genes rather than a nutritional limitation. Ethanol production was substantially increased without additional nutrients simply by increasing the level of pyruvate decarboxylase activity. This was accomplished by adding a multicopy plasmid containing pdc alone (but not adhB alone) to strain LY01, and by adding multicopymore » plasmids which express pdc and adhB from strong promoters. New strong promoters were isolated from random fragments of Z. mobilis DNA and characterized but were not used to construct integrated biocatalysts. These promoters contained regions resembling recognition sites for 3 different E. coli sigma factors: {sigma}{sup 70}, {sigma}{sup 38}, and {sigma}{sup 28}. The most effective plasmid-based promoters for fermentation were recognized by multiple sigma factors, expressed both pdc and adhB at high levels, and produced ethanol efficiently while allowing up to 80% reduction in complex nutrients as compared to LY01. The ability to utilize multiple sigma factors may be advantageous to maintain the high levels of PDC and ADH needed for efficient ethanol production throughout batch fermentation.« less

CP-25 Attenuates the Activation of CD4+ T Cells Stimulated with Immunoglobulin D in Human.

PubMed

Wu, Yu-Jing; Chen, Heng-Shi; Chen, Wen-Sheng; Dong, Jin; Dong, Xiao-Jie; Dai, Xing; Huang, Qiong; Wei, Wei

2018-01-01

Researchers have shown that the level of immunoglobulin D (IgD) is often elevated in patients with autoimmune diseases. The possible roles of IgD on the function of human T cell activation are still unclear. Paeoniflorin-6'- O -benzene sulfonate (code: CP-25), the chemistry structural modifications of paeoniflorin, was a novel drug of anti-inflammation and immunomodulation. The aims of this study were to determine if human CD4 + T cells could be activated by IgD via the IgD receptor (IgDR)-Lck pathway and whether the novel compound CP-25 could affect the activation of T cells by regulating Lck. Human CD4 + T cells were purified from peripheral blood mononuclear cells using microbeads. T cell viability and proliferation were detected by Cell Counting Kit-8 and CFSE Cell Proliferation Kit. Cytokines secreted by T cells were assessed with the Quantibody Human Inflammation Array. The binding affinity and expression of IgDR on T cells were detected by flow cytometry, and protein expression of IgDR, Lck, and P-Lck were analyzed by western blot. IgD was shown to bind to IgDR on CD4 + T cells in a concentration-dependent manner and stimulate the activation and proliferation of these cells by enhancing phosphorylation of the activating tyrosine residue of Lck (Tyr 394 ). CP-25 inhibited the IgD-stimulated activation and proliferation of CD4 + T cells, as well as the production of inflammatory cytokines; it was thus suggested that this process might be related to the downregulation of Lck (Tyr 394 ) phosphorylation. These results demonstrate that IgD amplifies the activation of CD4 + T cells, which could be mediated by Lck phosphorylation. Further, CP-25, via its ability to modulate Lck, is a novel potential therapeutic agent for the treatment of human autoimmune diseases.

Some semiclassical structure constants for AdS 4 × CP 3

NASA Astrophysics Data System (ADS)

Ahn, Changrim; Bozhilov, Plamen

2018-02-01

We compute structure constants in three-point functions of three string states in AdS 4× CP 3 in the framework of the semiclassical approach. We consider HHL correlation functions where two of the states are "heavy" string states of finite-size giant magnons carrying one or two angular momenta and the other one corresponds to such "light" states as dilaton operators with non-zero momentum, primary scalar operators, and singlet scalar operators with higher string levels.

Insights into Acetate Toxicity in Zymomonas mobilis 8b using Different Substrates

DOE PAGES

Yang, Shihui; Franden, M. A.; Brown, S. D.; ...

2014-09-30

The lignocellulosic biomass is a promising renewable feedstock for biofuel production. Acetate is one of the major inhibitors liberated from hemicelluloses during hydrolysis. Likewise, an understanding of the toxic effects of acetate on the fermentation microorganism and the efficient utilization of mixed sugars of glucose and xylose in the presence of hydrolysate inhibitors is crucial for economic biofuel production.

Structural and Computational Studies of Cp(CO)2(PCy3)MoFBF3, a Complex with a Bound BF4- Ligand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Tan-Yun; Szalda, David J.; Franz, James A.

2010-02-15

Hydride transfer from Cp(CO)2(PCy3)MoH to Ph3C+BF4 gives Cp(CO)2(PCy3)MoFBF3, and the crystal structure of this complex was determined. In the weakly bound FBF3 ligand, the B-F(bridging) bond length is 1.475(8) Å, which is 0.15 Å longer than the average length of the three B-F(terminal) bonds. The PCy3 and FBF3 ligands are cis to each other in the four-legged piano stool structure. Electronic structure (DFT) calculations predict the trans isomer of Cp(CO)2(PCy3)MoFBF3 to be 9.5 kcal/mol (in ΔGog,298)) less stable than the cis isomer that was crystallographically characterized. Hydride transfer from Cp(CO)2(PCy3)MoH to Ph3C+BAr'4 [Ar' = 3,5-bis(trifluoromethyl)phenyl] in CH2Cl2 solvent produces [Cp(CO)2(PCy3)Mo(ClCH2Cl)]+[BAr'4]more » , in which CH2Cl2 is coordinated to the metal. Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.« less

[Regulatory B cells activated by CpG-ODN combined with anti-CD40 monoclonal antibody inhibit CD4(+)T cell proliferation].

PubMed

Wang, Keng; Tao, Lei; Su, Jianbing; Zhang, Yueyang; Zou, Binhua; Wang, Yiyuan; Li, Xiaojuan

2016-09-01

Objective To observe the immunosuppressive function of regulatory B cells (Bregs) in vitro after activated by CpG oligodeoxynucleotide (CpG-ODN) and anti-CD40 mAb. Methods Mice splenic CD5(+)CD1d(high)B cells and CD5(-)CD1d(low)B cells were sorted by flow cytometry. These B cells were first stimulated with CpG-ODN combined with anti-CD40 mAb for 24 hours, and then co-cultured with purified CD4(+)T cells. The interleukin 10 (IL-10) expression in the activated Bregs and other B cell subset, as well as the proliferation and interferon γ (IFN-γ) expression in the CD4(+) T cells activated by anti-CD3 mAb plus anti-CD28 mAb were determined by flow cytometry. Results CD5(+)CD1d(high) B cells activated by CpG-ODN plus anti-CD40 mAb blocked the up-regulated CD4(+)T proliferation and significantly reduced the IFN-γ level. At the same time, activated CD5(-)CD1d(low)B cells showed no inhibitory effect on CD4(+)T cells. Further study revealed that IL-10 expression in the CD5(+)CD1d(high) B cells were much higher than that in the CD5(-)CD1d(low)B cells after stimulated with CpG-ODN combined with anti-CD40 mAb for 24 hours. Conclusion CD5(+)CD1d(high) B cells activated by CpG-ODN combined with anti-CD40 mAb have immune inhibitory effects on CD4(+)T cell activation in vitro , which possibly due to IL-10 secretion.

Conditioning of dilute-acid pretreated corn stover hydrolysate liquors by treatment with lime or ammonium hydroxide to improve conversion of sugars to ethanol.

PubMed

Jennings, Edward W; Schell, Daniel J

2011-01-01

Dilute-acid pretreatment of lignocellulosic biomass enhances the ability of enzymes to hydrolyze cellulose to glucose, but produces many toxic compounds that inhibit fermentation of sugars to ethanol. The objective of this study was to compare the effectiveness of treating hydrolysate liquor with Ca(OH)2 and NH4OH for improving ethanol yields. Corn stover was pretreated in a pilot-scale reactor and then the liquor fraction (hydrolysate) was extracted and treated with various amounts of Ca(OH)2 or NH4OH at several temperatures. Glucose and xylose in the treated liquor were fermented to ethanol using a glucose-xylose fermenting bacteria, Zymomonas mobilis 8b. Sugar losses up to 10% occurred during treatment with Ca(OH)2, but these losses were two to fourfold lower with NH4OH treatment. Ethanol yields for NH4OH-treated hydrolysate were 33% greater than those achieved in Ca(OH)2-treated hydrolysate and pH adjustment to either 6.0 or 8.5 with NH4OH prior to fermentation produced equivalent ethanol yields. Copyright © 2010 Elsevier Ltd. All rights reserved.

Commercially pure titanium (cp-Ti) versus titanium alloy (Ti6Al4V) materials as bone anchored implants - Is one truly better than the other?

PubMed

Shah, Furqan A; Trobos, Margarita; Thomsen, Peter; Palmquist, Anders

2016-05-01

Commercially pure titanium (cp-Ti) and titanium alloys (typically Ti6Al4V) display excellent corrosion resistance and biocompatibility. Although the chemical composition and topography are considered important, the mechanical properties of the material and the loading conditions in the host have, conventionally, influenced material selection for different clinical applications: predominantly Ti6Al4V in orthopaedics while cp-Ti in dentistry. This paper attempts to address three important questions: (i) To what extent do the surface properties differ when cp-Ti and Ti6Al4V materials are manufactured with the same processing technique?, (ii) Does bone tissue respond differently to the two materials, and (iii) Do bacteria responsible for causing biomaterial-associated infections respond differently to the two materials? It is concluded that: (i) Machined cp-Ti and Ti6Al4V exhibit similar surface morphology, topography, phase composition and chemistry, (ii) Under experimental conditions, cp-Ti and Ti6Al4V demonstrate similar osseointegration and biomechanical anchorage, and (iii) Experiments in vitro fail to disclose differences between cp-Ti and Ti6Al4V to harbour Staphylococcus epidermidis growth. No clinical comparative studies exist which could determine if long-term, clinical differences exist between the two types of bulk materials. It is debatable whether cp-Ti or Ti6Al4V exhibit superiority over the other, and further comparative studies, particularly in a clinical setting, are required. Copyright © 2016 Elsevier B.V. All rights reserved.

Measurement of the branching fractions and CP asymmetry of B--->D(0)((CP))K- decays with the BABAR detector.

PubMed

Aubert, B; Barate, R; Boutigny, D; Gaillard, J-M; Hicheur, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Zghiche, A; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; LeClerc, C; Levi, M E; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Ford, K; Harrison, T J; Hawkes, C M; Knowles, D J; Morgan, S E; Penny, R C; Watson, A T; Watson, N K; Goetzen, K; Koch, H; Lewandowski, B; Pelizaeus, M; Peters, K; Schmuecker, H; Steinke, M; Boyd, J T; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Mackay, C; Wilson, F F; Abe, K; Cuhadar-Donszelmann, T; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Kyberd, P; McKemey, A K; Teodorescu, L; Blinov, V E; Bukin, A D; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Eschrich, I; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Gary, J W; Shen, B C; Wang, K; Del Re, D; Hadavand, H K; Hill, E J; MacFarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Dahmes, B; Kuznetsova, N; Levy, S L; Long, O; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Beringer, J; Eisner, A M; Heusch, C A; Lockman, W S; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Turri, M; Walkowiak, W; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Abe, T; Blanc, F; Bloom, P; Chen, S; Clark, P J; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Roy, J; Smith, J G; Van Hoek, W C; Zhang, L; Harton, J L; Hu, T; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel De Monchenault, G; Kozanecki, W; Langer, M; Legendre, M; London, G W; Mayer, B; Schott, G; Vasseur, G; Yeche, Ch; Zito, M; Altenburg, D; Brandt, T; Brose, J; Colberg, T; Dickopp, M; Hauke, A; Lacker, H M; Maly, E; Müller-Pfefferkorn, R; Nogowski, R; Otto, S; Schubert, J; Schubert, K R; Schwierz, R; Spaan, B; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Grenier, P; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Khan, A; Lavin, D; Muheim, F; Playfer, S; Swain, J E; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; De Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Morii, M; Won, E; Dubitzky, R S; Langenegger, U; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Gaillard, J R; Morton, G W; Nash, J A; Sanders, P; Taylor, G P; Grenier, G J; Lee, S-J; Mallik, U; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Yi, J; Biasini, M; Pioppi, M; Davier, M; Grosdidier, G; Höcker, A; Laplace, S; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Plaszczynski, S; Schune, M H; Tantot, L; Wormser, G; Brigljević, V; Cheng, C H; Lange, D J; Wright, D M; Bevan, A J; Fry, J R; Gabathuler, E; Gamet, R; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Back, J J; Cormack, C M; Harrison, P F; Shorthouse, H W; Vidal, P B; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; George, S; Green, M G; Kurup, A; Marker, C E; McMahon, T R; Ricciardi, S; Salvatore, F; Vaitsas, G; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Hart, P A; Hodgkinson, M C; Jackson, F; Lafferty, G D; Lyon, A J; Weatherall, J H; Williams, J C; Farbin, A; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Mangeol, D J J; Patel, P M; Robertson, S H; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Cote-Ahern, D; Taras, P; Nicholson, H; Raven, G; Wilden, L; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; Jessop, C P; LoSecco, J M; Gabriel, T A; Brau, B; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Wong, Q K; Brau, J; Frey, R; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Tiozzo, G; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; De la Vaissière, Ch; Del Buono, L; Hamon, O; John, M J J; Leruste, Ph; Ocariz, J; Pivk, M; Roos, L; Stark, J; T'Jampens, S; Therin, G; Manfredi, P F; Re, V; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Del Gamba, V; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Cavoto, G; Danielson, N; Elmer, P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Tanaka, H A; Bellini, F; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Mazzoni, M A; Morganti, S; Pierini, M; Piredda, G; Safai Tehrani, F; Voena, C; Christ, S; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Geddes, N I; Gopal, G P; Olaiya, E O; Xella, S M; Purohit, M V; Weidemann, A W; Yumiceva, F X; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Convery, M R; Coupal, D P; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Field, R C; Glanzman, T; Gowdy, S J; Grauges-Pous, E; Hadig, T; Halyo, V; Hryn'ova, T; Innes, W R; Kelsey, M H; Kim, P; Kocian, M L; Leith, D W G S; Libby, J; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Petrak, S; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Simi, G; Snyder, A; Soha, A; Stelzer, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Edwards, A J; Meyer, T I; Petersen, B A; Roat, C; Ahmed, M; Ahmed, S; Alam, M S; Ernst, J A; Saeed, M A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Borean, C; Bosisio, L; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Panvini, R S; Banerjee, Sw; Brown, C M; Fortin, D; Jackson, P D; Kowalewski, R; Roney, J M; Band, H R; Dasu, S; Datta, M; Eichenbaum, A M; Johnson, J R; Kutter, P E; Li, H; Liu, R; Di Lodovico, F; Mihalyi, A; Mohapatra, A K; Pan, Y; Prepost, R; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Neal, H

2004-05-21

We present a study of B--->D(0)(CP)K- decays, where D(0)(CP) is reconstructed in CP-even channels, based on a sample of 88.8 x 10(6) Upsilon(4S)-->BB decays collected with the BABAR detector at the PEP-II e(+)e(-) storage ring. We measure the ratio of Cabibbo-suppressed to Cabibbo-favored branching fractions B(B--->D(0)(CP)K-)/B(B--->D(0)(CP)pi(-))=[8.8+/-1.6(stat)+/-0.5(syst)]x10(-2) and the CP asymmetry A(CP)=0.07+/-0.17(stat)+/-0.06(syst). We also measure B(B--->D0K-)/B(B--->D0pi(-))=[8.31+/-0.35(stat)+/-0.20(syst)]x10(-2) using a sample of 61.0 x 10(6) BB pairs.

Safety characterisation and inhibition of fungi and bacteria by a novel multiple enterocin-producing Enterococcus lactis 4CP3 strain.

PubMed

Ben Braïek, Olfa; Cremonesi, Paola; Morandi, Stefano; Smaoui, Slim; Hani, Khaled; Ghrairi, Taoufik

2018-03-07

This study aims to characterise a potential bacteriocinogenic lactic acid bacterial strain isolated from a raw pink shrimp (Palaemon serratus) and evaluate its safety aspect. The strain designated as 4CP3 was noted to display antibacterial activities (P < 0.05) against Gram-positive and Gram-negative foodborne pathogens (Listeria monocytogenes and Pseudomonas aeruginosa) and some filamentous fungi (e.g. Aspergillus niger A79). Phenotypic and molecular techniques as well as phylogenetic analysis identified the isolate 4CP3 as Enterococcus lactis. Its produced antimicrobial substance was determined as a bacteriocin that was stable over a wide range of pH (2-10) and after heating at 100 °C for 15 min. The maximum bacteriocin production was 1400 AU/ml recorded after 12 h of incubation in de Man, Rogosa and Sharpe (MRS) broth medium at 30 °C. The mode of action of the bacteriocin produced by 4CP3 strain was identified as bactericidal against L. monocytogenes EGDe 107776 and P. aeruginosa ATCC 27853. By specific PCR amplifications, E. lactis 4CP3 was shown to produce the enterocins A, B and P. To our knowledge, this feature is newly described for E. lactis strain isolated from raw shrimps. Regarding safety aspect of E. lactis 4CP3, it has been demonstrated that this strain was not haemolytic, gelatinase negative, sensitive to vancomycin, and free of common antibiotic resistance genes and virulence factors. Therefore, it may be useful as a safe natural agent in preservation of foods or as a new probiotic strain in food and feed. Copyright © 2018 Elsevier Ltd. All rights reserved.

1/2-BPS D-branes from covariant open superstring in AdS4 × CP3 background

NASA Astrophysics Data System (ADS)

Park, Jaemo; Shin, Hyeonjoon

2018-05-01

We consider the open superstring action in the AdS4 × CP 3 background and investigate the suitable boundary conditions for the open superstring describing the 1/2-BPS D-branes by imposing the κ-symmetry of the action. This results in the classification of 1/2-BPS D-branes from covariant open superstring. It is shown that the 1/2-BPS D-brane configurations are restricted considerably by the Kähler structure on CP 3. We just consider D-branes without worldvolume fluxes.

Risk Factors for Carbapenemase-Producing Carbapenem-Resistant Enterobacteriaceae (CP-CRE) Acquisition Among Contacts of Newly Diagnosed CP-CRE Patients.

PubMed

Schwartz-Neiderman, Anat; Braun, Tali; Fallach, Noga; Schwartz, David; Carmeli, Yehuda; Schechner, Vered

2016-10-01

OBJECTIVE Carbapenemase-producing carbapenem-resistant Enterobacteriaceae (CP-CRE) are extremely drug-resistant pathogens. Screening of contacts of newly identified CP-CRE patients is an important step to limit further transmission. We aimed to determine the risk factors for CP-CRE acquisition among patients exposed to a CP-CRE index patient. METHODS A matched case-control study was performed in a tertiary care hospital in Israel. The study population was comprised of patients who underwent rectal screening for CP-CRE following close contact with a newly identified CP-CRE index patient. Cases were defined as positive tests for CP-CRE. For each case patient, 2 matched controls were randomly selected from the pool of contacts who tested negative for CP-CRE following exposure to the same index case. Bivariate and multivariate analyses were conducted using conditional logistic regression. RESULTS In total, 53 positive contacts were identified in 40 unique investigations (896 tests performed on 735 contacts) between October 6, 2008, and June 7, 2012. bla KPC was the only carbapenemase identified. In multivariate analysis, risk factors for CP-CRE acquisition among contacts were (1) contact with an index patient for ≥3 days (odds ratio [OR], 9.8; 95% confidence interval [CI], 2.0-48.9), (2) mechanical ventilation (OR, 4.1; 95% CI, 1.4-11.9), and (3) carriage or infection with another multidrug-resistant organism (MDRO; OR, 2.6; 95% CI, 1.0-7.1). Among patients who received antibiotics, cephalosporins were associated with a lower risk of acquisition. CONCLUSIONS Patient characteristics (ventilation and carriage of another MDRO) as well as duration of contact are risk factors for CP-CRE acquisition among contacts. The role of cephalosporins requires further study. Infect Control Hosp Epidemiol 2016;1-7.

A Highly Active Endo-Levanase BT1760 of a Dominant Mammalian Gut Commensal Bacteroides thetaiotaomicron Cleaves Not Only Various Bacterial Levans, but Also Levan of Timothy Grass

PubMed Central

Vija, Heiki; Aasamets, Anneli; Viigand, Katrin

2017-01-01

Bacteroides thetaiotaomicron, an abundant commensal of the human gut, degrades numerous complex carbohydrates. Recently, it was reported to grow on a β-2,6-linked polyfructan levan produced by Zymomonas mobilis degrading the polymer into fructooligosaccharides (FOS) with a cell surface bound endo-levanase BT1760. The FOS are consumed by B. thetaiotaomicron, but also by other gut bacteria, including health-promoting bifidobacteria and lactobacilli. Here we characterize biochemical properties of BT1760, including the activity of BT1760 on six bacterial levans synthesized by the levansucrase Lsc3 of Pseudomonas syringae pv. tomato, its mutant Asp300Asn, levansucrases of Zymomonas mobilis, Erwinia herbicola, Halomonas smyrnensis as well as on levan isolated from timothy grass. For the first time a plant levan is shown as a perfect substrate for an endo-fructanase of a human gut bacterium. BT1760 degraded levans to FOS with degree of polymerization from 2 to 13. At optimal reaction conditions up to 1 g of FOS were produced per 1 mg of BT1760 protein. Low molecular weight (<60 kDa) levans, including timothy grass levan and levan synthesized from sucrose by the Lsc3Asp300Asn, were degraded most rapidly whilst levan produced by Lsc3 from raffinose least rapidly. BT1760 catalyzed finely at human body temperature (37°C) and in moderately acidic environment (pH 5–6) that is typical for the gut lumen. According to differential scanning fluorimetry, the Tm of the endo-levanase was 51.5°C. All tested levans were sufficiently stable in acidic conditions (pH 2.0) simulating the gastric environment. Therefore, levans of both bacterial and plant origin may serve as a prebiotic fiber for B. thetaiotaomicron and contribute to short-chain fatty acids synthesis by gut microbiota. In the genome of Bacteroides xylanisolvens of human origin a putative levan degradation locus was disclosed. PMID:28103254

A Highly Active Endo-Levanase BT1760 of a Dominant Mammalian Gut Commensal Bacteroides thetaiotaomicron Cleaves Not Only Various Bacterial Levans, but Also Levan of Timothy Grass.

PubMed

Mardo, Karin; Visnapuu, Triinu; Vija, Heiki; Aasamets, Anneli; Viigand, Katrin; Alamäe, Tiina

2017-01-01

Bacteroides thetaiotaomicron, an abundant commensal of the human gut, degrades numerous complex carbohydrates. Recently, it was reported to grow on a β-2,6-linked polyfructan levan produced by Zymomonas mobilis degrading the polymer into fructooligosaccharides (FOS) with a cell surface bound endo-levanase BT1760. The FOS are consumed by B. thetaiotaomicron, but also by other gut bacteria, including health-promoting bifidobacteria and lactobacilli. Here we characterize biochemical properties of BT1760, including the activity of BT1760 on six bacterial levans synthesized by the levansucrase Lsc3 of Pseudomonas syringae pv. tomato, its mutant Asp300Asn, levansucrases of Zymomonas mobilis, Erwinia herbicola, Halomonas smyrnensis as well as on levan isolated from timothy grass. For the first time a plant levan is shown as a perfect substrate for an endo-fructanase of a human gut bacterium. BT1760 degraded levans to FOS with degree of polymerization from 2 to 13. At optimal reaction conditions up to 1 g of FOS were produced per 1 mg of BT1760 protein. Low molecular weight (<60 kDa) levans, including timothy grass levan and levan synthesized from sucrose by the Lsc3Asp300Asn, were degraded most rapidly whilst levan produced by Lsc3 from raffinose least rapidly. BT1760 catalyzed finely at human body temperature (37°C) and in moderately acidic environment (pH 5-6) that is typical for the gut lumen. According to differential scanning fluorimetry, the Tm of the endo-levanase was 51.5°C. All tested levans were sufficiently stable in acidic conditions (pH 2.0) simulating the gastric environment. Therefore, levans of both bacterial and plant origin may serve as a prebiotic fiber for B. thetaiotaomicron and contribute to short-chain fatty acids synthesis by gut microbiota. In the genome of Bacteroides xylanisolvens of human origin a putative levan degradation locus was disclosed.

Spontaneous CP-violation in extended technicolor models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldstein, W.H.

1983-01-01

The spontaneous CP-violation in models with dynamically broken weak interaction symmetries, i.e., extended technicolor models is examined. Attention is focussed on situations in which the global, flavor symmetry of the strong, color-technicolor, interactions is a product of chiral, horizontal U(2), or, when weak degrees of freedom are included, U(4) factors. In this context, we demonstrate the Eichten, Lane, Preskill CP-violation mechanism and show that the nemesis of this mechanism, strong CP-violation, can be easily avoided by imposing a discrete symmetry on the chiral perturbation. When strong CP-invariance is preserved by this means, we find that spontaneously generated CP-violating phases aremore » suppressed by a ratio of extended technicolor mass scales. In addition, we consider, and attempt to analyze the direct contribution to strong CP-violation from colored technifermions.« less

Cyclopentadienylniobium and -molybdenum phosphorodithioate complexes. X-ray crystal structures of CpNbCl sub 3 (S sub 2 P(OPr sup i ) sub 2 ), CpNbCl(. mu. -Cl) sub 2 Nb(S sub 2 P(OPr sup i ) sub 2 )Cp, and cis-Cp prime Mo(CO) sub 2 (S sub 2 P(OPr sup i ) sub 2 )

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woodward, S.; Riaz, U.; Curtis, M.D.

1990-10-01

Reaction of CpNbCl{sub 4} (Cp = {eta}-C{sub 5}H{sub 5}) with (Pr{sup i}O){sub 2}P(S)(SH) in the presence of NEt{sub 3} yields CpNbCl{sub 3}(S{sub 2}P(S{sub 2}Pr{sup i}){sub 2}) (1). Reduction of 1 with Na/Hg affords the Nb-Nb-bonded complex CpNbCl({mu}-Cl){sub 2}Nb(S{sub 2}P(OR){sub 2})Cp (2). In refluxing toluene, (Pr{sup i}O){sub 2}P(S)(SH) with (Cp{prime}Mo(CO){sub 3}){sub 2} (Cp{prime} = {eta}-C{sub 5}H{sub 4}Me) gives cis-Cp{prime}Mo(CO){sub 2}(S{sub 2}P(OPr{sup i}){sub 2}) (3). Oxidation of 3 with I{sub 2} affords Cp{prime}MoI{sub 2}(CO)(S{sub 2}P(OPr{sup i}){sub 2}) (4). The crystal structures of 1-3 are compared. For 1, triclinic, P{bar 1}, a = 7.122 (3) {angstrom}, b = 11.365 (4) {angstrom}, c =more » 12.532 (4) {angstrom}, {alpha} = 77.38 (3){degree}, {beta} = 89.08 (3){degree}, {gamma} = 72.87 (3){degree}, V = 944.5 (8) {angstrom}{sup 3}. For 2, triclinic, P{bar 1}, a = 7.251 (3) {angstrom}, b = 12.386 (5) {angstrom}, c = 13.988 (5) {angstrom}, {alpha} = 102.66 (3){degree}, {beta} = 103.56 (3){degree}, {gamma} = 94.66 (3){degree}, V = 1180.0 (8) {angstrom}{sup 3}, Z = 2. For 3, orthorhombic, Pbca, a = 12.703 (3) {angstrom}, b = 16.707 (4) {angstrom}, c = 18.398 (4) {angstrom}, V = 3904.4 (17) {angstrom}{sup 3}, Z = 8.« less

An Experimental Investigation of Effects of Fluxes (Na3AlF6 and K2TiF6), Element Alloys (Mg), and Composite Powders ((Al + TiC)CP and (Al + B4C)CP) on Distribution of Particles and Phases in Al-B4C and Al-TiC Composites

NASA Astrophysics Data System (ADS)

Mazaheri, Younes; Emadi, Rahmatollah; Meratian, Mahmood; Zarchi, Mehdi Karimi

2017-04-01

The wettability, incorporation, and gravity segregation of TiC and B4C particles into molten aluminum are important problems in the production of Al-TiC and Al-B4C composites by the casting techniques. In order to solve these problems, different methods consisting of adding the Na3AlF6 and K2TiF6 fluxes and Mg (as the alloying element) into the molten aluminum and injection of the (Al + TiC)CP and (Al + B4C)CP composite powders instead of B4C and TiC particles are evaluated. In this work, the conditions of sample preparation, such as particle addition temperature, stirring speed, and stirring time, are determined after many studies and tests. Microstructural characterizations of samples are investigated by scanning electron microscopy equipped with energy dispersive spectroscopy (EDS) and X-ray diffractometry. The results show better distribution and incorporation of TiCp and B4Cp in aluminum matrix when the fluxes are used, as well as EDS analysis of the interface between the matrix and reinforcement-strengthened formation of the different phases such as Al4C3 in the Al-TiC composites and Al3BC, TiB2 in the Al-B4C composites.

Registration of ‘CP 06-2425’, ‘CP 06-2495’, ‘CP 06-2964’, ‘CP 06-3103’, and ‘CP 07-1313’ Sugarcane for Sand Soils in Florida

USDA-ARS?s Scientific Manuscript database

‘CP 06-2425’ (Reg. No. CV-172; PI 678574), ‘CP 06-2495’ (Reg. No. CV-173; PI 678575), ‘CP 06-2964’ (Reg. No. CV-174; PI 678576), ‘CP 06-3103’ (Reg. No. CV-175; PI 678577), and ‘CP 07-1313’ (Reg. No. CV-176; PI 678578) sugarcane (a complex hybrid of Saccharum spp.) were released in June 2015 to be cu...

Inhibition of microbial biofuel production in drought-stressed switchgrass hydrolysate

DOE PAGES

Ong, Rebecca Garlock; Higbee, Alan; Bottoms, Scott; ...

2016-11-08

Here, interannual variability in precipitation, particularly drought, can affect lignocellulosic crop biomass yields and composition, and is expected to increase biofuel yield variability. However, the effect of precipitation on downstream fermentation processes has never been directly characterized. In order to investigate the impact of interannual climate variability on biofuel production, corn stover and switchgrass were collected during 3 years with significantly different precipitation profiles, representing a major drought year (2012) and 2 years with average precipitation for the entire season (2010 and 2013). All feedstocks were AFEX (ammonia fiber expansion)-pretreated, enzymatically hydrolyzed, and the hydrolysates separately fermented using xylose-utilizing strainsmore » of Saccharomyces cerevisiae and Zymomonas mobilis. As a result, a chemical genomics approach was also used to evaluate the growth of yeast mutants in the hydrolysates.« less

Recombinant cells that highly express chromosomally-integrated heterologous genes

DOEpatents

Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

1998-01-01

Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

Recombinant cells that highly express chromosomally-integrated heterologous genes

DOEpatents

Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

2000-08-22

Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

The combination of quantitative PCR and western blot detecting CP4-EPSPS component in Roundup Ready soy plant tissues and commercial soy-related foodstuffs.

PubMed

Xiao, Xiao; Wu, Honghong; Zhou, Xinghu; Xu, Sheng; He, Jian; Shen, Wenbiao; Zhou, Guanghong; Huang, Ming

2012-06-01

With the widespread use of Roundup Ready soy (event 40-3-2) (RRS), the comprehensive detection of genetically modified component in foodstuffs is of significant interest, but few protein-based approaches have been found useful in processed foods. In this report, the combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different RRS plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing both meat and plant protein concentrates. The validity of the 2 methods was confirmed first. We also showed that the CP4-EPSPS protein existed in different RRS plant tissues. In certain cases, the results from the western blot and the qPCR were not consistent. To be specific, at least 2 degraded fragments of CP4-EPSPS protein (35.5 and 24.6 kDa) were observed. For dried bean curd crust and deep-fried bean curd, a degraded protein fragment with the size of 24.6 kDa appeared, while cp4-epsps gene could not be traced by qPCR. In contrast, we found a signal of cp4-epsps DNA in 3 foodstuffs, including soy-containing ham cutlet product, meat ball, and sausage by qPCR, while CP4-EPSPS protein could not be detected by western blot in such samples. Our study therefore concluded that the combination of DNA- and protein-based methods would compensate each other, thus resulting in a more comprehensive detection from nucleic acid and protein levels. The combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different Roundup Ready soy (event 40-3-2) plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing a combination of both meat and plant protein concentrates. This study indicated that the combination of DNA- and protein-based methods

Neutrino CP phases from sneutrino chaotic inflation

NASA Astrophysics Data System (ADS)

Nakayama, Kazunori; Takahashi, Fuminobu; Yanagida, Tsutomu T.

2017-10-01

We study if the minimal sneutrino chaotic inflation is consistent with a flavor symmetry of the Froggatt-Nielsen type, to derive testable predictions on the Dirac and Majorana CP violating phases, δ and α. For successful inflation, the two right-handed neutrinos, i.e., the inflaton and stabilizer fields, must be degenerate in mass. First we find that the lepton flavor symmetry structure becomes less manifest in the light neutrino masses in the seesaw mechanism, and this tendency becomes most prominent when right-handed neutrinos are degenerate. Secondly, the Dirac CP phase turns out to be sensitive to whether the shift symmetry breaking depends on the lepton flavor symmetry. When the flavor symmetry is imposed only on the stabilizer Yukawa couplings, distributions of the CP phases are peaked at δ ≃ ± π / 4 , ± 3 π / 4 and α = 0, while the vanishing and maximal Dirac CP phases are disfavored. On the other hand, when the flavor symmetry is imposed on both the inflaton and stabilizer Yukawa couplings, it is rather difficult to explain the observed neutrino data, and those parameters consistent with the observation prefer the vanishing CP phases δ = 0 , π and α = 0.

Reaction of BH4- with [Mo2Cp2(mu-SMe)n] species to give tetrahydroborato, hydrido or dimetallaborane compounds: control of product by ancillary ligands.

PubMed

Cabon, Nolwenn; Petillon, Francois Y; Schollhammer, Philippe; Talarmin, Jean; Muir, Kenneth W

2004-09-07

The reaction of mono- or dichloro-dimolybdenum(III) complexes [Mo2Cp2(mu-SMe)2(mu-Cl)(mu-Y)] (Cp=eta5-C5H5; 1, Y=SMe; 2, Y=PPh2; 3, Y=Cl) with NaBH4 at room temperature gave in high yields tetrahydroborato (8), hydrido (9) or metallaborane (12) complexes depending on the ancillary ligands. The correct formulation of derivatives and has been unambigously determined by X-ray diffraction methods. That of the hydrido compound 9 has been established in solution by NMR analysis and confirmed by an X-ray study of the mu-azavinylidene derivative [Mo2Cp2(mu-SMe)2(mu-PPh2)(mu-N=CHMe)] (10) obtained from the insertion of acetonitrile into the Mo-H bond of 9. Reaction of NaBH4 with nitrile derivatives, [Mo2Cp2(mu-SMe)4-n(CH3CN)2n]n+(5, n=1; 6 n=2), afforded the tetrahydroborato compound 8, together with a mu-azavinylidene species [Mo2Cp2(mu-SMe)3(mu-N=CHMe)](14), when n=1, and the metallaborane complex 12, together with a mixed borohydrato-azavinylidene derivative [Mo2Cp2(mu-SMe)2(mu-BH4)(mu-N=CHMe)] (13), when n=2. The molecular structures of these complexes have been confirmed by X-ray analysis. Preparations of some of the starting complexes (3 and 4) are also described, as are the molecular structures of the precursors [Mo2Cp2(mu-SMe)2(mu-X)(mu-Y)] (1, X/Y=Cl/SMe; 2, X/Y=Cl/PPh2; 4, X/Y=SMe/PPh2).

Genetic engineering of Clostridium thermocellum DSM1313 for enhanced ethanol production.

PubMed

Kannuchamy, Saranyah; Mukund, Nisha; Saleena, Lilly M

2016-05-11

The twin problem of shortage in fossil fuel and increase in environmental pollution can be partly addressed by blending of ethanol with transport fuel. Increasing the ethanol production for this purpose without affecting the food security of the countries would require the use of cellulosic plant materials as substrate. Clostridium thermocellum is an anaerobic thermophilic bacterium with cellulolytic property and the ability to produce ethanol. But its application as biocatalyst for ethanol production is limited because pyruvate ferredoxin oxidoreductase, which diverts pyruvate to ethanol production pathway, has low affinity to the substrate. Therefore, the present study was undertaken to genetically modify C. thermocellum for enhancing its ethanol production capacity by transferring pyruvate carboxylase (pdc) and alcohol dehydrogenase (adh) genes of the homoethanol pathway from Zymomonas mobilis. The pdc and adh genes from Z. mobilis were cloned in pNW33N, and transformed to Clostridium thermocellum DSM 1313 by electroporation to generate recombinant CTH-pdc, CTH-adh and CTH-pdc-adh strains that carried heterologous pdc, adh, and both genes, respectively. The plasmids were stably maintained in the recombinant strains. Though both pdc and adh were functional in C. thermocellum, the presence of adh severely limited the growth of the recombinant strains, irrespective of the presence or absence of the pdc gene. The recombinant CTH-pdc strain showed two-fold increase in pyruvate carboxylase activity and ethanol production when compared with the wild type strain. Pyruvate decarboxylase gene of the homoethanol pathway from Z mobilis was functional in recombinant C. thermocellum strain and enhanced its ability to produced ethanol. Strain improvement and bioprocess optimizations may further increase the ethanol production from this recombinant strain.

The series of carbon-chain complexes {Ru(dppe)Cp*}₂{μ-(C≡C )x} (x = 4–8, 11): Synthesis, structures, properties and some reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.

The construction of a series of compounds {Ru(dppe)Cp*} 2(μ-C 2x) (Ru*-C2x-Ru*, x = 4–8, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me 3Si(Ctriple bond; length of mdashC) 4SiMe 3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh 3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC) 3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC) 4Au(PPh 3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC) 3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe 3}(dppe)Cp*Ru*-C2x-Si (x =more » 3, 4) followed by oxidative coupling [Cu(OAc) 2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh 3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC) 2SiMe 3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe 2(CO) 9 gave {Fe 3(CO) 9}{μ 3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]} 2Fe(C 3-Ru*) 2 and {Fe 3(CO) 9}{μ 3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{μ 3-C(Ctriple bond; length of mdashC) 2[Ru(dppe)Cp*]} Fe(C 3-Ru*)(C 5-Ru*), respectively. The redox properties of the series of complexes with 2x = 2–16 were measured and showed a diminution of the separation of the first two oxidation potentials, ΔE = E 2 - E 1, with increasing carbon chain length. The X-ray-determined molecular structures of Ru*-C8-Si, Ru*-C8-Ru*, Ru*-C14-Ru* (two C 6H 6 solvates), {Ru(PPh 3) 2Cp} 2{μ-(Ctriple bond; length of mdashC) 4}·4CHCl 3Ru-C 8-Ru·4CHCl 3 and of Fe

CP-violating phase on magnetized toroidal orbifolds

NASA Astrophysics Data System (ADS)

Kobayashi, Tatsuo; Nishiwaki, Kenji; Tatsuta, Yoshiyuki

2017-04-01

We study the CP-violating phase of the quark sector on T 2 /Z N ( N = 2 , 3 , 4 , 6) with non-vanishing magnetic fluxes, where properties of possible origins of the CP violation are investigated minutely. In this system, a non-vanishing value is mandatory in the real part of the complex modulus parameter τ of the two-dimensional torus in order to explain the CP violation in the quark sector. On T 2 without orbifolding, underlying discrete flavor symmetries severely restrict the form of Yukawa couplings and it is very difficult to reproduce the observed pattern in the quark sector including the CP-violating phase δ CP. When multiple Higgs doublets emerge on T 2 /Z 2, the mass matrices of the zero-mode fermions can be written in the Gaussian textures by choosing appropriate configurations of vacuum expectation values of the Higgs fields. When such Gaussian textures of mass matrices are realized, we show that all of the quark profiles, which are mass hierarchies among the quarks, quark mixing angles, and δ CP can be simultaneously realized.

Fermentation of D-xylose and L-arabinose to ethanol by Erwinia chrysanthemi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolan, J.S.; Finn, R.K.

1987-09-01

Erwinia spp. are gram-negative facultative anaerobes within the family Enterobacteriacae which possess several desirable traits for the conversion of pentose sugars to ethanol, such as the ability to ferment a broad range of carbohydrates and the ease with which they can be genetically modified. Twenty-eight strains of Erwinia carotovora and E. chrysanthemi were screened for the ability to ferment D-xylose to ethanol. E. chrysanthemi B374 was chosen for further study on the basis of its superior (4%) ethanol tolerance. They have characterized the fermentation of D-xylose and L-arabinose by the wild type and mutants which bear plasmids containing the pyruvatemore » decarboxylase gene from Zymomonas mobilis. Expression of the gene markedly increased the yields of ethanol (from 0.7 up to 1.45 mol/mol of xylose) and decreased the yields of formate, acetate, and lactate. However, the cells with pyruvate decarboxylase grew only one-fourth as fast as the wild type and tolerated only 2% ethanol. Alcohol tolerance was stimulated by the addition of yeast extract to the growth medium. Xylose catabolism was characterized by a high saturation constant K/sub s/ (4.5 mM).« less

Transcriptome analysis of Zymomonas mobilis ZM4 reveals mechanisms of tolerance and detoxification of phenolic aldehyde inhibitors from lignocellulose pretreatment

USDA-ARS?s Scientific Manuscript database

Background: Phenolic aldehydes generated from lignocellulose pretreatment exhibited severe toxic inhibitions on microbial growth and fermentation. Numerous tolerance studies against furfural, 5-hydroxymethyl-2-furaldehyde (HMF), acetate, and ethanol were reported, but studies on inhibition of phenol...

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

Association of Corynebacterium pseudotuberculosis recombinant proteins rCP09720 or rCP01850 with rPLD as immunogens in caseous lymphadenitis immunoprophylaxis.

PubMed

Silva, Mara Thais de Oliveira; Bezerra, Francisco Silvestre Brilhante; de Pinho, Rodrigo Barros; Begnini, Karine Rech; Seixas, Fabiana Kommling; Collares, Tiago; Portela, Ricardo Dias; Azevedo, Vasco; Dellagostin, Odir; Borsuk, Sibele

2018-01-02

Caseous lymphadenitis (CLA) is a chronic disease responsible for significant economic losses in sheep and goat breeding worldwide. The treatment for this disease is not effective, and an intense vaccination schedule would be the best control strategy. In this study, we evaluated the associations of rCP09720 or rCP01850 proteins from Corynebacterium pseudotuberculosis with recombinant exotoxin phospholipase D (rPLD) as subunit vaccines in mice. Four experimental groups (10 animals each) were immunized with a sterile 0.9% saline solution (G1), rPLD (G2), rPLD + rCP09720 (G3), and rPLD + rCP01850 (G4). The mice received two doses of each vaccine at a 21-day interval and were challenged 21 days after the last immunization. The animals were evaluated daily for 40 days after the challenge, and mortality rate was recorded. The total IgG production level increased significantly in the experimental groups on day 42 after the first vaccination. Similarly, higher levels of specific IgG2a were observed in experimental groups G2, G3, and G4 compared to the IgG1 levels on day 42. G4 showed a significant (p < .05) humoral response against both antigens of the antigenic formulations. The cellular immune response induced by immunization was characterized by a significant (p < .05) production of interferon-γ compared to that in the control, while the concentrations of interleukin (IL)-4 and IL-12 were not significant in any group. A significant increase of tumor necrosis factor was observed only in G4. The survival rates after the challenge were 30% (rPLD), 40% (rPLD + rCP09720), and 50% (rPLD + rCP01850). Thus, the association of rCP01850 with rPLD resulted in the best protection against the challenge with C. pseudotuberculosis and induced a more intense type 1 T-helper cell immune response. Copyright © 2017 Elsevier Ltd. All rights reserved.

Recombinant cells that highly express chromosomally-integrated heterologous genes

DOEpatents

Ingram, L.O.; Ohta, Kazuyoshi; Wood, B.E.

1998-10-13

Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol. 13 figs.

Accounting for all sugars produced during integrated production of ethanol from lignocellulosic biomass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schell, Daniel J.; Dowe, Nancy; Chapeaux, Alexandre

This study explored integrated conversion of corn stover to ethanol and highlights techniques for accurate yield calculations. Acid pretreated corn stover (PCS) produced in a pilot-scale reactor was enzymatically hydrolyzed and the resulting sugars were fermented to ethanol by the glucose–xylose fermenting bacteria, Zymomonas mobilis 8b. The calculations account for high solids operation and oligomeric sugars produced during pretreatment, enzymatic hydrolysis, and fermentation, which, if not accounted for, leads to overestimating ethanol yields. The calculations are illustrated for enzymatic hydrolysis and fermentation of PCS at 17.5% and 20.0% total solids achieving 80.1% and 77.9% conversion of cellulose and xylan tomore » ethanol and ethanol titers of 63 g/L and 69 g/L, respectively. In the future, these techniques, including the TEA results, will be applied to fully integrated pilot-scale runs.« less

Accounting for all sugars produced during integrated production of ethanol from lignocellulosic biomass

DOE PAGES

Schell, Daniel J.; Dowe, Nancy; Chapeaux, Alexandre; ...

2016-01-19

This study explored integrated conversion of corn stover to ethanol and highlights techniques for accurate yield calculations. Acid pretreated corn stover (PCS) produced in a pilot-scale reactor was enzymatically hydrolyzed and the resulting sugars were fermented to ethanol by the glucose–xylose fermenting bacteria, Zymomonas mobilis 8b. The calculations account for high solids operation and oligomeric sugars produced during pretreatment, enzymatic hydrolysis, and fermentation, which, if not accounted for, leads to overestimating ethanol yields. The calculations are illustrated for enzymatic hydrolysis and fermentation of PCS at 17.5% and 20.0% total solids achieving 80.1% and 77.9% conversion of cellulose and xylan tomore » ethanol and ethanol titers of 63 g/L and 69 g/L, respectively. In the future, these techniques, including the TEA results, will be applied to fully integrated pilot-scale runs.« less

Mathematical modeling of ethanol production in solid-state fermentation based on solid medium' dry weight variation.

PubMed

Mazaheri, Davood; Shojaosadati, Seyed Abbas; Zamir, Seyed Morteza; Mousavi, Seyyed Mohammad

2018-04-21

In this work, mathematical modeling of ethanol production in solid-state fermentation (SSF) has been done based on the variation in the dry weight of solid medium. This method was previously used for mathematical modeling of enzyme production; however, the model should be modified to predict the production of a volatile compound like ethanol. The experimental results of bioethanol production from the mixture of carob pods and wheat bran by Zymomonas mobilis in SSF were used for the model validation. Exponential and logistic kinetic models were used for modeling the growth of microorganism. In both cases, the model predictions matched well with the experimental results during the exponential growth phase, indicating the good ability of solid medium weight variation method for modeling a volatile product formation in solid-state fermentation. In addition, using logistic model, better predictions were obtained.

Recombinant cells that highly express chromosomally-integrated heterologous gene

DOEpatents

Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

2007-03-20

Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

Induction of Experimental Arthritis by Borrelial Lipoprotein and CpG Motifs: Are Toll-Like Receptors 2, 4, 9 or CD-14 Involved?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Batsford, S.; Dunn, J.; Mihatsch, M.

Bacterial lipoproteins and CpG-DNA are ligands for Toll-Like-Receptors (TLR) 2 and 9 respectively. Both classes of molecules were reported to induce experimental arthritis in rodents following direct intra-articular injection. Here we studied: (1) whether arthritis induction by Outer surface (Lipo)protein A (OspA) (B.burgdorferi) involved the TLR-2 as well as the TLR-4 or the CD-14 receptors in addition, and (2) re-examined the arthritogenic potential of CpG-DNA motifs in mice. Following intra-articular injection of the test substances [20 {micro}g recombinant, lipidated OspA; 1nM(6 {micro}g) to 10nM(60 {micro}g) synthetic CpG-DNA], inflammation was monitored by {sup 99}Tc scintigraphy (ratio left/right knee joint uptake >more » 1.1 indicates inflammation) and by histology. Lipoprotein OspA induced severe, acute arthritis in TLR-2{sup +/+} w.t. but not in TLR-2{sup -/-} mice (p<0.01). There were no significant differences in the severity of arthritis induced in TLR-4{sup +/+} w.t. and TLR-4{sup -/-} mutant mice, or between CD14{sup +/+} w.t. and CD14{sup -/-} mice. CpG-DNA (1or 10 nM) did not cause notable inflammation in C57BL/6 mice; {sup 99}Tc ratios were < 1.0 and histology showed only minimal changes. Induction of arthritis by the OspA lipoprotein of B.burgdorferi involves the TLR-2 receptor, no evidence for additional participation of TLR-4 or CD14 receptors was found. Intra-articular injection of CpG-DNA did not produce manifest joint injury in mice, at variance with previous reports.« less

Search for CP violation in singly Cabibbo suppressed four-body D decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinelli, Maurizio

2011-02-01

We search for CP violation in a sample of 4.7 x 10 4 singly Cabibbo suppressed D 0 → K + K - π +π - decays and 1.8(2.6) x 10 4 D (s) + → K S 0 K + π + π - decays. CP violation is searched for in the difference between the T-odd asymmetries, obtained using triple product correlations, measured for D and D decays. The measured CP violation parameters are A T(D 0) = (1.0 ± 5.1(stat) ± 4.4(syst)) x 10 -3, A T(D +) = (-11.96 ± 10.04(stat) ± 4.81(syst)) x 10 -3 andmore » A T(D s +) = (-13.57 ± 7.67(stat) ± 4.82(syst)) x 10 -3. This search for CP violation showed that the T-odd correlations are a powerful tool to measure the CP violating observable A T. The relative simplicity of an analysis based on T-odd correlations and the high quality results that can be obtained, allow to consider this tool as fundamental to search for CP violation in four-body decays. Even if the CP violation has not been found, excluding any New Physics effect to the sensitivity of about 0.5%, it is still worth to search for CP violation in D decays. The high statistics that can be obtained at the LHC or by the proposed high luminosity B-factories, make this topic to be considered in high consideration by experiments such as LHCb, SuperB or SuperBelle. The results outlined in this thesis strongly suggest to include a similar analysis into the Physics program of these experiments.« less

ESTIMATE OF CP VIOLATION FOR THE LBNE PROJECT AND δCP

NASA Astrophysics Data System (ADS)

Kisslinger, Leonard S.

2012-08-01

Measurements of CP violation (CPV) and the basic δCP parameter are the goals of the LBNE Project, which is being planned. Using the expected energy and baseline parameters for the LBNE Project, CPV and the dependence of CPV on δCP are estimated, to help in the planning of this project.

Hypo-electronic triple-decker sandwich complexes: synthesis and structural characterization of [(Cp*Mo)2{μ-η(6):η(6)-B4H4E-Ru(CO)3}] (E = S, Se, Te or Ru(CO)3 and Cp* = η(5)-C5Me5).

PubMed

Mondal, Bijan; Bhattacharyya, Moulika; Varghese, Babu; Ghosh, Sundargopal

2016-07-05

The syntheses and structural characterization of hypo-electronic di-molybdenum triple-decker sandwich clusters are reported. Thermolysis of [Ru3(CO)12] with an in situ generated intermediate obtained from the reaction of [Cp*MoCl4] with [LiBH4·THF] yielded an electron deficient triple-decker sandwich complex, [(Cp*Mo)2{μ-η(6):η(6)-B4H4Ru2(CO)6}], . In an effort to generate analogous triple-deckers containing group-16 elements, we isolated [(Cp*Mo)2{μ-η(6):η(6)-B4H4ERu(CO)3}] (: E = Te; : E = S; : E = Se). These clusters show a high metal coordination number and cross cluster Mo-Mo bond. The formal cluster electron count of these compounds is four or three skeletal electron pairs less than required for a canonical closo-structure of the same nuclearity. Therefore, these compounds represent a novel class of triple-decker sandwich complex with 22 or 24 valence-electrons (VE), wherein the "chair" like hexagonal middle ring is composed of B, Ru and chalcogen. One of the key differences among the synthesized triple-decker molecules is the puckering nature of the middle ring [B4RuE], which increases in the order S < Se < Ru(CO)3 < Te. In addition, Fenske-Hall and quantum-chemical calculations with DFT methods at the BP86 level of theory have been used to analyze the bonding of these novel complexes. The studies not only explain the electron unsaturation of the molecules, but also reveal the reason for the significant puckering of the middle deck. All the compounds have been characterized by IR, (1)H, (11)B, and (13)C NMR spectroscopy in solution and the solid state structures were established by crystallographic analysis.

The comparison of antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide (CP) and sulfated CP.

PubMed

Liu, Cui; Chen, Jin; Li, Entao; Fan, Qiang; Wang, Deyun; Li, Peng; Li, Xiuping; Chen, Xingying; Qiu, Shulei; Gao, Zhenzhen; Li, Hongquan; Hu, Yuanliang

2015-02-01

Codonopsis pilosula polysaccharide (CP) was extracted, purified and modified by chlorosulfonic acid-pyridine method to obtain a sulfated CP (sCP). Their antioxidative activities in vitro were compared through the free radical-scavenging test. The results demonstrated that the scavenging capabilities of sCP were significantly stronger than those of CP. In vivo test, the mice hepatic injury model was prepared by BCG/LPS method, then administrated respectively with sCP and CP at three dosages, the biochemical indexes in serum, antioxidative indexes in liver homogenate and histopathological change in liver of the mice were compared. The results showed that in high (200mg/kg) and middle (150mg/kg) dosages of sCP groups, the contents of ALT, AST and TNF-α in serum and MDA in liver homogenate were significantly lower than those in the model group and numerically lower than those in the CP groups, the activities of SOD and GSH-Px in liver homogenate were significantly higher than those in the model group and numerically higher than those in the CP groups. In the model group there were obvious pathological changes in the liver, while in the sCP groups were near normal. These results indicate that sCP and CP possess antioxidative activity in vitro and in vivo, the activity of sCP is stronger than that of CP and sulfation modification can enhance the antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of the One-electron Oxidations of CO-Bridged vs Unbridged Bimetallic Complexes: Electron-transfer Chemistry of Os2Cp2(CO)4 and Os2Cp*2(μ-CO)2(CO)2 (Cp = η5-C5H5, Cp* = η5-C5Me5)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laws, Derek R.; Bullock, R. Morris; Lee, Richmond

The one-electron oxidations of two dimers of half-sandwich osmium carbonyl complexes have been examined by electrochemistry, spectro-electrochemistry, and computational methods. The all-terminal carbonyl complex Os2Cp2(CO)4 (1, Cp = η5-C5H5) undergoes a reversible one-electron anodic reaction at E1/2 = 0.41 V vs ferrocene in CH2Cl2/0.05 M [NBu4][B(C6F5)4], giving a rare example of a metal-metal bonded radical cation unsupported by bridging ligands. The IR spectrum of 1+ is consistent with an approximately 1:1 mixture of anti and gauche structures for the 33 e- radical cation in which it has retained all-terminal bonding of the CO ligands. DFT calculations, including orbital-occupancy-perturbed Mayer bond-ordermore » analyses, show that the HOMOs of anti-1 and gauche-1 are metal-ligand delocalized. Removal of an electron from 1 has very little effect on the Os-Os bond order, accounting for the resistance of 1+ to heterolytic cleavage. The Os-Os bond distance is calculated to decrease by 0.10 Å and 0.06 Å as a consequence of one-electron oxidation of anti-1 and gauche-1, respectively. The CO-bridged complex Os2Cp*2(μ-CO)2(CO)2 (Cp* = η5-C5Me5), trans-2, undergoes a more facile oxidation, E1/2 = - 0.11 V, giving a persistent radical cation shown by solution IR analysis to preserve its bridged-carbonyl structure. However, ESR analysis of frozen solutions of 2+ is interpreted in terms of the presence of two isomers, most likely anti-2+ and trans-2+, at low temperature. Calculations show that the HOMO of trans-2 is highly delocalized over the metal-ligand framework, with the bridging carbonyls accounting for about half of the orbital makeup. The Os-Os bond order again changes very little with removal of an electron, and the Os-Os bond length actually undergoes minor shortening. Calculations suggest that the second isomer of 2+ has both the trans CO-bridged and the anti all-terminal CO structures. DRL and WEG acknowledge the support of the National Science

OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Indro Neil; Landick, Robert

The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe 2+-dependent AdhB and Zn 2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

DOE PAGES

Ghosh, Indro Neil; Landick, Robert

2016-07-16

The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe 2+-dependent AdhB and Zn 2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Neutrino mixing and CP phase correlations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Ernest; Natale, Alexander; Popov, Oleg

A specimore » al form of the 3 × 3 Majorana neutrino mass matrix derivable from μ – τ interchange symmetry accompanied by a generalized CP transformation was obtained many years ago. It predicts θ 23 = π / 4 as well as δ CP = ± π / 2 , with θ 13 ≠ 0 . Whereas this is consistent with present data, we explore a deviation of this result which occurs naturally in a recent proposed model of radiative inverse seesaw neutrino mass.« less

Neutrino mixing and CP phase correlations

DOE PAGES

Ma, Ernest; Natale, Alexander; Popov, Oleg

2015-04-30

A specimore » al form of the 3 × 3 Majorana neutrino mass matrix derivable from μ – τ interchange symmetry accompanied by a generalized CP transformation was obtained many years ago. It predicts θ 23 = π / 4 as well as δ CP = ± π / 2 , with θ 13 ≠ 0 . Whereas this is consistent with present data, we explore a deviation of this result which occurs naturally in a recent proposed model of radiative inverse seesaw neutrino mass.« less

Enhancement of expression and apparent secretion of Erwinia chrysanthemi endoglucanase (encoded by celZ) in Escherichia coli B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, S.; Yomano, L.P.; Saleh, A.Z.

1999-06-01

Escherichia coli B has been engineered as a biocatalyst for the conversion of lignocellulose into ethanol. Previous research has demonstrated that derivatives of E. coli B can produce high levels of Erwinia chrysanthemi endoglucanase (encoded by celZ) as a periplasmic product and that this enzyme can function with commercial fungal cellulase to increase ethanol production. In this study, the authors have demonstrated two methods that improve celZ expression in E. coli B. Initially, with a low-copy-number vector, two E. coli glycolytic gene promoters (gap and eno) were tested and found to be less effective than the original celZ promoter. Bymore » screening 18,000 random fragments of Zymomonas mobilis DNA, a surrogate promoter was identified which increased celZ expression up to sixfold. With this promoter, large polar inclusion bodies were clearly evident in the periplasmic space. Sequencing revealed that the most active surrogate promoter is derived from five Sau3A1 fragments, one of which was previously sequenced in Z. mobilis. Visual inspection indicated that this DNA fragment contains at least five putative promoter regions, two of which were confirmed by primer extension analysis. Addition of the out genes from E. chrysanthemi EC16 caused a further increase in the production of active enzyme and facilitated secretion or release of over half of the activity into the extracellular environment. With the most active construct, of a total of 13,000 IU of active enzyme per liter of culture, 7,800 IU was in the supernatant. The total active endoglucanase was estimated to represent 4 to 6% of cellular protein.« less

Dissection of the methyl-CpG binding domain from the chromosomal protein MeCP2.

PubMed Central

Nan, X; Meehan, R R; Bird, A

1993-01-01

MeCP2 is a chromosomal protein which binds to DNA that is methylated at CpG. In situ immunofluorescence in mouse cells has shown that the protein is most concentrated in pericentromeric heterochromatin, suggesting that MeCP2 may play a role in the formation of inert chromatin. Here we have isolated a minimal methyl-CpG binding domain (MBD) from MeCP2. MBD is 85 amino acids in length, and binds exclusively to DNA that contains one or more symmetrically methylated CpGs. MBD has negligable non-specific affinity for DNA, confirming that non-specific and methyl-CpG specific binding domains of MeCP2 are distinct. In vitro footprinting indicates that MBD binding can protect a 12 nucleotide region surrounding a methyl-CpG pair, with an approximate dissociation constant of 10(-9) M. Images PMID:8177735

Classification of Rhizomonas suberifaciens, an unnamed Rhizomonas species, and Sphingomonas spp. in rRNA superfamily IV.

PubMed

van Bruggen, A H; Jochimsen, K N; Steinberger, E M; Segers, P; Gillis, M

1993-01-01

Thermal melting profiles of hybrids between 3H-labeled rRNA of Rhizomonas suberifaciens, the causal agent of corky root of lettuce, and chromosomal DNAs from 27 species of gram-negative bacteria indicated that the genus Rhizomonas belongs to superfamily IV of De Ley. On the basis of the melting temperatures of DNA hybrids with rRNAs from the type strains of R. suberifaciens, Sphingomonas paucimobilis, and Sphingomonas capsulata, Rhizomonas strains constitute a separate branch in superfamily IV, which is closely related to but separate from branches containing Zymomonas mobilis, Sphingomonas spp., and S. capsulata. Sphingomonas yanoikuyae and Rhizomonas sp. strain WI4 are located toward the base of the Rhizomonas rRNA branch. DNA-DNA hybridization indicated that S. yanoikuyae is equidistant from Rhizomonas sp. strain WI4 and S. paucimobilis. Sequences of 270 bp of 16S ribosomal DNAs from eight strains of Rhizomonas spp., eight strains of Sphingomonas spp., and Agrobacterium tumefaciens indicated that S. yanoikuyae and Rhizomonas sp. strains WI4 and CA16 are genetically more closely related to R. suberifaciens than to Sphingomonas spp. Thus, S. yanoikuyae may need to be transferred to the genus Rhizomonas on the basis of the results of further study.

CP and CP-PGN protect mice against MRSA infection by inducing M1 macrophages.

PubMed

Zhang, Yang; Li, Xiang-Xiang; Ma, Yuan; Xu, Jie; Zhao, Li-Na; Qian, Xue-Feng; Zhang, Xian-Feng; Shi, Jin-Fang; Han, Qing-Zhen

2017-12-04

Corynebacterium pyruviciproducens (C. pyruviciproducens, CP), as a newly discovered immunomodulator, has been confirmed to have a stronger immunoregulation than Propionibacterium acnes (P. acnes) of the traditional immune adjuvant, by previous experiments with model antigen ovalbumin and sheep red blood cells. Here, it was designed to assess its ability to resist methicillin-resistant Staphylococcus aureus (MRSA), since MRSA as a vital gram positive pathogen is characterized by high morbidity and mortality. In this report, it was indicated that C. pyruviciproducens and its peptidoglycan (CP-PGN) could help to be against bloodstream infection of MRSA with raised survival rate, decreased bacteria load and alleviated systemic inflammation, and these effects of CP-PGN were more pronounced. However, the whole CP was inclined to prevent localized abdominal infection of MRSA from progressing to a systemic infection. And they showed the potential as a therapeutic drug alone or combined with vancomycin. The diversity of capacity of activating macrophages induced by CP and CP-PGN may result in distinct resistance to MRSA in different infection models. Furthermore, both CP and CP-PGN induced M1 macrophages. In conclusion, CP and its PGN could act as promising immune agents to treat and prevent MRSA infection.

Technique of ethanol food grade production with batch distillation and dehydration using starch-based adsorbent

NASA Astrophysics Data System (ADS)

Widjaja, Tri; Altway, Ali; Ni'mah, Hikmatun; Tedji, Namira; Rofiqah, Umi

2015-12-01

Development and innovation of ethanol food grade production are becoming the reasearch priority to increase economy growth. Moreover, the government of Indonesia has established regulation for increasing the renewable energy as primary energy. Sorghum is cerealia plant that contains 11-16% sugar that is optimum for fermentation process, it is potential to be cultivated, especially at barren area in Indonesia. The purpose of this experiment is to learn about the effect of microorganisms in fermentation process. Fermentation process was carried out batchwise in bioreactor and used 150g/L initial sugar concentration. Microorganisms used in this experiment are Zymomonas mobilis mutation (A3), Saccharomyces cerevisiae and mixed of Pichia stipitis. The yield of ethanol can be obtained from this experiment. For ethanol purification result, distillation process from fermentation process has been done to search the best operation condition for efficiency energy consumption. The experiment for purification was divided into two parts, which are distillation with structured packing steel wool and adsorption (dehydration) sequencely. In distillation part, parameters evaluation (HETP and pressure drop) of distillation column that can be used for scale up are needed. The experiment was operated at pressure of 1 atm. The distillation stage was carried out at 85 °C and reflux ratio of 0.92 with variety porosities of 20%, 40%, and 60%. Then the adsorption process was done at 120°C and two types of adsorbent, which are starch - based adsorbent with ingredient of cassava and molecular sieve 3A, were used. The adsorption process was then continued to purify the ethanol from impurities by using activated carbon. This research shows that the batch fermentation process with Zymomonas mobilis A3 obtain higher % yield of ethanol of 40,92%. In addition to that, for purification process, the best operation condition is by using 40% of porosity of stuctured packing steel wool in distillation

Search for CP Violation in Charged-Ξ and Λ Hyperon Decays

NASA Astrophysics Data System (ADS)

Holmstrom, T.; Leros, N.; Burnstein, R. A.; Chakravorty, A.; Chan, A.; Chen, Y. C.; Choong, W. S.; Clark, K.; Dukes, E. C.; Durandet, C.; Felix, J.; Fu, Y.; Gidal, G.; Gu, P.; Gustafson, H. R.; Ho, C.; Huang, M.; James, C.; Jenkins, C. M.; Jones, T.; Kaplan, D. M.; Lederman, L. M.; Longo, M. J.; Lopez, F.; Lu, L. C.; Luebke, W.; Luk, K. B.; Nelson, K. S.; Park, H. K.; Perroud, J.-P.; Rajaram, D.; Rubin, H. A.; Teng, P. K.; Volk, J.; White, C. G.; White, S. L.; Zyla, P.

2004-12-01

We have compared the p and p¯ angular distributions in 117×106 Ξ-→Λπ-→pπ-π- and 41×106 Ξ¯+→Λ¯π+→p¯π+π+ decays using a subset of the data from the HyperCP experiment (E871) at Fermilab. We find no evidence of CP violation, with the direct-CP-violating parameter AΞΛ≡(αΞαΛ-α¯Ξα¯Λ)/(αΞαΛ+α¯Ξα¯Λ)=[0.0±5.1(stat)±4.4(syst)]×10-4.

Measurement of CP observables in B{sup {+-}{yields}D}{sub CP}K{sup {+-}}decays and constraints on the CKM angle {gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Amo Sanchez, P. del; Lees, J. P.; Poireau, V.

Using the entire sample of 467x10{sup 6} {Upsilon}(4S){yields}BB decays collected with the BABAR detector at the PEP-II asymmetric-energy B factory at the SLAC National Accelerator Laboratory, we perform an analysis of B{sup {+-}}{yields}DK{sup {+-}}decays, using decay modes in which the neutral D meson decays to either CP-eigenstates or non-CP-eigenstates. We measure the partial decay rate charge asymmetries for CP-even and CP-odd D final states to be A{sub CP+}=0.25{+-}0.06{+-}0.02 and A{sub CP-}=-0.09{+-}0.07{+-}0.02, respectively, where the first error is the statistical and the second is the systematic uncertainty. The parameter A{sub CP+} is different from zero with a significance of 3.6 standardmore » deviations, constituting evidence for direct CP violation. We also measure the ratios of the charged-averaged B partial decay rates in CP and non-CP decays, R{sub CP+}=1.18{+-}0.09{+-}0.05 and R{sub CP-}=1.07{+-}0.08{+-}0.04. We infer frequentist confidence intervals for the angle {gamma} of the unitarity triangle, for the strong phase difference {delta}{sub B}, and for the amplitude ratio r{sub B}, which are related to the B{sup -}{yields}DK{sup -} decay amplitude by r{sub B}e{sup i({delta}{sub B}-{gamma})}=A(B{sup -}{yields}D{sup 0}K{sup -})/A(B{sup -}{yields}D{sup 0}K{sup -}). Including statistical and systematic uncertainties, we obtain 0.24

Systematic CpT (ApG) depletion and CpG excess are unique genomic signatures of large DNA viruses infecting invertebrates.

PubMed

Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

2014-01-01

Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts.

Systematic CpT (ApG) Depletion and CpG Excess Are Unique Genomic Signatures of Large DNA Viruses Infecting Invertebrates

PubMed Central

Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

2014-01-01

Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts. PMID:25369195

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Syntheses, structures and redox properties of some complexes containing the Os(dppe)Cp* fragment, including [{Os(dppe)Cp*}2(mu-C triple bondCC triple bond C)].

PubMed

Bruce, Michael I; Costuas, Karine; Davin, Thomas; Halet, Jean-François; Kramarczuk, Kathy A; Low, Paul J; Nicholson, Brian K; Perkins, Gary J; Roberts, Rachel L; Skelton, Brian W; Smith, Mark E; White, Allan H

2007-12-14

The sequential conversion of [OsBr(cod)Cp*] (9) to [OsBr(dppe)Cp*] (10), [Os([=C=CH2)(dppe)Cp*]PF6 ([11]PF6), [Os(C triple bond CH)(dppe)Cp*] (12), [{Os(dppe)Cp*}2{mu-(=C=CH-CH=C=)}][PF6]2 ([13](PF6)2) and finally [{Os(dppe)Cp*}(2)(mu-C triple bond CC triple bond C)] (14) has been used to make the third member of the triad [{M(dppe)Cp*}2(mu-C triple bond CC triple bond C)] (M = Fe, Ru, Os). The molecular structures of []PF6, 12 and 14, together with those of the related osmium complexes [Os(NCMe)(dppe)Cp*]PF6 ([15]PF6) and [Os(C triple bond CPh)(dppe)Cp*] (16), have been determined by single-crystal X-ray diffraction studies. Comparison of the redox properties of 14 with those of its iron and ruthenium congeners shows that the first oxidation potential E1 varies as: Fe approximately Os < Ru. Whereas the Fe complex has been shown to undergo three sequential 1-electron oxidation processes within conventional electrochemical solvent windows, the Ru and Os compounds undergo no fewer than four sequential oxidation events giving rise to a five-membered series of redox related complexes [{M(dppe)Cp*}2(mu-C4)]n+ (n = 0, 1, 2, 3 and 4), the osmium derivatives being obtained at considerably lower potentials than the ruthenium analogues. These results are complimented by DFT and DT DFT calculations.

Characterization of bacteriophages Cp1 and Cp2, the strain-typing agents for Xanthomonas axonopodis pv. citri.

PubMed

Ahmad, Abdelmonim Ali; Ogawa, Megumi; Kawasaki, Takeru; Fujie, Makoto; Yamada, Takashi

2014-01-01

The strains of Xanthomonas axonopodis pv. citri, the causative agent of citrus canker, are historically classified based on bacteriophage (phage) sensitivity. Nearly all X. axonopodis pv. citri strains isolated from different regions in Japan are lysed by either phage Cp1 or Cp2; Cp1-sensitive (Cp1(s)) strains have been observed to be resistant to Cp2 (Cp2(r)) and vice versa. In this study, genomic and molecular characterization was performed for the typing agents Cp1 and Cp2. Morphologically, Cp1 belongs to the Siphoviridae. Genomic analysis revealed that its genome comprises 43,870-bp double-stranded DNA (dsDNA), with 10-bp 3'-extruding cohesive ends, and contains 48 open reading frames. The genomic organization was similar to that of Xanthomonas phage phiL7, but it lacked a group I intron in the DNA polymerase gene. Cp2 resembles morphologically Escherichia coli T7-like phages of Podoviridae. The 42,963-bp linear dsDNA genome of Cp2 contained terminal repeats. The Cp2 genomic sequence has 40 open reading frames, many of which did not show detectable homologs in the current databases. By proteomic analysis, a gene cluster encoding structural proteins corresponding to the class III module of T7-like phages was identified on the Cp2 genome. Therefore, Cp1 and Cp2 were found to belong to completely different virus groups. In addition, we found that Cp1 and Cp2 use different molecules on the host cell surface as phage receptors and that host selection of X. axonopodis pv. citri strains by Cp1 and Cp2 is not determined at the initial stage by binding to receptors.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

Sigma decomposition: the CP-odd Lagrangian

NASA Astrophysics Data System (ADS)

Hierro, I. M.; Merlo, L.; Rigolin, S.

2016-04-01

In Alonso et al., JHEP 12 (2014) 034, the CP-even sector of the effective chiral Lagrangian for a generic composite Higgs model with a symmetric coset has been constructed, up to four momenta. In this paper, the CP-odd couplings are studied within the same context. If only the Standard Model bosonic sources of custodial symmetry breaking are considered, then at most six independent operators form a basis. One of them is the weak- θ term linked to non-perturbative sources of CP violation, while the others describe CP-odd perturbative couplings between the Standard Model gauge bosons and an Higgs-like scalar belonging to the Goldstone boson sector. The procedure is then applied to three distinct exemplifying frameworks: the original SU(5)/SO(5) Georgi-Kaplan model, the minimal custodial-preserving SO(5)/SO(4) model and the minimal SU(3)/(SU(2) × U(1)) model, which intrinsically breaks custodial symmetry. Moreover, the projection of the high-energy electroweak effective theory to the low-energy chiral effective Lagrangian for a dynamical Higgs is performed, uncovering strong relations between the operator coefficients and pinpointing the differences with the elementary Higgs scenario.

Leveraging model-based study designs and serial micro-sampling techniques to understand the oral pharmacokinetics of the potent LTB4 inhibitor, CP-105696, for mouse pharmacology studies.

PubMed

Spilker, Mary E; Chung, Heekyung; Visswanathan, Ravi; Bagrodia, Shubha; Gernhardt, Steven; Fantin, Valeria R; Ellies, Lesley G

2017-07-01

1. Leukotriene B4 (LTB4) is a proinflammatory mediator important in the progression of a number of inflammatory diseases. Preclinical models can explore the role of LTB4 in pathophysiology using tool compounds, such as CP-105696, that modulate its activity. To support preclinical pharmacology studies, micro-sampling techniques and mathematical modeling were used to determine the pharmacokinetics of CP-105696 in mice within the context of systemic inflammation induced by a high-fat diet (HFD). 2. Following oral administration of doses > 35 mg/kg, CP-105696 kinetics can be described by a one-compartment model with first order absorption. The compound's half-life is 44-62 h with an apparent volume of distribution of 0.51-0.72 L/kg. Exposures in animals fed an HFD are within 2-fold of those fed a normal chow diet. Daily dosing at 100 mg/kg was not tolerated and resulted in a >20% weight loss in the mice. 3. CP-105696's long half-life has the potential to support a twice weekly dosing schedule. Given that most chronic inflammatory diseases will require long-term therapies, these results are useful in determining the optimal dosing schedules for preclinical studies using CP-105696.

First Observation of CP Violation in B[over ¯]^{0}→D_{CP}^{(*)}h^{0} Decays by a Combined Time-Dependent Analysis of BABAR and Belle Data.

PubMed

Abdesselam, A; Adachi, I; Adametz, A; Adye, T; Ahmed, H; Aihara, H; Akar, S; Alam, M S; Albert, J; Al Said, S; Andreassen, R; Angelini, C; Anulli, F; Arinstein, K; Arnaud, N; Asner, D M; Aston, D; Aulchenko, V; Aushev, T; Ayad, R; Babu, V; Badhrees, I; Bahinipati, S; Bakich, A M; Band, H R; Banerjee, Sw; Barberio, E; Bard, D J; Barlow, R J; Batignani, G; Beaulieu, A; Bellis, M; Ben-Haim, E; Bernard, D; Bernlochner, F U; Bettarini, S; Bettoni, D; Bevan, A J; Bhardwaj, V; Bhuyan, B; Bianchi, F; Biasini, M; Biswal, J; Blinov, V E; Bloom, P C; Bobrov, A; Bomben, M; Bondar, A; Bonneaud, G R; Bonvicini, G; Bozek, A; Bozzi, C; Bračko, M; Briand, H; Browder, T E; Brown, D N; Brown, D N; Bünger, C; Burchat, P R; Buzykaev, A R; Calabrese, R; Calcaterra, A; Calderini, G; Carpinelli, M; Cartaro, C; Casarosa, G; Cenci, R; Červenkov, D; Chang, P; Chao, D S; Chauveau, J; Cheaib, R; Chekelian, V; Chen, A; Chen, C; Cheng, C H; Cheon, B G; Chilikin, K; Chistov, R; Cho, K; Chobanova, V; Choi, H H F; Choi, S-K; Chrzaszcz, M; Cibinetto, G; Cinabro, D; Cochran, J; Coleman, J P; Contri, R; Convery, M R; Cowan, G; Cowan, R; Cremaldi, L; Dalseno, J; Dasu, S; Davier, M; Davis, C L; De Mori, F; De Nardo, G; Denig, A G; Derkach, D; de Sangro, R; Dey, B; Di Lodovico, F; Dingfelder, J; Dittrich, S; Doležal, Z; Dorfan, J; Drásal, Z; Drutskoy, A; Druzhinin, V P; Dubois-Felsmann, G P; Dunwoodie, W; Dutta, D; Ebert, M; Echenard, B; Eidelman, S; Eigen, G; Eisner, A M; Emery, S; Ernst, J A; Faccini, R; Farhat, H; Fast, J E; Feindt, M; Ferber, T; Ferrarotto, F; Ferroni, F; Field, R C; Filippi, A; Finocchiaro, G; Fioravanti, E; Flood, K T; Ford, W T; Forti, F; Franco Sevilla, M; Fritsch, M; Fry, J R; Fulsom, B G; Gabathuler, E; Gabyshev, N; Gamba, D; Garmash, A; Gary, J W; Garzia, I; Gaspero, M; Gaur, V; Gaz, A; Gershon, T J; Getzkow, D; Gillard, R; Li Gioi, L; Giorgi, M A; Glattauer, R; Godang, R; Goh, Y M; Goldenzweig, P; Golob, B; Golubev, V B; Gorodeisky, R; Gradl, W; Graham, M T; Grauges, E; Griessinger, K; Gritsan, A V; Grosdidier, G; Grünberg, O; Guttman, N; Haba, J; Hafner, A; Hamilton, B; Hara, T; Harrison, P F; Hast, C; Hayasaka, K; Hayashii, H; Hearty, C; He, X H; Hess, M; Hitlin, D G; Hong, T M; Honscheid, K; Hou, W-S; Hsiung, Y B; Huard, Z; Hutchcroft, D E; Iijima, T; Inguglia, G; Innes, W R; Ishikawa, A; Itoh, R; Iwasaki, Y; Izen, J M; Jaegle, I; Jawahery, A; Jessop, C P; Joffe, D; Joo, K K; Julius, T; Kang, K H; Kass, R; Kawasaki, T; Kerth, L T; Khan, A; Kiesling, C; Kim, D Y; Kim, J B; Kim, J H; Kim, K T; Kim, P; Kim, S H; Kim, Y J; King, G J; Kinoshita, K; Ko, B R; Koch, H; Kodyš, P; Kolomensky, Yu G; Korpar, S; Kovalskyi, D; Kowalewski, R; Kravchenko, E A; Križan, P; Krokovny, P; Kuhr, T; Kumar, R; Kuzmin, A; Kwon, Y-J; Lacker, H M; Lafferty, G D; Lanceri, L; Lange, D J; Lankford, A J; Latham, T E; Leddig, T; Le Diberder, F; Lee, D H; Lee, I S; Lee, M J; Lees, J P; Leith, D W G S; Leruste, Ph; Lewczuk, M J; Lewis, P; Libby, J; Lockman, W S; Long, O; Lopes Pegna, D; LoSecco, J M; Lou, X C; Lueck, T; Luitz, S; Lukin, P; Luppi, E; Lusiani, A; Luth, V; Lutz, A M; Lynch, G; MacFarlane, D B; Malaescu, B; Mallik, U; Manoni, E; Marchiori, G; Margoni, M; Martellotti, S; Martinez-Vidal, F; Masuda, M; Mattison, T S; Matvienko, D; McKenna, J A; Meadows, B T; Miyabayashi, K; Miyashita, T S; Miyata, H; Mizuk, R; Mohanty, G B; Moll, A; Monge, M R; Moon, H K; Morandin, M; Muller, D R; Mussa, R; Nakano, E; Nakazawa, H; Nakao, M; Nanut, T; Nayak, M; Neal, H; Neri, N; Nisar, N K; Nishida, S; Nugent, I M; Oberhof, B; Ocariz, J; Ogawa, S; Okuno, S; Olaiya, E O; Olsen, J; Ongmongkolkul, P; Onorato, G; Onuchin, A P; Onuki, Y; Ostrowicz, W; Oyanguren, A; Pakhlova, G; Pakhlov, P; Palano, A; Pal, B; Palombo, F; Pan, Y; Panduro Vazquez, W; Paoloni, E; Park, C W; Park, H; Passaggio, S; Patel, P M; Patrignani, C; Patteri, P; Payne, D J; Pedlar, T K; Peimer, D R; Peruzzi, I M; Pesántez, L; Pestotnik, R; Petrič, M; Piccolo, M; Piemontese, L; Piilonen, L E; Pilloni, A; Piredda, G; Playfer, S; Poireau, V; Porter, F C; Posocco, M; Prasad, V; Prell, S; Prepost, R; Puccio, E M T; Pulliam, T; Purohit, M V; Pushpawela, B G; Rama, M; Randle-Conde, A; Ratcliff, B N; Raven, G; Ribežl, E; Richman, J D; Ritchie, J L; Rizzo, G; Roberts, D A; Robertson, S H; Röhrken, M; Roney, J M; Roodman, A; Rossi, A; Rostomyan, A; Rotondo, M; Roudeau, P; Sacco, R; Sakai, Y; Sandilya, S; Santelj, L; Santoro, V; Sanuki, T; Sato, Y; Savinov, V; Schindler, R H; Schneider, O; Schnell, G; Schroeder, T; Schubert, K R; Schumm, B A; Schwanda, C; Schwartz, A J; Schwitters, R F; Sciacca, C; Seiden, A; Sekula, S J; Senyo, K; Seon, O; Serednyakov, S I; Sevior, M E; Shapkin, M; Shebalin, V; Shen, C P; Shibata, T-A; Shiu, J-G; Simard, M; Simi, G; Simon, F; Simonetto, F; Skovpen, Yu I; Smith, A J S; Smith, J G; Snyder, A; So, R Y; Sobie, R J; Soffer, A; Sohn, Y-S; Sokoloff, M D; Sokolov, A; Solodov, E P; Solovieva, E; Spaan, B; Spanier, S M; Starič, M; Stocchi, A; Stroili, R; Stugu, B; Su, D; Sullivan, M K; Sumihama, M; Sumisawa, K; Sumiyoshi, T; Summers, D J; Sun, L; Tamponi, U; Taras, P; Tasneem, N; Teramoto, Y; Tisserand, V; Todyshev, K Yu; Toki, W H; Touramanis, C; Trabelsi, K; Tsuboyama, T; Uchida, M; Uglov, T; Unno, Y; Uno, S; Usov, Y; Uwer, U; Vahsen, S E; Van Hulse, C; Vanhoefer, P; Varner, G; Vasseur, G; Va'vra, J; Verderi, M; Vinokurova, A; Vitale, L; Vorobyev, V; Voß, C; Wagner, M N; Wagner, S R; Waldi, R; Walsh, J J; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; West, C A; Williams, K M; Wilson, F F; Wilson, J R; Wisniewski, W J; Won, E; Wormser, G; Wright, D M; Wu, S L; Wulsin, H W; Yamamoto, H; Yamaoka, J; Yashchenko, S; Yuan, C Z; Yusa, Y; Zallo, A; Zhang, C C; Zhang, Z P; Zhilich, V; Zhulanov, V; Zupanc, A

2015-09-18

We report a measurement of the time-dependent CP asymmetry of B[over ¯]^{0}→D_{CP}^{(*)}h^{0} decays, where the light neutral hadron h^{0} is a π^{0}, η, or ω meson, and the neutral D meson is reconstructed in the CP eigenstates K^{+}K^{-}, K_{S}^{0}π^{0}, or K_{S}^{0}ω. The measurement is performed combining the final data samples collected at the ϒ(4S) resonance by the BABAR and Belle experiments at the asymmetric-energy B factories PEP-II at SLAC and KEKB at KEK, respectively. The data samples contain (471±3)×10^{6} BB[over ¯] pairs recorded by the BABAR detector and (772±11)×10^{6} BB[over ¯] pairs recorded by the Belle detector. We measure the CP asymmetry parameters -η_{f}S=+0.66±0.10(stat)±0.06(syst) and C=-0.02±0.07(stat)±0.03(syst). These results correspond to the first observation of CP violation in B[over ¯]^{0}→D_{CP}^{(*)}h^{0} decays. The hypothesis of no mixing-induced CP violation is excluded in these decays at the level of 5.4 standard deviations.

Oral immunization with F4 fimbriae and CpG formulated with carboxymethyl starch enhances F4-specific mucosal immune response and modulates Th1 and Th2 cytokines in weaned pigs.

PubMed

Delisle, Benjamin; Calinescu, Carmen; Mateescu, Mircea Alexandru; Fairbrother, John Morris; Nadeau, Éric

2012-01-01

F4 fimbriae are a potential candidate for an oral subunit vaccine for prevention of post-weaning diarrhea in swine due to infection with F4-positive enterotoxigenic Escherichia coli. However, large quantities of F4 fimbriae are required to induce a specific antibody response. The aim of the present study was to evaluate the effect of supplementation of F4 fimbriae with Cytosine-phosphate-Guanosine-oligodeoxynucleotide (CpG-A D19) or with complete cholera toxin (CT) as adjuvants on the F4-specific antibody response and cytokine production in weaned pigs following oral administration of F4 fimbrial antigen formulated with Carboxymethyl Starch (CMS). Oral dosage forms of F4 fimbriae alone or supplemented with CpG-A D19 or with CT were formulated with CMS as monolithic tablets, obtained by direct compression, and administered to weaned pigs. Blood and faecal samples were collected to determine the systemic and mucosal immune status of animals at various times until necropsy. During necropsy, contents of the jejunum and ileum were collected for determination of mucosal F4 specific antibodies. Segments of jejunum and ileum were also used to measure mRNA cytokine production. The presence of CpG in the formulation of the fimbriae significantly increased F4-specific immunoglobulin (Ig) IgM and IgG levels in intestinal secretions, and enhanced Th1 (Interferon-gamma / IFN-γ, Tumour Necrosis Factor-alpha / TNF-α, Interleukin-12p40 / IL-12p40, IL-1β) and Th2 (IL-4, IL-6) cytokine production in intestinal tissues. Supplementation with CT did not result in induction of F4-specific antibodies in secretions, although a significant Th1 response (IFN-α, IFN-γ, IL-18) was detected in tissues. Neither F4-specific systemic antibodies, nor intestinally secreted IgA were detected throughout the immunization trial for all groups. CpG-A D19 appeared to be a promising adjuvant for an oral F4 subunit vaccine formulated with CMS excipient as monolithic tablets. This matrix afforded gastro

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

On the Nature of CP Pup

NASA Technical Reports Server (NTRS)

Mason, E.; Orio, M.; Mukai, K.; Bianchini, A.; deMartino, D.; diMille, F.; Williams, R. E.

2013-01-01

We present new X-ray and optical spectra of the old nova CP Pup (nova Pup 1942) obtained with Chandra and the CTIO 4m telescope. The X-ray spectrum reveals a multi-temperature optically thin plasma reaching a maximum temperature of 36+19 keV 16 absorbed by local complex neutral material. The time resolved optical spectroscopy confirms the presence of the 1.47 hr period, with cycle-to-cycle amplitude changes, as well as of an additional long term modulation which is suggestive either of a longer pe- riod or of non-Keplerian velocities in the emission line regions. These new observational facts add further support to CP Pup as a magnetic cataclysmic variable (mCV). We compare the mCV and the non-mCV scenarios and while we cannot conclude whether CP Pup is a long period system, all observational evidences point at an intermediate polar (IP) type CV.

CT-1-CP-induced ventricular electrical remodeling in mice.

PubMed

Chen, Shu-fen; Wei, Tao-zhi; Rao, Li-ya; Xu, Ming-guang; Dong, Zhan-ling

2015-02-01

The chronic effects of carboxyl-terminal polypeptide of Cardiotrophin-1 (CT-1-CP) on ventricular electrical remodeling were investigated. CT-1-CP, which contains 16 amino acids in sequence of the C-terminal of Cardiotrophin-1, was selected and synthesized, and then administered to Kunming mice (aged 5 weeks) by intraperitoneal injection (500 ng·g⁻¹·day⁻¹) (4 groups, n=10 and female: male=1:1 in each group) for 1, 2, 3 and 4 weeks, respectively. The control group (n=10, female: male=1:1) was injected by physiological saline for 4 weeks. The epicardial monophasic action potential (MAP) was recorded by using a contact-type MAP electrode placed vertically on the left ventricular (LV) epicardium surface, and the electrocardiogram (ECG) signal in lead II was monitored synchronously. ECG intervals (RR, PR, QRS and QT) and the amplitude of MAP (Am), the maximum upstroke velocity (Vmax), as well as action potential durations (APDs) at different repolarization levels (APD30, APD50, APD70, and APD90) of MAP were determined and analyzed in detail. There were no significant differences in RR and P intervals between CT-1-CP-treated groups and control group, but the PR segment and the QRS complex were greater in the former than in the latter (F=2.681 and 5.462 respectively, P<0.05). Though QT interval and the corrected QT interval (QTc) were shorter in CT-1-CP-treated groups than in control group, the QT dispersion (QTd) of them was greater in the latter than in the former (F=3.090, P<0.05) and increased with the time. The ECG monitoring synchronously with the MAP showed that the compression of MAP electrode on the left ventricular epicardium induced performance similar to myocardium ischemia. As compared with those before chest-opening, the PR segment and QT intervals remained basically unchanged in control group, but prolonged significantly in all CT-1-CP-treated groups and the prolongation of QT intervals increased gradually along with the time of exposure to CT-1-CP

CpG island methylator phenotype in colorectal cancer

PubMed Central

Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

1999-01-01

Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

Collaborative trial validation studies of real-time PCR-based GMO screening methods for detection of the bar gene and the ctp2-cp4epsps construct.

PubMed

Grohmann, Lutz; Brünen-Nieweler, Claudia; Nemeth, Anne; Waiblinger, Hans-Ulrich

2009-10-14

Polymerase Chain Reaction (PCR)-based screening methods targeting genetic elements commonly used in genetically modified (GM) plants are important tools for the detection of GM materials in food, feed, and seed samples. To expand and harmonize the screening capability of enforcement laboratories, the German Federal Office of Consumer Protection and Food Safety conducted collaborative trials for interlaboratory validation of real-time PCR methods for detection of the phosphinothricin acetyltransferase (bar) gene from Streptomyces hygroscopicus and a construct containing the 5-enolpyruvylshikimate-3-phosphate synthase gene from Agrobacterium tumefaciens sp. strain CP4 (ctp2-cp4epsps), respectively. To assess the limit of detection, precision, and accuracy of the methods, laboratories had to analyze two sets of 18 coded genomic DNA samples of events LLRice62 and MS8 with the bar method and NK603 and GT73 with the ctp2-cp4epsps method at analyte levels of 0, 0.02, and 0.1% GM content, respectively. In addition, standard DNAs were provided to the laboratories to generate calibration curves for copy number quantification of the bar and ctp2-cp4epsps target sequences present in the test samples. The study design and the results obtained are discussed with respect to the difficult issue of developing general guidelines and concepts for the collaborative trial validation of qualitative PCR screening methods.

Search for CP violation in hyperon decays

NASA Astrophysics Data System (ADS)

Zyla, Piotr; Chan, A.; Chen, Y. C.; Ho, C.; Teng, P. K.; Choong, W. S.; Gidal, G.; Fu, Y.; Gu, P.; Jones, T.; Luk, K. B.; Turko, B.; Zyla, P.; James, C.; Volk, J.; Felix, J.; Burnstein, R. A.; Chakrovorty, A.; Kaplan, D. M.; Lederman, L. M.; Luebke, W.; Rajaram, D.; Rubin, H. A.; Solomey, N.; Torun, Y.; White, C. G.; White, S. L.; Leros, N.; Perroud, J. P.; Gustafson, H. R.; Longo, M. J.; Lopez, F.; Park, H. K.; Clark, K.; Jenkins, M.; Dukes, E. C.; Durandet, C.; Holmstrom, T.; Huang, M.; Lu, L.; Nelson, K. S.

2003-02-01

Direct CP violation in nonleptonic hyperon decays can be established by comparing the decays of hyperons and anti-hyperons. For Ξ decay to Λπ followed by Λ to pπ, the proton distribution in the rest frame of Lambda is governed by the product of the decay parameters αΞαΛ. The asymmetry ΛΞΛ, proportional to the difference of αΞαΛ of the hyperon and anti-hyperon decays, vanishes if CP is conserved. We report on an analysis of a fraction of 1997 and 1999 data collected by the HyperCP (E871) collaboration during the fixed-target runs at Fermilab. The preliminary measurement of the assymmetry is AΞΛ = [-7±12(stat)±6.2(sys)] × 10 -4, an order of magnitude better than the present limit.

Kinetics and Mechanism of the Hydrogenation of CpCr(CO)3•/[CpCr(CO)3]2 Equilibrium to CpCr(CO)3H

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norton, Jack R.; Spataru, Tudor; Camaioni, Donald M.

2014-05-26

The kinetics of the hydrogenation of 2 CpCr(CO)3•/[CpCr(CO)3]2 to CpCr(CO)3H has been investigated. The reaction is second-order in Cr and first-order in H2, with a rate constant of 45 M 2s 1 at 25 °C in benzene. DFT calculations rule out an H2 complex as an intermediate, and suggest (a) end-on approach of H2 to one Cr of [CpCr(CO)3]2 as the Cr-Cr bond undergoes heterolytic cleavage, (b) heterolytic cleavage of the coordinated H2 between O and Cr, and (c) isomerization of the resulting O-protonated CpCr(CO)2(COH) to CpCr(CO)3H. The work at Pacific Northwest National Laboratory (PNNL) was supported by the U.S.more » Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences and Biosciences; Battelle operates PNNL for DOE.« less

CP violating scalar Dark Matter

NASA Astrophysics Data System (ADS)

Cordero-Cid, A.; Hernández-Sánchez, J.; Keus, V.; King, S. F.; Moretti, S.; Rojas, D.; Sokołowska, D.

2016-12-01

We study an extension of the Standard Model (SM) in which two copies of the SM scalar SU(2) doublet which do not acquire a Vacuum Expectation Value (VEV), and hence are inert, are added to the scalar sector. We allow for CP-violation in the inert sector, where the lightest inert state is protected from decaying to SM particles through the conservation of a Z 2 symmetry. The lightest neutral particle from the inert sector, which has a mixed CP-charge due to CP-violation, is hence a Dark Matter (DM) candidate. We discuss the new regions of DM relic density opened up by CP-violation, and compare our results to the CP-conserving limit and the Inert Doublet Model (IDM). We constrain the parameter space of the CP-violating model using recent results from the Large Hadron Collider (LHC) and DM direct and indirect detection experiments.

Development and application of co-culture for ethanol production by co-fermentation of glucose and xylose: a systematic review.

PubMed

Chen, Yanli

2011-05-01

This article reviews current co-culture systems for fermenting mixtures of glucose and xylose to ethanol. Thirty-five co-culture systems that ferment either synthetic glucose and xylose mixture or various biomass hydrolysates are examined. Strain combinations, fermentation modes and conditions, and fermentation performance for these co-culture systems are compared and discussed. It is noted that the combination of Pichia stipitis with Saccharomyces cerevisiae or its respiratory-deficient mutant is most commonly used. One of the best results for fermentation of glucose and xylose mixture is achieved by using co-culture of immobilized Zymomonas mobilis and free cells of P. stipitis, giving volumetric ethanol production of 1.277 g/l/h and ethanol yield of 0.49-0.50 g/g. The review discloses that, as a strategy for efficient conversion of glucose and xylose, co-culture fermentation for ethanol production from lignocellulosic biomass can increase ethanol yield and production rate, shorten fermentation time, and reduce process costs, and it is a promising technology although immature.

Bacterial supersystem for alginate import/metabolism and its environmental and bioenergy applications.

PubMed

Hashimoto, Wataru; Kawai, Shigeyuki; Murata, Kousaku

2010-01-01

Distinct from most alginate-assimilating bacteria that secrete polysaccharide lyases extracellularly, a gram-negative bacterium, Sphingomonas sp. A1 (strain A1), can directly incorporate alginate into its cytoplasm, without degradation, through a "superchannel" consisting of a mouth-like pit on the cell surface, periplasmic binding proteins, and a cytoplasmic membrane-bound ATP-binding cassette transporter. Flagellin homologues function as cell surface alginate receptors essential for expressing the superchannel. Cytoplasmic alginate lyases with different substrate specificities and action modes degrade the polysaccharide to its constituent monosaccharides. The resultant monosaccharides, α-keto acids, are converted to a reduced form by NADPH-dependent reductase, and are finally metabolized in the TCA cycle. Transplantation of the strain A1 superchannel to xenobiotic-degrading sphingomonads enhances bioremediation through the propagation of bacteria with an elevated transport activity. Furthermore, strain A1 cells transformed with Zymomonas mobilis genes for pyruvate decarboxylase and alcohol dehydrogenase II produce considerable amounts of biofuel ethanol from alginate when grown statically. © 2010 Landes Bioscience

Single-species microbial biofilm screening for industrial applications.

PubMed

Li, Xuan Zhong; Hauer, Bernhard; Rosche, Bettina

2007-10-01

While natural microbial biofilms often consist of multiple species, single-species biofilms are of great interest to biotechnology. The current study evaluates biofilm formation for common industrial and laboratory microorganisms. A total of 68 species of biosafety level one bacteria and yeasts from over 40 different genera and five phyla were screened by growing them in microtiter plates and estimating attached biomass by crystal violet staining. Most organisms showed biofilm formation on surfaces of polystyrene within 24 h. By changing a few simple conditions such as substratum characteristics, inoculum and nutrient availability, 66 strains (97%) demonstrated biofilm formation under at least one of the experimental conditions and over half of these strains were classified as strong biofilm formers, potentially suitable as catalysts in biofilm applications. Many non-motile bacteria were also strong biofilm formers. Biofilm morphologies were visualized for selected strains. A model organism, Zymomonas mobilis, easily established itself as a biofilm on various reactor packing materials, including stainless steel.

Simultaneous consumption of pentose and hexose sugars: an optimal microbial phenotype for efficient fermentation of lignocellulosic biomass.

PubMed

Kim, Jae-Han; Block, David E; Mills, David A

2010-11-01

Lignocellulosic biomass is an attractive carbon source for bio-based fuel and chemical production; however, its compositional heterogeneity hinders its commercial use. Since most microbes possess carbon catabolite repression (CCR), mixed sugars derived from the lignocellulose are consumed sequentially, reducing the efficacy of the overall process. To overcome this barrier, microbes that exhibit the simultaneous consumption of mixed sugars have been isolated and/or developed and evaluated for the lignocellulosic biomass utilization. Specific strains of Escherichia coli, Saccharomyces cerevisiae, and Zymomonas mobilis have been engineered for simultaneous glucose and xylose utilization via mutagenesis or introduction of a xylose metabolic pathway. Other microbes, such as Lactobacillus brevis, Lactobacillus buchneri, and Candida shehatae possess a relaxed CCR mechanism, showing simultaneous consumption of glucose and xylose. By exploiting CCR-negative phenotypes, various integrated processes have been developed that incorporate both enzyme hydrolysis of lignocellulosic material and mixed sugar fermentation, thereby enabling greater productivity and fermentation efficacy.

Conceptual design of cost-effective and environmentally-friendly configurations for fuel ethanol production from sugarcane by knowledge-based process synthesis.

PubMed

Sánchez, Óscar J; Cardona, Carlos A

2012-01-01

In this work, the hierarchical decomposition methodology was used to conceptually design the production of fuel ethanol from sugarcane. The decomposition of the process into six levels of analysis was carried out. Several options of technological configurations were assessed in each level considering economic and environmental criteria. The most promising alternatives were chosen rejecting the ones with a least favorable performance. Aspen Plus was employed for simulation of each one of the technological configurations studied. Aspen Icarus was used for economic evaluation of each configuration, and WAR algorithm was utilized for calculation of the environmental criterion. The results obtained showed that the most suitable synthesized flowsheet involves the continuous cultivation of Zymomonas mobilis with cane juice as substrate and including cell recycling and the ethanol dehydration by molecular sieves. The proposed strategy demonstrated to be a powerful tool for conceptual design of biotechnological processes considering both techno-economic and environmental indicators. Copyright © 2011 Elsevier Ltd. All rights reserved.

De novo Biosynthesis of Biodiesel by Escherichia coli in Optimized Fed-Batch Cultivation

PubMed Central

Cai, Ke; Tan, Xiaoming; Lu, Xuefeng

2011-01-01

Biodiesel is a renewable alternative to petroleum diesel fuel that can contribute to carbon dioxide emission reduction and energy supply. Biodiesel is composed of fatty acid alkyl esters, including fatty acid methyl esters (FAMEs) and fatty acid ethyl esters (FAEEs), and is currently produced through the transesterification reaction of methanol (or ethanol) and triacylglycerols (TAGs). TAGs are mainly obtained from oilseed plants and microalgae. A sustainable supply of TAGs is a major bottleneck for current biodiesel production. Here we report the de novo biosynthesis of FAEEs from glucose, which can be derived from lignocellulosic biomass, in genetically engineered Escherichia coli by introduction of the ethanol-producing pathway from Zymomonas mobilis, genetic manipulation to increase the pool of fatty acyl-CoA, and heterologous expression of acyl-coenzyme A: diacylglycerol acyltransferase from Acinetobacter baylyi. An optimized fed-batch microbial fermentation of the modified E. coli strain yielded a titer of 922 mg L−1 FAEEs that consisted primarily of ethyl palmitate, -oleate, -myristate and -palmitoleate. PMID:21629774

Simultaneous saccharification of inulin and starch using commercial glucoamylase and the subsequent bioconversion to high titer sorbitol and gluconic acid.

PubMed

An, Kehong; Hu, Fengxian; Bao, Jie

2013-12-01

A new bioprocess for production of sorbitol and gluconic acid from two low-cost feedstocks, inulin and cassava starch, using a commercially available enzyme was proposed in this study. The commercial glucoamylase GA-L NEW from Genencor was found to demonstrate a high inulinase activity for hydrolysis of inulin into fructose and glucose. The glucoamylase was used to replace the expensive and not commercially available inulinase enzyme for simultaneous saccharification of inulin and starch into high titer glucose and fructose hydrolysate. The glucose and fructose in the hydrolysate were converted into sorbitol and gluconic acid using immobilized whole cells of the recombinant Zymomonas mobilis strain. The high gluconic acid concentration of 193 g/L and sorbitol concentration of 180 g/L with the overall yield of 97.3 % were obtained in the batch operations. The present study provided a practical production method of sorbitol and gluconic acid from low cost feedstocks and enzymes.

[Optimization of fuel ethanol production from kitchen waste by Plackett-Burman design].

PubMed

Ma, Hong-Zhi; Gong, Li-Juan; Wang, Qun-Hui; Zhang, Wen-Yu; Xu, Wen-Long

2008-05-01

Kitchen garbage was chosen to produce ethanol through simultaneous saccharification and fermentation (SSF) by Zymomonas mobilis. Plackett-Burman design was employed to screen affecting parameters during SSF process. The parameters were divided into two parts, enzymes and nutritions. None of the nutritions added showed significant effect during the experiment, which demonstrated that the kitchen garbage could meet the requirement of the microorganism without extra supplementation. Protease and glucoamylase were determined to be affecting factors for ethanol production. Single factor experiment showed that the optimum usage of these two enzymes were both 100 U/g and the corresponding maximum ethanol was determined to be 53 g/L. The ethanol yield could be as high as 44%. The utilization of kitchen garbage to produce ethanol could reduce threaten of waste as well as improve the protein content of the spent. This method could save the ethanol production cost and benefit for the recycle of kitchen garbage.

Simultaneous consumption of pentose and hexose sugars: an optimal microbial phenotype for efficient fermentation of lignocellulosic biomass

PubMed Central

Kim, Jae-Han; Block, David E.

2010-01-01

Lignocellulosic biomass is an attractive carbon source for bio-based fuel and chemical production; however, its compositional heterogeneity hinders its commercial use. Since most microbes possess carbon catabolite repression (CCR), mixed sugars derived from the lignocellulose are consumed sequentially, reducing the efficacy of the overall process. To overcome this barrier, microbes that exhibit the simultaneous consumption of mixed sugars have been isolated and/or developed and evaluated for the lignocellulosic biomass utilization. Specific strains of Escherichia coli, Saccharomyces cerevisiae, and Zymomonas mobilis have been engineered for simultaneous glucose and xylose utilization via mutagenesis or introduction of a xylose metabolic pathway. Other microbes, such as Lactobacillus brevis, Lactobacillus buchneri, and Candida shehatae possess a relaxed CCR mechanism, showing simultaneous consumption of glucose and xylose. By exploiting CCR-negative phenotypes, various integrated processes have been developed that incorporate both enzyme hydrolysis of lignocellulosic material and mixed sugar fermentation, thereby enabling greater productivity and fermentation efficacy. PMID:20838789

Accounting for all sugars produced during integrated production of ethanol from lignocellulosic biomass.

PubMed

Schell, Daniel J; Dowe, Nancy; Chapeaux, Alexandre; Nelson, Robert S; Jennings, Edward W

2016-04-01

Accurate mass balance and conversion data from integrated operation is needed to fully elucidate the economics of biofuel production processes. This study explored integrated conversion of corn stover to ethanol and highlights techniques for accurate yield calculations. Acid pretreated corn stover (PCS) produced in a pilot-scale reactor was enzymatically hydrolyzed and the resulting sugars were fermented to ethanol by the glucose-xylose fermenting bacteria, Zymomonas mobilis 8b. The calculations presented here account for high solids operation and oligomeric sugars produced during pretreatment, enzymatic hydrolysis, and fermentation, which, if not accounted for, leads to overestimating ethanol yields. The calculations are illustrated for enzymatic hydrolysis and fermentation of PCS at 17.5% and 20.0% total solids achieving 80.1% and 77.9% conversion of cellulose and xylan to ethanol and ethanol titers of 63g/L and 69g/L, respectively. These procedures will be employed in the future and the resulting information used for techno-economic analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Grain Refinement and Mechanical Properties of Cu–Cr–Zr Alloys with Different Nano-Sized TiCp Addition

PubMed Central

Zhang, Dongdong; Bai, Fang; Wang, Yong; Wang, Jinguo; Wang, Wenquan

2017-01-01

The TiCp/Cu master alloy was prepared via thermal explosion reaction. Afterwards, the nano-sized TiCp/Cu master alloy was dispersed by electromagnetic stirring casting into the melting Cu–Cr–Zr alloys to fabricate the nano-sized TiCp-reinforced Cu–Cr–Zr composites. Results show that nano-sized TiCp can effectively refine the grain size of Cu–Cr–Zr alloys. The morphologies of grain in Cu–Cr–Zr composites changed from dendritic grain to equiaxed crystal because of the addition and dispersion of nano-sized TiCp. The grain size decreased from 82 to 28 μm with the nano-sized TiCp content. Compared with Cu–Cr–Zr alloys, the ultimate compressive strength (σUCS) and yield strength (σ0.2) of 4 wt% TiCp-reinforced Cu–Cr–Zr composites increased by 6.7% and 9.4%, respectively. The wear resistance of the nano-sized TiCp-reinforced Cu–Cr–Zr composites increased with the increasing nano-sized TiCp content. The wear loss of the nano-sized TiCp-reinforced Cu–Cr–Zr composites decreased with the increasing TiCp content under abrasive particles. The eletrical conductivity of Cu–Cr–Zr alloys, 2% and 4% nano-sized TiCp-reinforced Cu–Cr–Zr composites are 64.71% IACS, 56.77% IACS and 52.93% IACS, respectively. PMID:28786937

Transgenic rice expressing a codon-modified synthetic CP4-EPSPS confers tolerance to broad-spectrum herbicide, glyphosate.

PubMed

Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla

2015-05-01

Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.

Penguin-diagram-induced CP violation in charmless exclusive hadronic B decays

NASA Astrophysics Data System (ADS)

Du, Dongsheng; Xing, Zhi-Zhong

1993-11-01

We make a detailed analysis of some charmless self-tagging B decays, e.g., B+u-->K+K¯0, K*+π0, and B0d-->K+π-, which are of great experimental interest for probing CP violation in the decay amplitude. A few neutral B decays into CP eigenstates such as B0d-->π+π- are also studied on the Υ(4S) resonance to distinguish CP violation induced by penguin loops from that via B0-dB¯0d mixing. We present a clear factorization description of partial decay rates and CP asymmetries for B-->PP, PV, and VV processes, and illustrate the rescattering effects of final-state particles on CP violation in those tree-penguin interfering channels. Our numerical estimates show that it is possible to uncover the penguin-diagram-induced CP violation in a handful of self-tagging modes if about 108-109 B events are accumulated.

Two Discrete RuCp* (Cp*=Pentamethylcyclopentadienyl) Binding Modes of N-Confused Porphyrins: Peripheral π Complex and Sitting Atop Ruthenocenophane Complex by Skeletal Transformation.

PubMed

Yamamoto, Takaaki; Mitsuno, Koki; Mori, Shigeki; Itoyama, Shuhei; Shiota, Yoshihito; Yoshizawa, Kazunari; Ishida, Masatoshi; Furuta, Hiroyuki

2018-05-07

Complexation of a RuCp* cation with N-confused tetraarylporphyrins (NCPs) forms directly bound ruthenium(II) pentamethylcyclopentadienyl (Cp*) π-complex on a specific meso-aryl group (e.g., phenyl) neighboring peripheral imino nitrogen of NCPs in high yields. In contrast, in the case of NCPs bearing bulky meso-substituents (e.g., 3,5-di-tert-butylphenyl), new ruthenocenophane-like complex embedded on an N-confused calix[4]phyrin was formed through multiple C-H bond activation of methyl groups of Cp* ligand. The mechanistic insight into the formation of the ruthenocenophane was derived from DFT calculations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The effect of mold temperature on castability of CP Ti and Ti-6Al-4V castings into phosphate bonded investment materials.

PubMed

Oliveira, Pedro César Garcia; Adabo, Gelson Luis; Ribeiro, Ricardo Faria; Rocha, Sicknan Soares

2006-12-01

The aim of this study was to evaluate the castability of CP titanium and Ti-6Al-4V alloy castings into Rematitan Plus investment at three different mold temperatures. A nylon mesh pattern (20 mm with 64 squares and wire of 0.7 mm in diameter) was used for the castability testing. Initially, an image of the wax pattern was obtained by means of a digital camera and the total extension of filaments (mm) was then measured, using the Leica Qwin image analysis system. The mesh sprued was placed in the Rematitan Plus investment material and the castings were made in a Discovery Plasma machine at three different mold temperatures: 430 degrees C (control group), 480 degrees C or 530 degrees C. Ten castings were made for each temperature. The images of the castings were analyzed (Leica Qwin) and the castability index determined by the number of the completely cast segments as a percentage of the wax pattern. Data were analyzed by two-way ANOVA and Tukey's multiple comparison test (a = 0.05) using materials and temperatures as discriminating variables. The Ti-6Al-4V alloy (60.86%) presented a better castability index than CP Ti (48.44%) (p < 0.000001). For CP Ti, the temperature of 530 degrees C (23.96%) presented better castability than at other temperatures, 480 degrees C (14.66%) and 430 degrees C (12.54%), with no difference between them (p < 0.001). For Ti-6Al-4V alloy, there was a statistically significant difference among the three temperatures: 530 degrees C (28.36%) > 480 degrees C (19.66%) > 430 degrees C (15.97%) (p < 0.002). Within the limitations of this study, the increase in the mold temperature of the Rematitan Plus investment resulted in a better castability index for both materials, and Ti-6Al-4V presented a better castability index than CP Ti.

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

The CP-PACS project

NASA Astrophysics Data System (ADS)

Iwasaki, Y.; CP-PACS Collaboration

1998-01-01

The CP-PACS project is a five year plan, which formally started in April 1992 and has been completed in March 1997, to develop a massively parallel computer for carrying out research in computational physics with primary emphasis on lattice QCD. The initial version of the CP-PACS computer with a theoretical peak speed of 307 GFLOPS with 1024 processors was completed in March 1996. The final version with a peak speed of 614 GFLOPS with 2048 processors was completed in September 1996, and has been in full operation since October 1996. We describe the architecture, the final specification, the hardware implementation, and the software of the CP-PACS computer. The CP-PACS has been used for hadron spectroscopy production runs since July 1996. The performance for lattice QCD applications and the LINPACK benchmark are given.

CP violation experiment at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsiung, Yee B.

1990-07-01

The E731 experiment at Fermilab has searched for direct'' CP violation in K{sup 0} {yields} {pi}{pi}, which is parametrized by {var epsilon}{prime}/{var epsilon}. For the first time, in 20% of the data set, all four modes of the K{sub L,S} {yields} {pi}{sup +}{pi}{sup {minus}} ({pi}{sup 0}{pi}{sup 0}) were collected simultaneously, providing a great check on the systematic uncertainty. The result is Re({var epsilon}{prime}/{var epsilon}) = {minus}0.0004 {plus minus} 0.0014 (stat) {plus minus} 0.0006(syst), which provides no evidence for direct'' CP violation. The CPT symmetry has also been tested by measuring the phase difference {Delta}{phi} = {phi}{sub 00} {minus} {phi}{sub {plusmore » minus}} between the two CP violating parameters {eta}{sub 00} and {eta}{sub {plus minus}}. We fine {Delta}{phi} = {minus}0.3{degrees} {plus minus} 2.4{degree}(stat) {plus minus} 1.2{degree}(syst). Using this together with the world average {phi}{sub {plus minus}}, we fine that the phase of the K{sup 0}-{bar K}{sup 0} mixing parameter {var epsilon} is 44.5{degree} {plus minus} 1.5{degree}. Both of these results agree well with the predictions of CPT symmetry. 17 refs., 10 figs.« less

First observation of CP violation in B¯ 0 → D (*) CP h 0 decays by a combined time-dependent analysis of BaBar And Belle Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdesselam, A.

We report a measurement of the time-dependent CP asymmetry of B¯ 0 → D (*) CPh 0 decays, where the light neutral hadron h 0 is a π 0, η, or ω meson, and the neutral D meson is reconstructed in the CP eigenstates K +K –, K 0 Sπ 0, or K 0 Sω. The measurement is performed combining the final data samples collected at the Υ(4S) resonance by the BABAR and Belle experiments at the asymmetric-energy B factories PEP-II at SLAC and KEKB at KEK, respectively. The data samples contain (471±3)×10 6 BB¯ pairs recorded by the BABARmore » detector and (772±11)×10 6 BB¯ pairs recorded by the Belle detector. We measure the CP asymmetry parameters –ηfS=+0.66±0.10(stat)±0.06(syst) and C=–0.02±0.07(stat)±0.03(syst). These results correspond to the first observation of CP violation in B¯ 0 → D (*) CPh 0 decays. As a result, the hypothesis of no mixing-induced CP violation is excluded in these decays at the level of 5.4 standard deviations.« less

Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds.

PubMed

Macfarlane, D E; Manzel, L

1998-02-01

Phosphorothioate oligodeoxynucleotides containing CpG (CpG-ODN) activate immune responses. We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231. They also inhibit IL-6 synthesis and thymidine uptake by human unfractionated PBMC induced by CpG-ODN. The compounds did not inhibit LPS-induced responses. Half-maximal inhibition required 10 nM quinacrine or 100 nM chloroquine. Inhibition was noncompetitive with respect to CpG-ODN. Quinine, quinidine, and primaquine were much less powerful. Quinacrine was effective even when added after the CpG-ODN. Near-toxic concentrations of ammonia plus bafilomycin A1 (used to inhibit vesicular acidification) did not reduce the efficacy of the quinacrine, but the effects of both quinacrine and chloroquine were enhanced by inhibition of the multidrug resistance efflux pump by verapamil. Agents that bind to DNA, including propidium iodide, Hoechst dye 33258, and coralyne chloride did not inhibit CpG-ODN effect, nor did 4-bromophenacyl bromide, an inhibitor of phospholipase A2. Examination of the structure-activity relationship of seventy 4-aminoquinoline and 9-aminoacridine analogues reveals that increased activity was conferred by bulky hydrophobic substituents on positions 2 and 6 of the quinoline nucleus. No correlation was found between published antimalarial activity and ability to block CpG-ODN-induced effects. These results are discussed in the light of the ability of quinacrine and chloroquine to induce remission of rheumatoid arthritis and lupus erythematosus.

Immunomodulatory Effects of CP-25 on Splenic T Cells of Rats with Adjuvant Arthritis.

PubMed

Wang, Yang; Han, Chen-Chen; Cui, Dongqian; Luo, Ting-Ting; Li, Yifan; Zhang, Yuwen; Ma, Yang; Wei, Wei

2018-06-01

Rheumatoid arthritis (RA) is an autoimmune disease in which T cells play an important role. Paeoniflorin-6-oxy-benzenesulfonate (CP-25) shows a strong anti-inflammatory and immunomodulatory effect in the joint of adjuvant arthritis (AA) rats, but the role of the spleen function is still unclear. The aim of this study was to research how CP-25 regulated spleen function of AA rats. Male Sprague-Dawley rats were administered with CP-25 (50 mg/kg) orally from day 17 to 29 after immunization. The spleen histopathological changes were analyzed by hematoxylin-eosin staining. G protein-coupled receptor kinases (GRKs) and prostaglandin receptor subtypes (EPs) were screened by Western blot and immunohistochemistry. The co-expression of GRK2 and EP2 as well as GRK2 and EP4 was measured by immunofluorescence and co-immunoprecipitation. The expression of GRK2 and EP4 in splenic T cells was further detected by immunofluorescence. CP-25 was found to relieve the secondary paw swelling, attenuate histopathologic changes, and downregulate GRK2, EP2 and EP4 expression in AA rats. Additionally, CP-25 not only downregulated the co-expression of GRK2 and EP4 but also downregulated GRK2, EP4 expression in splenic T cells of AA rats. From these results, we can infer that CP-25 play an anti-inflammatory and immune function by affecting the function of the splenic T cells.

Search for the CP-Violating Decays Υ(4S)→B0B¯0→J/ψKS0+J/ψ(ηc)KS0

NASA Astrophysics Data System (ADS)

Tajima, O.; Hazumi, M.; Adachi, I.; Aihara, H.; Aulchenko, V.; Aushev, T.; Bakich, A. M.; Barberio, E.; Bay, A.; Bedny, I.; Bhardwaj, V.; Bitenc, U.; Bozek, A.; Bračko, M.; Browder, T. E.; Chang, M.-C.; Chang, P.; Chen, A.; Chen, K.-F.; Chen, W. T.; Cheon, B. G.; Chiang, C.-C.; Chistov, R.; Cho, I.-S.; Choi, Y.; Choi, Y. K.; Dalseno, J.; Danilov, M.; Dash, M.; Drutskoy, A.; Eidelman, S.; Epifanov, D.; Go, A.; Gokhroo, G.; Golob, B.; Haba, J.; Hayasaka, K.; Hayashii, H.; Heffernan, D.; Hokuue, T.; Hoshi, Y.; Hou, W.-S.; Hsiung, Y. B.; Hyun, H. J.; Iijima, T.; Ikado, K.; Inami, K.; Ishikawa, A.; Ishino, H.; Itoh, R.; Iwasaki, M.; Iwasaki, Y.; Joshi, N. J.; Kah, D. H.; Kaji, H.; Kang, J. H.; Kataoka, S. U.; Kawai, H.; Kawasaki, T.; Kichimi, H.; Kim, H. J.; Kim, H. O.; Kim, S. K.; Kim, Y. J.; Kinoshita, K.; Korpar, S.; Križan, P.; Krokovny, P.; Kumar, R.; Kuo, C. C.; Kwon, Y.-J.; Lange, J. S.; Lee, J. S.; Lee, M. J.; Lee, S. E.; Lesiak, T.; Li, J.; Lin, S.-W.; Liventsev, D.; Mandl, F.; Marlow, D.; McOnie, S.; Medvedeva, T.; Mitaroff, W.; Miyabayashi, K.; Miyake, H.; Miyata, H.; Mizuk, R.; Mohapatra, D.; Nagasaka, Y.; Nakano, E.; Nakao, M.; Nishida, S.; Nitoh, O.; Noguchi, S.; Nozaki, T.; Ogawa, S.; Ohshima, T.; Okuno, S.; Ozaki, H.; Pakhlov, P.; Pakhlova, G.; Park, C. W.; Park, H.; Pestotnik, R.; Piilonen, L. E.; Sahoo, H.; Sakai, Y.; Schneider, O.; Sekiya, A.; Senyo, K.; Sevior, M. E.; Shapkin, M.; Shen, C. P.; Shibuya, H.; Shiu, J.-G.; Shwartz, B.; Singh, J. B.; Sokolov, A.; Somov, A.; Stanič, S.; Starič, M.; Sumisawa, K.; Sumiyoshi, T.; Takasaki, F.; Tanaka, M.; Taylor, G. N.; Teramoto, Y.; Trabelsi, K.; Uehara, S.; Ueno, K.; Uglov, T.; Unno, Y.; Uno, S.; Urquijo, P.; Usov, Y.; Varner, G.; Varvell, K. E.; Vervink, K.; Villa, S.; Vinokurova, A.; Wang, C. C.; Wang, C. H.; Wang, M.-Z.; Wang, P.; Watanabe, Y.; Wedd, R.; Won, E.; Yabsley, B. D.; Yamaguchi, A.; Yamashita, Y.; Yamauchi, M.; Yuan, C. Z.; Yusa, Y.; Zhang, C. C.; Zhang, Z. P.; Zhilich, V.; Zhulanov, V.; Zupanc, A.

2007-11-01

We report the first search for CP-violating decays of the Υ(4S) using a data sample that contains 535×106 Υ(4S) mesons with the Belle detector at the KEKB asymmetric-energy e+e- collider. A partial reconstruction technique is employed to enhance the signal sensitivity. No significant signals were observed. We obtain an upper limit of 4×10-7 at the 90% confidence level for the branching fractions of the CP violating modes, Υ(4S)→B0B¯0→J/ψKS0+J/ψ(ηc)KS0. Extrapolating the result, we find that an observation with 5σ significance is expected with a 30ab-1 data sample, which is within the reach of a future super B factory.

Preparation and Anodizing of SiCp/Al Composites with Relatively High Fraction of SiCp

PubMed Central

2018-01-01

By properly proportioned SiC particles with different sizes and using squeeze infiltration process, SiCp/Al composites with high volume fraction of SiC content (Vp = 60.0%, 61.2%, 63.5%, 67.4%, and 68.0%) were achieved for optical application. The flexural strength of the prepared SiCp/Al composites was higher than 483 MPa and the elastic modulus was increased from 174.2 to 206.2 GPa. With an increase in SiC volume fraction, the flexural strength and Poisson's ratio decreased with the increase in elastic modulus. After the anodic oxidation treatment, an oxidation film with porous structure was prepared on the surface of the composite and the oxidation film was uniformly distributed. The anodic oxide growth rate of composite decreased with SiC content increased and linearly increased with anodizing time. PMID:29682145

The optimization problems of CP operation

NASA Astrophysics Data System (ADS)

Kler, A. M.; Stepanova, E. L.; Maximov, A. S.

2017-11-01

The problem of enhancing energy and economic efficiency of CP is urgent indeed. One of the main methods for solving it is optimization of CP operation. To solve the optimization problems of CP operation, Energy Systems Institute, SB of RAS, has developed a software. The software makes it possible to make optimization calculations of CP operation. The software is based on the techniques and software tools of mathematical modeling and optimization of heat and power installations. Detailed mathematical models of new equipment have been developed in the work. They describe sufficiently accurately the processes that occur in the installations. The developed models include steam turbine models (based on the checking calculation) which take account of all steam turbine compartments and regeneration system. They also enable one to make calculations with regenerative heaters disconnected. The software for mathematical modeling of equipment and optimization of CP operation has been developed. It is based on the technique for optimization of CP operating conditions in the form of software tools and integrates them in the common user interface. The optimization of CP operation often generates the need to determine the minimum and maximum possible total useful electricity capacity of the plant at set heat loads of consumers, i.e. it is necessary to determine the interval on which the CP capacity may vary. The software has been applied to optimize the operating conditions of the Novo-Irkutskaya CP of JSC “Irkutskenergo”. The efficiency of operating condition optimization and the possibility for determination of CP energy characteristics that are necessary for optimization of power system operation are shown.

Possible large direct CP asymmetry in hadronic B+/--->π+/-η' decays

NASA Astrophysics Data System (ADS)

Ahmady, Mohammad R.; Kou, Emi

1999-03-01

We calculate the branching ratio and the direct CP asymmetry in nonleptonic two body B decays B+/--->π+/-η'. It is shown that the tree diagram and gluon fusion mechanism via the penguin diagram have comparable contributions to these decays which, as a result, could provide an interesting venue for investigating CP violation. Our estimate shows that the direct CP asymmetry in the above decays could be as large as 75% which along with a branching ratio B(B--->π-η')=3.4×10-6 should be accessible to experiment in the near future.

Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

PubMed

Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

2008-10-01

While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

Exploring CP violation in the MSSM.

PubMed

Arbey, Alexandre; Ellis, John; Godbole, Rohini M; Mahmoudi, Farvah

We explore the prospects for observing CP violation in the minimal supersymmetric extension of the Standard Model (MSSM) with six CP-violating parameters, three gaugino mass phases and three phases in trilinear soft supersymmetry-breaking parameters, using the CPsuperH code combined with a geometric approach to maximise CP-violating observables subject to the experimental upper bounds on electric dipole moments. We also implement CP-conserving constraints from Higgs physics, flavour physics and the upper limits on the cosmological dark matter density and spin-independent scattering. We study possible values of observables within the constrained MSSM (CMSSM), the non-universal Higgs model (NUHM), the CPX scenario and a variant of the phenomenological MSSM (pMSSM). We find values of the CP-violating asymmetry [Formula: see text] in [Formula: see text] decay that may be as large as 3 %, so future measurements of [Formula: see text] may provide independent information about CP violation in the MSSM. We find that CP-violating MSSM contributions to the [Formula: see text] meson mass mixing term [Formula: see text] are in general below the present upper limit, which is dominated by theoretical uncertainties. If these could be reduced, [Formula: see text] could also provide an interesting and complementary constraint on the six CP-violating MSSM phases, enabling them all to be determined experimentally, in principle. We also find that CP violation in the [Formula: see text] and [Formula: see text] couplings can be quite large, and so may offer interesting prospects for future [Formula: see text], [Formula: see text], [Formula: see text] and [Formula: see text] colliders.

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic

INFLUENCE OF THE FINAL TEMPERATURE OF INVESTMENT HEALTING ON THE TENSILE STRENGTH AND VICKERS HARDNESS OF CP TI AND TI-6AL-4V ALLOY

PubMed Central

Oliveira, Pedro César Garcia; Adabo, Gelson Luis; Ribeiro, Ricardo Faria; da Rocha, Sicknan Soares; Ávila, Fabiano Araújo; do Valle, Accácio Lins

2007-01-01

The aim of the work was to evaluate the influence of the temperature of investment healting on the tensile strength and Vickers hardness of CP Ti and Ti-6Al-4V alloy casting. Were obtained for the tensile strength test dumbbell rods that were invested in the Rematitan Plus investment and casting in the Discovery machine cast. Thirty specimens were obtained, fiftten to the CP Titanium and fifteen to the Ti-6Al-4V alloy, five samples to each an of the three temperatures of investment: 430°C (control group), 480°C and 530°C. The tensile test was measured by means of a universal testing machine, MTS model 810, at a strain of 1.0 mm/min. After the tensile strenght test the specimens were secctioned, embedded and polished to hardness measurements, using a Vickers tester, Micromet 2100. The means values to tensile tests to the temperatures 430°C, 480 and 530: CP Ti (486.1 – 501.16 – 498.14 –mean 495.30 MPa) and Ti-6Al-4V alloy (961.33 – 958.26 – 1005.80 – mean 975.13 MPa) while for the Vickers hardness the values were (198.06, 197.85, 202.58 – mean 199.50) and (352.95, 339.36, 344.76 – mean 345.69), respectively. The values were submitted to Analysis of Variance (ANOVA) and Tukey,s Test that indicate differences significant only between the materials, but not between the temperature, for both the materias. It was conclued that increase of the temperature of investment its not chance the tensile strength and the Vickers hardness of the CP Titanium and Ti-6Al-4V alloy. PMID:19089099

Selective preservation of cholinergic MeCP2 rescues specific Rett-syndrome-like phenotypes in MeCP2stop mice.

PubMed

Zhou, Huanhuan; Wu, Wei; Zhang, Ying; He, Haiyang; Yuan, Zhefeng; Zhu, Zhiwei; Zhao, Zhengyan

2017-03-30

RTT is a neurodevelopmental disorder characterized by growth regression, motor dysfunction, stereotypic hand movements, and autism features. Typical Rett syndrome (RTT) is predominantly caused by mutations in X-linked MeCP2 gene which encodes methyl-CpG-binding protein 2 (MeCP2). The brain-abundant MeCP2 protein mainly functions as a transcriptional regulator for neurodevelopment-associated genes. Specific functions of MeCP2 in certain neuron types remain to be known. Although cholinergic system is an important modulating system in brain, how MeCP2 in cholinergic neurons contribute to RTT has not been clearly understood. Here we use a mouse model with selectively activated endogenous MeCP2 in cholinergic neurons in otherwise MeCP2 stop mice to determine the cholinergic MeCP2 effects on rescuing the RTT-like phenotypes. We found cholinergic MeCP2 preservation could reverse some aspects of the RTT-like phenotypes in mice including hypolocomotion and increased anxiety level, and delay the onset of underweight, instead of improving the hypersocial abnormality and the poor general conditions such as short lifespan, low brain weight, and increasing severity score. Our findings suggest that selective activation of cholinergic MeCP2 is sufficient to reverse the locomotor impairment and increased anxiety-like behaviors at least in early symptomatic stage, supporting future development of RTT therapies associated with cholinergic system. Copyright © 2017 Elsevier B.V. All rights reserved.

Investigation of potential of agro-industrial residues for ethanol production by using Candida tropicalis and Zymomonas mobilis

NASA Astrophysics Data System (ADS)

Patle, Sonali

, sawdust, wood chips etc., can be promoted, which presents an inexpensive and abundant renewable source for ethanol production. Also there is an enormous production of fruits and vegetables in India and a very huge amount goes waste due to post-harvest losses and a large quantity of unused portion is also generated from processing industries. These substrates can be used as a potential source for ethanol production. These substrates are complex and are required to be broken down into simple sugars by acid, alkaline or enzymatic treatment. Two common methods for converting complex substrates to fermentable sugars are dilute acid hydrolysis and concentrated acid hydrolysis, both of which use either HCl or H2 So4. Since, acid hydrolysis has few disadvantages enzymatic hydrolysis was explored and found to be a better and more economic option. After substrate selection and its hydrolysis, it is very important to optimize the fermentation parameters and scale up the process. Different agro-industrial substrates were explored for this process. (Abstract shortened by UMI.)

Did the CP audits promote the enterprises' CP? A case study in Beijing.

PubMed

Yu, Gang; Huang, Jun; Chen, Qing

2002-03-09

Seven enterprises that have had recent Cleaner Production (CP) audits in Beijing were interviewed to identify whether these enterprises implemented the audit recommendations. If enterprises did implement the recommendations, their reasons and the results were analyzed. Finally, some suggestions on how to promote enterprise-wide CP were given.

Thermal Chemistry of Cp*W(NO)(CH2CMe3)(H)(L) Complexes (L = Lewis Base).

PubMed

Fabulyak, Diana; Handford, Rex C; Holmes, Aaron S; Levesque, Taleah M; Wakeham, Russell J; Patrick, Brian O; Legzdins, Peter; Rosenfeld, Devon C

2017-01-03

The complexes trans-Cp*W(NO)(CH 2 CMe 3 )(H)(L) (Cp* = η 5 -C 5 Me 5 ) result from the treatment of Cp*W(NO)(CH 2 CMe 3 ) 2 in n-pentane with H 2 (∼1 atm) in the presence of a Lewis base, L. The designation of a particular geometrical isomer as cis or trans indicates the relative positions of the alkyl and hydrido ligands in the base of a four-legged piano-stool molecular structure. The thermal behavior of these complexes is markedly dependent on the nature of L. Some of them can be isolated at ambient temperatures [e.g., L = P(OMe) 3 , P(OPh) 3 , or P(OCH 2 ) 3 CMe]. Others undergo reductive elimination of CMe 4 via trans to cis isomerization to generate the 16e reactive intermediates Cp*W(NO)(L). These intermediates can intramolecularly activate a C-H bond of L to form 18e cis complexes that may convert to the thermodynamically more stable trans isomers [e.g., Cp*W(NO)(PPh 3 ) initially forms cis-Cp*W(NO)(H)(κ 2 -PPh 2 C 6 H 4 ) that upon being warmed in n-pentane at 80 °C isomerizes to trans-Cp*W(NO)(H)(κ 2 -PPh 2 C 6 H 4 )]. Alternatively, the Cp*W(NO)(L) intermediates can effect the intermolecular activation of a substrate R-H to form trans-Cp*W(NO)(R)(H)(L) complexes [e.g., L = P(OMe) 3 or P(OCH 2 ) 3 CMe; R-H = C 6 H 6 or Me 4 Si] probably via their cis isomers. These latter activations are also accompanied by the formation of some Cp*W(NO)(L) 2 disproportionation products. An added complication in the L = P(OMe) 3 system is that thermolysis of trans-Cp*W(NO)(CH 2 CMe 3 )(H)(P(OMe) 3 ) results in it undergoing an Arbuzov-like rearrangement and being converted mainly into [Cp*W(NO)(Me)(PO(OMe) 2 )] 2 , which exists as a mixture of two isomers. All new complexes have been characterized by conventional and spectroscopic methods, and the solid-state molecular structures of most of them have been established by single-crystal X-ray crystallographic analyses.

Effects of Coordinating a Hemilabile Ligand to 14e Cp*M(NO) Scaffolds (M = Mo, W).

PubMed

Handford, Rex C; Patrick, Brian O; Legzdins, Peter

2017-10-16

This article describes the differing chemical properties imparted by the two ligands, hemilabile 2-[(diisopropylphosphino)methyl]-3-methylpyridine ( i Pr 2 PN) and the related 1,2-bis(dimethylphosphino)ethane (dmpe), when attached to the 14e Cp*M(NO) scaffolds (Cp* = η 5 -C 5 Me 5 ; M = W, Mo). For instance, the treatment of [Cp*W(NO)Cl 2 ] 2 with 2 or 1 equiv of dmpe in C 6 H 6 affords excellent yields of [Cp*W(NO)(κ 2 -dmpe)Cl]Cl (1) or [Cp*W(NO)Cl 2 ] 2 [μ-dmpe] (2). In contrast, the treatment of [Cp*W(NO)Cl 2 ] 2 with 1 equiv of i Pr 2 PN in C 6 H 6 does not produce the complex analogous to 1 but rather affords orange [Cp*W(NO)(κ 2 -P-N- i Pr 2 PN)Cl][Cp*W(NO)Cl 3 ] (3) in 90% yield. Furthermore, subsequent reduction of 1 or 2 with 2 or 4 equiv of Cp 2 Co in tetrahydrofuran (THF), respectively, results in the production of orange Cp*W(NO)(κ 2 -dmpe) (4) in good yields. However, a similar treatment of 3 with 1 equiv of Cp 2 Co in THF does not result in the production of Cp*W(NO)(κ 2 -P,N- i Pr 2 PN), the analogue of 4, but rather generates a 1:1 mixture of the novel complexes Cp*W(NO)(H)(κ 1 -P- i Pr 2 PN)Cl (5) and Cp*W(NO)(κ 2 -P,N- i Pr 2 PCH-2-(3-Me-C 5 H 3 N))Cl (6), which are separable by crystallization from pentane and diethyl ether solutions, respectively. The divergent reactivity imparted by the dmpe and i Pr 2 PN proligands is a unique demonstration of the unusual properties of a mixed-donor ligand. In the case of molybdenum, the reaction of [Cp*Mo(NO)Cl 2 ] 2 with 2 equiv of i Pr 2 PN in C 6 H 6 first forms Cp*Mo(NO)(κ 1 -P- i Pr 2 PN)Cl 2 , which then converts to [Cp*Mo(NO)(κ 2 -P,N- i Pr 2 PN)Cl][Cp*Mo(NO)Cl 3 ], the analogue of 3. Reduction of the Cp*Mo(NO)(κ 1 -P- i Pr 2 PN)Cl 2 intermediate complex with 2 equiv of Cp 2 Co affords dark-green Cp*Mo(NO)(κ 2 -P,N- i Pr 2 PN) (7). All new complexes have been characterized by conventional spectroscopic and analytical methods, and the solid-state molecular structures of most of them have

Diphosphine- and CO-Induced Fragmentation of Chloride-bridged Dinuclear Complex and Cp*Ir(mu-Cl)(3)Re(CO)(3) and Attempted Synthesis of Cp*Ir(mu-Cl)(3)Mn(CO)(3): Spectroscopic Data and X-ray Diffraction Structures of the Pentamethylcyclopentadienyl Compounds [Cp*IrCl{(Z)-Ph2PCH = CHPPh2}][Cl]center dot 2CHCl(3) and Cp*Ir(CO)Cl-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hammons, Casey; Wang, Xiaoping; Nesterov, Vladimir

2010-01-01

The confacial bioctahedral compound Cp*Ir(mu-Cl)(3)Re(CO)(3) (1) undergoes rapid fragmentation in the presence of the unsaturated diphosphine ligand (Z)-Ph2PCH = CHPPh2 to give the mononuclear compounds [Cp*IrCl {(Z)-Ph2PCH = CHPPh2}][Cl] (2) and fac-ClRe(CO)(3)[(Z)-Ph2PCH = CHPPh2] (3). 2 has been characterized by H-1 and P-31 NMR spectroscopy and X-ray diffraction analysis. 2 center dot 2CHCl(3) crystallizes in the monoclinic space group C2/c, a = 35.023 (8) angstrom, b = 10.189 (2) angstrom, c = 24.003 (6) angstrom, b = 103.340 (3), V = 8,335 (3) angstrom 3, Z = 8, and d(calc) = 1.647 Mg/m(3); R = 0.0383, R-w = 0.1135 formore » 8,178 reflections with I> 2 sigma(I). The Ir(III) center in 2 exhibits a six-coordinate geometry and displays a chelating diphosphine group. Compound 1 reacts with added CO with fragmentation to yield the known compounds Cp*Ir(CO)Cl-2 (4) and ClRe(CO)(5) (5) in near quantitative yield by IR spectroscopy. Using the protocol established by our groups for the synthesis of 1, we have explored the reaction of [Cp*IrCl2](2) with ClMn(CO)(5) as a potential route to Cp*Ir(mu-Cl)(3)Mn(CO)(3); unfortunately, 4 was the only product isolated from this reaction. The solid-state structure of 4 was determined by X-ray diffraction analysis. 4 crystallizes in the triclinic space group P-1, a = 7.4059 (4) angstrom, b = 7.8940 (4) angstrom, c = 11.8488 (7) angstrom, alpha = 80.020 (1), beta = 79.758 (1), gamma = 68.631 (1), V = 630.34 (6) angstrom(3), Z = 2, and d(calc) = 2.246 Mg/m(3); R = 0.0126, R-w = 0.0329 for 2,754 reflections with I> 2 sigma(I). The expected three-legged piano-stool geometry in 4 has been crystallographically confirmed.« less

Role of Su(Hw) zinc finger 10 and interaction with CP190 and Mod(mdg4) proteins in recruiting the Su(Hw) complex to chromatin sites in Drosophila.

PubMed

Melnikova, Larisa; Kostyuchenko, Margarita; Parshikov, Alexander; Georgiev, Pavel; Golovnin, Anton

2018-01-01

Su(Hw) belongs to the class of proteins that organize chromosome architecture and boundaries/insulators between regulatory domains. This protein contains a cluster of 12 zinc finger domains most of which are responsible for binding to three different modules in the consensus site. Su(Hw) forms a complex with CP190 and Mod(mdg4)-67.2 proteins that binds to well-known Drosophila insulators. To understand how Su(Hw) performs its activities and binds to specific sites in chromatin, we have examined the previously described su(Hw)f mutation that disrupts the 10th zinc finger (ZF10) responsible for Su(Hw) binding to the upstream module. The results have shown that Su(Hw)f loses the ability to interact with CP190 in the absence of DNA. In contrast, complete deletion of ZF10 does not prevent the interaction between Su(Hw)Δ10 and CP190. Having studied insulator complex formation in different mutant backgrounds, we conclude that both association with CP190 and Mod(mdg4)-67.2 partners and proper organization of DNA binding site are essential for the efficient recruitment of the Su(Hw) complex to chromatin insulators.

Fermentation of xylose to ethanol by genetically modified enteric bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolan, J.S.

1987-01-01

This thesis describes the fermentation of D-xylose by wild type and recombinant Klebsiella planticola ATCC 33531 and Erwinia chrysanthemi B374. The recombinant strains bear multi-copy plasmids containing the pdc gene inserted from Zymomonas mobilis. Expression of the gene in K. planticola markedly increased the yield of ethanol, up to 1.3 mole/mole xylose, or 25.1 g/L. Concurrently, there were significant decreases in the yields of formation acetate, lactate, and butanediol. Transconjugant Klebsiella grew almost as fast as the wild type and tolerated up to 4% ethanol. The plasmid was retained by the cells during at least one batch culture, even inmore » the absence of selective pressure by antibiotics to maintain the plasmid. The cells produced 31.6 g/L ethanol from 79.6 g/L of a D-glucose-D-xylose-L-arabinose mixture designed to simulate hydrolyzed hemicellulose. The physiology of the wild type K. planticola is described in more detail than in the original report of its isolation. E. chrysanthemi PDC transconjugants also produced ethanol in high yield (up to 1.45 mole/mole xylose). However, transconjugant E. chrysanthemi grew only 1/4 as rapidly as the wild type and tolerated only 2% ethanol. The plasmid PZM15 apparently exhibits pleiotropic effects when inserted into K. planticola and into E. chrysanthemi.« less

Construction and Immunological Evaluation of CpG-Au@HBc Virus-Like Nanoparticles as a Potential Vaccine

NASA Astrophysics Data System (ADS)

Wang, Yarun; Wang, Yue; Kang, Ning; Liu, Yongliang; Shan, Wenjun; Bi, Shengli; Ren, Lei; Zhuang, Guohong

2016-07-01

Different types of vaccines have been developed to elicit active immunization to treat various diseases, while suffer from limitation of efficacy. Herein, a novel immunostimulatory nanocomposite (CpG-Au@HBc VLP) was rationally designed by self-assembling engineered virus-like particles encapsulating CpG-gold nanoparticle conjugates through electrostatic interactions. The monodispersed and uniformly sized CpG-Au@HBc VLP showed increased CD4+, CD8+ T cell numbers and stronger secretion of cytokine interferon-gamma than HBc VLPs adjuvanted with conventional Freund's adjuvant. Furthermore, the use of Au nanoparticles also generated enhanced immunogenicity of CpG and VLPs on both humoral and cellular immune pathways, as followed from increased expressions of total HBc-specific antibody titer, CD4+ T cells, CD8+ T cells, cytokine interleukin-4, and interferon-gamma. These findings demonstrated that CpG-Au@HBc VLP nanocomposite could induce robust cellular and humoral immune response, which could be a potential vaccine for future prophylactic and therapeutic application.

Ultrasonic green synthesis of an Ag/CP nanocomposite for enhanced photodegradation effectiveness.

PubMed

Chang, Hai Ning; Hou, Suo Xia; Hao, Zeng Chuan; Cui, Guang Hua

2018-01-01

A nanoparticle of cobalt(II) coordination polymer (CP), [Co(L)(npht)] n (1) (H 2 npht=4-nitrophthalic acid, L=1,3-bis(5,6-dimethylbenzimidazol-1-ylmethyl)benzene) and its nanocomposite (Ag/CP 1) were obtained by the sonochemical approach and characterized by IR, elemental analysis, thermogravimetric analyses (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), and X-ray powder diffraction (XRPD). CP 1 shows a 1D double chain containing two different helical chains, which is further extended into a two-dimensional supramolecular framework by C-H⋯O hydrogen bonding interactions. The photoluminescence properties and photocatalytic properties of the nanoparticles of CP 1 and Ag/CP 1 on the degradation of methylene blue (MB) were investigated, Ag/CP 1 exhibited excellent photocatalytic activity under UV and visible light, which can be attributed to the strong interactions between Ag nanorods and CP 1, which lead to electron-hole pair separation between Ag nanorods and CP 1. In addition, the photocatalytic mechanism is also carried out by introducing t-butyl alcohol (TBA) as a widely used ·OH scavenger. The influence of ultrasound irradiation time and power on the morphology and size of the nanostructure CP 1 were studied. The results indicated that a decrease in time and an increase in power led to a decrease of particle size. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

Many Mg-Mg bonds form the core of the Mg16Cp*8Br4K cluster anion: the key to a reassessment of the Grignard reagent (GR) formation process?

PubMed

Kruczyński, T; Henke, F; Neumaier, M; Bowen, K H; Schnöckel, H

2016-02-01

It caused a sensation eight years ago, when the first room temperature stable molecular compound with a Mg-Mg bond (LMgMgL, L = chelating ligand) containing magnesium in the oxidation state +1 was prepared. Here, we report the preparation of a [Mg 16 Cp*8Br 4 K] - cluster anion (Cp* = pentamethylcyclopentadiene) with 27 Mg-Mg bonds. It has been obtained through the reaction of KCp* with a metastable solution of MgBr in toluene. A highly-resolved Fourier transform mass spectrum (FT-MS) of this cluster anion, brought into vacuum by electrospraying its solution in THF, provides the title cluster's stoichiometry. This Mg 16 cluster together with experiments on the metastable solution of MgBr show that: during the formation process of GRs (Grignard reagents) which are involved in most of sophisticated syntheses of organic products, not the highly reactive MgBr radical as often presumed, but instead the metalloid Mg 16 Cp*8Br 4 cluster anion and its related cousins that are the operative intermediates along the pathway from Mg metal to GRs ( e.g. Cp*MgBr).

Reactivity of cyclopentadienyl molybdenum compounds towards formic acid: Structural characterization of CpMo(PMe 3)(CO) 2H, CpMo(PMe 3) 2(CO)H, [CpMo(μ-O)(μ-O 2CH)] 2, and [Cp*Mo(μ-O)(μ-O 2CH)] 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neary, Michelle C.; Parkin, Gerard

Here, the molecular structures of CpMo(PMe 3)(CO) 2H and CpMo(PMe 3) 2(CO)H have been determined by X-ray diffraction, thereby revealing four-legged piano-stool structures in which the hydride ligand is trans to CO. However, in view of the different nature of the four basal ligands, the geometries of CpMo(PMe 3)(CO) 2H and CpMo(PMe 3) 2(CO)H deviate from that of an idealized four-legged piano stool, such that the two ligands that are orthogonal to the trans H–Mo–CO moiety are displaced towards the hydride ligand. While CpRMo(PMe 3) 3–x(CO) xH (Cp R = Cp, Cp*; x = 1, 2, 3) are catalysts formore » the release of H 2 from formic acid, the carbonyl derivatives, CpRMo(CO)3H, are also observed to form dinuclear formate compounds, namely, [Cp RMo(μ-O)(μ-O 2CH)] 2. The nature of the Mo···Mo interactions in [CpMo(μ-O)(μ-O 2CH)] 2 and [Cp*Mo(μ-O)(μ-O 2CH)] 2 have been addressed computationally. In this regard, the two highest occupied molecular orbitals of [CpMo(μ-O)(μ-O 2CH)] 2 correspond to metal-based δ* (HOMO) and σ (HOMO–1) orbitals. The σ 2δ *2 configuration thus corresponds to a formal direct Mo–Mo bond order of zero. The preferential occupation of the δ* orbital rather than the δ orbital is a consequence of the interaction of the latter orbital with p orbitals of the bridging oxo ligands. In essence, lone-pair donation from oxygen increases the electron count so that the molybdenum centers can achieve an 18-electron configuration without the existence of a Mo–Mo bond, whereas a Mo=Mo double bond is required in the absence of lone-pair donation.« less

Reactivity of Cyclopentadienyl Molybdenum Compounds towards Formic Acid: Structural Characterization of CpMo(PMe3)(CO)2H, CpMo(PMe3)2(CO)H, [CpMo(μ-O)(μ-O2CH)]2, and [Cp*Mo(μ-O)(μ-O2CH)]2.

PubMed

Neary, Michelle C; Parkin, Gerard

2017-02-06

The molecular structures of CpMo(PMe 3 )(CO) 2 H and CpMo(PMe 3 ) 2 (CO)H have been determined by X-ray diffraction, thereby revealing four-legged piano-stool structures in which the hydride ligand is trans to CO. However, in view of the different nature of the four basal ligands, the geometries of CpMo(PMe 3 )(CO) 2 H and CpMo(PMe 3 ) 2 (CO)H deviate from that of an idealized four-legged piano stool, such that the two ligands that are orthogonal to the trans H-Mo-CO moiety are displaced towards the hydride ligand. While Cp R Mo(PMe 3 ) 3-x (CO) x H (Cp R = Cp, Cp*; x = 1, 2, 3) are catalysts for the release of H 2 from formic acid, the carbonyl derivatives, Cp R Mo(CO) 3 H, are also observed to form dinuclear formate compounds, namely, [Cp R Mo(μ-O)(μ-O 2 CH)] 2 . The nature of the Mo···Mo interactions in [CpMo(μ-O)(μ-O 2 CH)] 2 and [Cp*Mo(μ-O)(μ-O 2 CH)] 2 have been addressed computationally. In this regard, the two highest occupied molecular orbitals of [CpMo(μ-O)(μ-O 2 CH)] 2 correspond to metal-based δ* (HOMO) and σ (HOMO-1) orbitals. The σ 2 δ* 2 configuration thus corresponds to a formal direct Mo-Mo bond order of zero. The preferential occupation of the δ* orbital rather than the δ orbital is a consequence of the interaction of the latter orbital with p orbitals of the bridging oxo ligands. In essence, lone-pair donation from oxygen increases the electron count so that the molybdenum centers can achieve an 18-electron configuration without the existence of a Mo-Mo bond, whereas a Mo═Mo double bond is required in the absence of lone-pair donation.

Reactivity of cyclopentadienyl molybdenum compounds towards formic acid: Structural characterization of CpMo(PMe 3)(CO) 2H, CpMo(PMe 3) 2(CO)H, [CpMo(μ-O)(μ-O 2CH)] 2, and [Cp*Mo(μ-O)(μ-O 2CH)] 2

DOE PAGES

Neary, Michelle C.; Parkin, Gerard

2017-01-19

Here, the molecular structures of CpMo(PMe 3)(CO) 2H and CpMo(PMe 3) 2(CO)H have been determined by X-ray diffraction, thereby revealing four-legged piano-stool structures in which the hydride ligand is trans to CO. However, in view of the different nature of the four basal ligands, the geometries of CpMo(PMe 3)(CO) 2H and CpMo(PMe 3) 2(CO)H deviate from that of an idealized four-legged piano stool, such that the two ligands that are orthogonal to the trans H–Mo–CO moiety are displaced towards the hydride ligand. While CpRMo(PMe 3) 3–x(CO) xH (Cp R = Cp, Cp*; x = 1, 2, 3) are catalysts formore » the release of H 2 from formic acid, the carbonyl derivatives, CpRMo(CO)3H, are also observed to form dinuclear formate compounds, namely, [Cp RMo(μ-O)(μ-O 2CH)] 2. The nature of the Mo···Mo interactions in [CpMo(μ-O)(μ-O 2CH)] 2 and [Cp*Mo(μ-O)(μ-O 2CH)] 2 have been addressed computationally. In this regard, the two highest occupied molecular orbitals of [CpMo(μ-O)(μ-O 2CH)] 2 correspond to metal-based δ* (HOMO) and σ (HOMO–1) orbitals. The σ 2δ *2 configuration thus corresponds to a formal direct Mo–Mo bond order of zero. The preferential occupation of the δ* orbital rather than the δ orbital is a consequence of the interaction of the latter orbital with p orbitals of the bridging oxo ligands. In essence, lone-pair donation from oxygen increases the electron count so that the molybdenum centers can achieve an 18-electron configuration without the existence of a Mo–Mo bond, whereas a Mo=Mo double bond is required in the absence of lone-pair donation.« less

Low doses of killed parasite in CpG elicit vigorous CD4+ T cell responses against blood-stage malaria in mice

PubMed Central

Pinzon-Charry, Alberto; McPhun, Virginia; Kienzle, Vivian; Hirunpetcharat, Chakrit; Engwerda, Christian; McCarthy, James; Good, Michael F.

2010-01-01

Development of a vaccine that targets blood-stage malaria parasites is imperative if we are to sustainably reduce the morbidity and mortality caused by this infection. Such a vaccine should elicit long-lasting immune responses against conserved determinants in the parasite population. Most blood-stage vaccines, however, induce protective antibodies against surface antigens, which tend to be polymorphic. Cell-mediated responses, on the other hand, offer the theoretical advantage of targeting internal antigens that are more likely to be conserved. Nonetheless, few of the current blood-stage vaccine candidates are able to harness vigorous T cell immunity. Here, we present what we believe to be a novel blood-stage whole-organism vaccine that, by combining low doses of killed parasite with CpG-oligodeoxynucleotide (CpG-ODN) adjuvant, was able to elicit strong and cross-reactive T cell responses in mice. Our data demonstrate that immunization of mice with 1,000 killed parasites in CpG-ODN engendered durable and cross-strain protection by inducing a vigorous response that was dependent on CD4+ T cells, IFN-γ, and nitric oxide. If applicable to humans, this approach should facilitate the generation of robust, cross-reactive T cell responses against malaria as well as antigen availability for vaccine manufacture. PMID:20628205

Comparative Study of Carbon Materials Synthesized "Greenly" for 2-CP Removal.

PubMed

Ma, Ying; Lu, Nan; Lu, Ying; Guan, Jiu-Nian; Qu, Jiao; Liu, Hai-Yang; Cong, Qiao; Yuan, Xing

2016-07-04

Carbon nanotubes (CNTs), graphene (GA) and carbon nanospheres (CNSs) were prepared respectively using grass (Festucaarundinace) as the sole carbon resource by solvothermal method and characterized as adsorbent and photocatalyst for 2-chlorophenol (2-CP) removal in water. With H2O2/HNO3/H2SO4, the CNTs were firstly produced from grass (Festucaarundinace) at 300 °C by hydrolysis and oxidization, the CNTs were secondly opened to form the GA by oxidization at 400 °C, and the GA was lastly rolled-up to form the CNSs by oxidization at 500 °C. All adsorption equilibration of the CNTs, GA, and CNSs for 2-CP were achieved within 120 min, and 60.35%, 20.12%, and 76.22% of 2-CP (5 mg L(-1), pH = 6.3) were adsorbed, respectively. Furthermore, the high removal rates of 2-CP were about 88.23%, 92.90%, and 79.64% by the CNTs, GA, and CNSs, after 120 min adsorption and 160 min irradiation. On the basis of these results, the CNSs were suitable for removal 2-CP as adsorbent, and the GA was suitable as photocatalyst. The photooxidation of 2-CP was mainly initiated by O2(·-) or ·OH which was generated from the combine with simulated sunlight and the CNTs or GA, respectively. However, the CNTs was not suitable for removal 2-CP owing to the increasing toxicity.

Characterization of human cytochrome P450s involved in the bioactivation of tri-ortho-cresyl phosphate (ToCP).

PubMed

Reinen, Jelle; Nematollahi, Leyla; Fidder, Alex; Vermeulen, Nico P E; Noort, Daan; Commandeur, Jan N M

2015-04-20

Tri-ortho-cresyl phosphate (ToCP) is a multipurpose organophosphorus compound that is neurotoxic and suspected to be involved in aerotoxic syndrome in humans. It has been reported that not ToCP itself but a metabolite of ToCP, namely, 2-(ortho-cresyl)-4H-1,2,3-benzodioxaphosphoran-2-one (CBDP), may be responsible for this effect as it can irreversibly bind to human butyrylcholinesterase (BuChE) and human acetylcholinesterase (AChE). The bioactivation of ToCP into CBDP involves Cytochrome P450s (P450s). However, the individual human P450s responsible for this bioactivation have not been identified yet. In the present study, we aimed to investigate the metabolism of ToCP by different P450s and to determine the inhibitory effect of the in vitro generated ToCP-metabolites on human BuChE and AChE. Human liver microsomes, rat liver microsomes, and recombinant human P450s were used for that purpose. The recombinant P450s 2B6, 2C18, 2D6, 3A4 and 3A5 showed highest activity of ToCP-bioactivation to BuChE-inhibitory metabolites. Inhibition experiments using pooled human liver microsomes indicated that P450 3A4 and 3A5 were mainly involved in human hepatic bioactivation of ToCP. In addition, these experiments indicated a minor role for P450 1A2. Formation of CBDP by in-house expressed recombinant human P450s 1A2 and 3A4 was proven by both LC-MS and GC-MS analysis. When ToCP was incubated with P450 1A2 and 3A4 in the presence of human BuChE, CBDP-BuChE-adducts were detected by LC-MS/MS which were not present in the corresponding control incubations. These results confirmed the role of human P450s 1A2 and 3A4 in ToCP metabolism and demonstrated that CBDP is the metabolite responsible for the BuChE inactivation. Interindividual differences at the level of P450 1A2 and 3A4 might play an important role in the susceptibility of humans in developing neurotoxic effects, such as aerotoxic syndrome, after exposure to ToCP.

Measurements of CP Asymmetries in the Decay B --> {phi}K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aubert, B

The authors present a preliminary measurement of the time-dependent CP asymmetry for the neutral B-meson decay B{sup 0} --> {phi}K{sup 0}. They use a sample of approximately 227 million B-meson pairs recorded at the {Upsilon}(4S) resonance with the BABAR detector at the PEP-II B-meson Factory at SLAC. They reconstruct the CP eigenstates {phi}K{sub s}{sup 0} and {phi}K{sub L}{sup 0} where {phi} --> K{sup +}K{sup -}, K{sub s}{sup 0} --> {pi}{sup +}{pi}{sup -}, and K{sub L}{sup 0} is observed via its hadronic interactions. The other B meson in the event is tagged as either a B{sup 0} or {bar B}{sup 0}more » from its decay products. The values of the CP-violation parameters deived from the combined {phi}K{sup 0} dataset are S{sub {phi}K} = +0.50 {+-} 0.25(stat.){sub -0.04}{sup +0.07}(syst.) and C{sub {phi}K} = 0.00 {+-} 0.23(stat.) {+-}0.05(syst.). In addition, the authors measure the CP-violating charge asymmetry A{sub CP}(B{sup +} --> {phi}K{sup +}) = 0.054 {+-} 0.056(stat.) {+-} 0.012(syst.). All results are preliminary.« less

Rett syndrome and MeCP2.

PubMed

Liyanage, Vichithra R B; Rastegar, Mojgan

2014-06-01

Rett syndrome (RTT) is a severe and progressive neurological disorder, which mainly affects young females. Mutations of the methyl-CpG binding protein 2 (MECP2) gene are the most prevalent cause of classical RTT cases. MECP2 mutations or altered expression are also associated with a spectrum of neurodevelopmental disorders such as autism spectrum disorders with recent links to fetal alcohol spectrum disorders. Collectively, MeCP2 relation to these neurodevelopmental disorders highlights the importance of understanding the molecular mechanisms by which MeCP2 impacts brain development, mental conditions, and compromised brain function. Since MECP2 mutations were discovered to be the primary cause of RTT, a significant progress has been made in the MeCP2 research, with respect to the expression, function and regulation of MeCP2 in the brain and its contribution in RTT pathogenesis. To date, there have been intensive efforts in designing effective therapeutic strategies for RTT benefiting from mouse models and cells collected from RTT patients. Despite significant progress in MeCP2 research over the last few decades, there is still a knowledge gap between the in vitro and in vivo research findings and translating these findings into effective therapeutic interventions in human RTT patients. In this review, we will provide a synopsis of Rett syndrome as a severe neurological disorder and will discuss the role of MeCP2 in RTT pathophysiology.

Alkali metal-templated assembly of cyanometalate ``boxes'' (NEt{sub 4}){sub 3}{l{underscore}brace}M[Cp*Rh(CN){sub 3}]{sub 4}[Mo(CO){sub 3}]{sub 4}{r{underscore}brace} (M = K, Cs). Selective binding of Cs{sup +}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klausmeyer, K.K.; Wilson, S.R.; Rauchfuss, T.B.

1999-03-31

The box-like cages {l{underscore}brace}M[Cp*Rh(CN){sub 3}]{sub 4}[Mo(CO){sub 3}]{sub 4}{r{underscore}brace}{sup 3{minus}} form as the sole metal-containing products of the reaction of [Cp*Rh(CN){sub 3}]{sup {minus}} and ({eta}{sup 6}-C{sub 6}H{sub 3}Me{sub 3})Mo(CO){sub 3} in the presence of K{sup +} and Cs{sup +}. Well-defined species could not be identified in solutions of Cp*Rh(CN){sub 3}{sup {minus}} ({eta}{sup 6}-C{sub 6}H{sub 3}Me{sub 3})Mo(CO){sub 3} in the absence of alkali metal cations. The new cages were isolated as their Et{sub 4}N{sup +} salts, M = K{sup +} (1), Cs{sup +} (2). Crystallographic characterization of 1 and 2 reveals box-like M{sub 8}({micro}-CN){sub 12} cages containing alkali metal cations. The cagesmore » feature 12 external CO and 4 external C{sub 5}Me{sub 5} ligands. In 1, the K{sup +} is disordered over two off-center positions, whereas in the case of 2, the Cs{sup +} is centered in the cage with a formal coordination number of 24. Otherwise, the structures of the two compounds are virtually indistinguishable. The persistence of the solid-state structures in solution was established through {sup 13}C NMR spectroscopy and electrospray mass spectrometric measurements. {sup 133}Cs NMR spectroscopy, which readily distinguishes free from included Cs{sup +}, shows that the boxes preferentially bind Cs{sup +} relative to K{sup +}.« less

Cp*Co(III) catalysts with proton-responsive ligands for carbon dioxide hydrogenation in aqueous media.

PubMed

Badiei, Yosra M; Wang, Wan-Hui; Hull, Jonathan F; Szalda, David J; Muckerman, James T; Himeda, Yuichiro; Fujita, Etsuko

2013-11-04

New water-soluble pentamethylcyclopentadienyl cobalt(III) complexes with proton-responsive 4,4'- and 6,6'-dihydroxy-2,2'-bipyridine (4DHBP and 6DHBP, respectively) ligands have been prepared and were characterized by X-ray crystallography, UV-vis and NMR spectroscopy, and mass spectrometry. These cobalt(III) complexes with proton-responsive ligands predominantly exist in their deprotonated [Cp*Co(DHBP-2H(+))(OH2)] forms with stronger electron-donating properties in neutral and basic solutions, and are active catalysts for CO2 hydrogenation in aqueous bicarbonate media at moderate temperature under a total 4-5 MPa (CO2:H2 1:1) pressure. The cobalt complexes containing 4DHBP ligands ([1-OH2](2+) and [1-Cl](+), where 1 = Cp*Co(4DHBP)) display better thermal stability and exhibit notable catalytic activity for CO2 hydrogenation to formate in contrast to the catalytically inactive nonsubstituted bpy analogues [3-OH2](2+) (3 = Cp*Co(bpy)). While the catalyst Cp*Ir(6DHBP)(OH2)(2+) in which the pendent oxyanion lowers the barrier for H2 heterolysis via proton transfer through a hydrogen-bonding network involving a water molecule is remarkably effective (ACS Catal. 2013, 3, 856-860), cobalt complexes containing 6DHBP ligands ([2-OH2](2+) and [2-Cl](+), 2 = Cp*Co(6DHBP)) exhibit lower TOF and TON for CO2 hydrogenation than those with 4DHBP. The low activity is attributed to thermal instability during the hydrogenation of CO2 as corroborated by DFT calculations.

Bacterial community analysis in chlorpyrifos enrichment cultures via DGGE and use of bacterial consortium for CP biodegradation.

PubMed

Akbar, Shamsa; Sultan, Sikander; Kertesz, Michael

2014-10-01

The organophosphate pesticide chlorpyrifos (CP) has been used extensively since the 1960s for insect control. However, its toxic effects on mammals and persistence in environment necessitate its removal from contaminated sites, biodegradation studies of CP-degrading microbes are therefore of immense importance. Samples from a Pakistani agricultural soil with an extensive history of CP application were used to prepare enrichment cultures using CP as sole carbon source for bacterial community analysis and isolation of CP metabolizing bacteria. Bacterial community analysis (denaturing gradient gel electrophoresis) revealed that the dominant genera enriched under these conditions were Pseudomonas, Acinetobacter and Stenotrophomonas, along with lower numbers of Sphingomonas, Agrobacterium and Burkholderia. Furthermore, it revealed that members of Bacteroidetes, Firmicutes, α- and γ-Proteobacteria and Actinobacteria were present at initial steps of enrichment whereas β-Proteobacteria appeared in later steps and only Proteobacteria were selected by enrichment culturing. However, when CP-degrading strains were isolated from this enrichment culture, the most active organisms were strains of Acinetobacter calcoaceticus, Pseudomonas mendocina and Pseudomonas aeruginosa. These strains degraded 6-7.4 mg L(-1) day(-1) of CP when cultivated in mineral medium, while the consortium of all four strains degraded 9.2 mg L(-1) day(-1) of CP (100 mg L(-1)). Addition of glucose as an additional C source increased the degradation capacity by 8-14 %. After inoculation of contaminated soil with CP (200 mg kg(-1)) disappearance rates were 3.83-4.30 mg kg(-1) day(-1) for individual strains and 4.76 mg kg(-1) day(-1) for the consortium. These results indicate that these organisms are involved in the degradation of CP in soil and represent valuable candidates for in situ bioremediation of contaminated soils and waters.

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

PubMed Central

Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

2012-01-01

The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

Beauty for pedestrians toy models for CP violation and baryon asymmetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lipkin, H.J.

Why are particles different from antiparticles? C and P Violation - 1956; CP Violation - 1964. Why so little new experimental information in thirty years? Where has all the antimatter gone? Toy models are presented showing: (1) How CPT and {Delta}I = 1/2 make life difficult in kaon physics by requiring equal K{sup {plus_minus}} total widths and also equal partial widths to many exclusive channels. (2) How to understand and get around CPT restrictions. (3) How CP asymmetries can occur in exclusive partial widths and still add up to equal total widths. (4) Sakharov`s 1966 scenario for how CP Violationmore » + proton decay can explain baryon asymmetry (5) How B physics can help.« less

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

The investigation of die-pressing and sintering behavior of ITP CP-Ti and Ti-6Al-4V powders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Wei; Yamamoto, Yukinori; Peter, William H

This paper investigated the die-pressing and sintering behavior of the low-cost CP-Ti and Ti-6Al- 4V powders made by the Armstrong Process . The Armstrong powders have an irregular coral like, dendritic morphology, with a dendrite size of approximately 2-5 m. As-received as well as milled powders were uniaxially pressed at designated pressures up to 690 MPa to form disk samples with different aspect ratios. In the studied pressure range, an empirical powder compaction equation was applied to linearize the green density pressure relationship, and powder compaction parameters were obtained. The Armstrong Ti-64 powder exhibited a significantly higher sinterability than themore » CP-Ti powder. This was explained to be due to the higher diffusivity of V at the sintering temperature. The Ti-64 samples with a green density of 71.0% increased to 99.6% after sintering at 1300oC for 1 hour. An ex-situ technique was used to track the powder morphology change before and after sintering.« less

MeCP2 regulates ethanol sensitivity and intake.

PubMed

Repunte-Canonigo, Vez; Chen, Jihuan; Lefebvre, Celine; Kawamura, Tomoya; Kreifeldt, Max; Basson, Oan; Roberts, Amanda J; Sanna, Pietro Paolo

2014-09-01

We have investigated the expression of chromatin-regulating genes in the prefrontal cortex and in the shell subdivision of the nucleus accumbens during protracted withdrawal in mice with increased ethanol drinking after chronic intermittent ethanol (CIE) vapor exposure and in mice with a history of non-dependent drinking. We observed that the methyl-CpG binding protein 2 (MeCP2) was one of the few chromatin-regulating genes to be differentially regulated by a history of dependence. As MeCP2 has the potential of acting as a broad gene regulator, we investigated sensitivity to ethanol and ethanol drinking in MeCP2(308/) (Y) mice, which harbor a truncated MeCP2 allele but have a milder phenotype than MeCP2 null mice. We observed that MeCP2(308/) (Y) mice were more sensitive to ethanol's stimulatory and sedative effects than wild-type (WT) mice, drank less ethanol in a limited access 2 bottle choice paradigm and did not show increased drinking after induction of dependence with exposure to CIE vapors. Alcohol metabolism did not differ in MeCP2(308/) (Y) and WT mice. Additionally, MeCP2(308/) (Y) mice did not differ from WT mice in ethanol preference in a 24-hour paradigm nor in their intake of graded solutions of saccharin or quinine, suggesting that the MeCP2(308/) (Y) mutation did not alter taste function. Lastly, using the Gene Set Enrichment Analysis algorithm, we found a significant overlap in the genes regulated by alcohol and by MeCP2. Together, these results suggest that MeCP2 contributes to the regulation of ethanol sensitivity and drinking. © 2013 The Authors, Addiction Biology © 2013 Society for the Study of Addiction.

EAST Organizes Drosophila Insulator Proteins in the Interchromosomal Nuclear Compartment and Modulates CP190 Binding to Chromatin

PubMed Central

Golovnin, Anton; Melnikova, Larisa; Shapovalov, Igor; Kostyuchenko, Margarita; Georgiev, Pavel

2015-01-01

Recent data suggest that insulators organize chromatin architecture in the nucleus. The best studied Drosophila insulator proteins, dCTCF (a homolog of the vertebrate insulator protein CTCF) and Su(Hw), are DNA-binding zinc finger proteins. Different isoforms of the BTB-containing protein Mod(mdg4) interact with Su(Hw) and dCTCF. The CP190 protein is a cofactor for the dCTCF and Su(Hw) insulators. CP190 is required for the functional activity of insulator proteins and is involved in the aggregation of the insulator proteins into specific structures named nuclear speckles. Here, we have shown that the nuclear distribution of CP190 is dependent on the level of EAST protein, an essential component of the interchromatin compartment. EAST interacts with CP190 and Mod(mdg4)-67.2 proteins in vitro and in vivo. Over-expression of EAST in S2 cells leads to an extrusion of the CP190 from the insulator bodies containing Su(Hw), Mod(mdg4)-67.2, and dCTCF. In consistent with the role of the insulator bodies in assembly of protein complexes, EAST over-expression led to a striking decrease of the CP190 binding with the dCTCF and Su(Hw) dependent insulators and promoters. These results suggest that EAST is involved in the regulation of CP190 nuclear localization. PMID:26489095

Measurement of CP Violation in B^{0}→D^{+}D^{-} Decays.

PubMed

Aaij, R; Adeva, B; Adinolfi, M; Ajaltouni, Z; Akar, S; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; An, L; Anderlini, L; Andreassi, G; Andreotti, M; Andrews, J E; Appleby, R B; Archilli, F; d'Argent, P; Arnau Romeu, J; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Babuschkin, I; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Baker, S; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Baszczyk, M; Batozskaya, V; Batsukh, B; Battista, V; Bay, A; Beaucourt, L; Beddow, J; Bedeschi, F; Bediaga, I; Bel, L J; Bellee, V; Belloli, N; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bertolin, A; Betti, F; Bettler, M-O; van Beuzekom, M; Bezshyiko, Ia; Bifani, S; Billoir, P; Bird, T; Birnkraut, A; Bitadze, A; Bizzeti, A; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Boettcher, T; Bondar, A; Bondar, N; Bonivento, W; Borgheresi, A; Borghi, S; Borisyak, M; Borsato, M; Bossu, F; Boubdir, M; Bowcock, T J V; Bowen, E; Bozzi, C; Braun, S; Britsch, M; Britton, T; Brodzicka, J; Buchanan, E; Burr, C; Bursche, A; Buytaert, J; Cadeddu, S; Calabrese, R; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Campora Perez, D H; Capriotti, L; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carniti, P; Carson, L; Carvalho Akiba, K; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cavallero, G; Cenci, R; Charles, M; Charpentier, Ph; Chatzikonstantinidis, G; Chefdeville, M; Chen, S; Cheung, S-F; Chobanova, V; Chrzaszcz, M; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coco, V; Cogan, J; Cogneras, E; Cogoni, V; Cojocariu, L; Collazuol, G; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombs, G; Coquereau, S; Corti, G; Corvo, M; Costa Sobral, C M; Couturier, B; Cowan, G A; Craik, D C; Crocombe, A; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; Da Cunha Marinho, F; Dall'Occo, E; Dalseno, J; David, P N Y; Davis, A; De Aguiar Francisco, O; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Serio, M; De Simone, P; Dean, C-T; Decamp, D; Deckenhoff, M; Del Buono, L; Demmer, M; Derkach, D; Deschamps, O; Dettori, F; Dey, B; Di Canto, A; Dijkstra, H; Dordei, F; Dorigo, M; Dosil Suárez, A; Dovbnya, A; Dreimanis, K; Dufour, L; Dujany, G; Dungs, K; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Déléage, N; Easo, S; Ebert, M; Egede, U; Egorychev, V; Eidelman, S; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; Elsasser, Ch; Ely, S; Esen, S; Evans, H M; Evans, T; Falabella, A; Farley, N; Farry, S; Fay, R; Fazzini, D; Ferguson, D; Fernandez Albor, V; Fernandez Prieto, A; Ferrari, F; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fini, R A; Fiore, M; Fiorini, M; Firlej, M; Fitzpatrick, C; Fiutowski, T; Fleuret, F; Fohl, K; Fontana, M; Fontanelli, F; Forshaw, D C; Forty, R; Franco Lima, V; Frank, M; Frei, C; Fu, J; Furfaro, E; Färber, C; Gallas Torreira, A; Galli, D; Gallorini, S; Gambetta, S; Gandelman, M; Gandini, P; Gao, Y; Garcia Martin, L M; García Pardiñas, J; Garra Tico, J; Garrido, L; Garsed, P J; Gascon, D; Gaspar, C; Gavardi, L; Gazzoni, G; Gerick, D; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gianì, S; Gibson, V; Girard, O G; Giubega, L; Gizdov, K; Gligorov, V V; Golubkov, D; Golutvin, A; Gomes, A; Gorelov, I V; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graverini, E; Graziani, G; Grecu, A; Griffith, P; Grillo, L; Gruberg Cazon, B R; Grünberg, O; Gushchin, E; Guz, Yu; Gys, T; Göbel, C; Hadavizadeh, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Han, X; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hatch, M; He, J; Head, T; Heister, A; Hennessy, K; Henrard, P; Henry, L; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hill, D; Hombach, C; Hopchev, H; Hulsbergen, W; Humair, T; Hushchyn, M; Hussain, N; Hutchcroft, D; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jalocha, J; Jans, E; Jawahery, A; Jiang, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Jurik, N; Kandybei, S; Kanso, W; Karacson, M; Kariuki, J M; Karodia, S; Kecke, M; Kelsey, M; Kenyon, I R; Kenzie, M; Ketel, T; Khairullin, E; Khanji, B; Khurewathanakul, C; Kirn, T; Klaver, S; Klimaszewski, K; Koliiev, S; Kolpin, M; Komarov, I; Koopman, R F; Koppenburg, P; Kosmyntseva, A; Kozachuk, A; Kozeiha, M; Kravchuk, L; Kreplin, K; Kreps, M; Krokovny, P; Kruse, F; Krzemien, W; Kucewicz, W; Kucharczyk, M; Kudryavtsev, V; Kuonen, A K; Kurek, K; Kvaratskheliya, T; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Leflat, A; Lefrançois, J; Lefèvre, R; Lemaitre, F; Lemos Cid, E; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Likhomanenko, T; Lindner, R; Linn, C; Lionetto, F; Liu, B; Liu, X; Loh, D; Longstaff, I; Lopes, J H; Lucchesi, D; Lucio Martinez, M; Luo, H; Lupato, A; Luppi, E; Lupton, O; Lusiani, A; Lyu, X; Machefert, F; Maciuc, F; Maev, O; Maguire, K; Malde, S; Malinin, A; Maltsev, T; Manca, G; Mancinelli, G; Manning, P; Maratas, J; Marchand, J F; Marconi, U; Marin Benito, C; Marino, P; Marks, J; Martellotti, G; Martin, M; Martinelli, M; Martinez Santos, D; Martinez Vidal, F; Martins Tostes, D; Massacrier, L M; Massafferri, A; Matev, R; Mathad, A; Mathe, Z; Matteuzzi, C; Mauri, A; Maurin, B; Mazurov, A; McCann, M; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Melnychuk, D; Merk, M; Merli, A; Michielin, E; Milanes, D A; Minard, M-N; Mitzel, D S; Mogini, A; Molina Rodriguez, J; Monroy, I A; Monteil, S; Morandin, M; Morawski, P; Mordà, A; Morello, M J; Moron, J; Morris, A B; Mountain, R; Muheim, F; Mulder, M; Mussini, M; Müller, D; Müller, J; Müller, K; Müller, V; Naik, P; Nakada, T; Nandakumar, R; Nandi, A; Nasteva, I; Needham, M; Neri, N; Neubert, S; Neufeld, N; Neuner, M; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nieswand, S; Niet, R; Nikitin, N; Nikodem, T; Novoselov, A; O'Hanlon, D P; Oblakowska-Mucha, A; Obraztsov, V; Ogilvy, S; Oldeman, R; Onderwater, C J G; Otalora Goicochea, J M; Otto, A; Owen, P; Oyanguren, A; Pais, P R; Palano, A; Palombo, F; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Pappalardo, L L; Parker, W; Parkes, C; Passaleva, G; Pastore, A; Patel, G D; Patel, M; Patrignani, C; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perret, P; Pescatore, L; Petridis, K; Petrolini, A; Petrov, A; Petruzzo, M; Picatoste Olloqui, E; Pietrzyk, B; Pikies, M; Pinci, D; Pistone, A; Piucci, A; Playfer, S; Plo Casasus, M; Poikela, T; Polci, F; Poluektov, A; Polyakov, I; Polycarpo, E; Pomery, G J; Popov, A; Popov, D; Popovici, B; Poslavskii, S; Potterat, C; Price, E; Price, J D; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Quagliani, R; Rachwal, B; Rademacker, J H; Rama, M; Ramos Pernas, M; Rangel, M S; Raniuk, I; Raven, G; Redi, F; Reichert, S; Dos Reis, A C; Remon Alepuz, C; Renaudin, V; Ricciardi, S; Richards, S; Rihl, M; Rinnert, K; Rives Molina, V; Robbe, P; Rodrigues, A B; Rodrigues, E; Rodriguez Lopez, J A; Rodriguez Perez, P; Rogozhnikov, A; Roiser, S; Rollings, A; Romanovskiy, V; Romero Vidal, A; Ronayne, J W; Rotondo, M; Rudolph, M S; Ruf, T; Ruiz Valls, P; Saborido Silva, J J; Sadykhov, E; Sagidova, N; Saitta, B; Salustino Guimaraes, V; Sanchez Mayordomo, C; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santimaria, M; Santovetti, E; Sarti, A; Satriano, C; Satta, A; Saunders, D M; Savrina, D; Schael, S; Schellenberg, M; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmelzer, T; Schmidt, B; Schneider, O; Schopper, A; Schubert, K; Schubiger, M; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Semennikov, A; Sergi, A; Serra, N; Serrano, J; Sestini, L; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Siddi, B G; Silva Coutinho, R; Silva de Oliveira, L; Simi, G; Simone, S; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, E; Smith, I T; Smith, J; Smith, M; Snoek, H; Sokoloff, M D; Soler, F J P; Souza De Paula, B; Spaan, B; Spradlin, P; Sridharan, S; Stagni, F; Stahl, M; Stahl, S; Stefko, P; Stefkova, S; Steinkamp, O; Stemmle, S; Stenyakin, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Stracka, S; Straticiuc, M; Straumann, U; Sun, L; Sutcliffe, W; Swientek, K; Syropoulos, V; Szczekowski, M; Szumlak, T; T'Jampens, S; Tayduganov, A; Tekampe, T; Teklishyn, M; Tellarini, G; Teubert, F; Thomas, E; van Tilburg, J; Tilley, M J; Tisserand, V; Tobin, M; Tolk, S; Tomassetti, L; Tonelli, D; Topp-Joergensen, S; Toriello, F; Tournefier, E; Tourneur, S; Trabelsi, K; Traill, M; Tran, M T; Tresch, M; Trisovic, A; Tsaregorodtsev, A; Tsopelas, P; Tully, A; Tuning, N; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vacca, C; Vagnoni, V; Valassi, A; Valat, S; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; van Veghel, M; Velthuis, J J; Veltri, M; Veneziano, G; Venkateswaran, A; Vernet, M; Vesterinen, M; Viaud, B; Vieira, D; Vieites Diaz, M; Vilasis-Cardona, X; Volkov, V; Vollhardt, A; Voneki, B; Vorobyev, A; Vorobyev, V; Voß, C; de Vries, J A; Vázquez Sierra, C; Waldi, R; Wallace, C; Wallace, R; Walsh, J; Wang, J; Ward, D R; Wark, H M; Watson, N K; Websdale, D; Weiden, A; Whitehead, M; Wicht, J; Wilkinson, G; Wilkinson, M; Williams, M; Williams, M P; Williams, M; Williams, T; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wraight, K; Wright, S; Wyllie, K; Xie, Y; Xing, Z; Xu, Z; Yang, Z; Yin, H; Yu, J; Yuan, X; Yushchenko, O; Zarebski, K A; Zavertyaev, M; Zhang, L; Zhang, Y; Zhang, Y; Zhelezov, A; Zheng, Y; Zhokhov, A; Zhu, X; Zhukov, V; Zucchelli, S

2016-12-23

The CP violation observables S and C in the decay channel B^{0}→D^{+}D^{-} are determined from a sample of proton-proton collisions at center-of-mass energies of 7 and 8 TeV, collected by the LHCb experiment and corresponding to an integrated luminosity of 3  fb^{-1}. The observable S describes CP violation in the interference between mixing and the decay amplitude, and C parametrizes direct CP violation in the decay. The following values are obtained from a flavor-tagged, decay-time-dependent analysis: S=-0.54_{-0.16}^{+0.17}(stat)±0.05(syst), C=0.26_{-0.17}^{+0.18}(stat)±0.02(syst). These values provide evidence for CP violation at a significance level of 4.0 standard deviations. The phase shift due to higher-order standard model corrections is constrained to a small value of Δϕ=-0.16_{-0.21}^{+0.19}  rad.

Measurement of the CP asymmetry in B - → D s - D 0 and B - → D - D 0 decays

NASA Astrophysics Data System (ADS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albicocco, P.; Albrecht, J.; Alessio, F.; Alexander, M.; Alfonso Albero, A.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Atzeni, M.; Auriemma, G.; Bachmann, S.; Back, J. J.; Baker, S.; Balagura, V.; Baldini, W.; Baranov, A.; Barlow, R. J.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Batozskaya, V.; Battista, V.; Bay, A.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Beiter, A.; Bel, L. J.; Beliy, N.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Beranek, S.; Berezhnoy, A.; Bernet, R.; Berninghoff, D.; Bertholet, E.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M. O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Birnkraut, A.; Bizzeti, A.; Bjørn, M.; Blake, T.; Blanc, F.; Blusk, S.; Bocci, V.; Boente Garcia, O.; Boettcher, T.; Bondar, A.; Bondar, N.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Brodski, M.; Brodzicka, J.; Brundu, D.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Byczynski, W.; Cadeddu, S.; Cai, H.; Calabrese, R.; Calladine, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Chapman, M. G.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Chitic, S.-G.; Chobanova, V.; Chrzaszcz, M.; Chubykin, A.; Ciambrone, P.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collins, P.; Colombo, T.; Comerma-Montells, A.; Contu, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Da Silva, C. L.; Dall'Occo, E.; Dalseno, J.; Danilina, A.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C. T.; Decamp, D.; Del Buono, L.; Delaney, B.; Dembinski, H.-P.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Nezza, P.; Didenko, S.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Douglas, L.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Durante, P.; Durham, J. M.; Dutta, D.; Dzhelyadin, R.; Dziewiecki, M.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Ene, A.; Escher, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fazzini, D.; Federici, L.; Fernandez, G.; Fernandez Declara, P.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Lopes, L.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fontana, M.; Fontanelli, F.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Färber, C.; Gabriel, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; Garcia Plana, B.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianí, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Grabowski, J. P.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greim, R.; Griffith, P.; Grillo, L.; Gruber, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hamilton, B.; Han, X.; Hancock, T. H.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Hasse, C.; Hatch, M.; He, J.; Hecker, M.; Heinicke, K.; Heister, A.; Hennessy, K.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hopchev, P. H.; Hu, W.; Huang, W.; Huard, Z. C.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Ibis, P.; Idzik, M.; Ilten, P.; Ivshin, K.; Jacobsson, R.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kazeev, N.; Kecke, M.; Keizer, F.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kim, K. E.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Klimkovich, T.; Koliiev, S.; Kolpin, M.; Kopecna, R.; Koppenburg, P.; Kotriakhova, S.; Kozeiha, M.; Kravchuk, L.; Kreps, M.; Kress, F.; Krokovny, P.; Krupa, W.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lenisa, P.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, P.-R.; Li, T.; Li, Z.; Liang, X.; Likhomanenko, T.; Lindner, R.; Lionetto, F.; Lisovskyi, V.; Liu, X.; Loh, D.; Loi, A.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Macko, V.; Mackowiak, P.; Maddrell-Mander, S.; Maev, O.; Maguire, K.; Maisuzenko, D.; Majewski, M. W.; Malde, S.; Malecki, B.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Marangotto, D.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Mead, J. V.; Meadows, B.; Meaux, C.; Meier, F.; Meinert, N.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Millard, E.; Minard, M.-N.; Minzoni, L.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Mombächer, T.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morello, G.; Morello, M. J.; Morgunova, O.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nogay, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Ossowska, A.; Otalora Goicochea, J. M.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palutan, M.; Panshin, G.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Pereima, D.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Pietrzyk, B.; Pietrzyk, G.; Pikies, M.; Pinci, D.; Pisani, F.; Pistone, A.; Piucci, A.; Placinta, V.; Playfer, S.; Plo Casasus, M.; Polci, F.; Poli Lener, M.; Poluektov, A.; Polukhina, N.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Ponce, S.; Popov, A.; Popov, D.; Poslavskii, S.; Potterat, C.; Price, E.; Prisciandaro, J.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Pullen, H.; Punzi, G.; Qian, W.; Qin, J.; Quagliani, R.; Quintana, B.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Ratnikov, F.; Raven, G.; Ravonel Salzgeber, M.; Reboud, M.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rinnert, K.; Robbe, P.; Robert, A.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Vidal, J.; Saborido Silva, J. J.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarpis, G.; Sarti, A.; Satriano, C.; Satta, A.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schreiner, H. F.; Schubiger, M.; Schune, M. H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepulveda, E. S.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Skidmore, N.; Skwarnicki, T.; Smith, I. T.; Smith, M.; Soares Lavra, l.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stepanova, M.; Stevens, H.; Stone, S.; Storaci, B.; Stracka, S.; Stramaglia, M. E.; Straticiuc, M.; Straumann, U.; Strokov, S.; Sun, J.; Sun, L.; Swientek, K.; Syropoulos, V.; Szumlak, T.; Szymanski, M.; T'Jampens, S.; Tang, Z.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Tourinho Jadallah Aoude, R.; Tournefier, E.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tully, A.; Tuning, N.; Ukleja, A.; Usachov, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagner, A.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Verlage, T. A.; Vernet, M.; Vesterinen, M.; Viana Barbosa, J. V.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitkovskiy, A.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Walsh, J.; Wang, J.; Wang, M.; Wang, Y.; Wang, Z.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Weisser, C.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M. R. J.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Winn, M.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wyllie, K.; Xiao, D.; Xie, Y.; Xu, A.; Xu, M.; Xu, Q.; Xu, Z.; Xu, Z.; Yang, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zonneveld, J. B.; Zucchelli, S.

2018-05-01

The CP asymmetry in B - → D s - D 0 and B - → D - D 0 decays is measured using LHCb data corresponding to an integrated luminosity of 3.0 fb-1, collected in pp collisions at centre-of-mass energies of 7 and 8 TeV. The results are A^{CP}({B}-\\to {D}_s-{D}^0)=(-0.4± 0.5± 0.5) and A^{CP}({B}-\\to {D}-{D}^0)=(2.3± 2.7± 0.4)% , where the first uncertainties are statistical and the second systematic. This is the first measurement of A^{CP}({B}-\\to {D}_s-{D}^0) and the most precise determination of A^{CP}({B}-\\to {D}-{D}^0) . Neither result shows evidence of CP violation. [Figure not available: see fulltext.

Bioethanol production by heterologous expression of Pdc and AdhII in Streptomyces lividans.

PubMed

Lee, Jae Sun; Chi, Won-Jae; Hong, Soon-Kwang; Yang, Ji-Won; Chang, Yong Keun

2013-07-01

Two genes from Zymomonas mobilis that are responsible for ethanol production, pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adhII), were heterologously expressed in the Gram-positive bacterium Streptomyces lividans TK24. An examination of carbon distribution revealed that a significant portion of carbon metabolism was switched from biomass and organic acid biosynthesis to ethanol production upon the expression of pdc and adhII. The recombinant S. lividans TK24 produced ethanol from glucose with a yield of 23.7% based on the carbohydrate consumed. The recombinant was able to produce ethanol from xylose, L-arabinose, mannose, L-rhamnose, galactose, ribose, and cellobiose with yields of 16.0, 25.6, 21.5, 33.6, 30.6, 14.6, and 33.3%, respectively. Polymeric substances such as starch and xylan were directly converted to ethanol by the recombinant with ethanol yields of 18.9 and 8.8%, respectively. The recombinant S. lividans TK24/Tpet developed in this study is potentially a useful microbial resource for ethanol production from various sources of biomasses, especially microalgae.

Metabolically engineered glucose-utilizing Shewanella strains under anaerobic conditions.

PubMed

Choi, Donggeon; Lee, Sae Bom; Kim, Sohyun; Min, Byoungnam; Choi, In-Geol; Chang, In Seop

2014-02-01

Comparative genome analysis of Shewanella strains predicted that the strains metabolize preferably two- and three-carbon carbohydrates as carbon/electron source because many Shewanella genomes are deficient of the key enzymes in glycolysis (e.g., glucokinase). In addition, all Shewanella genomes are known to have only one set of genes associated with the phosphotransferase system required to uptake sugars. To engineer Shewanella strains that can utilize five- and six-carbon carbohydrates, we constructed glucose-utilizing Shewanella oneidensis MR-1 by introducing the glucose facilitator (glf; ZMO0366) and glucokinase (glk; ZMO0369) genes of Zymomonas mobilis. The engineered MR-1 strain was able to grow on glucose as a sole carbon/electron source under anaerobic conditions. The glucose affinity (Ks) and glucokinase activity in the engineered MR-1 strain were 299.46 mM and 0.259 ± 0.034 U/g proteins. The engineered strain was successfully applied to a microbial fuel cell system and exhibited current generation using glucose as the electron source. Copyright © 2013 Elsevier Ltd. All rights reserved.

Three immobilized-cell columnar bioreactors for enhanced production of commodity chemicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davison, B.H.; Scott, C.D.; Kaufman, E.N.

1993-12-31

Immobilized-cell fluidized-bed bioreactors (FBRs) can be used with a variety of fermentations to increase production of fuels, solvents, organic acids, and other fermentation products. Part of the increased rates and yields are due to the immobilization of the biocatalyst at high concentrations. This FBR system with immobilized Zymomonas mobilis increased ethanol productivity more than tenfold with 99% conversion and near stoichiometric yields. FBRs also offer several additional modes of operation for simultaneous fermentation and separation to further increase production by removing the inhibitory products directly from the continuous fermentation. The production of lactic acid by immobilized Lactobacillus was augmented withmore » the addition and removal of solid adsorbent particles to the FBR. An immiscible organic extractant also was used to extract butanol from the acetone-butanol fermentation by Clostridium acetobutylicum. Demonstrations with these FBR systems have already shown definite advantages by improved overall product yields (decreasing feed costs) and by increased rates (decreasing capital and operating costs). Further demonstration and scale-up continue.« less

Bioethanol production from fermentable sugar juice.

PubMed

Zabed, Hossain; Faruq, Golam; Sahu, Jaya Narayan; Azirun, Mohd Sofian; Hashim, Rosli; Boyce, Amru Nasrulhaq

2014-01-01

Bioethanol production from renewable sources to be used in transportation is now an increasing demand worldwide due to continuous depletion of fossil fuels, economic and political crises, and growing concern on environmental safety. Mainly, three types of raw materials, that is, sugar juice, starchy crops, and lignocellulosic materials, are being used for this purpose. This paper will investigate ethanol production from free sugar containing juices obtained from some energy crops such as sugarcane, sugar beet, and sweet sorghum that are the most attractive choice because of their cost-effectiveness and feasibility to use. Three types of fermentation process (batch, fed-batch, and continuous) are employed in ethanol production from these sugar juices. The most common microorganism used in fermentation from its history is the yeast, especially, Saccharomyces cerevisiae, though the bacterial species Zymomonas mobilis is also potentially used nowadays for this purpose. A number of factors related to the fermentation greatly influences the process and their optimization is the key point for efficient ethanol production from these feedstocks.

Pyruvate decarboxylase and alcohol dehydrogenase overexpression in Escherichia coli resulted in high ethanol production and rewired metabolic enzyme networks.

PubMed

Yang, Mingfeng; Li, Xuefeng; Bu, Chunya; Wang, Hui; Shi, Guanglu; Yang, Xiushan; Hu, Yong; Wang, Xiaoqin

2014-11-01

Pyruvate decarboxylase and alcohol dehydrogenase are efficient enzymes for ethanol production in Zymomonas mobilis. These two enzymes were over-expressed in Escherichia coli, a promising candidate for industrial ethanol production, resulting in high ethanol production in the engineered E. coli. To investigate the intracellular changes to the enzyme overexpression for homoethanol production, 2-DE and LC-MS/MS were performed. More than 1,000 protein spots were reproducibly detected in the gel by image analysis. Compared to the wild-type, 99 protein spots showed significant changes in abundance in the recombinant E. coli, in which 46 were down-regulated and 53 were up-regulated. Most proteins related to tricarboxylic acid cycle, glycerol metabolism and other energy metabolism were up-regulated, whereas proteins involved in glycolysis and glyoxylate pathway were down-regulated, indicating the rewired metabolism in the engineered E. coli. As glycolysis is the main pathway for ethanol production, and it was inhibited significantly in engineered E. coli, further efforts should be directed at minimizing the repression of glycolysis to optimize metabolism network for higher yields of ethanol production.

Bioethanol Production from Fermentable Sugar Juice

PubMed Central

Zabed, Hossain; Faruq, Golam; Sahu, Jaya Narayan; Azirun, Mohd Sofian; Hashim, Rosli; Nasrulhaq Boyce, Amru

2014-01-01

Bioethanol production from renewable sources to be used in transportation is now an increasing demand worldwide due to continuous depletion of fossil fuels, economic and political crises, and growing concern on environmental safety. Mainly, three types of raw materials, that is, sugar juice, starchy crops, and lignocellulosic materials, are being used for this purpose. This paper will investigate ethanol production from free sugar containing juices obtained from some energy crops such as sugarcane, sugar beet, and sweet sorghum that are the most attractive choice because of their cost-effectiveness and feasibility to use. Three types of fermentation process (batch, fed-batch, and continuous) are employed in ethanol production from these sugar juices. The most common microorganism used in fermentation from its history is the yeast, especially, Saccharomyces cerevisiae, though the bacterial species Zymomonas mobilis is also potentially used nowadays for this purpose. A number of factors related to the fermentation greatly influences the process and their optimization is the key point for efficient ethanol production from these feedstocks. PMID:24715820

Study of CP asymmetry in B^{0}-B[over ¯]^{0} mixing with inclusive dilepton events.

PubMed

Lees, J P; Poireau, V; Tisserand, V; Grauges, E; Palano, A; Eigen, G; Stugu, B; Brown, D N; Kerth, L T; Kolomensky, Yu G; Lee, M J; Lynch, G; Koch, H; Schroeder, T; Hearty, C; Mattison, T S; McKenna, J A; So, R Y; Khan, A; Blinov, V E; Buzykaev, A R; Druzhinin, V P; Golubev, V B; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Lankford, A J; Mandelkern, M; Dey, B; Gary, J W; Long, O; Campagnari, C; Franco Sevilla, M; Hong, T M; Kovalskyi, D; Richman, J D; West, C A; Eisner, A M; Lockman, W S; Panduro Vazquez, W; Schumm, B A; Seiden, A; Chao, D S; Cheng, C H; Echenard, B; Flood, K T; Hitlin, D G; Miyashita, T S; Ongmongkolkul, P; Porter, F C; Röhrken, M; Andreassen, R; Huard, Z; Meadows, B T; Pushpawela, B G; Sokoloff, M D; Sun, L; Bloom, P C; Ford, W T; Gaz, A; Smith, J G; Wagner, S R; Ayad, R; Toki, W H; Spaan, B; Bernard, D; Verderi, M; Playfer, S; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Fioravanti, E; Garzia, I; Luppi, E; Piemontese, L; Santoro, V; Calcaterra, A; de Sangro, R; Finocchiaro, G; Martellotti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Contri, R; Lo Vetere, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Bhuyan, B; Prasad, V; Adametz, A; Uwer, U; Lacker, H M; Dauncey, P D; Mallik, U; Chen, C; Cochran, J; Prell, S; Ahmed, H; Gritsan, A V; Arnaud, N; Davier, M; Derkach, D; Grosdidier, G; Le Diberder, F; Lutz, A M; Malaescu, B; Roudeau, P; Stocchi, A; Wormser, G; Lange, D J; Wright, D M; Coleman, J P; Fry, J R; Gabathuler, E; Hutchcroft, D E; Payne, D J; Touramanis, C; Bevan, A J; Di Lodovico, F; Sacco, R; Cowan, G; Bougher, J; Brown, D N; Davis, C L; Denig, A G; Fritsch, M; Gradl, W; Griessinger, K; Hafner, A; Schubert, K R; Barlow, R J; Lafferty, G D; Cenci, R; Hamilton, B; Jawahery, A; Roberts, D A; Cowan, R; Sciolla, G; Cheaib, R; Patel, P M; Robertson, S H; Neri, N; Palombo, F; Cremaldi, L; Godang, R; Sonnek, P; Summers, D J; Simard, M; Taras, P; De Nardo, G; Onorato, G; Sciacca, C; Martinelli, M; Raven, G; Jessop, C P; LoSecco, J M; Honscheid, K; Kass, R; Feltresi, E; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simi, G; Simonetto, F; Stroili, R; Akar, S; Ben-Haim, E; Bomben, M; Bonneaud, G R; Briand, H; Calderini, G; Chauveau, J; Leruste, Ph; Marchiori, G; Ocariz, J; Biasini, M; Manoni, E; Pacetti, S; Rossi, A; Angelini, C; Batignani, G; Bettarini, S; Carpinelli, M; Casarosa, G; Cervelli, A; Chrzaszcz, M; Forti, F; Giorgi, M A; Lusiani, A; Oberhof, B; Paoloni, E; Perez, A; Rizzo, G; Walsh, J J; Lopes Pegna, D; Olsen, J; Smith, A J S; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Pilloni, A; Piredda, G; Bünger, C; Dittrich, S; Grünberg, O; Hess, M; Leddig, T; Voß, C; Waldi, R; Adye, T; Olaiya, E O; Wilson, F F; Emery, S; Vasseur, G; Anulli, F; Aston, D; Bard, D J; Cartaro, C; Convery, M R; Dorfan, J; Dubois-Felsmann, G P; Dunwoodie, W; Ebert, M; Field, R C; Fulsom, B G; Graham, M T; Hast, C; Innes, W R; Kim, P; Leith, D W G S; Lewis, P; Lindemann, D; Luitz, S; Luth, V; Lynch, H L; MacFarlane, D B; Muller, D R; Neal, H; Perl, M; Pulliam, T; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Snyder, A; Su, D; Sullivan, M K; Va'vra, J; Wisniewski, W J; Wulsin, H W; Purohit, M V; White, R M; Wilson, J R; Randle-Conde, A; Sekula, S J; Bellis, M; Burchat, P R; Puccio, E M T; Alam, M S; Ernst, J A; Gorodeisky, R; Guttman, N; Peimer, D R; Soffer, A; Spanier, S M; Ritchie, J L; Ruland, A M; Schwitters, R F; Wray, B C; Izen, J M; Lou, X C; Bianchi, F; De Mori, F; Filippi, A; Gamba, D; Lanceri, L; Vitale, L; Martinez-Vidal, F; Oyanguren, A; Villanueva-Perez, P; Albert, J; Banerjee, Sw; Beaulieu, A; Bernlochner, F U; Choi, H H F; King, G J; Kowalewski, R; Lewczuk, M J; Lueck, T; Nugent, I M; Roney, J M; Sobie, R J; Tasneem, N; Gershon, T J; Harrison, P F; Latham, T E; Band, H R; Dasu, S; Pan, Y; Prepost, R; Wu, S L

2015-02-27

We present a measurement of the asymmetry A_{CP} between same-sign inclusive dilepton samples ℓ^{+}ℓ^{+} and ℓ^{-}ℓ^{-} (ℓ=e, μ) from semileptonic B decays in ϒ(4S)→BB[over ¯] events, using the complete data set recorded by the BABAR experiment near the ϒ(4S) resonance, corresponding to 471×10^{6} BB[over ¯] pairs. The asymmetry A_{CP} allows comparison between the mixing probabilities P(B[over ¯]^{0}→B^{0}) and P(B^{0}→B[over ¯]^{0}), and therefore probes CP and T violation. The result, A_{CP}=[-3.9±3.5(stat)±1.9(syst)]×10^{-3}, is consistent with the standard model expectation.

CP violation in the B system.

PubMed

Gershon, T; Gligorov, V V

2017-04-01

The phenomenon of CP violation is crucial to understand the asymmetry between matter and antimatter that exists in the Universe. Dramatic experimental progress has been made, in particular in measurements of the behaviour of particles containing the b quark, where CP violation effects are predicted by the Kobayashi-Maskawa mechanism that is embedded in the standard model. The status of these measurements and future prospects for an understanding of CP violation beyond the standard model are reviewed.

The CP-PACS Project and Lattice QCD Results

NASA Astrophysics Data System (ADS)

Iwasaki, Y.

The aim of the CP-PACS project was to develop a massively parallel computer for performing numerical research in computational physics with primary emphasis on lattice QCD. The CP-PACS computer with a peak speed of 614 GFLOPS with 2048 processors was completed in September 1996, and has been in full operation since October 1996. We present an overview of the CP-PACS project and describe characteristics of the CP-PACS computer. The CP-PACS has been mainly used for hadron spectroscopy studies in lattice QCD. Main results in lattice QCD simulations are given.

Evidence for landscape-level, pollen-mediated gene flow from genetically modified creeping bentgrass with CP4 EPSPS as a marker

USGS Publications Warehouse

Watrud, L.S.; Lee, E.H.; Fairbrother, A.; Burdick, C.; Reichman, J.R.; Bollman, M.; Storm, M.; King, G.; Van De Water, Peter K.

2004-01-01

Sampling methods and results of a gene flow study are described that will be of interest to plant scientists, evolutionary biologists, ecologists, and stakeholders assessing the environmental safety of transgenic crops. This study documents gene flow on a landscape level from creeping bentgrass (Agrostis stolonifera L.), one of the first wind-pollinated, perennial, and highly outcrossing transgenic crops being developed for commercial use. Most of the gene flow occurred within 2 km in the direction of prevailing winds. The maximal gene flow distances observed were 21 km and 14 km in sentinel and resident plants, respectively, that were located in primarily nonagronomic habitats. The selectable marker used in these studies was the CP4 EPSPS gene derived from Agrobacterium spp. strain CP4 that encodes 5-enol-pyruvylshikimate-3-phosphate synthase and confers resistance to glyphosate herbicide. Evidence for gene flow to 75 of 138 sentinel plants of A. stolonifera and to 29 of 69 resident Agrostis plants was based on seedling progeny survival after spraying with glyphosate in greenhouse assays and positive TraitChek, PCR, and sequencing results. Additional studies are needed to determine whether introgression will occur and whether it will affect the ecological fitness of progeny or the structure of plant communities in which transgenic progeny may become established.

Progressive Changes in a Distributed Neural Circuit Underlie Breathing Abnormalities in Mice Lacking MeCP2.

PubMed

Huang, Teng-Wei; Kochukov, Mikhail Y; Ward, Christopher S; Merritt, Jonathan; Thomas, Kaitlin; Nguyen, Tiffani; Arenkiel, Benjamin R; Neul, Jeffrey L

2016-05-18

Rett syndrome (RTT) is a neurodevelopmental disorder caused by mutations in Methyl-CpG-binding protein 2 (MECP2). Severe breathing abnormalities are common in RTT and are reproduced in mouse models of RTT. Previously, we found that removing MeCP2 from the brainstem and spinal cord in mice caused early lethality and abnormal breathing. To determine whether loss of MeCP2 in functional components of the respiratory network causes specific breathing disorders, we used the Cre/LoxP system to differentially manipulate MeCP2 expression throughout the brainstem respiratory network, specifically within HoxA4-derived tissues, which include breathing control circuitry within the nucleus tractus solitarius and the caudal part of ventral respiratory column but do not include more rostral parts of the breathing control circuitry. To determine whether respiratory phenotypes manifested in animals with MeCP2 removed from specific pons medullary respiratory circuits, we performed whole-body plethysmography and electrophysiological recordings from in vitro brainstem slices from mice lacking MeCP2 in different circuits. Our results indicate that MeCP2 expression in the medullary respiratory network is sufficient for normal respiratory rhythm and preventing apnea. However, MeCP2 expression within components of the breathing circuitry rostral to the HoxA4 domain are neither sufficient to prevent the hyperventilation nor abnormal hypoxic ventilatory response. Surprisingly, we found that MeCP2 expression in the HoxA4 domain alone is critical for survival. Our study reveals that MeCP2 is differentially required in select respiratory components for different aspects of respiratory functions, and collectively for the integrity of this network functions to maintain proper respiration. Breathing abnormalities are a significant clinical feature in Rett syndrome and are robustly reproduced in the mouse models of this disease. Previous work has established that alterations in the function of MeCP

CpG-B Oligodeoxynucleotides Inhibit TLR-Dependent and -Independent Induction of Type I IFN in Dendritic Cells

PubMed Central

Liu, Yi C.; Gray, Reginald C.; Hardy, Gareth A. D.; Kuchtey, John; Abbott, Derek W.; Emancipator, Steven N.; Harding, Clifford V.

2010-01-01

CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type I IFN (IFN-αβ) in dendritic cells (DCs). CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFN-αβ. Because IFN-αβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFN-αβ. In our studies, CpG-B ODN inhibited induction of IFN-αβ by CpG-A ODN, whereas induction of TNF-α and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFN-αβ was observed in FLT3 ligand-induced murine DCs, purified murine myeloid DCs, plasmacytoid DCs, and human PBMCs. CpG-B ODN inhibited induction of IFN-αβ by agonists of multiple receptors, including MyD88-dependent TLRs (CpG-AODN signaling via TLR9, or R837 or Sendai virus signaling via TLR7) and MyD88-independent receptors (polyinosinic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway). CpG-B ODN did not inhibit the IFN-αβ positive feedback loop second-wave IFN-αβ, because IFN-αβ–induced expression of IFN-αβ was unaffected, and CpG-B inhibition of IFN-αβ was manifested in IFN-αβR−/− DCs, which lack the positive feedback mechanism. Rather, CpG-B ODN inhibited early TLR-induced first wave IFN-α4 and IFN-β. Chromatin immunoprecipitation revealed that association of IFN regulatory factor 1 with the IFN-α4 and IFN-β promoters was induced by CpG-A ODN but not CpG-B ODN. Moreover, CpG-A–induced association of IFN regulatory factor 1 with these promoters was inhibited by CpG-B ODN. Our studies demonstrate a novel mechanism of transcriptional regulation of first-wave IFN-αβ that selectively inhibits induction of IFN-αβ downstream of multiple receptors and may provide targets for future therapeutic inhibition of IFN-αβ expression in vivo. PMID:20181884

Standard Model Prediction for Direct CP Violation in K→ππ Decay.

PubMed

Bai, Z; Blum, T; Boyle, P A; Christ, N H; Frison, J; Garron, N; Izubuchi, T; Jung, C; Kelly, C; Lehner, C; Mawhinney, R D; Sachrajda, C T; Soni, A; Zhang, D

2015-11-20

We report the first lattice QCD calculation of the complex kaon decay amplitude A_{0} with physical kinematics, using a 32³×64 lattice volume and a single lattice spacing a, with 1/a=1.3784(68) GeV. We find Re(A_{0})=4.66(1.00)(1.26)×10(-7) GeV and Im(A_{0})=-1.90(1.23)(1.08)×10(-11) GeV, where the first error is statistical and the second systematic. The first value is in approximate agreement with the experimental result: Re(A_{0})=3.3201(18)×10(-7) GeV, while the second can be used to compute the direct CP-violating ratio Re(ϵ^{'}/ϵ)=1.38(5.15)(4.59)×10^{-4}, which is 2.1σ below the experimental value 16.6(2.3)×10(-4). The real part of A_{0} is CP conserving and serves as a test of our method while the result for Re(ϵ^{'}/ϵ) provides a new test of the standard model theory of CP violation, one which can be made more accurate with increasing computer capability.

CpG oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via TLR9-mediated pathways.

PubMed

Qi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-Ki

2013-07-01

Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) analysis were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addition, both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic molecules such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma. Copyright © 2013 Elsevier Ltd. All rights reserved.

Poly-L-arginine synergizes with oligodeoxynucleotides containing CpG-motifs (CpG-ODN) for enhanced and prolonged immune responses and prevents the CpG-ODN-induced systemic release of pro-inflammatory cytokines.

PubMed

Lingnau, Karen; Egyed, Alena; Schellack, Carola; Mattner, Frank; Buschle, Michael; Schmidt, Walter

2002-10-04

This study describes an entirely synthetic vaccine composed of antigenic peptides (T cell epitopes), oligodeoxynucleotides containing CpG-motifs (CpG-ODN) and poly-L-arginine (pR). CpG-ODN are known to be potent inducers of predominantly type 1-like immune responses, while polycationic amino acids, like pR, facilitate the uptake of antigens into antigen presenting cells (APCs). We demonstrate that the application of peptides and pR/CpG-ODN results in strongly enhanced peptide-specific immune responses as compared to the application of peptides with either of the immunomodulators alone. High numbers of antigen-specific T cells can be observed even after only one injection of the vaccine for a remarkably long period of time (at least 372 days). Furthermore, the potentially harmful systemic release of pro-inflammatory cytokines induced upon injection of CpG-ODN is inhibited. Thus, the combined application of CpG-ODN and pR may represent a novel vaccine strategy in humans.

The Physiological Functions and Structural Determinants of Catalytic Bias in the [FeFe]-Hydrogenases CpI and CpII of Clostridium pasteurianum Strain W5.

PubMed

Therien, Jesse B; Artz, Jacob H; Poudel, Saroj; Hamilton, Trinity L; Liu, Zhenfeng; Noone, Seth M; Adams, Michael W W; King, Paul W; Bryant, Donald A; Boyd, Eric S; Peters, John W

2017-01-01

The first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogen production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro , with CpII capturing

CpG DNA: A pathogenic factor in systemic lupus erythematosus?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krieg, A.M.

1995-11-01

Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

Development of TRAIL Resistance by Radiation-Induced Hypermethylation of DR4 CpG Island in Recurrent Laryngeal Squamous Cell Carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jong Cheol; Department of Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan; Lee, Won Hyeok

2014-04-01

Purpose: There are limited therapeutic options for patients with recurrent head and neck cancer after radiation therapy failure. To assess the use of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) as a salvage chemotherapeutic agent for recurrent cancer after radiation failure, we investigated the effect of clinically relevant cumulative irradiation on TRAIL-induced apoptosis. Methods and Materials: Using a previously established HN3 cell line from a laryngeal carcinoma patient, we generated a chronically irradiated HN3R isogenic cell line. Viability and apoptosis in HN3 and HN3R cells treated with TRAIL were analyzed with MTS and PI/annexin V-FITC assays. Western blotting and flow cytometry weremore » used to determine the underlying mechanism of TRAIL resistance. DR4 expression was semiquantitatively scored in a tissue microarray with 107 laryngeal cancer specimens. Methylation-specific polymerase chain reaction and bisulfite sequencing for DR4 were performed for genomic DNA isolated from each cell line. Results: HN3R cells were more resistant than HN3 cells to TRAIL-induced apoptosis because of significantly reduced levels of the DR4 receptor. The DR4 staining score in 37 salvage surgical specimens after radiation failure was lower in 70 surgical specimens without radiation treatment (3.03 ± 2.75 vs 5.46 ± 3.30, respectively; P<.001). HN3R cells had a methylated DR4 CpG island that was partially demethylated by the DNA demethylating agent 5-aza-2′-deoxycytidine. Conclusion: Epigenetic silencing of the TRAIL receptor by hypermethylation of a DR4 CpG island might be an underlying mechanism for TRAIL resistance in recurrent laryngeal carcinoma treated with radiation.« less

Kinetic and mechanistic aspects of propene oligomerization with ionic organozirconium and -hafnium compounds: Crystal structures of [Cp* {sub 2}MMe(THT)]{sup +}[BPh{sub 4}]{sup {minus}} (M=Zr, Hf)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eshuis, J.J.W.; Tan, Y.Y.; Meetsma, A.

1992-01-01

In N,N-dimethylaniline the ionic complexes [Cp{sup *}{sub 2}MMe(THT)]{sup +}[BPh{sub 4}]{sup {minus}}(M=Zr,Hf) oligomerize propene to low molecular weight oligomers. At room temperature for M = Zr a rather broad molecular weight distribution is obtained (C{sub 6} to C{sub 24}), whereas for M = Hf only one dimer (4-methyl-1-pentene) and one trimer (4,6-dimethyl-1-heptene) are formed. With an increase in temperature the product composition shifts to lower molecular weights, but the specific formation of head-to-tail oligomers is retained. The oligomers are formed by {beta}-Me transfer from the growing oligopropene alkyl chain to the metal center. The molecular weight distributions of the oligomers producedmore » at temperature between 5 and 45 {degrees}C are satisfactorily described by the Flory-Schulz theory. This allows the calculation of ratios of rate coefficients for propagation (k{sub p}) and termination (k{sub t}). Inactivation of the catalysts is caused by two different mechanisms. At room temperature allylic C-H activation of monomer and isobutene (formed by a minor {beta}-H transfer termination) gives inactive (meth) allyl compounds, [Cp{sup *} {sub 2}M({eta}{sup 3}-C{sub 3}H{sub 5})]{sup +} and [Cp{sup *}{sub 2}M({eta}{sup 3}-C{sub 4}H{sub 7})]{sup +} (M = Zr, Hf). At elevated temperatures (>45 {degrees}C) catalytically inactive zwitterionic complexes Cp{sup *}{sub M}{sup +}-m-C{sub 6}H{sub 4}-BPh{sub 3}{sup {minus}}(M = Zr, Hf) are formed through aromatic C-H activation. Reactivation of the inactive (meth)allyl complexes can be achieved by addition of hydrogen to the oligomerization mixtures. 38 refs., 4 figs., 7 tabs.« less

Influence of the presence of Zymomonas anaerobia on the conversion of cellobiose, glucose, and xylose to ethanol by Clostridium saccharolyticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asther, M.; Khan, A.W.

1984-01-01

To convert sugar mixtures containing cellobiose, glucose, and xylose to ethanol in a single step, the possibility of using a coculture consisting of Clostridium saccharolyticum and Zymomonas anaerobia was studied. In monoculture, C. saccharolyticum utilized all three sugars; however, it preferentially utilized glucose and produced acetic acid in addition to ethanol. The formation of acetic acid from the metabolism of glucose inhibited the growth of C. saccharolyticum and, consequently, the utilization of cellobiose and xylose. In monoculture, Z. anaerobia utilized glucose at a rate of 50 g/L day, but it did not ferment cellobiose or xylose. In coculture, Z. anaerobiamore » converted most of the glucose to ethanol during the lag phase of growth of C. saccharolyticum, which then converted cellobiose and xylose to ethanol. The use of this coculture increased both the rate and the efficiency of the conversion of these three sugars to ethanol, and produced relatively small amounts of acetic acid.« less

Synthesis of Ruthenium Carbonyl Complexes with Phosphine or Substituted Cp Ligands, and Their Activity in the Catalytic Deoxygenation of 1,2-Propanediol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bullock, R.M.; Ghosh, P.; Fagan, P.J.

2009-07-20

A ruthenium hydride with a bulky tetra-substituted Cp ligand, (Cp{sup iPr{sub 4}})Ru(CO){sub 2}H (Cp{sup iPr{sub 4}} = C{sub 5}(i-C{sub 3}H{sub 7}){sub 4}H) was prepared from the reaction of Ru{sub 3}(CO){sub 12} with 1,2,3,4-tetraisopropylcyclopentadiene. The molecular structure of (Cp{sup iPr{sub 4}})Ru(CO){sub 2}H was determined by X-ray crystallography. The ruthenium hydride complex (C{sub 5}Bz{sub 5})Ru(CO){sub 2}H (Bz = CH{sub 2}Ph) was similarly prepared. The Ru-Ru bonded dimer, [(1,2,3-trimethylindenyl)Ru(CO){sub 2}]{sub 2}, was produced from the reaction of 1,2,3-trimethylindene with Ru{sub 3}(CO){sub 12}, and protonation of this dimer with HOTf gives {l_brace}[(1,2,3-trimethylindenyl)Ru(CO){sub 2}]{sub 2}-({mu}-H){r_brace}{sup +}OTf{sup -}. A series of ruthenium hydride complexes CpRu(CO)(L)H [Lmore » = P(OPh){sub 3}, PCy{sub 3}, PMe{sub 3}, P(p-C{sub 6}H{sub 4}F){sub 3}] were prepared by reaction of Cp(CO){sub 2}RuH with added L. Protonation of (Cp{sup iPr{sub 4}})Ru(CO){sub 2}H, Cp*Ru(CO){sub 2}H, or CpRu(CO)[P-(OPh){sub 3}]H by HOTf at -80 C led to equilibria with the cationic dihydrogen complexes, but H{sub 2} was released at higher temperatures. Protonation of CpRu[P(OPh){sub 3}]{sub 2}H with HOTf gave an observable dihydrogen complex, {l_brace}CpRu[P-(OPh){sub 3}]{sub 2}({eta}{sup 2}-H{sub 2}){r_brace}+OTf{sup -} that was converted at -20 C to the dihydride complex {l_brace}CpRu[P(OPh){sub 3}]{sub 2}(H){sub 2}{r_brace}{sup +}OTf{sup -}. These Ru complexes serve as catalyst precursors for the catalytic deoxygenation of 1,2-propanediol to give n-propanol. The catalytic reactions were carried out in sulfolane solvent with added HOTf under H{sub 2} (750 psi) at 110 C.« less

Domain wall fermion and CP symmetry breaking

NASA Astrophysics Data System (ADS)

Fujikawa, Kazuo; Suzuki, Hiroshi

2003-02-01

We examine the CP properties of chiral gauge theory defined by a formulation of the domain wall fermion, where the light field variables q and q¯ together with Pauli-Villars fields Q and Q¯ are utilized. It is shown that this domain wall representation in the infinite flavor limit N=∞ is valid only in the topologically trivial sector, and that the conflict among lattice chiral symmetry, strict locality and CP symmetry still persists for finite lattice spacing a. The CP transformation generally sends one representation of lattice chiral gauge theory into another representation of lattice chiral gauge theory, resulting in the inevitable change of propagators. A modified form of lattice CP transformation motivated by the domain wall fermion, which keeps the chiral action in terms of the Ginsparg-Wilson fermion invariant, is analyzed in detail; this provides an alternative way to understand the breaking of CP symmetry at least in the topologically trivial sector. We note that the conflict with CP symmetry could be regarded as a topological obstruction. We also discuss the issues related to the definition of Majorana fermions in connection with the supersymmetric Wess-Zumino model on the lattice.

Induction of the chemotactic S100 protein, CP-10, in monocyte/macrophages by lipopolysaccharide.

PubMed

Hu, S P; Harrison, C; Xu, K; Cornish, C J; Geczy, C L

1996-05-01

The murine S100 protein CP-10 is a potent chemotactic factor for murine and human myeloid cells in vivo and in vitro. This is the first report describing regulations of the CP-10 gene by a proinflammatory stimulus, lipopolysaccharide (LPS), in cells of the monocyte/macrophage lineage. Murine monocyte/macrophage-like WEHI 265 and RAW 264.7 cells preexposed to 5 to 50 ng/mL LPS expressed significant levels of CP-10 mRNA 4 hours, and maximal at 20 hours, after a secondary LPS challenge. This was accompanied by increasing levels of cell-associated and released CP-10 protein. In contrast, a single dose of LPS upregulated CP-10 mRNA in elicited peritoneal macrophages, whereas mRNA and protein levels decreased following LPS challenge. The state of macrophage differentiation may control responsiveness as LPS had no effect on CP-10 basal levels in bone marrow derived macrophages. LPS-induced CP-10 expression was controlled at the transcriptional level and nuclear run-on and protein synthesis inhibition assays indicated that LPS priming and challenge of RAW cells occurred via distinct pathways. MRP14, another S100 protein generally coordinately expressed with human MRP8, was not induced by LPS under the same conditions. We propose that CP-10 may play a key role in recruitment of leukocytes into tissues in response to gram-negative bacterial infection.

Profile of refractive errors in cerebral palsy: impact of severity of motor impairment (GMFCS) and CP subtype on refractive outcome.

PubMed

Saunders, Kathryn J; Little, Julie-Anne; McClelland, Julie F; Jackson, A Jonathan

2010-06-01

To describe refractive status in children and young adults with cerebral palsy (CP) and relate refractive error to standardized measures of type and severity of CP impairment and to ocular dimensions. A population-based sample of 118 participants aged 4 to 23 years with CP (mean 11.64 +/- 4.06) and an age-appropriate control group (n = 128; age, 4-16 years; mean, 9.33 +/- 3.52) were recruited. Motor impairment was described with the Gross Motor Function Classification Scale (GMFCS), and subtype was allocated with the Surveillance of Cerebral Palsy in Europe (SCPE). Measures of refractive error were obtained from all participants and ocular biometry from a subgroup with CP. A significantly higher prevalence and magnitude of refractive error was found in the CP group compared to the control group. Axial length and spherical refractive error were strongly related. This relation did not improve with inclusion of corneal data. There was no relation between the presence or magnitude of spherical refractive errors in CP and the level of motor impairment, intellectual impairment, or the presence of communication difficulties. Higher spherical refractive errors were significantly associated with the nonspastic CP subtype. The presence and magnitude of astigmatism were greater when intellectual impairment was more severe, and astigmatic errors were explained by corneal dimensions. Conclusions. High refractive errors are common in CP, pointing to impairment of the emmetropization process. Biometric data support this In contrast to other functional vision measures, spherical refractive error is unrelated to CP severity, but those with nonspastic CP tend to demonstrate the most extreme errors in refraction.

Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

PubMed Central

Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

2000-01-01

Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

The Physiological Functions and Structural Determinants of Catalytic Bias in the [FeFe]-Hydrogenases CpI and CpII of Clostridium pasteurianum Strain W5

DOE PAGES

Therien, Jesse B.; Artz, Jacob H.; Poudel, Saroj; ...

2017-07-12

Here, the first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogenmore » production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro, with Cp

The Physiological Functions and Structural Determinants of Catalytic Bias in the [FeFe]-Hydrogenases CpI and CpII of Clostridium pasteurianum Strain W5

PubMed Central

Therien, Jesse B.; Artz, Jacob H.; Poudel, Saroj; Hamilton, Trinity L.; Liu, Zhenfeng; Noone, Seth M.; Adams, Michael W. W.; King, Paul W.; Bryant, Donald A.; Boyd, Eric S.; Peters, John W.

2017-01-01

The first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogen production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro, with CpII capturing excess

Induction of anti-glioma natural killer cell response following multiple low-dose intracerebral CpG therapy.

PubMed

Alizadeh, Darya; Zhang, Leying; Brown, Christine E; Farrukh, Omar; Jensen, Michael C; Badie, Behnam

2010-07-01

Stimulation of toll-like receptor-9 by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN, which can induce toxicity in a clinical setting. The goal of this study was to evaluate the antitumor efficacy of multiple low-dose intratumoral CpG-ODN in a glioma model. Mice bearing 4-day-old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 microg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months) and were protected from intracranial rechallenge with GL261 gliomas, showing the capacity for long-term antitumor immunity. Although most inflammatory cells seemed to increase, activated natural killer (NK) cells (i.e., NK(+)CD107a(+)) were more frequent than CD8(+)CD107a(+) in the brains of rechallenged CpG-ODN-treated animals and showed a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN antitumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK-mediated effector function.

Hemilability of the 1,2-Bis(dimethylphosphino)ethane (dmpe) Ligand in Cp*Mo(NO)(κ2-dmpe).

PubMed

Holmes, Aaron S; Patrick, Brian O; Levesque, Taleah M; Legzdins, Peter

2017-09-18

Reaction of Cp*Mo(NO)Cl 2 with 1 equiv of 1,2-bis(dimethylphosphino)ethane (dmpe) in THF at ambient temperature forms [Cp*Mo(NO)(Cl)(κ 2 -dmpe)]Cl (1), which is isolable as an analytically pure yellow powder in 65% yield. Further addition of 2 equiv of Cp 2 Co to 1 in CH 2 Cl 2 affords dark red Cp*Mo(NO)(κ 2 -dmpe) (2), which was isolated in 36% yield by recrystallization from Et 2 O at -30 °C. Reaction of a benzene solution of 2 with an equimolar amount of elemental sulfur results in the immediate production of dark blue (μ-S)[Cp*Mo(NO)(κ 1 -dmpeS)] 2 (3), which is a rare example of a bimetallic transition-metal complex bridged by only a single sulfur atom and involving Mo═S═Mo bonding. In contrast, reaction of 2 with an excess of sulfur in benzene results in the formation of Cp*Mo(NO)(η 2 -S 2 )(κ 1 -dmpeS) (4). Complex 4 can also be formed by the addition of elemental sulfur to 3, thereby indicating that 3 is a precursor to 4. Cp*Mo(NO)(κ 2 -dmpe) (2) also undergoes interesting transformations when treated with organic bromides. For instance, reaction of 2 with 5 equiv benzyl bromide in THF produces the bimetallic complex (μ-dmpe)[Cp*Mo(NO)Br 2 ] 2 (5) and bibenzyl after 4 d at 70 °C probably via radical intermediates. In contrast to its reaction with benzyl bromide, complex 2 forms [Mo(NO)Br 2 (κ 2 -dmpe)] 2 (6), olefin, alkane, and Cp*H when treated with 5 equiv of 1-bromopropane or 1-bromooctane in THF at 70 °C for 72 h. Interestingly, complex 2 does not display any reactivity with bromobenzene or 1-bromoadamantane even after being heated for several days at 70 °C. All new complexes were characterized by conventional spectroscopic and analytical methods, and the solid-state molecular structures of most of them were established by single-crystal X-ray crystallographic analyses.

Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

PubMed

Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

2016-12-01

For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Unified models of neutrinos, flavour and CP Violation

NASA Astrophysics Data System (ADS)

King, S. F.

2017-05-01

Recent data from neutrino experiments gives intriguing hints about the mass ordering, the CP violating phase and non-maximal atmospheric mixing. There seems to be a (one sigma) preference for a normal ordered (NO) neutrino mass pattern, with a CP phase δ = - 100 ° ± 50 °, and (more significantly) non-maximal atmospheric mixing. Global fits for the NO case yield lepton mixing angle one sigma ranges: θ23 ≈ 41.4 ° ± 1.6 °, θ12 ≈ 33.2 ° ± 1.2 °, θ13 ≈ 8.45 ° ± 0.15 °. Cosmology gives a limit on the total of the three masses to be below about 0.23 eV, favouring hierarchical neutrino masses over quasi-degenerate masses. Given such experimental advances, it seems an opportune moment to review the theoretical status of attempts to explain such a pattern of neutrino masses and lepton mixing, focusing on approaches based on the four pillars of: predictivity, minimality, robustness and unification. Predictivity can result from various mixing sum rules whose status is reviewed. Minimality can follow from the type I seesaw mechanism, including constrained sequential dominance of right-handed (RH) neutrinos, and the littlest seesaw model. Robustness requires enforcing a discrete CP and non-Abelian family symmetry, spontaneously broken by flavons with the symmetry preserved in a semi-direct way. Unification can account for all lepton and quark masses, mixing angles and CP phases, as in Supersymmetric Grand Unified Theories of Flavour, with possible string theory origin.

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

Strengthening Mechanisms in Nanostructured Al/SiCp Composite Manufactured by Accumulative Press Bonding

NASA Astrophysics Data System (ADS)

Amirkhanlou, Sajjad; Rahimian, Mehdi; Ketabchi, Mostafa; Parvin, Nader; Yaghinali, Parisa; Carreño, Fernando

2016-10-01

The strengthening mechanisms in nanostructured Al/SiCp composite deformed to high strain by a novel severe plastic deformation process, accumulative press bonding (APB), were investigated. The composite exhibited yield strength of 148 MPa which was 5 and 1.5 times higher than that of raw aluminum (29 MPa) and aluminum-APB (95 MPa) alloys, respectively. A remarkable increase was also observed in the ultimate tensile strength of Al/SiCp-APB composite, 222 MPa, which was 2.5 and 1.2 times greater than the obtained values for raw aluminum (88 MPa) and aluminum-APB (180 MPa) alloys, respectively. Analytical models well described the contribution of various strengthening mechanisms. The contributions of grain boundary, strain hardening, thermal mismatch, Orowan, elastic mismatch, and load-bearing strengthening mechanisms to the overall strength of the Al/SiCp microcomposite were 64.9, 49, 6.8, 2.4, 5.4, and 1.5 MPa, respectively. Whereas Orowan strengthening mechanism was considered as the most dominating strengthening mechanism in Al/SiCp nanocomposites, it was negligible for strengthening the microcomposite. Al/SiCp nanocomposite showed good agreement with quadratic summation model; however, experimental results exhibited good accordance with arithmetic and compounding summation models in the microcomposite. While average grain size of the composite reached 380 nm, it was less than 100 nm in the vicinity of SiC particles as a result of particle-stimulated nucleation mechanism.

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Transdermal permeation of WIN 55,212-2 and CP 55,940 in human skin in vitro.

PubMed

Valiveti, Satyanarayana; Kiptoo, Paul K; Hammell, Dana C; Stinchcomb, Audra L

2004-06-18

Synthetic cannabinoids have a promising future as treatments for nausea, appetite modulation, pain, and many neurological disorders. Transdermal delivery is a convenient and desirable dosage form for these drugs and health conditions. The aim of the present study was to investigate the in vitro transdermal permeation of two synthetic cannabinoids, WIN 55,212-2 and CP 55,940. Transdermal flux, drug content in the skin, and lag times were measured in split-thickness human abdominal skin in flow-through diffusion cells with receiver solutions of 4% bovine serum albumin (BSA) or 0.5% Brij 98. Differential thermal analysis (DSC) was performed in order to determine heats of fusion, melting points, and relative thermodynamic activities. The in vitro diffusion studies in 0.5% Brij 98 indicated that WIN 55,212-2 diffuses across human skin faster than CP 55,940. The WIN 55,212-2 skin disposition concentration levels were also significantly higher than that of CP 55,940. Correspondingly, CP 55,940 was significantly metabolized in the skin. WIN 55,212-2 flux and skin disposition were significantly lower into 4% BSA than into 0.5% Brij 98 receiver solutions. There was no significant difference in the flux, lag time, and drug content in the skin of CP 55,940 in 4% BSA versus 0.5% Brij 98 receiver solutions. The DSC studies showed that CP 55,940 had a significantly lower melting point, smaller heat of fusion, and corresponding higher calculated thermodynamic activity than the more crystalline WIN 55,212-2 mesylate salt. The permeation results indicated that WIN 55,212-2 mesylate, CP 55,940, and other potent synthetic cannabinoids with these physicochemical properties could be ideal candidates for the development of a transdermal therapeutic system. Copyright 2004 Elsevier B.V.

Host and symbiont intraspecific variability: The case of Paramecium calkinsi and "Candidatus Trichorickettsia mobilis".

PubMed

Sabaneyeva, E; Castelli, M; Szokoli, F; Benken, K; Lebedeva, N; Salvetti, A; Schweikert, M; Fokin, S; Petroni, G

2018-02-01

Newly isolated strains of the ciliate Paramecium calkinsi and their cytoplasmic bacterial endosymbionts were characterized by a multidisciplinary approach, including live observation, ultrastructural investigation, and molecular analysis. Despite morphological resemblance, the characterized P. calkinsi strains showed a significant molecular divergence compared to conspecifics, possibly hinting for a cryptic speciation. The endosymbionts were clearly found to be affiliated to the species "Candidatus Trichorickettsia mobilis" (Rickettsiales, Rickettsiaceae), currently encompassing only bacteria retrieved in an obligate intracellular association with other ciliates. However, a relatively high degree of intraspecific divergence was observed as well, thus it was possible to split "Candidatus Trichorickettsia" into three subspecies, one of which represented so far only by the newly characterized endosymbionts of P. calkinsi. Other features distinguished the members of each different subspecies. In particular, the endosymbionts of P. calkinsi resided in the cytoplasm and possessed numerous peritrichous flagella, although no motility was evidenced, whereas their conspecifics in other hosts were either cytoplasmic and devoid of flagella, or macronuclear, displaying flagellar-driven motility. Moreover, contrarily to previously analyzed "Candidatus Trichorickettsia" hosts, infected P. calkinsi cells frequently became amicronucleate and demonstrated abnormal cell division, eventually leading to decline of the laboratory culture. Copyright © 2017 Elsevier GmbH. All rights reserved.

The interaction of fentanyl on the Cp50 of propofol for loss of consciousness and skin incision.

PubMed

Smith, C; McEwan, A I; Jhaveri, R; Wilkinson, M; Goodman, D; Smith, L R; Canada, A T; Glass, P S

1994-10-01

We have previously demonstrated that the minimum alveolar concentration of isoflurane at 1 atm that is required to prevent movement in 50% of patients or animals exposed to a maximal noxious stimulus is markedly reduced by increasing fentanyl concentrations. Total intravenous anesthesia with propofol is increasing in popularity, yet the propofol concentrations required for total intravenous anesthesia or the interaction between propofol and fentanyl have not yet been defined. Propofol and fentanyl were administered via computer-assisted continuous infusion to provide pseudo-steady-state concentrations and allow equilibration between plasma-blood concentration and their biophase concentration. For the induction of anesthesia patients were randomly allocated to receive propofol only or propofol plus fentanyl 0.2, 0.8, 1.5, 3.0, and 4.5 ng/ml. In each group patients were randomized to target propofol concentrations of 1.5-10 micrograms/ml. At 7 and 10 min arterial blood samples were taken for subsequent measurement of propofol and fentanyl concentrations. At 10 min loss of consciousness was assessed by the patients' ability to respond to a simple verbal command. Thereafter a new target concentration of propofol was entered to ensure loss of consciousness, and succinylcholine was administered to facilitate tracheal intubation. Patients were rerandomized to a new target concentration of propofol (1-19 micrograms/ml) until skin incision. Before skin incision and 1 min after skin incision, arterial blood samples were again obtained for subsequent measurement of fentanyl and propofol concentrations. At skin incision and for 1 min the patient was observed for purposeful movement. Only samples in which the pre- and poststimulus drug concentrations were within 35% of each other were included. The propofol blood concentration at which 50% or 95% of patients did not respond to verbal command (Cp50s and Cp95s, respectively) and to skin incision (Cp50i and Cp95i, respectively

Revisiting and re-engineering the classical zinc finger peptide: consensus peptide-1 (CP-1).

PubMed

Besold, Angelique N; Widger, Leland R; Namuswe, Frances; Michalek, Jamie L; Michel, Sarah L J; Goldberg, David P

2016-04-01

Zinc plays key structural and catalytic roles in biology. Structural zinc sites are often referred to as zinc finger (ZF) sites, and the classical ZF contains a Cys2His2 motif that is involved in coordinating Zn(II). An optimized Cys2His2 ZF, named consensus peptide 1 (CP-1), was identified more than 20 years ago using a limited set of sequenced proteins. We have reexamined the CP-1 sequence, using our current, much larger database of sequenced proteins that have been identified from high-throughput sequencing methods, and found the sequence to be largely unchanged. The CCHH ligand set of CP-1 was then altered to a CAHH motif to impart hydrolytic activity. This ligand set mimics the His2Cys ligand set of peptide deformylase (PDF), a hydrolytically active M(II)-centered (M = Zn or Fe) protein. The resultant peptide [CP-1(CAHH)] was evaluated for its ability to coordinate Zn(II) and Co(II) ions, adopt secondary structure, and promote hydrolysis. CP-1(CAHH) was found to coordinate Co(II) and Zn(II) and a pentacoordinate geometry for Co(II)-CP-1(CAHH) was implicated from UV-vis data. This suggests a His2Cys(H2O)2 environment at the metal center. The Zn(II)-bound CP-1(CAHH) was shown to adopt partial secondary structure by 1-D (1)H NMR spectroscopy. Both Zn(II)-CP-1(CAHH) and Co(II)-CP-1(CAHH) show good hydrolytic activity toward the test substrate 4-nitrophenyl acetate, exhibiting faster rates than most active synthetic Zn(II) complexes.

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG Pattern

Immunization against leishmaniasis by PLGA nanospheres encapsulated with autoclaved Leishmania major (ALM) and CpG-ODN.

PubMed

Tafaghodi, Mohsen; Khamesipour, Ali; Jaafari, Mahmoud R

2011-05-01

Various adjuvants and delivery systems have been evaluated for increasing the protective immune responses against leishmaniasis and mostly have been shown not to be effective enough. In this study, poly(D,L-lactide-co-glycolide) (PLGA) nanospheres as an antigen delivery system and CpG-ODN as an immunoadjuvant have been used for the first time to enhance the immune response against autoclaved Leishmania major (ALM). PLGA nanospheres were prepared by a double-emulsion (W/O/W) technique. Particulate characteristics were studied by scanning electron microscopy and particle size analysis. Mean diameter of ALM + CpG-ODN-loaded nanospheres was 300 ± 128 nm. BALB/c mice were immunized three times in 3-week intervals using ALM plus CpG-ODN-loaded nanospheres [(ALM + CpG-ODN)(PLGA)], ALM encapsulated PLGA nanospheres [(ALM)(PLGA)], (ALM)(PLGA) + CpG, ALM + CpG, ALM alone, or phosphate buffer solution (PBS). The intensity of infection induced by L. major challenge was assessed by measuring size of footpad swelling. The strongest protection, showed by significantly (P<0.05) smaller footpad, was observed in mice immunized with (ALM + CpG-ODN)(PLGA). The (ALM)(PLGA), (ALM)(PLGA) + CpG, and ALM + CpG were also showed a significantly (P<0.05) smaller footpad swelling compared to the groups received either PBS or ALM alone. The mice immunized with (ALM + CpG-ODN)(PLGA), (ALM)(PLGA) + CpG, and ALM + CpG showed the highest IgG2a/IgG1 ratio, interferon-γ production, and lowest interleukin-4 production compared to the other groups. It is concluded that when both PLGA nanospheres and CpG-ODN adjuvants were used simultaneously, it induce stronger immune response and enhance protection rate against Leishmania infection.

Bangladesh Cerebral Palsy Register (BCPR): a pilot study to develop a national cerebral palsy (CP) register with surveillance of children for CP.

PubMed

Khandaker, Gulam; Smithers-Sheedy, Hayley; Islam, Johurul; Alam, Monzurul; Jung, Jenny; Novak, Iona; Booy, Robert; Jones, Cheryl; Badawi, Nadia; Muhit, Mohammad

2015-09-25

The causes and pathogenesis of cerebral palsy (CP) are all poorly understood, particularly in low- and middle-income countries (LMIC). There are gaps in knowledge about CP in Bangladesh, especially in the spheres of epidemiological research, intervention and service utilization. In high-income countries CP registers have made substantial contributions to our understanding of CP. In this paper, we describe a pilot study protocol to develop, implement, and evaluate a CP population register in Bangladesh (i.e., Bangladesh Cerebral Palsy Register - BCPR) to facilitate studies on prevalence, severity, aetiology, associated impairments and risk factors for CP. The BCPR will utilise a modified version of the Australian Cerebral Palsy Register (ACPR) on a secured web-based platform hosted by the Cerebral Palsy Alliance Research Institute, Australia. A standard BCPR record form (i.e., data collection form) has been developed in consultation with local and international experts. Using this form, the BPCR will capture information about maternal health, birth history and the nature of disability in all children with CP aged <18 years. The pilot will be conducted in the Shahjadpur sub-district of Sirajgonj district in the northern part of Bangladesh. There are 296 villages in Shahjadpur, a total population of 561,076 (child population ~ 226,114), an estimated 70,998 households and 12,117 live births per annum. Children with CP will be identified by using the community based Key Informants Method (KIM). Data from the completed BPCR record together with details of assessment by a research physician will be entered into an online data repository. Once implemented, BCPR will be, to the best of our knowledge, the first formalised CP register from a LMIC. Establishment of the BCPR will enable estimates of prevalence; facilitate clinical surveillance and promote research to improve the care of individuals with CP in Bangladesh.

Registration of 'CP 09-2392' Sugarcane

USDA-ARS?s Scientific Manuscript database

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

Observation of D^{0}→ρ^{0}γ and Search for CP Violation in Radiative Charm Decays.

PubMed

Nanut, T; Zupanc, A; Adachi, I; Aihara, H; Al Said, S; Asner, D M; Aulchenko, V; Aushev, T; Ayad, R; Babu, V; Badhrees, I; Bakich, A M; Bansal, V; Behera, P; Bhardwaj, V; Biswal, J; Bondar, A; Bozek, A; Bračko, M; Browder, T E; Červenkov, D; Chekelian, V; Chen, A; Cheon, B G; Chistov, R; Cho, K; Choi, S-K; Choi, Y; Cinabro, D; Dash, N; Di Carlo, S; Doležal, Z; Dutta, D; Eidelman, S; Farhat, H; Fast, J E; Ferber, T; Fulsom, B G; Gaur, V; Gabyshev, N; Garmash, A; Gillard, R; Goldenzweig, P; Golob, B; Hayasaka, K; Hayashii, H; Hou, W-S; Iijima, T; Inami, K; Inguglia, G; Ishikawa, A; Iwasaki, Y; Jacobs, W W; Jaegle, I; Joffe, D; Joo, K K; Julius, T; Kaliyar, A B; Kang, K H; Kawasaki, T; Kim, D Y; Kim, J B; Kim, K T; Kim, M J; Kim, S H; Kinoshita, K; Kodyš, P; Korpar, S; Krokovny, P; Kuhr, T; Kulasiri, R; Kuzmin, A; Kwon, Y-J; Lange, J S; Lee, I S; Li, C H; Li, L; Li, Y; Li Gioi, L; Libby, J; Liventsev, D; Lubej, M; Masuda, M; Matsuda, T; Matvienko, D; Miyabayashi, K; Miyata, H; Mizuk, R; Mohanty, G B; Moon, H K; Nakao, M; Nath, K J; Nayak, M; Nisar, N K; Nishida, S; Ogawa, S; Okuno, S; Pakhlov, P; Pakhlova, G; Pal, B; Park, C-S; Park, C W; Park, H; Paul, S; Pedlar, T K; Pesántez, L; Pestotnik, R; Petrič, M; Piilonen, L E; Prasanth, K; Pulvermacher, C; Rauch, J; Ritter, M; Rostomyan, A; Sakai, Y; Sandilya, S; Santelj, L; Sanuki, T; Sato, Y; Savinov, V; Schlüter, T; Schneider, O; Schnell, G; Schwanda, C; Schwartz, A J; Seino, Y; Senyo, K; Seon, O; Sevior, M E; Shebalin, V; Shen, C P; Shibata, T-A; Shiu, J-G; Shwartz, B; Solovieva, E; Stanič, S; Starič, M; Strube, J F; Stypula, J; Sumiyoshi, T; Takizawa, M; Tamponi, U; Tenchini, F; Trabelsi, K; Uchida, M; Uno, S; Ushiroda, Y; Varner, G; Vinokurova, A; Vorobyev, V; Vossen, A; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; Widmann, E; Won, E; Yamaoka, J; Yamashita, Y; Yelton, J; Zhang, Z P; Zhilich, V; Zhukova, V; Zhulanov, V

2017-02-03

We report the first observation of the radiative charm decay D^{0}→ρ^{0}γ and the first search for CP violation in decays D^{0}→ρ^{0}γ, ϕγ, and K[over ¯]^{*0}(892)γ, using a data sample of 943  fb^{-1} collected with the Belle detector at the KEKB asymmetric-energy e^{+}e^{-} collider. The branching fraction is measured to be B(D^{0}→ρ^{0}γ)=(1.77±0.30±0.07)×10^{-5}, where the first uncertainty is statistical and the second is systematic. The obtained CP asymmetries A_{CP}(D^{0}→ρ^{0}γ)=+0.056±0.152±0.006, A_{CP}(D^{0}→ϕγ)=-0.094±0.066±0.001, and A_{CP}(D^{0}→K[over ¯]^{*0}γ)=-0.003±0.020±0.000 are consistent with no CP violation. We also present an improved measurement of the branching fractions B(D^{0}→ϕγ)=(2.76±0.19±0.10)×10^{-5} and B(D^{0}→K[over ¯]^{*0}γ)=(4.66±0.21±0.21)×10^{-4}.

The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

PubMed Central

Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

2013-01-01

DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

Physical and Mental Quality of Life (QOL) in Chronic Pancreatitis(CP): A Case-Control Study from the NAPS2 cohort

PubMed Central

Amann, Stephen T.; Yadav, Dhiraj; Barmada, M. Micheal; O’Connell, Michael; Kennard, Elizabeth D.; Anderson, Michelle; Baillie, John; Sherman, Stuart; Romagnuolo, Joseph; Hawes, Robert H.; AlKaade, Samer; Brand, Randall E.; Lewis, Michele D.; Gardner, Timothy B.; Gelrud, Andres; Money, Mary E.; Banks, Peter A.; Slivka, Adam; Whitcomb, David C

2012-01-01

Objectives Define the Quality of Life (QOL) in chronic pancreatitis (CP) subjects Methods We studied 443 well phenotyped CP subjects and 611 controls prospectively enrolled from 20 US centers between 2000–2006 in the North American Pancreatitis Study 2 (NAPS2). Responses to the SF-12 questionnaire were used to calculate the Mental (MCS) and Physical component summary scores (PCS) with norm based scoring (normal ≥50). QOL in CP subjects was compared with controls after controlling for demographic factors, drinking history, smoking and medical conditions. QOL in CP was also compared with known scores for several chronic conditions. Results Both PCS (38±11.5 vs. 52±9.4) and MCS (44±11.5 vs. 51±9.2) were significantly lower in CP compared with controls (p<0.001). On multivariable analyses, compared to controls, a profound decrease in physical QOL (PCS 12.02 points lower) and a clinically significant decrease in mental QOL (MCS 4.24 points lower) was seen due to CP. QOL in CP was similar to (heart, kidney, liver, lung disease) or worse than (non-skin cancers, diabetes mellitus, hypertension, rheumatoid arthritis) other chronic conditions. Conclusions The impact of CP on QOL appears substantial. The QOL in CP subjects appears to be worse or similar to the QOL of many other chronic conditions. PMID:23357924

Leptonic Unitarity Triangle and CP-Violation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farzan, Yasaman

2002-02-01

The area of the unitarity triangle is a measure of CP-violation. We introduce the leptonic unitarity triangles and study their properties. We consider the possibility of reconstructing the unitarity triangle in future oscillation and non-oscillation experiments. A set of measurements is suggested which will, in principle, allow us to measure all sides of the triangle, and consequently to establish CP-violation. For different values of the CP-violating phase, {delta}{sub D}, the required accuracy of measurements is estimated. The key elements of the method include determination of |U{sub e3}| and studies of the {nu}{sub {mu}} - {nu}{sub {mu}} survival probability in oscillationsmore » driven by the solar mass splitting {Delta}m{sub sun}{sup 2}. We suggest additional astrophysical measurements which may help to reconstruct the triangle. The method of the unitarity triangle is complementary to the direct measurements of CP-asymmetry. It requires mainly studies of the survival probabilities and processes where oscillations are averaged or the coherence of the state is lost.« less

Status of the CP-PACS Project

NASA Astrophysics Data System (ADS)

Iwasaki, Y.

1997-02-01

The CP-PACS computer with a peak speed of 300 Gflops was completed in March 1996 and has started to operate. We describe the final specification and the hardware implementation of the CP-PACS computer, and its performance for QCD codes. A plan of the grade-up of the computer scheduled for fall of 1996 is also given.

Synthesis, Characterization, and Some Properties of Cp*W(NO)(H)(η(3)-allyl) Complexes.

PubMed

Baillie, Rhett A; Holmes, Aaron S; Lefèvre, Guillaume P; Patrick, Brian O; Shree, Monica V; Wakeham, Russell J; Legzdins, Peter; Rosenfeld, Devon C

2015-06-15

Sequential treatment at low temperatures of Cp*W(NO)Cl2 in THF with 1 equiv of a binary magnesium allyl reagent, followed by an excess of LiBH4, affords three new Cp*W(NO)(H)(η(3)-allyl) complexes, namely, Cp*W(NO)(H)(η(3)-CH2CHCMe2) (1), Cp*W(NO)(H)(η(3)-CH2CHCHPh) (2), and Cp*W(NO)(H)(η(3)-CH2CHCHMe) (3). Complexes 1-3 are isolable as air-stable, analytically pure yellow solids in good to moderate yields by chromatography or fractional crystallization. In solutions, complex 1 exists as two coordination isomers in an 83:17 ratio differing with respect to the endo/exo orientation of the allyl ligand. In contrast, complexes 2 and 3 each exist as four coordination isomers, all differing by the orientation of their allyl ligands which can have either an endo or an exo orientation with the phenyl or methyl groups being either proximal or distal to the nitrosyl ligand. A DFT computational analysis using the major isomer of Cp*W(NO)(H)(η(3)-CH2CHCHMe) (3a) as the model complex has revealed that its lowest-energy thermal-decomposition pathway involves the intramolecular isomerization of 3a to the 16e η(2)-alkene complex, Cp*W(NO)(η(2)-CH2═CHCH2Me). Such η(2)-alkene complexes are isolable as their 18e PMe3 adducts when compounds 1-3 are thermolyzed in neat PMe3, the other organometallic products formed during these thermolyses being Cp*W(NO)(PMe3)2 (5) and, occasionally, Cp*W(NO)(H)(η(1)-allyl)(PMe3). All new complexes have been characterized by conventional spectroscopic and analytical methods, and the solid-state molecular structures of most of them have been established by single-crystal X-ray crystallographic analyses.

The Ruthenostannylene Complex [Cp*(IXy)H2 Ru-Sn-Trip]: Providing Access to Unusual Ru-Sn Bonded Stanna-imine, Stannene, and Ketenylstannyl Complexes.

PubMed

Liu, Hsueh-Ju; Ziegler, Micah S; Tilley, T Don

2015-05-26

Reactivity studies of the thermally stable ruthenostannylene complex [Cp*(IXy)(H)2 Ru-Sn-Trip] (1; IXy=1,3-bis(2,6-dimethylphenyl)imidazol-2-ylidene; Cp*=η(5) -C5 Me5 ; Trip=2,4,6-iPr3 C6 H2 ) with a variety of organic substrates are described. Complex 1 reacts with benzoin and an α,β-unsaturated ketone to undergo [1+4] cycloaddition reactions and afford [Cp*(IXy)(H)2 RuSn(κ(2) -O,O-OCPhCPhO)Trip] (2) and [Cp*(IXy)(H)2 RuSn(κ(2) -O,C-OCPhCHCHPh)Trip] (3), respectively. The reaction of 1 with ethyl diazoacetate resulted in a tin-substituted ketene complex [Cp*(IXy)(H)2 RuSn(OC2 H5 )(CHCO)Trip] (4), which is most likely a decomposition product from the putative ruthenium-substituted stannene complex. The isolation of a ruthenium-substituted stannene [Cp*(IXy)(H)2 RuSn(=Flu)Trip] (5) and stanna-imine [Cp*(IXy)(H)2 RuSn(κ(2) -N,O-NSO2 C6 H4 Me)Trip] (6) complexes was achieved by treatment of 1 with 9-diazofluorene and tosyl azide, respectively. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Putrescine-Dependent Re-Localization of TvCP39, a Cysteine Proteinase Involved in Trichomonas vaginalis Cytotoxicity

PubMed Central

Carvajal-Gamez, Bertha Isabel; Quintas-Granados, Laura Itzel; Arroyo, Rossana; Vázquez-Carrillo, Laura Isabel; Ramón-Luing, Lucero De los Angeles; Carrillo-Tapia, Eduardo; Alvarez-Sánchez, María Elizbeth

2014-01-01

Polyamines are involved in the regulation of some Trichomonas vaginalis virulence factors such as the transcript, proteolytic activity, and cytotoxicity of TvCP65, a cysteine proteinase (CP) involved in the trichomonal cytotoxicity. In this work, we reported the putrescine effect on TvCP39, other CP that also participate in the trichomonal cytotoxicity. Parasites treated with 1,4-diamino-2-butanone (DAB) (an inhibitor of putrescine biosynthesis), diminished the amount and proteolytic activity of TvCP39 as compared with untreated parasites. Inhibition of putrescine biosynthesis also reduced ∼80% the tvcp39 mRNA levels according to RT-PCR and qRT-PCR assays. Additionally, actinomycin D-treatment showed that the tvcp39 mRNA half-life decreased in the absence of putrescine. However, this reduction was restored by exogenous putrescine addition, suggesting that putrescine is necessary for tvcp39 mRNA stability. TvCP39 was localized in the cytoplasm but, in DAB treated parasites transferred into exogenous putrescine culture media, TvCP39 was re-localized to the nucleus and nuclear periphery of trichomonads. Interestingly, the amount and proteolytic activity of TvCP39 was recovered as well as the tvcp39 mRNA levels were restored when putrescine exogenous was added to the DAB-treated parasites. In conclusion, our data show that putrescine regulate the TvCP39 expression, protein amount, proteolytic activity, and cellular localization. PMID:25251406

CP110 exhibits novel regulatory activities during centriole assembly in Drosophila

PubMed Central

Franz, Anna; Roque, Hélio; Saurya, Saroj; Dobbelaere, Jeroen

2013-01-01

CP110 is a conserved centriole protein implicated in the regulation of cell division, centriole duplication, and centriole length and in the suppression of ciliogenesis. Surprisingly, we report that mutant flies lacking CP110 (CP110Δ) were viable and fertile and had no obvious defects in cell division, centriole duplication, or cilia formation. We show that CP110 has at least three functions in flies. First, it subtly influences centriole length by counteracting the centriole-elongating activity of several centriole duplication proteins. Specifically, we report that centrioles are ∼10% longer than normal in CP110Δ mutants and ∼20% shorter when CP110 is overexpressed. Second, CP110 ensures that the centriolar microtubules do not extend beyond the distal end of the centriole, as some centriolar microtubules can be more than 50 times longer than the centriole in the absence of CP110. Finally, and unexpectedly, CP110 suppresses centriole overduplication induced by the overexpression of centriole duplication proteins. These studies identify novel and surprising functions for CP110 in vivo in flies. PMID:24297749

CP asymmetry in charged Higgs decays to chargino-neutralino pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, Mariana; Turan, Ismail

2007-10-01

We analyze the charge-parity (CP) asymmetry in the charged Higgs boson decays to chargino-neutralino pairs, H{sup {+-}}{yields}{chi}{sub i}{sup {+-}}{chi}{sub j}{sup 0}, i=1, 2, j=1,...,4. We show first that these modes have a large branching ratio for m{sub H{sup {+-}}} > or approx. 600 GeV. We use Cutkosky rules to obtain the analytical formulas needed for the evaluation of the asymmetry under consideration. We then calculate the CP asymmetry in chargino-neutralino decays by including supersymmetric mass bounds, as well as constraints from b{yields}s{gamma} (g-2){sub {mu}}, {delta}{rho} and electric dipole moments. Finally, we discuss observability of the asymmetry at the LHC bymore » calculating the number of required charged Higgs events to observe the asymmetry for each decay channel. We show that the inclusion of constraints considerably reduces the projected CP asymmetry, and that the optimal channel for observing the asymmetry is H{sup {+-}}{yields}{chi}{sub 1}{sup {+-}}{chi}{sub 2}{sup 0}.« less

New observables for $CP$ violation in Higgs decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yi; Falkowski, Adam; Low, Ian

Current experimental data on the 125 GeV Higgs boson still allow room for large $CP$ violation. The observables usually considered in this context are triple product asymmetries, which require an input of four visible particles after imposing momentum conservation. Here, we point out a new class of $CP$ -violating observables in Higgs physics which require only three reconstructed momenta. They may arise if the process involves an interference of amplitudes with different intermediate particles, which provide distinct “strong phases” in the form of the Breit-Wigner widths, in addition to possible “weak phases” that arise from $CP$ -violating couplings of themore » Higgs in the Lagrangian. As an example, we propose a forward-backward asymmetry of the charged lepton in the three-body Higgs decay, h → ℓ $-$ ℓ + γ , as a probe for $CP$ -violating Higgs couplings to Zγ and γγ pairs. In conclusion, we also discuss other processes exhibiting this type of $CP$ violation.« less

New observables for $CP$ violation in Higgs decays

DOE PAGES

Chen, Yi; Falkowski, Adam; Low, Ian; ...

2014-12-09

Current experimental data on the 125 GeV Higgs boson still allow room for large $CP$ violation. The observables usually considered in this context are triple product asymmetries, which require an input of four visible particles after imposing momentum conservation. Here, we point out a new class of $CP$ -violating observables in Higgs physics which require only three reconstructed momenta. They may arise if the process involves an interference of amplitudes with different intermediate particles, which provide distinct “strong phases” in the form of the Breit-Wigner widths, in addition to possible “weak phases” that arise from $CP$ -violating couplings of themore » Higgs in the Lagrangian. As an example, we propose a forward-backward asymmetry of the charged lepton in the three-body Higgs decay, h → ℓ $-$ ℓ + γ , as a probe for $CP$ -violating Higgs couplings to Zγ and γγ pairs. In conclusion, we also discuss other processes exhibiting this type of $CP$ violation.« less

Substance P Antagonist CP-96345 Blocks Lung Vascular Leakage and Inflammation More Effectively than its Stereoisomer CP-96344 in a Mouse Model of Smoke Inhalation and Burn Injury

PubMed Central

Jacob, Sam; Deyo, Donald J.; Cox, Robert A.; Jacob, Reuben K; Herndon, David N.; Traber, Daniel L.; Hawkins, Hal K.

2010-01-01

The recently developed murine model of smoke inhalation and burn (SB) injury was used to study the effect of the substance-P antagonist CP96345. C57BL/6 mice were pretreated with an i.v. dose of a specific NK-1 receptor antagonist, CP9635, or its inactive enantiomer, CP96344, (10 mg/Kg) 1 hr prior to SB injury per protocol (n = 5). Mice were anesthetized and exposed to cooled cotton smoke, 2X 30 sec, followed by a 40% total body surface area flame burn per protocol. At 48 hr after SB injury Evans Blue (EB) dye and myeloperoxidase (MPO) were measured in lung after vascular perfusion. Lungs were also analyzed for hemoglobin (Hb) and wet/dry weight ratio. In the current study, CP96345 pretreatment caused a significant decrease in wet/dry weight ratio (23%, *p = 0.048), EB (31%, *p = 0.047), Hb (46%, *p = 0.002) and MPO (54%, *p = 0.037) levels following SB injury compared to animals with SB injury alone. CP-96344 pretreatment caused an insignificant decrease in wet/dry weight ratio (14%, p=0.18), EB (16%, p = 0.134), Hb (9%, p = 0.39) and an insignificant increase in MPO (4%, p =0.79) as compared to mice that received SB injury alone. As expected, levels of EB, Hb, MPO, and wet/dry weight ratios were all significantly (p < 0.05) increased 48 hr following SB injury alone compared to respective sham animals. In conclusion, the current study indicates that pretreatment with specific NK-1R antagonist CP-96345 attenuates the lung injury and inflammation induced by SB injury in mice. PMID:20201741

Searches for New Physics in CP Violation from BABAR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palombo, Fernando

Results of recent searches for new physics in CP violation in charm decays from the BABAR experiment are presented. These results include a measurement of D 0 - anti D 0 mixing and searches for CP violation in two-body D 0 decays, a search for CP violation in the charm decays D ± → K S 0K ± and D s ± → K S 0K ± , K S 0π ± , and a search for direct CP violation in the singly-Cabibbo suppressed D ± → K +K -π ±decays. These studies are based on the final datasetmore » collected by BABAR at the PEP-II B factory at SLAC in the period 1999-2008. No evidence of CP violation is found in these charm decays. The measured mixing parameter y CP = [0.72 ± 0.18(stat) ± 0.12(syst)]% excludes the no-mixing null hypothesis with a significance of 3.3σ .« less

Ectopically tethered CP190 induces large-scale chromatin decondensation

NASA Astrophysics Data System (ADS)

Ahanger, Sajad H.; Günther, Katharina; Weth, Oliver; Bartkuhn, Marek; Bhonde, Ramesh R.; Shouche, Yogesh S.; Renkawitz, Rainer

2014-01-01

Insulator mediated alteration in higher-order chromatin and/or nucleosome organization is an important aspect of epigenetic gene regulation. Recent studies have suggested a key role for CP190 in such processes. In this study, we analysed the effects of ectopically tethered insulator factors on chromatin structure and found that CP190 induces large-scale decondensation when targeted to a condensed lacO array in mammalian and Drosophila cells. In contrast, dCTCF alone, is unable to cause such a decondensation, however, when CP190 is present, dCTCF recruits it to the lacO array and mediates chromatin unfolding. The CP190 induced opening of chromatin may not be correlated with transcriptional activation, as binding of CP190 does not enhance luciferase activity in reporter assays. We propose that CP190 may mediate histone modification and chromatin remodelling activity to induce an open chromatin state by its direct recruitment or targeting by a DNA binding factor such as dCTCF.

A Whole Methylome CpG-SNP Association Study of Psychosis in Blood and Brain Tissue.

PubMed

van den Oord, Edwin J C G; Clark, Shaunna L; Xie, Lin Ying; Shabalin, Andrey A; Dozmorov, Mikhail G; Kumar, Gaurav; Vladimirov, Vladimir I; Magnusson, Patrik K E; Aberg, Karolina A

2016-07-01

Mutated CpG sites (CpG-SNPs) are potential hotspots for human diseases because in addition to the sequence variation they may show individual differences in DNA methylation. We performed methylome-wide association studies (MWAS) to test whether methylation differences at those sites were associated with schizophrenia. We assayed all common CpG-SNPs with methyl-CpG binding domain protein-enriched genome sequencing (MBD-seq) using DNA extracted from 1408 blood samples and 66 postmortem brain samples (BA10) of schizophrenia cases and controls. Seven CpG-SNPs passed our FDR threshold of 0.1 in the blood MWAS. Of the CpG-SNPs methylated in brain, 94% were also methylated in blood. This significantly exceeded the 46.2% overlap expected by chance (P-value < 1.0×10(-8)) and justified replicating findings from blood in brain tissue. CpG-SNP rs3796293 in IL1RAP replicated (P-value = .003) with the same direction of effects. This site was further validated through targeted bisulfite pyrosequencing in 736 independent case-control blood samples (P-value < 9.5×10(-4)). Our top result in the brain MWAS (P-value = 8.8×10(-7)) was CpG-SNP rs16872141 located in the potential promoter of ENC1. Overall, our results suggested that CpG-SNP methylation may reflect effects of environmental insults and can provide biomarkers in blood that could potentially improve disease management. © The Author 2015. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

50 CFR 660.160 - Catcher/processor (C/P) Coop Program.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Coop Program, or the Shorebased IFQ Program. As determined necessary by the Regional Administrator... combination. [Reserved] (4) Appeals. [Reserved] (5) Fees. The Regional Administrator is authorized to charge... entry permit owner in the NMFS permit database. (ii) Qualifying criteria for C/P endorsement. In order...

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

Evidence for Isospin Violation and Measurement of CP Asymmetries in B→K^{*}(892)γ.

PubMed

Horiguchi, T; Ishikawa, A; Yamamoto, H; Adachi, I; Aihara, H; Al Said, S; Asner, D M; Aulchenko, V; Aushev, T; Ayad, R; Babu, V; Badhrees, I; Bakich, A M; Bansal, V; Behera, P; Bhardwaj, V; Bhuyan, B; Biswal, J; Bobrov, A; Bonvicini, G; Bozek, A; Bračko, M; Browder, T E; Červenkov, D; Chekelian, V; Chen, A; Cheon, B G; Chilikin, K; Cho, K; Choi, Y; Cinabro, D; Czank, T; Dash, N; Di Carlo, S; Doležal, Z; Drásal, Z; Dutta, D; Eidelman, S; Epifanov, D; Farhat, H; Fast, J E; Ferber, T; Fulsom, B G; Gaur, V; Gabyshev, N; Garmash, A; Gelb, M; Gillard, R; Goldenzweig, P; Golob, B; Guan, Y; Guido, E; Haba, J; Hara, T; Hayasaka, K; Hayashii, H; Hedges, M T; Higuchi, T; Hirose, S; Hou, W-S; Iijima, T; Inami, K; Inguglia, G; Itoh, R; Iwasaki, Y; Jacobs, W W; Jaegle, I; Jeon, H B; Jia, S; Jin, Y; Joffe, D; Joo, K K; Julius, T; Kang, K H; Kawasaki, T; Kim, D Y; Kim, J B; Kim, K T; Kim, M J; Kim, S H; Kim, Y J; Kinoshita, K; Kodyš, P; Korpar, S; Kotchetkov, D; Križan, P; Krokovny, P; Kuhr, T; Kulasiri, R; Kumar, R; Kumita, T; Kuzmin, A; Kwon, Y-J; Lange, J S; Li, C H; Li, L; Li Gioi, L; Libby, J; Liventsev, D; Lubej, M; Luo, T; Masuda, M; Matsuda, T; Matvienko, D; Merola, M; Miyabayashi, K; Miyata, H; Mizuk, R; Mohanty, G B; Mohanty, S; Moon, H K; Mori, T; Mussa, R; Nakano, E; Nakao, M; Nanut, T; Nath, K J; Natkaniec, Z; Nayak, M; Nisar, N K; Nishida, S; Ogawa, S; Okuno, S; Ono, H; Pakhlov, P; Pakhlova, G; Pal, B; Pardi, S; Park, C-S; Park, H; Paul, S; Pedlar, T K; Pestotnik, R; Piilonen, L E; Prasanth, K; Pulvermacher, C; Rauch, J; Rostomyan, A; Sakai, Y; Sandilya, S; Santelj, L; Savinov, V; Schneider, O; Schnell, G; Schwanda, C; Schwartz, A J; Seino, Y; Senyo, K; Seong, I S; Sevior, M E; Shebalin, V; Shen, C P; Shibata, T-A; Shiu, J-G; Simon, F; Sokolov, A; Solovieva, E; Starič, M; Strube, J F; Sumisawa, K; Sumiyoshi, T; Takizawa, M; Tamponi, U; Tanida, K; Tenchini, F; Trabelsi, K; Uchida, M; Uglov, T; Unno, Y; Uno, S; Urquijo, P; Ushiroda, Y; Usov, Y; Van Hulse, C; Varner, G; Vinokurova, A; Vorobyev, V; Vossen, A; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; Watanuki, S; Weber, T; Widmann, E; Won, E; Yamashita, Y; Ye, H; Zhang, Z P; Zhilich, V; Zhukova, V; Zhulanov, V; Zupanc, A

2017-11-10

We report the first evidence for isospin violation in B→K^{*}γ and the first measurement of the difference of CP asymmetries between B^{+}→K^{*+}γ and B^{0}→K^{*0}γ. This analysis is based on the data sample containing 772×10^{6}BB[over ¯] pairs that was collected with the Belle detector at the KEKB energy-asymmetric e^{+}e^{-} collider. We find evidence for the isospin violation with a significance of 3.1σ, Δ_{0+}=[+6.2±1.5(stat)±0.6(syst)±1.2(f_{+-}/f_{00})]%, where the third uncertainty is due to the uncertainty on the fraction of B^{+}B^{-} to B^{0}B[over ¯]^{0} production in ϒ(4S) decays. The measured value is consistent with predictions of the standard model. The result for the difference of CP asymmetries is ΔA_{CP}=[+2.4±2.8(stat)±0.5(syst)]%, consistent with zero. The measured branching fractions and CP asymmetries for charged and neutral B meson decays are the most precise to date. We also calculate the ratio of branching fractions of B^{0}→K^{*0}γ to B_{s}^{0}→ϕγ.

Measurement of the Branching Fractions and CP Asymmetries of B{sup -} --> D{sup 0}{sub (CP)}K{sup -} Decays with the BABAR Detector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aubert, B

The authors have reconstructed B{sup -} --> D{sup 0}K{sup -} decays with D{sup 0} mesons decaying to non-CP (K{sup -}{pi}{sup +}), CD-even (K{sup -}K{sup +}, {pi}{sup -}{pi}{sup +}) and CP-odd (K{sup 0}{sub s}{pi}{sup 0}) eigenstates. They have measured the CP asymmetries A{sub CP{sup +}} = 0.40 {+-} 0.15(stat) {+-} 0.08(syst), A{sup CP{sup -}} = 0.21 {+-} 0.17(stat) {+-} 0.07(syst), and the double ratio of branching fractions R{sub +} = 0.87 {+-} 0.14(stat) {+-} 0.06(syst), R{sub -} = 0.80 {+-} 0.14(stat) {+-} 0.08(syst). These results improve the previous existing measurements from BABAR. All results presented in this document are preliminary.

Synthesis of Ruthenium Carbonyl Complexes with Phosphine or Substituted Cp Ligands, and Their Activity in the Catalytic Deoxygenation of 1,2-Propanediol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Prasenjit; Fagan, Paul J.; Marshall, William J.

2009-07-20

A ruthenium hydride with a bulky substituted Cp ligand, (CpiPr4)Ru(CO)2H (CpiPr4 = C5(i-C3H7)4H) was prepared from the reaction of Ru3(CO)12 with 1,2,3,4-tetraisopropylcyclopentadiene. The molecular structure of (CpiPr4)Ru(CO)2H was determined by x-ray crystallography. The ruthenium hydride complex (C5Bz5)Ru(CO)2H (Bz = CH2Ph) was similarly prepared. The Ru-Ru bonded dimer, [(1,2,3-trimethylindenyl)Ru(CO)2]2, was produced from the reaction of 1,2,3-trimethylindene with Ru3(CO)12, and protonation of this dimer with HOTf gives {[(1,2,3-trimethylindenyl)Ru(CO)2]2(μ H)}+OTf –. A series of ruthenium hydride complexes CpRu(CO)(L)H [L = P(OPh)3, PCy3, PMe3, P(p C6H4F)3] were prepared by reaction of Cp(CO)2RuH with added L. Protonation of (CpiPr4)Ru(CO)2H, Cp*Ru(CO)2H or CpRu(CO)[P(OPh)3]H by HOTf 80more » °C led to equilibria with the cationic dihydrogen complexes, but H2 was released at higher temperatures. Protonation of CpRu[P(OPh)3]2H with HOTf gave an observable dihydrogen complex, {CpRu[P(OPh)3]2(η2 H2)}+OTf – that was converted at -20 °C to the dihydride complex {CpRu[P(OPh)3]2(H)2}+OTf –. These Ru complexes serve as catalyst precursors for the catalytic deoxygenation of 1,2-propanediol to give n-propanol. The catalytic reactions were carried out in sulfolane solvent with added HOTf under H2 (750 psi) at 110 °C. This work was supported by the U.S. Department of Energy's (DOE) Office of Basic Energy Sciences, Chemical Sciences program. Pacific Northwest National Laboratory is operated by Battelle for DOE.« less

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Recent advances in MeCP2 structure and function1

PubMed Central

Hite, Kristopher C.; Adams, Valerie H.; Hansen, Jeffrey C.

2010-01-01

Mutations in methyl DNA binding protein 2 (MeCP2) cause the neurodevelopmental disorder Rett syndrome (RTT). The mechanism(s) by which the native MeCP2 protein operates in the cell are not well understood. Historically, MeCP2 has been characterized as a proximal gene silencer with 2 functional domains: a methyl DNA binding domain and a transcription repression domain. However, several lines of new data indicate that MeCP2 structure and function relationships are more complex. In this review, we first discuss recent studies that have advanced understanding of the basic structural biochemistry of MeCP2. This is followed by an analysis of cell-based experiments suggesting MeCP2 is a regulator, rather than a strict silencer, of transcription. The new data establish MeCP2 as a multifunctional nuclear protein, with potentially important roles in chromatin architecture, regulation of RNA splicing, and active transcription. We conclude by discussing clinical correlations between domain-specific mutations and RTT pathology to stress that all structural domains of MeCP2 are required to properly mediate cellular function of the intact protein. PMID:19234536

B Physics and CP Violation

NASA Astrophysics Data System (ADS)

Kowalewski, R. V.

2004-03-01

These lectures present the phenomenology of B meson decays and their impact on our understanding of CP violation in the quark sector, with an emphasis on measurements made at the e+e- B factories. Some of the relevant theoretical ideas such as the Operator Product Expansion and Heavy Quark Symmetry are introduced, and applications to the determination of CKM matrix elements given. The phenomenon of B flavor oscillations is reviewed, and the mechanisms for and current status of CP violation in the B system is given. The status of rare B decays is also discussed.

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

The possibility of leptonic CP-violation measurement with JUNO

NASA Astrophysics Data System (ADS)

Smirnov, M. V.; Hu, Zh. J.; Li, S. J.; Ling, J. J.

2018-06-01

The existence of CP-violation in the leptonic sector is one of the most important issues for modern science. Neutrino physics is a key to the solution of this problem. JUNO (under construction) is the near future of neutrino physics. However CP-violation is not a priority for the current scientific program. We estimate the capability of δCP measurement, assuming a combination of the JUNO detector and a superconductive cyclotron as the antineutrino source. This method of measuring CP-violation is an alternative to conventional beam experiments. A significance level of 3σ can be reached for 22% of the δCP range. The accuracy of measurement lies between 8o and 22o. It is shown that the dominant influence on the result is the uncertainty in the mixing angle Θ23.

Reaction of tin(iv) phthalocyanine dichloride with decamethylmetallocenes (M = CrII and CoII). Strong magnetic coupling of spins in (Cp*2Co+){SnIVCl2(Pc˙3-)}˙-·2C6H4Cl2.

PubMed

Konarev, Dmitri V; Troyanov, Sergey I; Shestakov, Alexander F; Yudanova, Evgeniya I; Otsuka, Akihiro; Yamochi, Hideki; Kitagawa, Hiroshi; Lyubovskaya, Rimma N

2018-01-23

The reaction of tin(iv) phthalocyanine dichloride {Sn IV Cl 2 (Pc 2- )} with decamethylmetallocenes (Cp* 2 M, M = Co, Cr) has been studied. Decamethylcobaltocene reduces Sn IV Cl 2 (Pc 2- ) to form the (Cp* 2 Co + ){Sn IV Cl 2 (Pc˙ 3- )}˙ - ·2C 6 H 4 Cl 2 (1) complex. The negative charge of {Sn IV Cl 2 (Pc˙ 3- )}˙ - is delocalized over the Pc macrocycle providing the alternation of the C-N(imine) bonds, the appearance of new bands in the NIR range and a strong blue shift of both the Soret and Q-bands in the spectrum of 1. The magnetic moment of 1 is equal to 1.68μ B at 300 K, indicating the contribution of one S = 1/2 spin of the Pc˙ 3- macrocycles. These macrocycles form closely packed double stacks in 1 with effective π-π interactions providing strong antiferromagnetic coupling of spins at a Weiss temperature of -80 K. Decamethylchromocene initially also reduces Sn IV Cl 2 (Pc 2- ) to form the [(Cp* 2 Cr + ){Sn VI Cl 2 (Pc˙ 3- )}˙ - complex but further reaction between the ions is observed. This reaction is accompanied by the substitution of one Cp* ligand of Cp* 2 Cr by chloride anions originating from {Sn IV Cl 2 (Pc˙ 3- )}˙ - to form the complex {(Cp*CrCl 2 )(Sn IV (μ-Cl)(Pc 2- ))}·C 6 H 4 Cl 2 (2) in which the (Cp*CrCl 2 ) and {Sn IV (Pc 2- )} species are bonded through the μ-bridged Cl - anion. According to the DFT calculations, this reaction proceeds via an intermediate [(Cp* 2 CrCl)(SnClPc)] complex.

A bottom-up approach to the strong CP problem

NASA Astrophysics Data System (ADS)

Diaz-Cruz, J. L.; Hollik, W. G.; Saldana-Salazar, U. J.

2018-05-01

The strong CP problem is one of many puzzles in the theoretical description of elementary particle physics that still lacks an explanation. While top-down solutions to that problem usually comprise new symmetries or fields or both, we want to present a rather bottom-up perspective. The main problem seems to be how to achieve small CP violation in the strong interactions despite the large CP violation in weak interactions. In this paper, we show that with minimal assumptions on the structure of mass (Yukawa) matrices, they do not contribute to the strong CP problem and thus we can provide a pathway to a solution of the strong CP problem within the structures of the Standard Model and no extension at the electroweak scale is needed. However, to address the flavor puzzle, models based on minimal SU(3) flavor groups leading to the proposed flavor matrices are favored. Though we refrain from an explicit UV completion of the Standard Model, we provide a simple requirement for such models not to show a strong CP problem by construction.

Human apolipoprotein B transgenic SHR/NDmcr-cp rats show exacerbated kidney dysfunction

PubMed Central

ASAHINA, Makoto; SHIMIZU, Fumi; OHTA, Masayuki; TAKEYAMA, Michiyasu; TOZAWA, Ryuichi

2015-01-01

Nephropathy frequently co-occurs with metabolic syndrome in humans. Metabolic syndrome is a cluster of metabolic diseases including obesity, diabetes, hypertension, and dyslipidemia, and some previous studies revealed that dyslipidemia contributes to the progression of kidney dysfunction. To establish a new nephropathy model with metabolic syndrome, we produced human apolipoprotein B (apoB) transgenic (Tg.) SHR/NDmcr-cp (SHR-cp/cp) rats, in which dyslipidemia is exacerbated more than in an established metabolic syndrome model, SHR-cp/cp rats. Human apoB Tg. SHR-cp/cp rats showed obesity, hyperinsulinemia, hypertension, and severe hyperlipidemia. They also exhibited exacerbated early-onset proteinuria, accompanied by increased kidney injury and increased oxidative and inflammatory markers. Histological analyses revealed the characteristic features of human apoB Tg. SHR-cp/cp rats including prominent glomerulosclerosis with lipid accumulation. Our newly established human apoB Tg. SHR-cp/cp rat could be a useful model for the nephropathy in metabolic syndrome and for understanding the interaction between dyslipidemia and renal dysfunction in metabolic syndrome. PMID:25912321

Human apolipoprotein B transgenic SHR/NDmcr-cp rats show exacerbated kidney dysfunction.

PubMed

Asahina, Makoto; Shimizu, Fumi; Ohta, Masayuki; Takeyama, Michiyasu; Tozawa, Ryuichi

2015-01-01

Nephropathy frequently co-occurs with metabolic syndrome in humans. Metabolic syndrome is a cluster of metabolic diseases including obesity, diabetes, hypertension, and dyslipidemia, and some previous studies revealed that dyslipidemia contributes to the progression of kidney dysfunction. To establish a new nephropathy model with metabolic syndrome, we produced human apolipoprotein B (apoB) transgenic (Tg.) SHR/NDmcr-cp (SHR-cp/cp) rats, in which dyslipidemia is exacerbated more than in an established metabolic syndrome model, SHR-cp/cp rats. Human apoB Tg. SHR-cp/cp rats showed obesity, hyperinsulinemia, hypertension, and severe hyperlipidemia. They also exhibited exacerbated early-onset proteinuria, accompanied by increased kidney injury and increased oxidative and inflammatory markers. Histological analyses revealed the characteristic features of human apoB Tg. SHR-cp/cp rats including prominent glomerulosclerosis with lipid accumulation. Our newly established human apoB Tg. SHR-cp/cp rat could be a useful model for the nephropathy in metabolic syndrome and for understanding the interaction between dyslipidemia and renal dysfunction in metabolic syndrome.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma

PubMed Central

Wei, Jin-Huan; Haddad, Ahmed; Wu, Kai-Jie; Zhao, Hong-Wei; Kapur, Payal; Zhang, Zhi-Ling; Zhao, Liang-Yun; Chen, Zhen-Hua; Zhou, Yun-Yun; Zhou, Jian-Cheng; Wang, Bin; Yu, Yan-Hong; Cai, Mu-Yan; Xie, Dan; Liao, Bing; Li, Cai-Xia; Li, Pei-Xing; Wang, Zong-Ren; Zhou, Fang-Jian; Shi, Lei; Liu, Qing-Zuo; Gao, Zhen-Li; He, Da-Lin; Chen, Wei; Hsieh, Jer-Tsong; Li, Quan-Zhen; Margulis, Vitaly; Luo, Jun-Hang

2015-01-01

Clear cell renal cell carcinomas (ccRCCs) display divergent clinical behaviours. Molecular markers might improve risk stratification of ccRCC. Here we use, based on genome-wide CpG methylation profiling, a LASSO model to develop a five-CpG-based assay for ccRCC prognosis that can be used with formalin-fixed paraffin-embedded specimens. The five-CpG-based classifier was validated in three independent sets from China, United States and the Cancer Genome Atlas data set. The classifier predicts the overall survival of ccRCC patients (hazard ratio=2.96−4.82; P=3.9 × 10−6−2.2 × 10−9), independent of standard clinical prognostic factors. The five-CpG-based classifier successfully categorizes patients into high-risk and low-risk groups, with significant differences of clinical outcome in respective clinical stages and individual ‘stage, size, grade and necrosis' scores. Moreover, methylation at the five CpGs correlates with expression of five genes: PITX1, FOXE3, TWF2, EHBP1L1 and RIN1. Our five-CpG-based classifier is a practical and reliable prognostic tool for ccRCC that can add prognostic value to the staging system. PMID:26515236

Strong CP and SUZ2

NASA Astrophysics Data System (ADS)

Albaid, Abdelhamid; Dine, Michael; Draper, Patrick

2015-12-01

Solutions to the strong CP problem typically introduce new scales associated with the spontaneous breaking of symmetries. Absent any anthropic argument for small overline{θ} , these scales require stabilization against ultraviolet corrections. Supersymmetry offers a tempting stabilization mechanism, since it can solve the "big" electroweak hierarchy problem at the same time. One family of solutions to strong CP, including generalized parity models, heavy axion models, and heavy η' models, introduces {Z}_2 copies of (part of) the Standard Model and an associated scale of {Z}_2 -breaking. We review why, without additional structure such as supersymmetry, the {Z}_2 -breaking scale is unacceptably tuned. We then study "SUZ2" models, supersymmetric theories with {Z}_2 copies of the MSSM. We find that the addition of SUSY typically destroys the {Z}_2 protection of overline{θ}=0 , even at tree level, once SUSY and {Z}_2 are broken. In theories like supersymmetric completions of the twin Higgs, where {Z}_2 addresses the little hierarchy problem but not strong CP, two axions can be used to relax overline{θ}.

77 FR 37098 - Proposed Collection; Comment Request for Form 8038-CP

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-20

... 8038-CP AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... Form 8038-CP, Return for Credit Payments to Issuers of Qualified Bonds. DATES: Written comments should... Issuers of Qualified Bonds. OMB Number: 1545-2142. Form Number: Form 8038-CP. Abstract: Form 8038-CP...

Induction of anti-glioma NK cell response following multiple low-dose intracerebral CpG therapy

PubMed Central

Alizadeh, Darya; Zhang, Leying; Brown, Christine E.; Farrukh, Omar; Jensen, Michael C.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN which can induce toxicity in a clinical setting. The goal of this study was to evaluate the anti-tumor efficacy of multiple low-dose intratumoral CpG- ODN in a glioma model. Experimental Design Mice bearing four-day old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 μg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Results Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor free remission (> 3 months), and were protected from intracranial rechallenge with GL21 gliomas, demonstrating the capacity for long-term anti-tumor immunity. Although most inflammatory cells appeared to increase, activated NK cells (i.e. NK+CD107a+) were more frequent than CD8+CD107a+ in the brains of rechallenged CpG-ODN-treated animals and demonstrated a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN anti-tumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. Conclusions These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK mediated effector function. PMID:20570924

Study of CP Violation in Dalitz-Plot Analyses of B-Meson Decays to Three Kaons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindquist, Brian

The Standard Model (SM) explains CP violation in terms of the CKM matrix. The BABAR experiment was designed mainly to test the CKM model in B decays. B decays that proceed through b → s loop diagrams, of which B {yields} KKK decays are an example, are sensitive to new physics effects that could lead to deviations from the CKM predictions for CP violation. We present studies of CP violation in the decays B + → K +K -K +, B + → K S 0K S 0K +, and B 0 → K +K -K S 0, using a Dalitz plot amplitude analysis. These studies are based on approximately 470 million Bmore » $$\\bar{B}$$ decays collected by BABAR at the PEP-II collider at SLAC. We perform measurements of time-dependent CP violation in B 0 → K +K -K S 0, including B 0 → ΦK S 0. We measure a CP-violating phase β eff (ΦK S 0) = 0.36 ± 0.11 ± 0.04 rad., in agreement with the SM. This is the world's most precise measurement of this quantity. We also measure direct CP asymmetries in all three decay modes, including the direct CP asymmetry A CP (ΦK +) = (12.8 ± 4.4 ± 1.3)%, which is 2.8 sigma away from zero. This measurement is in tension with the SM, which predicts an asymmetry of a few percent. We also study the resonant and nonresonant features in the B → KKK Dalitz plots. We find that the hypothetical scalar f X(1500) resonance, introduced by prior analyses to explain an unknown peak in the m KK spectrum, cannot adequately describe the data. We conclude instead that the f X(1500) can be explained as the sum of the f 0(1500), f' 2(1525), and f 0(1710) resonances, removing the need for the hypothetical f X(1500). We also find that an exponential nonresonant model, used by previous analyses to describe the broad nonresonant feature seen in B → KKK decays, cannot fully model the data. We introduce a new nonresonant model that contains more free parameters, allows for phase motion, and contains both S-wave and P-wave components.« less

Reactivity of cyclopentadienyl transition metal(ii) complexes with borate ligands: structural characterization of the toluene-activated molybdenum complex [Cp*Mo(CO)2(η3-CH2C6H5)].

PubMed

Ramalakshmi, Rongala; Maheswari, K; Sharmila, Dudekula; Paul, Anamika; Roisnel, Thierry; Halet, Jean-François; Ghosh, Sundargopal

2016-10-18

Reactions of cyclopentadienyl transition-metal halide complexes [Cp*Mo(CO) 3 Cl], 1, and [CpFe(CO) 2 I], 2, (Cp = C 5 H 5 ; Cp* = η 5 -C 5 Me 5 ) with borate ligands are reported. Treatment of 1 with [NaBt 2 ] (Bt 2 = dihydrobis(2-mercapto-benzothiazolyl)borate) in toluene yielded [Cp*Mo(CO) 2 (C 7 H 4 S 2 N)], 3, and [Cp*Mo(CO) 2 (η 3 -CH 2 C 6 H 5 )], 4, with a selective binding of toluene through C-H activation followed by orthometallation. Note that compound 4 is a structurally characterized toluene-activated molecule in which the metal is in η 3 -coordination mode. Under similar reaction conditions, [NaPy 2 ] (Py 2 = dihydrobis(2-mercaptopyridyl)borate) produced only the mercaptopyridyl molybdenum complex [Cp*Mo(CO) 2 (C 5 H 4 SN)], 5, in good yield. On the other hand, when compound 2 was treated individually with [NaBt] (Bt = trihydro(2-mercapto-benzothiazolyl)borate) and [NaPy 2 ] in THF, formation of the η 1 -coordinated complexes [CpFe(CO) 2 (C 7 H 4 S 2 N)], 6, and [CpFe(CO) 2 (C 5 H 4 SN)], 7, was observed. The solid-state molecular structures of compounds 3, 4, 6, and 7 have been established by single-crystal X-ray crystallographic analyses.

Preparation of TiO(2) layers on cp-Ti and Ti6Al4V by thermal and anodic oxidation and by sol-gel coating techniques and their characterization.

PubMed

Velten, D; Biehl, V; Aubertin, F; Valeske, B; Possart, W; Breme, J

2002-01-01

The excellent biocompatibility of titanium and its alloys used, for example, for medical devices, is associated with the properties of their surface oxide. For a better understanding of the tissue reaction in contact with the oxide layer, knowledge of the chemical and physical properties of this layer is of increasing interest. In this study, titania films were produced on cp-Ti and Ti6Al4V substrates by thermal oxidation, anodic oxidation, and by the sol-gel process. The thickness and structure of the films produced under different conditions were determined by ellipsometry, infrared spectroscopy, and X-ray diffraction measurements. The corrosion properties of these layers were investigated by current density-potential curves under physiological conditions. The oxide layers produced on cp-Ti and Ti6Al4V by thermal oxidation consist of TiO(2) in the rutile structure. For the anodized samples the structure of TiO(2) is a mixture of amorphous phase and anatase. The structure of the coatings produced by the sol-gel process for a constant annealing time depends on the annealing temperature, and with increasing temperature successively amorphous, anatase, and rutile structure is observed. Compared to the uncoated, polished substrate with a natural oxide layer, the corrosion resistance of cp-Ti and Ti6Al4V is increased for the samples with an oxide layer thickness of about 100 nm, independent of the oxidation procedure. Copyright 2001 John Wiley & Sons, Inc.

Consolidation Process in Near Net Shape Manufacturing of Armstrong CP-Ti/Ti-6Al-4V Powders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Yukinori; Kiggans, Jim; Clark, Michael B

2010-01-01

This paper summarizes our recent efforts to develop the manufacturing technologies of consolidated net-shape components by using new low-cost commercially pure titanium (CP-Ti) and Ti-6Al-4V alloy powders made by the Armstrong process. Fabrication processes of net shape/ near net shape components, such as uniaxial die-pressing, cold isostatic pressing (CIP), sintering, roll compaction and stamping, have been evaluated. The press-and-sinter processing of the powders were systematically investigated in terms of theoretical density and microstructure as a function of time, pressure, and temperature. Up to 96.4% theoretical density has been achieved with the press-and-sinter technology. Tensile properties of the consolidated samples exhibitmore » good ductility as well as equivalent yield/ultimate tensile strengths to those of fully consolidate materials, even with the presence of a certain amount of porosity. A consolidation model is also under development to interpret the powder deformation during processing. Net shape components made of the Armstrong powder can successfully be fabricated with clearer surface details by using press-and-sinter processing.« less

The CP-PACS parallel computer

NASA Astrophysics Data System (ADS)

Ukawa, Akira

1998-05-01

The CP-PACS computer is a massively parallel computer consisting of 2048 processing units and having a peak speed of 614 GFLOPS and 128 GByte of main memory. It was developed over the four years from 1992 to 1996 at the Center for Computational Physics, University of Tsukuba, for large-scale numerical simulations in computational physics, especially those of lattice QCD. The CP-PACS computer has been in full operation for physics computations since October 1996. In this article we describe the chronology of the development, the hardware and software characteristics of the computer, and its performance for lattice QCD simulations.

Alkaline/peracetic acid as a pretreatment of lignocellulosic biomass for ethanol fuel production

NASA Astrophysics Data System (ADS)

Teixeira, Lincoln Cambraia

Peracetic acid is a lignin oxidation pretreatment with low energy input by which biomass can be treated in a silo type system for improving enzymatic digestibility of lignocellulosic materials for ethanol production. Experimentally, ground hybrid poplar wood and sugar cane bagasse are placed in plastic bags and a peracetic acid solution is added to the biomass in different concentrations based on oven-dry biomass. The ratio of solution to biomass is 6:1; after initial mixing of the resulting paste, a seven-day storage period at about 20°C is used in this study. As a complementary method, a series of pre-pretreatments using stoichiometric amounts of sodium hydroxide and ammonium hydroxide based on 4-methyl-glucuronic acid and acetyl content in the biomass is been performed before addition of peracetic acid. The alkaline solutions are added to the biomass in a ratio of 14:1 solution to biomass; the slurry is mixed for 24 hours at ambient temperature. The above procedures give high xylan content substrates. Consequently, xylanase/beta-glucosidase combinations are more effective than cellulase preparations in hydrolyzing these materials. The pretreatment effectiveness is evaluated using standard enzymatic hydrolysis and simultaneous saccharification and cofermentation (SSCF) procedures. Hybrid poplar wood pretreated with 15 and 21% peracetic acid based on oven-dry weight of wood gives glucan conversion yields of 76.5 and 98.3%, respectively. Sugar cane bagasse pretreated with the same loadings gives corresponding yields of 85.9 and 93.1%. Raw wood and raw bagasse give corresponding yields of 6.8 and 28.8%, respectively. The combined 6% NaOH/15% peracetic acid pretreatments increase the glucan conversion yields from 76.5 to 100.0% for hybrid poplar wood and from 85.9 to 97.6% for sugar cane bagasse. Respective ethanol yields of 92.8 and 91.9% are obtained from 6% NaOH/15% peracetic acid pretreated materials using recombinant Zymomonas mobilis CP4/pZB5. Peracetic acid

New results of the spectral observations of CP stars

NASA Astrophysics Data System (ADS)

Polosukhina, N. S.; Shavrina, A. V.; Drake, N. A.; Kudryavtsev, D. O.; Smirnova, M. A.

2010-04-01

The lithium problem in Ap-CP stars has been, for a long time, a subject of debate. Individual characteristics of CP stars, such as high abundance of the rare-earth elements presence of magnetic fields, complicate structure of the surface distribution of chemical elements, rapid oscillations of some CP-stars, make the detection of the lithium lines and the determination of the lithium abundance, a difficult task. During the International Meeting in Slovakia in 1996, the lithium problem in Ap-CP stars was discussed. The results of the Li study carried out in CrAO Polosukhina (1973-1976), the works of Hack & Faraggiana (1963), Wallerstein & Hack (1964), Faraggiana et al. (1992-1996) formed the basis of the International project ‘Lithium in the cool CP-stars with magnetic fields’. The main goal of the project was, using systematical observations of Ap-CP stars with phase rotation in the spectral regions of the resonance doublet Li I 6708 Å and subordinate 6104 Å lithium lines with different telescopes, to create a database, which will permit to explain the physical origin of anomalous Li abundance in the atmospheres of these stars.

Immunostimulation of bronchoalveolar lavage cells from recurrent airway obstruction-affected horses by different CpG-classes bound to gelatin nanoparticles.

PubMed

Klier, John; May, Anna; Fuchs, Sebastian; Schillinger, Ulrike; Plank, Christian; Winter, Gerhard; Gehlen, Heidrun; Coester, Conrad

2011-11-15

Recurrent airway obstruction (RAO) in horses has become a common problem in stabled horses in industrialized countries and deserves new therapeutic strategies. CpG-oligodeoxynucleotides (CpG-ODNs) were developed as effective immunostimulating agents to induce a Th2/Th1 shift. These agents showed a beneficial therapeutic effect in allergic diseases with predominant Th2 immunoresponse. CpG-ODN delivery by gelatin nanoparticles (GNPs) resulted in enhanced cellular uptake in murine and human in vitro studies and was a starting point for the present trial. The aim of this study was to identify an optimal stimulating CpG motif in horses with regard to species specificity on equine bronchoalveolar lavage (BAL) cells, in terms of a possible specific immunomodulation effect (Th2/Th1 shift) by used CpG-ODN. Accordingly, GNPs were evaluated as a delivery system to improve CpG-ODN immunostimulation in equine BAL cells. BAL fluid (BALF) was obtained from seven horses with moderate RAO and from four healthy horses and was subsequently incubated with five different CpG-ODN sequences (from A-, B- and C-class) and one ODN without any CpG motif. Release of three key cytokines (IL-4, IL-10 and IFN-γ) was quantified by ELISA to detect an allergy mediated Th2 immunoresponse (IL-4) as well as a proinflammatory Th1 response (IFN-γ). Due to its specific anti-inflammatory and anti-allergic effects, IL-10 was considered as a beneficial agent in pathophysiology of RAO. Results showed a significant upregulation of IL-10 and IFN-γ on the one hand and a downregulation of IL-4 on the other hand in RAO affected horses. Cell cultures from healthy horses had a significantly stronger response in cytokine release to all the applied stimuli in contrast to RAO derived cells. Comparing all five CpG sequences, A-class 2216 significantly showed the highest immunomodulatory effects on equine BALF cells and, hence, was chosen for follow-up preliminary clinical studies. Copyright © 2011 Elsevier B.V. All

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

PubMed Central

Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

2010-01-01

Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

Reducing the CP content in broiler feeds: impact on animal performance, meat quality and nitrogen utilization.

PubMed

Belloir, P; Méda, B; Lambert, W; Corrent, E; Juin, H; Lessire, M; Tesseraud, S

2017-11-01

Reducing the dietary CP content is an efficient way to limit nitrogen excretion in broilers but, as reported in the literature, it often reduces performance, probably because of an inadequate provision in amino acids (AA). The aim of this study was to investigate the effect of decreasing the CP content in the diet on animal performance, meat quality and nitrogen utilization in growing-finishing broilers using an optimized dietary AA profile based on the ideal protein concept. Two experiments (1 and 2) were performed using 1-day-old PM3 Ross male broilers (1520 and 912 for experiments 1 and 2, respectively) using the minimum AA:Lys ratios proposed by Mack et al. with modifications for Thr and Arg. The digestible Thr (dThr): dLys ratio was increased from 63% to 68% and the dArg:dLys ratio was decreased from 112% to 108%. In experiment 1, the reduction of dietary CP from 19% to 15% (five treatments) did not alter feed intake or BW, but the feed conversion ratio was increased for the 16% and 15% CP diets (+2.4% and +3.6%, respectively), while in experiment 2 (three treatments: 19%, 17.5% and 16% CP) there was no effect of dietary CP on performance. In both experiments, dietary CP content did not affect breast meat yield. However, abdominal fat content (expressed as a percentage of BW) was increased by the decrease in CP content (up to +0.5 and +0.2 percentage point, in experiments 1 and 2, respectively). In experiment 2, meat quality traits responded to dietary CP content with a higher ultimate pH and lower lightness and drip loss values for the low CP diets. Nitrogen retention efficiency increased when reducing CP content in both experiments (+3.5 points/CP percentage point). The main consequence of this higher efficiency was a decrease in nitrogen excretion (-2.5 g N/kg BW gain) and volatilization (expressed as a percentage of excretion: -5 points/CP percentage point). In conclusion, this study demonstrates that with an adapted AA profile, it is possible to reduce

Methyl-CpG-binding protein 2 mediates antifibrotic effects in scleroderma fibroblasts.

PubMed

He, Ye; Tsou, Pei-Suen; Khanna, Dinesh; Sawalha, Amr H

2018-05-14

Emerging evidence supports a role for epigenetic regulation in the pathogenesis of scleroderma (SSc). We aimed to assess the role of methyl-CpG-binding protein 2 (MeCP2), a key epigenetic regulator, in fibroblast activation and fibrosis in SSc. Dermal fibroblasts were isolated from patients with diffuse cutaneous SSc (dcSSc) and from healthy controls. MeCP2 expression was measured by qPCR and western blot. Myofibroblast differentiation was evaluated by gel contraction assay in vitro. Fibroblast proliferation was analysed by ki67 immunofluorescence staining. A wound healing assay in vitro was used to determine fibroblast migration rates. RNA-seq was performed with and without MeCP2 knockdown in dcSSc to identify MeCP2-regulated genes. The expression of MeCP2 and its targets were modulated by siRNA or plasmid. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) using anti-MeCP2 antibody was performed to assess MeCP2 binding sites within MeCP2-regulated genes. Elevated expression of MeCP2 was detected in dcSSc fibroblasts compared with normal fibroblasts. Overexpressing MeCP2 in normal fibroblasts suppressed myofibroblast differentiation, fibroblast proliferation and fibroblast migration. RNA-seq in MeCP2-deficient dcSSc fibroblasts identified MeCP2-regulated genes involved in fibrosis, including PLAU , NID2 and ADA . Plasminogen activator urokinase (PLAU) overexpression in dcSSc fibroblasts reduced myofibroblast differentiation and fibroblast migration, while nidogen-2 (NID2) knockdown promoted myofibroblast differentiation and fibroblast migration. Adenosine deaminase (ADA) depletion in dcSSc fibroblasts inhibited cell migration rates. Taken together, antifibrotic effects of MeCP2 were mediated, at least partly, through modulating PLAU, NID2 and ADA. ChIP-seq further showed that MeCP2 directly binds regulatory sequences in NID2 and PLAU gene loci. This study demonstrates a novel role for MeCP2 in skin fibrosis and identifies MeCP2-regulated genes

Composite-pulse and partially dipolar dephased multiCP for improved quantitative solid-state 13C NMR

NASA Astrophysics Data System (ADS)

Duan, Pu; Schmidt-Rohr, Klaus

2017-12-01

Improved multiple cross polarization (multiCP) pulse sequences for quickly acquiring quantitative 13C NMR spectra of organic solids are presented. Loss of 13C magnetization due to imperfect read-out and storage pulses in multiCP has been identified as a significant mechanism limiting polarization enhancement for 13C sites with weak couplings to 1H. This problem can be greatly reduced by composite 90° pulses with non-orthogonal phases that flip the magnetization onto the spin-lock field and back to the longitudinal direction for the 1H repolarization period; the observed loss is <3% for over ±10 kHz resonance offset and up to 20% flip-angle error. This composite-pulse multiCP (ComPmultiCP) sequence consistently provides performance superior to that of conventional multiCP, without any trade-off. The longer total CP time enabled by the composite pulses allows for a wider amplitude ramp during CP, which decreases the sensitivity to Hartmann-Hahn mismatch by a factor of two, with a <7% root-mean-square deviation within a 1-dB range for Boc-alanine. In samples with very short T1ρ, under-polarization of non-protonated carbons can be compensated by slight dipolar dephasing of CHn signals resulting from relatively weak decoupling during the Hahn spin echo period before detection. Quantitative spectra have been obtained by ComPmultiCP for low-crystallinity branched polyethylene at 4.5 kHz MAS, and in combination with partial dipolar dephasing for soil organic matter at 14 kHz MAS.

Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.

PubMed

Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao

2016-11-14

This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.

CpG islands: algorithms and applications in methylation studies.

PubMed

Zhao, Zhongming; Han, Leng

2009-05-15

Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

Neutral D→KK^{*} Decays as Discovery Channels for Charm CP Violation.

PubMed

Nierste, Ulrich; Schacht, Stefan

2017-12-22

We point out that the CP asymmetries in the decays D^{0}→K_{S}K^{*0} and D^{0}→K_{S}K[over ¯]^{*0} are potential discovery channels for charm CP violation in the standard model. We stress that no flavor tagging is necessary, the untagged CP asymmetry a_{CP}^{dir}(D[over (-)]→K_{S}K^{*0}) is essentially equal to the tagged one, so that the untagged measurement comes with a significant statistical gain. Depending on the relevant strong phase, |a_{CP}^{dir,untag}| can be as large as 0.003. The CP asymmetry is dominantly generated by exchange diagrams and does not require nonvanishing penguin amplitudes. While the CP asymmetry is smaller than in the case of D^{0}→K_{S}K_{S}, the experimental analysis is more efficient due to the prompt decay K^{*0}→K^{+}π^{-}. One may further search for favorable strong phases in the Dalitz plot in the vicinity of the K^{*0} peak.

Partial Quark-Lepton Universality and Neutrino CP Violation

DOE PAGES

Liao, Jiajun; Marfatia, D.; Whisnant, K.

2015-01-01

We smore » tudy a model with partial quark-lepton universality that can naturally arise in grand unified theories. We find that constraints on the model can be reduced to a single condition on the Dirac CP phase δ in the neutrino sector. Using our current knowledge of the CKM and PMNS mixing matrices, we predict - 32 . 4 ° ≤ δ ≤ 32 . 0 ° at 2 σ .« less

The inverse sandwich complex [(K(18-crown-6))2Cp][CpFe(CO)2]--unpredictable redox reactions of [CpFe(CO)2]I with the silanides Na[SiRtBu2] (R = Me, tBu) and the isoelectronic phosphanyl borohydride K[PtBu2BH3].

PubMed

Sänger, Inge; Kückmann, Theresa I; Dornhaus, Franz; Bolte, Michael; Wagner, Matthias; Lerner, Hans-Wolfram

2012-06-14

The dimeric iron carbonyl [CpFe(CO)(2)](2) and the iodosilanes tBu(2)RSiI were obtained from the reaction of [CpFe(CO)(2)]I with the silanides Na[SiRtBu(2)] (R = Me, tBu) in THF. By the reactions of [CpFe(CO)(2)]I and Na[SiRtBu(2)] (R = Me, tBu) the disilanes tBu(2)RSiSiRtBu(2) (R = Me, tBu) were additionally formed using more than one equivalent of the silanide. In this context it should be noted that reduction of [CpFe(CO)(2)](2) with Na[SitBu(3)] gives the disilanes tBu(3)SiSitBu(3) along with the sodium ferrate [(Na(18-crown-6))(2)Cp][CpFe(CO)(2)]. The potassium analogue [(K(18-crown-6))(2)Cp][CpFe(CO)(2)] (orthorhombic, space group Pmc2(1)), however, could be isolated as a minor product from the reaction of [CpFe(CO)(2)]I with [K(18-crown-6)][PtBu(2)BH(3)]. The reaction of [CpFe(CO)(2)](2) with the potassium benzophenone ketyl radical and subsequent treatment with 18-crown-6 yielded the ferrate [K(18-crown-6)][CpFe(CO)(2)] in THF at room temperature. The crown ether complex [K(18-crown-6)][CpFe(CO)(2)] was analyzed using X-ray crystallography (orthorhombic, space group Pna2(1)) and its thermal behaviour was investigated.

Interrelating Fermion Masses, CP Violation and Baryogenesis via Grand Unification

NASA Astrophysics Data System (ADS)

Pati, Jogesh C.

2005-08-01

An attempt is made to interrelate (i) fermion masses, (ii) neutrino oscillations, (iii) CP and flavor violations, and (iv) baryogenesis via leptogenesis, within supersymmetric grand unification, based on an effective symmetry which is either G(224) = SU(2)L × SU(2)R × SU(4)c or SO(10). Reviewing the framework proposed in this context by Babu, Pati and Wilczek (BPW), which successfully describes fermion masses and neutrino oscillations, a recent work by Babu, Rastogi and me is presented. It is shown that the BPW framework can be extended rather simply to include CP violation that is intimately linked to fermion masses and neutrino oscillations. Including SM and SUSY contributions, it is found that the extension can correctly account for the observed flavor and/or CP violations in ΔmK, ΔmBd, S(Bd → J/ψKS) as well as ɛK, while retaining the successes of the BPW framework as regards fermion masses and neutrino oscillations. While SUSY contribution is small (≲ few%) for the first three quantities, that to ɛK is sizable (~ 20-25%) and negative (as desired) compared to that of the SM. The model predicts S(Bd → ϕKS) to be in the range +(0.65-0.73), close to the SM prediction. The model yields Re(ɛ'/ɛ)SUSY ≈ +(4 - 14) × 10-4 the relevance of this contribution can be assessed only when the associated matrix elements are known reliably. The model also predicts that the electric dipole moments of the neutron and the electron, as well as the rare processes μ → eγ and τ → μγ, should be discovered with improvements in the current limits by factors of 10 to 100. Last but not the least, the model naturally leads to baryogenesis via leptogenesis in good accord with observation.

Methods for detection of methyl-CpG dinucleotides

DOEpatents

Dunn, John J

2013-11-26

The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

Methods for detection of methyl-CpG dinucleotides

DOEpatents

Dunn, John J.

2013-01-29

The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

Methods for detection of methyl-CpG dinucleotides

DOEpatents

Dunn, John J.

2012-09-11

The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

The Craterostigma plantagineum glycine-rich protein CpGRP1 interacts with a cell wall-associated protein kinase 1 (CpWAK1) and accumulates in leaf cell walls during dehydration.

PubMed

Giarola, Valentino; Krey, Stephanie; von den Driesch, Barbara; Bartels, Dorothea

2016-04-01

Craterostigma plantagineum tolerates extreme desiccation. Leaves of this plant shrink and extensively fold during dehydration and expand again during rehydration, preserving their structural integrity. Genes were analysed that may participate in the reversible folding mechanism. Analysis of transcripts abundantly expressed in desiccated leaves identified a gene putatively coding for an apoplastic glycine-rich protein (CpGRP1). We studied the expression, regulation and subcellular localization of CpGRP1 and its ability to interact with a cell wall-associated protein kinase (CpWAK1) to understand the role of CpGRP1 in the cell wall during dehydration. The CpGRP1 protein accumulates in the apoplast of desiccated leaves. Analysis of the promoter revealed that the gene expression is mainly regulated at the transcriptional level, is independent of abscisic acid (ABA) and involves a drought-responsive cis-element (DRE). CpGRP1 interacts with CpWAK1 which is down-regulated in response to dehydration. Our data suggest a role of the CpGRP1-CpWAK1 complex in dehydration-induced morphological changes in the cell wall during dehydration in C. plantagineum. Cell wall pectins and dehydration-induced pectin modifications are predicted to be involved in the activity of the CpGRP1-CpWAK1 complex. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Theoretical Prediction on [5]Radialene Sandwich Complexes (CpM)2(C10H10) (Cp = η5-C5H5; M = Fe, Co, Ni): Geometry, Spin States, and Bonding.

PubMed

Liu, Nan-Nan; Xue, Ying-Ying; Ding, Yi-Hong

2017-02-09

[5]Radialene, the missing link for synthesis of radialene family, has been finally obtained via the preparation and decomplexation of the [5]radialene-bis-Fe(CO) 3 complex. The stability of [5]radialene complex benefits from the coordination with Fe(CO) 3 by losing free 1,3-butadiene structures to avoid polymerization. In light of the similar coordination ability of half-sandwiches CpM(Cp = η 5 -C 5 H 5 ; M = Fe, Co, Ni), there is a great possibility that the sandwiched complexes of [5]radialene with CpM are available. Herein, we present the first theoretical prediction on the geometry, spin states and bonding of (CpM)(C 10 H 10 ) and (CpM) 2 (C 10 H 10 ). For M = Fe, Co, Ni, the ground states of (CpM)(C 10 H 10 ) and (CpM) 2 (C 10 H 10 ) are doublet and triplet, singlet and singlet, and doublet and triplet states, where each Fe, Co, and Ni adopts 17, 18, and 19 electron-configuration, respectively. In particular, (CpFe) 2 (C 10 H 10 ) and (CpNi) 2 (C 10 H 10 ) have considerable open-shell singlet features. Generally the trans isomers of (CpM) 2 (C 10 H 10 ) with two CpM fragments on the opposite sides of the [5]radialene plane are apparently more stable than the cis ones with CpM fragments on the same side. However, for the singlet and triplet isomers of (CpNi) 2 (C 10 H 10 ) (both cis and trans isomers), the energy differences are relatively small, indicating that these isomers all have the opportunity to exist. Besides, the easy Diels-Alder (DA) dimerization between the [3]dendralene-like fragments of (CpM)(C 10 H 10 ) suggests the great difficulty in isolating the (CpM)(C 10 H 10 ) monomer.

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

Enhancement of anti-tumor effect of particulate vaccine delivery system by 'bacteriomimetic' CpG functionalization of poly-lactic-co-glycolic acid nanoparticles.

PubMed

Kokate, Rutika A; Thamake, Sanjay I; Chaudhary, Pankaj; Mott, Brittney; Raut, Sangram; Vishwanatha, Jamboor K; Jones, Harlan P

2015-01-01

Low immunogenicity remains a major obstacle in realizing the full potential of cancer vaccines. In this study, we evaluated CpG-coated tumor antigen (Tag)-encapsulating 'bacteriomimetic' nanoparticles (CpG-nanoparticle [NP]-Tag NPs) as an approach to enhance anti-tumor immunity. CpG-NP-Tag NPs were synthesized, characterized for their physicochemical properties and tested in vivo. We found CpG predosing followed by intraperitoneal (IP) immunization with CpG-NP-Tag NPs significantly attenuated tumor growth in female BALB/c mice compared with respective controls. Histopathological and Immunofluorescence data revealed CpG-NP-Tag tumors had lower proliferation, higher apoptotic activity, greater CD4(+) and CD8(+) T cell infiltration as well as higher IFN-γ levels as compared with control groups. Our findings suggest CpG-NP-Tag NPs can enhance anti-tumor effect of nanoparticulate tumor vaccination system.

The Effect of Chronic Prostatitis/Chronic Pelvic Pain Syndrome (CP/CPPS) on Erectile Function: A Systematic Review and Meta-Analysis.

PubMed

Chen, Xiang; Zhou, ZhiRui; Qiu, XiaoChun; Wang, Bin; Dai, JiCan

2015-01-01

High prevalence of erectile dysfunction (ED) has been observed in patients with chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS). However, whether or not CP/CPPS is a risk factor of ED remains unknown and controversial. Therefore, we conducted this systematic review and meta-analysis to evaluate the relationship between CP/CPPS and ED. PubMed, Embase, Web of Science, and The Cochrane Library were searched up to November 11, 2014 to identify studies reporting the association between CP/CPPS and ED. Case-control, cohort and cross-sectional studies were included. Quality of the included studies was assessed. The odds ratio of ED and the mean difference of five-item International Index of Erectile Function (IIEF-5) score were pooled using a random effects model. Subgroup analysis and sensitivity analyses were performed. Three cross-sectional studies, two case-control studies, and four retrospective studies with 31,956 participants were included to calculate the pooled odds ratio of ED, and two studies with 1499 participants were included to calculate the pooled mean difference of IIEF-5 scores. A strong correlation was found between CP/CPPS and ED (pooled odds ratio: 3.02, 95% CI: 2.18-4.17, P < 0.01), with heterogeneity across studies (I2 = 65%; P < 0.01). A significant decrease in the IIFE-5 score was observed in the CP/CPPS group (pooled mean difference: -4.54, 95% CI: -5.11--3.98; P < 0.01). Our study indicates that patients with CP/CPPS have an increased risk of suffering from ED. Assessment of erectile function is necessary for the therapy of patients with CP/CPPS. Further evidence is necessary to confirm the relationship between CP/CPPS and ED.

CP function: an alpha spending function based on conditional power.

PubMed

Jiang, Zhiwei; Wang, Ling; Li, Chanjuan; Xia, Jielai; Wang, William

2014-11-20

Alpha spending function and stochastic curtailment are two frequently used methods in group sequential design. In the stochastic curtailment approach, the actual type I error probability cannot be well controlled within the specified significance level. But conditional power (CP) in stochastic curtailment is easier to be accepted and understood by clinicians. In this paper, we develop a spending function based on the concept of conditional power, named CP function, which combines desirable features of alpha spending and stochastic curtailment. Like other two-parameter functions, CP function is flexible to fit the needs of the trial. A simulation study is conducted to explore the choice of CP boundary in CP function that maximizes the trial power. It is equivalent to, even better than, classical Pocock, O'Brien-Fleming, and quadratic spending function as long as a proper ρ0 is given, which is pre-specified CP threshold for efficacy. It also well controls the overall type I error type I error rate and overcomes the disadvantage of stochastic curtailment. Copyright © 2014 John Wiley & Sons, Ltd.

Cytotect®CP as salvage therapy in patients with CMV infection following allogeneic hematopoietic cell transplantation: a multicenter retrospective study.

PubMed

Alsuliman, Tamim; Kitel, Caroline; Dulery, Rémy; Guillaume, Thierry; Larosa, Fabrice; Cornillon, Jérôme; Labussière-Wallet, Helene; Médiavilla, Clémence; Belaiche, Stéphanie; Delage, Jeremy; Alain, Sophie; Yakoub-Agha, Ibrahim

2018-04-13

Cytomegalovirus is one of the main contributing factors to high mortality rates in patients undergoing allogeneic hematopoietic cell transplantation (allo-HCT). The main factors of treatment failure are both drug resistance and intolerance. In some cases, Cytotect®CP CMV-hyperimmune globulin is used as salvage therapy. This study aims to investigate the safety and efficacy of Cytotect®CP as a salvage therapy in patients with CMV infection after allo-HCT. Twenty-three consecutive patients received Cytotect®CP for CMV infection after prior CMV therapy. At the time of Cytotect®CP introduction, 17 patients (74%) had developed acute GVHD and 15 patients (64%) were receiving steroid treatment; Cytotect®CP was used as monotherapy (n = 7) and in combination (n = 16). Overall, response was observed in 18 patients (78%) with a median time of 15 days (range: 3-51). Of the 18 responders, 4 experienced CMV reactivation, while 5 responders died within 100 days of beginning treatment. Of these 5 deaths, 4 were due to causes unrelated to CMV. Estimated 100-day OS from the introduction of Cytotect®CP was 69.6%. No statistically significant difference was observed in 100-day OS between responders and non-responders (73.7% vs 50.0%, p = 0.258). Cytotect®CP as salvage therapy is effective and well-tolerated. Given its safety profile, early treatment use should be considered.

Extraction and utilization of the repeating patterns for CP writing in mask making

NASA Astrophysics Data System (ADS)

Shoji, Masahiro; Inoue, Tadao; Yamabe, Masaki

2010-05-01

In May 2006, the Mask Design, Drawing, and Inspection Technology Research Department (Mask D2I) at the Association of Super-Advanced Electronics Technologies (ASET) launched a 4-year program for reducing mask manufacturing cost and TAT by concurrent optimization of Mask Data Preparation (MDP), mask writing, and mask inspection [1]. Figure 1 shows an outline of the project at Mask D2I at ASET. As one of the tasks being pursued at the Mask Design Data Technology Research Laboratory we have evaluated the effect of reducing the writing shot counts by utilizing the repeating patterns, and that showed positive impact on mask making by using CP writing. During the past four years, we have developed a software to extract repeating patterns from fractured OPCed mask data and have evaluated the efficiency of reducing the writing shot counts using the repeating patterns with this software. In this evaluation, we have used many actual device production data obtained from the member companies of Mask D2I. To the extraction software, we added new functions for extracting common repeating patterns from a set of multiple masks, and studied how this step affects the ratio of reducing the shot counts in comparison to the case of utilization of the repeating patterns for single mask. We have also developed a software that uses the result of extracting repeating patterns and prepares writing-data for the MCC/CP writing system which has been developed at the Mask Writing Equipment Technology Research Laboratory. With this software, we have examined how EB proximity effect on CP writing affects in reducing the shot count where CP shots with large CD errors have to be divided into VSB shots. In this paper we will report on making common CP mask from a set of multiple actual device data by using these software, and will also report on the results of CP writing and calculation of writing-TAT by MCC/CP writing system.

Replacing process water and nitrogen sources with biogas slurry during cellulosic ethanol production.

PubMed

You, Yang; Wu, Bo; Yang, Yi-Wei; Wang, Yan-Wei; Liu, Song; Zhu, Qi-Li; Qin, Han; Tan, Fu-Rong; Ruan, Zhi-Yong; Ma, Ke-Dong; Dai, Li-Chun; Zhang, Min; Hu, Guo-Quan; He, Ming-Xiong

2017-01-01

Environmental issues, such as the fossil energy crisis, have resulted in increased public attention to use bioethanol as an alternative renewable energy. For ethanol production, water and nutrient consumption has become increasingly important factors being considered by the bioethanol industry as reducing the consumption of these resources would decrease the overall cost of ethanol production. Biogas slurry contains not only large amounts of wastewater, but also the nutrients required for microbial growth, e.g., nitrogen, ammonia, phosphate, and potassium. Therefore, biogas slurry is an attractive potential resource for bioethanol production that could serve as an alternative to process water and nitrogen sources. In this study, we propose a method that replaces the process water and nitrogen sources needed for cellulosic ethanol production by Zymomonas mobilis with biogas slurry. To test the efficacy of these methods, corn straw degradation following pretreatment with diluted NaOH and enzymatic hydrolysis in the absence of fresh water was evaluated. Then, ethanol fermentation using the ethanologenic bacterial strain Z. mobilis ZMT2 was conducted without supplementing with additional nitrogen sources. After pretreatment with 1.34% NaOH (w/v) diluted in 100% biogas slurry and continuous enzymatic hydrolysis for 144 h, 29.19 g/L glucose and 12.76 g/L xylose were generated from 30 g dry corn straw. The maximum ethanol concentration acquired was 13.75 g/L, which was a yield of 72.63% ethanol from the hydrolysate medium. Nearly 94.87% of the ammonia nitrogen was depleted and no nitrate nitrogen remained after ethanol fermentation. The use of biogas slurry as an alternative to process water and nitrogen sources may decrease the cost of cellulosic ethanol production by 10.0-20.0%. By combining pretreatment with NaOH diluted in biogas slurry, enzymatic hydrolysis, and ethanol fermentation, 56.3 kg of ethanol was produced by Z. mobilis ZMT-2 through fermentation of

FRET analysis of CP12 structural interplay by GAPDH and PRK.

PubMed

Moparthi, Satish Babu; Thieulin-Pardo, Gabriel; de Torres, Juan; Ghenuche, Petru; Gontero, Brigitte; Wenger, Jérôme

2015-03-13

CP12 is an intrinsically disordered protein playing a key role in the regulation of the Benson-Calvin cycle. Due to the high intrinsic flexibility of CP12, it is essential to consider its structural modulation induced upon binding to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) enzymes. Here, we report for the first time detailed structural modulation about the wild-type CP12 and its site-specific N-terminal and C-terminal disulfide bridge mutants upon interaction with GAPDH and PRK by Förster resonance energy transfer (FRET). Our results indicate an increase in CP12 compactness when the complex is formed with GAPDH or PRK. In addition, the distributions in FRET histograms show the elasticity and conformational flexibility of CP12 in all supra molecular complexes. Contrarily to previous beliefs, our FRET results importantly reveal that both N-terminal and C-terminal site-specific CP12 mutants are able to form the monomeric (GAPDH-CP12-PRK) complex. Copyright © 2015 Elsevier Inc. All rights reserved.

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Excretion, metabolism, and pharmacokinetics of CP-945,598, a selective cannabinoid receptor antagonist, in rats, mice, and dogs.

PubMed

Miao, Zhuang; Scott, Dennis O; Griffith, David A; Day, Robert; Prakash, Chandra

2011-12-01

1-(8-(2-Chlorophenyl)-9-(4-chlorophenyl)-9H-purin-6-yl)-4-(ethylamino)piperidine-4-carboxamide (CP-945,598) is an orally active antagonist of the cannabinoid CB-1 receptor that progressed into phase 3 human clinical trials for the treatment of obesity. In this study, we investigated the metabolic fate and disposition of CP-945,598 in rats, Tg-RasH2 mice, and dogs after oral administration of a single dose of [(14)C]CP-945,598. Total mean recoveries of the radioactive dose were 97.7, 97.8, and 99.3% from mice, rats, and dogs, respectively. The major route of excretion in all three species was via the feces, but on the basis of separate studies in bile duct-cannulated rats and dogs, this probably reflects excretion in bile rather than incomplete absorption. CP-945,598 underwent extensive metabolism in all three species, because no unchanged parent compound was detected in the urine across species. The primary metabolic pathway of CP-945,598 involved N-deethylation to form an N-desethyl metabolite (M1). M1 was subsequently metabolized by amide hydrolysis, oxidation, and ribose conjugation to numerous novel and unusual metabolites. The major circulating and excretory metabolites were species-dependent; however, several common metabolites were observed in more than one species. In addition to parent compound, M1, M3, M4, and M5 in rats, M1, M3, and M4 in mice, and M1 and M2 in dogs were identified as the major circulating metabolites. Gender-related differences were also apparent in the quantitative and qualitative nature of the metabolites in rats. An unprecedented metabolite, M4, formed by deamidation of M1 or M3 (N-hydroxy-M1), but not by decarboxylation of M2, was identified in all species. M4 was nonenzymatically converted to M5.

Synthesis of Carboxylate Cp*Zr(IV) Species: Toward the Formation of Novel Metallocavitands.

PubMed

Daigle, Maxime; Bi, Wenhua; Légaré, Marc-André; Morin, Jean-François; Fontaine, Frédéric-Georges

2015-06-01

With the intent of generating metallocavitands isostructural to species [(CpZr)3(μ(3)-O)(μ(2)-OH)3(κO,O,μ(2)-O2C(R))3](+), the reaction of Cp*2ZrCl2 and Cp*ZrCl3 with phenylcarboxylic acids was carried out. Depending on the reaction conditions, five new complexes were obtained, which consisted of Cp*2ZrCl(κ(2)-OOCPh) (1), (Cp*ZrCl(κ(2)-OOCPh))2(μ-κ(2)-OOCPh)2 (2), [(Cp*Zr(κ(2)-OOCPh))2(μ-κ(2)-OOCPh)2(μ(2)-OH)2]·Et2O (3·Et2O), [[Cp*ZrCl2](μ-Cl)(μ-OH)(μ-O2CC6H5)[Cp*Zr